CN107164435B - Preparation method of rebaudioside KA - Google Patents

Abstract

Rebaudioside KA is a novel tetracyclic diterpenoid sweet compound with low calorie and high sweetness, which is derived from natural sources, and the content of the compound in stevia is extremely low, so that the compound is difficult to obtain in a large amount, green and low cost. The invention establishes a green biosynthesis method for synthesizing rebaudioside KA by site-directed glycosylation by taking rubusoside which is easily obtained in large quantity as a substrate by utilizing glycosyltransferase OleD and homologous protein thereof. The green biological preparation of the high-purity rebaudioside KA is realized by optimizing reaction conditions. The sweetness of rebaudioside KA is equivalent to that of rubusoside (more than 300 times of the sweetness of cane sugar), but the rebaudioside KA has pure taste and no aftertaste, so the rebaudioside KA is more suitable to be used as a sweetening agent or a flavoring agent for products and fields such as food, beverage, medicine, wine, nutritional health care products, seasonings, daily chemicals, oral hygiene products or cosmetics and the like.

Description

Preparation method of rebaudioside KA

Technical Field

The invention belongs to the technical field of natural product biosynthesis and food chemical industry, and particularly relates to a natural nonsaccharide sweetener rebaudioside KA biosynthesized by sweet tea glycoside catalyzed by glycosyl transferase.

Background

Obesity, diabetes, hyperlipidemia and related metabolic diseases caused by excessive intake of high calorie food and beverage have become major health problems to afflict international society, and development of low (no) calorie, non-sugar sweeteners is increasingly gaining attention. The number of non-sugar sweeteners currently in wide use worldwide is small and can be divided into two categories according to sources: the first type is natural sweetener, which is extracted from natural organism such as stevioside, mogroside, rubusoside, glycyrrhizin, etc. The second type is chemically synthesized sweetener, which refers to chemically synthesized compound with sweet taste, such as aspartame, sucralose, saccharin sodium, sodium cyclamate, etc. (Weihrauch M.R.et al.Ann Oncol,2004,15: 1460-. The chemical synthetic sweetener has side effects of carcinogenesis, teratogenesis, pathogenicity and the like on human bodies, so in recent years, strict control measures are taken on the chemical synthetic sweetener in many countries, and the chemical synthetic sweetener is strictly prohibited to be added into infant food and beverage. Against this background, low-or non-caloric, safe, green natural sweeteners have received wide consumer acceptance and popularity as ideal additives for foods, beverages, pharmaceuticals, nutraceuticals, wines, and the like (Carakostas M.C. et al. food Chem Toxicol,2008,46: S1-S10; Lemus-Mondacar. et al. food Chem,2012,132:1121 1132.).

Rubusoside (Rubusoside, shown in figure) is a tetracyclic diterpene glycoside compound produced by Rubus suavissmus S (Lee) of Rosaceae, and has a molecular formula of C₃₂H₅₀O₁₃Sweetness 300 times that of sucrose and calorific value less than 1% of sucrose (He Weiping, Guangxi light industry, 1999,1: 1-5.). Rubusoside is stable to heat and acid, does not cause diseases such as dental caries, cardiovascular disease, obesity, diabetes and the like after being eaten, is a natural sweetener with high sweetness, low heat energy and health-care function, and has been applied to the fields of food, beverage, health-care products and the like (Shijia, et al, food science and technology, 2013,38:262 and 266). However, the impure sweet taste and bitter taste after bitter taste are the biggest defects of rubusoside, and the wide application of rubusoside is limited.

Ibrahim MA and the like separated and purified from stevia rebaudiana Bertoni for the first time in 2014 and structurally characterize the isomer rebaudioside KA (shown in the figure) of stevioside, and the molecular formula is C₃₈H₅₉O₁₈The sweetness is hundreds of times of that of cane sugar, the calorific value is less than 1 percent of that of cane sugar, the sweet taste is pure, and no aftertaste exists, so the sweetener is an ideal natural sweetener. However, rebaudioside KA is very low in stevia rebaudiana, difficult to prepare in large quantities by separation and purification methods, and currently cannot be synthesized by synthetic biological strategies or chemical methods (Ibrahim m.a.et al.j Nat Prod,2014,77: 1231-. Therefore, rebaudioside KA has not been added as a sweetener at present due to limitations on availability, but can be used as an additive for foods (e.g., candies, chocolates, preserves, confectionery, cakes, pickles, health foods, etc.), beverages (e.g., colas, coffees, juices, herbal teas, cans, carbonated beverages, functional beverages, nutritional beverages, energy beverages, tea beverages, carbonated beverages, etc.), medicines (e.g., flavors and sweeteners for medicines), alcoholic beverages (e.g., red wine, sake, yellow wine, fruit wine, ice wine, etc.), alcoholic beverages (e.g., red wine, sake, rice wine, yellow wine, fruit wine, ice wine, etc.) according to sweetness andwine, etc.), nutritional health products (enzymes, honey, milk products, folic acid products, dietary fiber products, vitamin products, protein powder products, calcium supplement products, collagen powder products, fish oil products, trace element products, blood enriching agents, etc.), seasonings (jam, sweet vinegar, cooking wine, maltose, preserved fruits, etc.), daily chemicals (pectin, soap, cigarette, etc.), oral hygiene products (chewing gum, toothpaste, Suzukou water, etc.) or cosmetics.

Glycosyltransferases are a class of enzymes that catalyze the transfer of monosaccharide groups from a glycosyl donor to an acceptor substrate and form glycosidic linkages, and belong to the main enzyme class of glycosylation modification of compounds. Glycosyltransferases can be classified into two types, based on the glycosyl donor, as NDP-sugar (e.g., NDP-glucose, NDP-galactose, NDP-maltose, NDP-glucuronic acid, etc.) dependent Leloir GTs and Non-NDP-sugar (soluble starch, sucrose, dextrin, etc.) dependent Non-Leloir GTs (Breton C.et al. curr OpinStruc Biol,1999,9: 563-) 571.). Compared with a chemical glycosylation modification method, the glycosylation modification reaction catalyzed by the glycosyltransferase has stronger site selectivity and stereoselectivity. Therefore, glycosyltransferases have been widely used to improve the water solubility of drug molecules, to increase the biological activity (Wei W.et al. mol Plant,2015,8:1412-1424.), and to improve the taste and increase the sweetness of sweeteners (Danieli B.et al. Helv Chim Acta,1997,80: 1153-1160.).

In view of the structural characteristics that rebaudioside KA has only one more glucose group connected by β -1, 2-glycosidic bond at position 19 than rubusoside and the advantages that glycosyltransferase can catalyze glycosylation modification, dutchman group (DSM) and american company have recently developed the biosynthesis technology of rebaudioside KA by using UDP-glucose dependent glycosyltransferase HV1, EUGT11, UGT76G1, etc. (WO2016151046, WO2016146711, WO2016168413, US20160153018), respectively.

Disclosure of Invention

The invention aims to establish a novel green, specific and economic biosynthesis method of rebaudioside-A as a natural sweetener by adopting glycosyltransferase with strong substrate specificity, and largely obtain the rebaudioside-A with the purity of more than 95 percent. In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

a method for preparing rebaudioside KA is characterized in that UDP-glucose is used as an active sugar donor, and rebaudioside KA is prepared by modifying rubusoside through site-directed glycosylation by using UDP-G dependent glycosyltransferase OleD or enzyme or protein with amino acid sequence homology of 69.5% or more with the OleD, wherein the glycosyltransferase OleD is UDP-G dependent glycosyltransferase from Streptomyces antibioticus, and preferably the amino acid sequence of the UDP-G dependent glycosyltransferase OleD is shown in SEQ ID NO 1.

The enzyme or protein with homology of greater than or equal to 69.5% is shown as HXSW-GT-09 (amino acid sequence is shown as SEQ ID NO: 2), HXSW-GT-10 (amino acid sequence is shown as SEQ ID NO: 3) and HXSW-GT-11 (amino acid sequence is shown as SEQ ID NO: 4). HXSW-GT-09, HXSW-GT-10, and HXSW-GT-11 are OleD mutants obtained by engineering based on sequence, structure, and catalytic mechanism. According to the preparation method, after the OleD and the homologous protein gene thereof are synthesized, a corresponding expression vector is utilized to construct an escherichia coli engineering strain, a yeast engineering strain, a bacillus subtilis expression strain, a lactic acid bacteria expression strain and a streptomycete expression strain, and the escherichia coli engineering strain, the yeast engineering strain, the bacillus subtilis expression strain, the lactic acid bacteria expression strain and the streptomycete expression strain are used for recombinant expression of glycosyltransferase.

The preparation method can use UDP-glucose, sucrose-sucrose synthase-UDP-glucose regeneration circulation system or bacterial endogenous UDP-glucose biosynthesis system or UDP-glucose biosynthesis system after design and modification (Mao Z C et al, Biotechnol Prog,2006,22:369-374, Oh J S.et al KSBB J,2008,23:474-478, Rodr i guezd i az J.et al J.Biotechnol,2011,154:212-215, Ruffing A.et al.Mirob Cell Fact,2006,5:25, Yan Y.al.Biotechnol Bioeng,2008,100:126-140) as the source of active sugar donor. Exogenous UDP-glucose can be added into the reaction system, and can also be generated by a sucrose-sucrose synthase-UDP-glucose regeneration circulation system or an endogenous UDP-glucose synthesis path.

The enzyme activity of OleD and homologous protein thereof is defined by the glycosylation modification of catalytic rubusoside. Under the same reaction system condition, the efficiency of preparing rebaudioside KA by catalyzing the fixed-point glucosyl modification of rubusoside by OleD and homologous protein thereof is examined.

The preparation method can catalyze the biosynthesis of rebaudioside KA by taking free OleD and homologous protein thereof, immobilized OleD and homologous protein thereof or bacterial cells expressing the OLED and the homologous protein thereof as biocatalysts.

Furthermore, the method can use cell extract containing glycosyltransferase to construct a reaction system; or constructing an in-situ or resting cell reaction system by using thalli containing glycosyltransferase; or immobilized enzyme is used for constructing a catalytic system.

In a preferred embodiment of the present invention, the reaction is carried out at a pH of 6.0 to 14.0, preferably 11.0; the reaction temperature is 15-40 ℃, preferably 30 ℃; the molar concentration ratio of the rubusoside to the UDP-glucose is 1:0.5-1:10, preferably 1: 6; the reaction time is 2 to 72 hours, preferably 16 hours.

In a preferred embodiment of the invention, under the condition of 0.5U/ml enzyme activity, the concentration of the substrate rubusoside is 1-100mg/ml, preferably 15mg/ml, and the optimal ratio of the substrate concentration (mg/ml) to the enzyme activity (U/ml) is 2: 1-50: 1.

another objective of the invention is to provide a homologous protein with homology of more than 69.5% with OleD, and the amino acid sequence of the protein is shown as SEQ ID NO. 2-4.

The sweetness of rebaudioside KA is about 300 times that of cane sugar, and the taste is pure without afterstagnation bitter taste and is insufficient for 1 percent of the heat of the cane sugar. Rebaudioside KA is soluble in water and ethanol water, and can be added as sweetener or correctant to food (such as candy, chocolate, preserved fruit, confectionery, cake, pickled product, health food, etc.), beverage (cola, coffee, fruit juice, herbal tea, canned food, carbonated beverage, functional beverage, nutritious beverage, energy beverage, tea beverage, gas-containing low-alcohol beverage, etc.), medicine (correctant of medicine, sweetener, etc.), wine (red wine, rice wine, yellow wine, fruit wine, ice wine, etc.), nutritious health product (ferment, honey, milk product, folic acid product, dietary fiber product, vitamin product, protein powder product, calcium supplement product, collagen powder product, fish oil product, microelement product, blood enriching agent, etc.), seasoning (jam, sweet vinegar, preserved fruit wine, maltose, preserved fruit, etc.), daily chemical product (pectin, soap, preserved fruit, etc.), calcium supplement product, collagen powder product, fish oil, trace element product, blood enriching agent, etc.), seasoning (fruit jam, sweet vinegar, preserved, Cigarettes, etc.), oral hygiene products (chewing gum, toothpaste, saliva, etc.) or cosmetics.

The invention has the following advantages:

oled is a UDP-glucose dependent glycosyltransferase derived from Streptomyces antibioticus, natural substrates in vivo are oleandomycin, erythromycin and tylosin, and can transfer glucose from UDP-glucose to 2-OH of the deoxysugar amine structure of the macrolide antibiotic to form β -1, 2-glycosidic bond (Quiros LM, et al.J Biol Chem,1995, 27: 18234-.

In conclusion, the rebaudioside KA has excellent properties, good safety, huge potential application value and wide market prospect. The method for obtaining rebaudioside KA by modifying rubusoside through glycosyltransferase site-directed glycosylation is green, advanced and easy to industrialize.

Drawings

FIG. 1 is an HPLC chromatogram of rebaudioside KA synthesized from OleD and its homologous proteins HXSW-GT-09, HXSW-GT-10, HXSW-GT-11, and HXSW-GT-12.

FIG. 2 shows rebaudioside KA¹H-NMR spectrum.

FIG. 3 shows rebaudioside KA¹³C-NMR spectrum.

FIG. 4 is a DEPT profile of rebaudioside KA.

Fig. 5 is an HMBC profile of rebaudioside KA.

Fig. 6 is a HMQC spectrum of rebaudioside KA.

FIG. 7 is a NOSEY pattern of rebaudioside KA.

Detailed Description

The following further provides examples which are intended to aid in the understanding of the present invention and are intended to be illustrative only and do not limit the scope of the invention.

Example 1 recombinant expression of glycosyltransferase in E.coli

Design of an OleD homologous protein: HXSW-GT-09 and HXSW-GT-10 are obtained by selecting multiple key amino acid residue mutations based on the OleD structure and the catalytic mechanism; HXSW-GT-11 and HXSW-GT-12 are obtained by performing key amino acid residue mutations and motif recombination at UDP-glucose or substrate binding related sites based on multiple sequence alignment and an OleD structure. HXSW-GT-09 (the amino acid sequence is shown as SEQ ID NO:2, and the nucleotide sequence is shown as SEQ ID NO: 7), HXSW-GT-10 (the amino acid sequence is shown as SEQ ID NO:3, and the nucleotide sequence is shown as SEQ ID NO: 8), HXSW-GT-11 (the amino acid sequence is shown as SEQ ID NO:4, and the nucleotide sequence is shown as SEQ ID NO: 9), and HXSW-GT-12 (the amino acid sequence is shown as SEQ ID NO:5, and the nucleotide sequence is shown as SEQ ID NO: 10).

Glycosyltransferase OleD (amino acid sequence is shown as SEQ ID NO:1, nucleotide sequence is shown as SEQ ID NO: 6) and the gene of the oleD homologous protein are synthesized by Suzhou Jinzhi biotechnology and Tech, and pET22b (+) is used to construct expression plasmids pET22b-OleD, pET22b-HXSW-gt09, pET22 b-HXSW-10, pET22 b-HXSW-11 and pET22 b-HXSW-12. The recombinant expression plasmids are respectively transferred into E.coli BL21 expression hosts to obtain 5 E.coli engineering strains which are respectively named as pOleD, pGT-09, pGT-10, pGT-11 and pGT-12.

5 E.coli engineering bacteria were inoculated into 50mL LB medium (containing 100. mu.g/mL ampicillin), and cultured overnight at 37 ℃ with shaking at 220rpm to obtain the corresponding seed solutions. The seed solution was inoculated into LB medium (containing 100. mu.g/mL ampicillin) at an inoculum size of 5%, and shake-cultured at 37 ℃ until OD₆₀₀When the concentration is 0.8 + -0.1, IPTG is added as inducer to give final concentration0.4mM, and inducing and culturing for 12 hours at the temperature of 16 ℃, thus realizing the heterologous expression of the glycosyl transferase. The results of SDS-PAGE analysis of soluble expression of glycosyltransferases in pOleD, pGT-09, pGT-10, pGT-11 and pGT-12 engineered bacteria are shown in Table 1. The results showed that the glycosyltransferases OleD, HXSW-GT-09, HXSW-GT-10, HXSW-GT-11, and HXSW-GT-12 were all soluble in expression at levels of 20%, 22%, 18%, 7%, and 23% of total soluble protein, respectively.

TABLE 1 glycosyltransferase species and information

Example 2 recombinant expression of glycosyltransferase in Yeast

Glycosyltransferase OleD and homologous protein genes thereof are respectively constructed into a pichia pastoris protein expression vector pPIC9K, then the recombinant expression plasmid is transformed into pichia pastoris GS115 by electric shock, and positive transformants are screened according to a pichia pastoris operation manual of Invitrogen company (G418 resistance screening). Selecting a single clone, inoculating the single clone to an LB culture medium, culturing overnight at 30 ℃ to obtain a bacterial solution, inoculating the bacterial solution to a BMGY culture medium according to the inoculation amount (v/v) of 1 percent, culturing for 48 hours at 30 ℃ and 250rpm, centrifugally collecting thalli, then resuspending the thalli, inoculating the thalli to BMMY, and carrying out methanol induction expression for 5 days at 30 ℃ and 250 rpm. After induction expression is finished, SDS-PAGE analyzes the expression condition of the target protein in the supernatant of the culture medium, corresponding positive strains are screened, and then the expression conditions are preliminarily optimized from three aspects of the pH value of the culture medium, the induction temperature and the methanol concentration. The results show that the expression levels of glycosyltransferases OleD, HXSW-GT-09, HXSW-GT-10, HXSW-GT-11 and HXSW-GT-12 in Pichia pastoris GS115 are 0.28. mu.g/ml, 0.27. mu.g/ml, 0.21. mu.g/ml, 0.23. mu.g/ml and 0.25. mu.g/ml, respectively, and the feasibility of glycosyltransferase expression in yeast is verified.

Example 3 recombinant expression of glycosyltransferases in Bacillus subtilis

Respectively constructing glycosyltransferase OleD and homologous protein genes thereof into a bacillus subtilis secretion expression vector pHT43, chemically transforming a recombinant expression plasmid into bacillus subtilis WB800, and adding ampicillinPositive clones were screened on LB solid medium for mycin. Selecting positive colonies, inoculating to LB liquid culture medium containing ampicillin, and culturing at 37 deg.C to OD₆₀₀When the concentration is 0.5, IPTG is added for induction overnight, the culture supernatant is obtained by centrifugation, and the expression of the target protein in the supernatant is analyzed by SDS-PAGE. The results show that the secretion expression amounts of glycosyltransferases OleD, HXSW-GT-09, HXSW-GT-10, HXSW-GT-11 and HXSW-GT-12 in Bacillus subtilis WB800 are higher than those of yeast, and are respectively 0.33. mu.g/ml, 0.31. mu.g/ml, 0.27. mu.g/ml, 0.25. mu.g/ml and 0.28. mu.g/ml, and the feasibility of glycosyltransferase expression in Bacillus subtilis is verified.

Example 4 recombinant expression of glycosyltransferase in lactic acid bacteria

And (3) respectively constructing glycosyltransferase OleD and homologous protein genes thereof into a lactobacillus food-grade expression vector pNZ8148, electrically transferring the recombinant expression plasmid into lactobacillus NZ9000, and screening positive strains in a GM17 culture medium containing chloramphenicol. The positive strain is inoculated to fresh GM17 culture medium and cultured to OD₆₀₀When the expression level is 0.6, nisin is added for induction, and SDS-PAGE is used for analyzing the expression of the target protein. The results show that the expression levels of glycosyltransferases OleD, HXSW-GT-09, HXSW-GT-10, HXSW-GT-11, and HXSW-GT-12 in lactic acid bacteria WB800 were higher than in Bacillus subtilis, 0.54. mu.g/ml, 0.57. mu.g/ml, 0.42. mu.g/ml, 0.19. mu.g/ml, and 0.38. mu.g/ml, respectively, confirming the feasibility of glycosyltransferase expression in lactic acid bacteria.

Example 5 recombinant expression of glycosyltransferase in Streptomyces

Glycosyltransferase OleD and homologous protein genes thereof are respectively constructed into a streptomyces free expression plasmid vector pWHM7, transformed into streptomyces lividans TK24(S.lividans TK24) by an escherichia coli-streptomyces intergeneric combined transfer method, after positive strains are screened, fermented and cultured, and the expression level of glycosyltransferase genes is evaluated by measuring glycosylation modification of rubusoside catalyzed by a S.lividans TK24 transformant (the HPLC analysis method of the product is shown in example 6). The results show that glycosyltransferases OleD, HXSW-GT-09, HXSW-GT-10 and HXSW-GT-11 can catalyze rubusoside glycosylation, the yield of the product is 53.1%, 50.7%, 5.8% and 11.5% respectively, while HXSW-GT-12 has no catalytic function, and the feasibility of expressing glycosyltransferase in streptomyces is verified.

Example 6 glycosyltransferase catalyzed glycosylation of rubusoside

In view of the economy, simplicity and high efficiency of the expression of glycosyltransferase escherichia coli, the escherichia coli expression system is preferably selected for subsequent examination of rubusoside glycosylation modification conditions.

In 1mL of the reaction system, the substrate rubusoside was 0.3mM, UDP-glucose was 1.2mM, 0.05M Tris-HCl buffer (pH 8.0), and 500. mu.L of the crude enzyme solution of glycosyltransferase was reacted with shaking at 25 ℃ for 12 hours. After the reaction, the reaction mixture was heated to remove proteins, and then twice the volume of methanol was added for treatment, and the filtrate obtained by centrifugal filtration was subjected to HPLC analysis. The amount of enzyme that catalyzes the disappearance of 50 μm substrate rubusoside per ml of enzyme solution per hour was defined as 1U of enzyme activity. The activities of OleD, HXSW-GT-09, HXSW-GT-10, HXSW-GT-11, and HXSW-GT-12 were 1.0U/ml, 0.2U/ml, 0.4U/ml, and 0U/ml, respectively.

HPLC detection conditions: a chromatographic column: agilent C18,5 μm, 150X 4.6 mm; mobile phase: a: ultrapure water (containing 0.1% formic acid); b: acetonitrile (0.1% formic acid); analysis time: 25min, sample size: 20 μ L, column temperature: 35 ℃, detection wavelength: 220 nm; flow rate: 0.8ml/min, gradient elution: 10% B-95% B.

Under the above HPLC analysis conditions, the retention time of rubusoside is 13.9min, the product is 11.5min, and the result is shown in FIG. 1. The product is prepared by preparing a high performance liquid phase to obtain a white solid sample with the purity of 98.5 percent (10 mg), and the product is rebaudioside KA (shown in figures 2-7) after NMR spectrum analysis. According to the area normalization method, the efficiency of catalytic synthesis of rebaudioside KA by glycosyltransferase is calculated, and the results are shown in table 2. The catalysis efficiency of the OleD and the HXSW-GT-09 is equivalent, and the HXSW-GT-12 has no catalysis function, so the OleD and the HXSW-GT-09 are selected as objects to be investigated in the subsequent reaction condition investigation.

TABLE 2 efficiency of glycosyltransferase catalyzed synthesis of rebaudioside KA

Glycosyltransferases	Amino acid sequence homology to OleD	Rebaudioside KA yield
			OleD
	100％	99.6％
			HXSW-GT-09	98.3％	99.5％
HXSW-GT-10	89.5％	18.2％
			HXSW-GT-11	69.5％	23.8％
HXSW-GT-12	58.2％	0

Example 7 resting cells catalyze rubusoside glycosylation

In 1mL reaction system, the substrate rubusoside is 1mM, UDP-glucose is 4mM or no exogenous UDP-glucose is added, 0.05M Tris-HCl buffer solution (pH 8.0) and resting cell resuspension containing glycosyltransferase (enzyme activity is 0.5U) are shaken at 25 ℃ for reaction for 12 hours. After the reaction was completed, 2 volumes of methanol was added for treatment, and the filtrate obtained by centrifugal filtration was subjected to HPLC analysis in the manner described in example 6. The results are shown in Table 3.

TABLE 3 efficiency of catalytic synthesis of rebaudioside KA by resting cells

Glycosyltransferases	Whether or not UDP-glucose is added	Rebaudioside KA yield
			OleD	Is that	86.3％
OleD	Whether or not	38.6％
			HXSW-GT-09	Is that	84.9％
HXSW-GT-09	Whether or not	36.1％

Example 8 in situ bioconversion

In a 50mL in-situ system, the substrate rubusoside is 1mM, the UDP-glucose is 4mM or no exogenous UDP-glucose is added, the pH of the fermentation liquid is adjusted to 8.0, and the fermentation liquid is shaken at 25 ℃ for reaction for 12 hours. After the reaction was completed, 2 volumes of methanol was added for treatment, and the filtrate obtained by centrifugal filtration was subjected to HPLC analysis in the manner described in example 6. The results are shown in Table 4.

TABLE 4 in situ biosynthesis of rebaudioside KA

In situ transformed strains	With the addition of UDP-glucose	Rebaudioside KA yield
			pOleD	Is that	44.7％
pOleD	Whether or not	21.9％
			pGT-09	Is that	45.4％
pGT-09	Whether or not	19.8％

EXAMPLE 9 catalytic Synthesis of rebaudioside KA by immobilized enzyme

Respectively adopting chitosan and gelatin to prepare immobilized OleD and immobilized HXSW-GT-09 according to a conventional immobilized enzyme preparation method for catalytically synthesizing rebaudioside KA. In 1mL of the reaction system, the substrate rubusoside was 1mM, UDP-glucose was 4mM, 0.05M Tris-HCl buffer (pH 8.0), 0.5U of immobilized glycosyltransferase, and the reaction was carried out at 25 ℃ for 12 hours with shaking. After the reaction, the immobilized enzyme was removed by filtration, and the filtrate was treated with 2 volumes of methanol, followed by centrifugation and HPLC analysis, the analytical method of which is shown in example 6. The results show that the yield of rebaudioside KA catalytically synthesized by immobilized OleD and immobilized HXSW-GT-09 is 87.8% and 84.9%, respectively.

Example 10 sucrose-UDP-glucose regeneration cycle System I

Sucrose, sucrose synthase and UDP are adopted to form a UDP-glucose regeneration system for preparing rebaudioside KA by glycosyltransferase. In 5mL of the reaction system, 1mM of rubusoside as a substrate, 4mM of UDP, 2.5U of glycosyltransferase, 0.1M of sucrose, 2.5mL of a crude enzyme solution of sucrose synthase, pH of the reaction system was 8.0, and the reaction was carried out for 12 hours with shaking at 25 ℃. After the reaction was completed, the reaction mixture was boiled and centrifuged to remove proteins, and then treated with two volumes of methanol, and centrifuged to perform HPLC analysis in the same manner as in example 6. The results are shown in Table 5.

TABLE 5 Synthesis efficiency of rebaudioside KA

Glycosyltransferases	Sucrose synthase sources	Rebaudioside KA yield
			OleD	Arabidopsis thaliana	86.7％
OleD	Vigna radiate	83.8％
			HXSW-GT-09	Arabidopsis thaliana	84.4％
HXSW-GT-09	Vigna radiate	82.5％

Example 11 sucrose-UDP-glucose regeneration cycle System II

The co-expression plasmid of glycosyltransferase and sucrose synthase is constructed by using pETDuet-1 co-expression vector, and corresponding co-expression strains pO-AtS, pO-VRS, pGT9-AtS and pGT9-VrS are obtained. The co-expression procedure was the same as in example 1, with the expression conditions being 0.5mM IPTG, 20 ℃ for 12 hours. After the expression is finished, 50ml of bacterial liquid is used for constructing an in-situ conversion system: the substrate rubusoside was 1mM, UDP was 4mM, sucrose was 0.1M, the pH of the reaction system was adjusted to 8.0, and the reaction was carried out at 25 ℃ for 12 hours with shaking. After the reaction is finished, the synthesis condition of rebaudioside KA is analyzed by HPLC, and the analysis method is shown in example 6. The results are shown in Table 6.

TABLE 6 Synthesis efficiency of rebaudioside KA

Example 12 sucrose-UDP-glucose regeneration cycle System III

After pO-AtS, pO-VrS, pGT9-AtS and pGT9-VrS were expressed under the conditions of example 8, the cells were collected and then diluted with 0.05M Tris-HCl (pH 8.0) buffer at a ratio of 1:10 to construct a resting cell reaction system: the substrate rubusoside was 1mM, UDP was 4mM, sucrose was 0.1M, and the reaction was carried out at 25 ℃ for 12 hours with shaking. After the reaction is finished, the synthesis condition of rebaudioside KA is analyzed by HPLC, and the analysis method is shown in example 6. The results are shown in Table 7.

TABLE 7 Synthesis efficiency of rebaudioside KA

Example 13 endogenous UDP-glucose Synthesis System

Two key enzymes glucose phosphoglucomutase (Pgm) and UDP-glucose pyrophosphorylase (GalU) in the UDP-glucose synthetic pathway are introduced into the engineering strains pOleD and pGT-09 together by using a pACYCDuet-1 vector, and thus the Escherichia coli strains pOleD-P-G and pGT-09-P-G modified by the endogenous UDP-glucose synthetic pathway are obtained. The conditions for inducing expression were the same as in example 8. After the expression is finished, 50ml of bacterial liquid is used for constructing an in-situ conversion system: the substrate rubusoside is 1mM, glucose is 0.05M, the pH of the reaction system is adjusted to 8.0, and the reaction is carried out for 12 hours at 25 ℃ with shaking. After the reaction is finished, the synthesis condition of rebaudioside KA is analyzed by HPLC, and the analysis method is shown in example 6. The results are shown in Table 8.

TABLE 8 Synthesis efficiency of rebaudioside KA

Example 14 optimum reaction pH

Since OleD catalyzes the glycosylation of rubusoside more strongly than HXSW-GT-09, the reaction conditions were optimized for OleD. The optimum reaction pH (5ml) was investigated: 23.4mM (15mg/ml) of rubusoside as a substrate, 93.6mM of UDP-glucose, 6.0-14.0 pH of the reaction, 2.5U of crude Oled enzyme solution, and shaking the solution at 25 ℃ for 12 hours. After the reaction, the reaction mixture was heated to remove proteins, and then 2 volumes of methanol were added for treatment, and the filtrate obtained by centrifugal filtration was subjected to HPLC analysis in the manner described in example 6. Rebaudioside KA yields at different pH conditions are shown in table 9. According to the results, the optimal pH for preparing rebaudioside KA by OleD catalyzed rubusoside glycosylation is 11.0.

TABLE 9 rebaudioside KA yields at different pH conditions

Reaction pH	6.0	7.0	8.0	9.0	10.0	11.0	12.0	13.0	14.0
										Yield of	2.57％	14.89％	27.62％	34.71％	47.31％	63.26％	58.81％	23.27％	7.18％

EXAMPLE 15 optimum reaction temperature

Consider the optimal reaction temperature (5 ml): 23.4mM (15mg/ml) of rubusoside as a substrate, 93.6mM of UDP-glucose and 11.0 pH, 2.5U of crude enzyme solution of OleD were reacted with shaking at 15 to 40 ℃ for 12 hours, respectively. After the reaction, the reaction mixture was heated to remove proteins, and then 2 volumes of methanol were added for treatment, and the filtrate obtained by centrifugal filtration was subjected to HPLC analysis in the manner described in example 6. Rebaudioside KA yields at different reaction temperatures are shown in table 10. According to the results, the optimal temperature for preparing rebaudioside KA by catalyzing rubusoside glycosylation by OleD is 30 ℃.

TABLE 10 rebaudioside KA yields at different reaction temperatures

Reaction temperature	15℃	25℃	30℃	35℃	40℃
						Yield of	49.16％	63.26％	73.71％	70.54％	66.82％

EXAMPLE 16 optimal amounts of UDP-glucose

The optimal UDP-glucose dose (5ml) was examined: 23.4mM (15mg/ml) of rubusoside as a substrate, 11.7 to 234mM of UDP-glucose and 11.0 pH, 2.5U of the crude enzyme solution of OleD were reacted with shaking at 30 ℃ for 12 hours, respectively. After the reaction, the reaction mixture was heated to remove proteins, and then 2 volumes of methanol were added for treatment, and the filtrate obtained by centrifugal filtration was subjected to HPLC analysis in the manner described in example 6. The rebaudioside KA yields for the different UDP-glucose (UDPG) dosages are shown in table 11. According to the results, the optimal UDP-glucose dosage for preparing rebaudioside KA by catalyzing rubusoside glycosylation by OleD is 140.4mM, and the optimal molar concentration ratio of the UDP-glucose dosage to the substrate is 6: 1.

TABLE 11 rebaudioside KA yields for different UDP-glucose (UDPG) dosages

EXAMPLE 17 optimal substrate concentration and enzyme dosage

The optimal substrate concentration (5ml) was examined: the substrate rubusoside is 1mg/ml-100mg/ml, UDP-glucose is 6 times of the substrate molar concentration, the pH value is 11.0, 2.5U of OleD crude enzyme liquid are respectively shaken at 30 ℃ for reaction for 16 hours. After the reaction, the reaction mixture was heated to remove proteins, and then 2 volumes of methanol were added for treatment, and the filtrate obtained by centrifugal filtration was subjected to HPLC analysis in the manner described in example 6. Rebaudioside KA yields for different rubusoside concentration conditions are shown in table 12. According to the results and combining factors such as energy loss and the like, the optimal substrate concentration (mg/ml) and enzyme activity (U/ml) ratio of rebaudioside KA prepared by catalyzing rubusoside glycosylation by OleD is 30: 1.

TABLE 12 rebaudioside KA yields for different rubusoside concentration conditions

EXAMPLE 18 optimum reaction time

Consider the optimal reaction time (5 ml): 15mg/ml of rubusoside serving as a substrate, 140.4mM of UDP-glucose and 11.0 of pH, and 2.5U of crude Oled enzyme solution are respectively shaken at 30 ℃ for reaction for 4 to 72 hours. After the reaction, the reaction mixture was heated to remove proteins, and then 2 volumes of methanol were added for treatment, and the filtrate obtained by centrifugal filtration was subjected to HPLC analysis in the manner described in example 6. The rebaudioside KA yields at different reaction times are shown in table 13. According to the results and the factors such as energy loss, the optimal reaction time for preparing rebaudioside KA by catalyzing rubusoside glycosylation by OleD is determined to be 16 hours.

TABLE 13 rebaudioside KA yields at different reaction times

Reaction time

4hrs

8hrs

12hrs

16hrs

24hrs

36hrs

48hrs

72hrs

Yield of

73.41％

83.22％

90.72％

96.87％

96.93％

97.01％

97.31％

97.11％

SEQUENCE LISTING

<110> university of Chinese pharmacy

<120> preparation method of rebaudioside KA

<130>

<160>10

<170>PatentIn version 3.5

<210>1

<211>415

<212>PRT

<213> Artificial sequence

<400>1

Met Thr Thr Gln Thr Thr Pro Ala His Ile Ala Met Phe Ser Ile Ala

Ala His Gly His Val Asn Pro Ser Leu Glu Val Ile Arg Glu Leu Val

Ala Arg Gly His Arg Val Thr Tyr Ala Ile Pro Pro Val Phe Ala Asp

Lys ValAla Ala Thr Gly Ala Arg Pro Val Leu Tyr His Ser Thr Leu

Pro Gly Pro Asp Ala Asp Pro Glu Ala Trp Gly Ser Thr Leu Leu Asp

Asn Val Glu Pro Phe Leu Asn Asp Ala Ile Gln Ala Leu Pro Gln Leu

Ala Asp Ala Tyr Ala Asp Asp Ile Pro Asp Leu Val Leu His Asp Ile

Thr Ser Tyr Pro Ala Arg Val Leu Ala Arg Arg Trp Gly Val Pro Ala

Val Ser Leu Ser Pro Asn Leu Val Ala Trp Lys Gly Tyr Glu Glu Glu

Val Ala Glu Pro Met Trp Arg Glu Pro Arg Gln Thr Glu Arg Gly Arg

Ala Tyr Tyr Ala Arg Phe Glu Ala Trp Leu Lys Glu Asn Gly Ile Thr

Glu His Pro Asp Thr Phe Ala Ser His Pro Pro Arg Ser Leu Val Leu

Ile Pro Lys Ala Leu Gln Pro His Ala Asp Arg Val Asp Glu Asp Val

Tyr Thr Phe Val Gly Ala Cys Gln Gly Asp Arg Ala Glu Glu Gly Gly

Trp Gln Arg Pro Ala Gly Ala Glu Lys Val Val Leu Val Ser Leu Gly

Ser Ala Phe Thr Lys Gln Pro Ala Phe Tyr Arg Glu Cys Val Arg Ala

Phe Gly Asn Leu Pro Gly Trp His Leu Val Leu Gln Ile Gly Arg Lys

Val Thr Pro Ala Glu Leu Gly Glu Leu Pro Asp Asn Val Glu Val His

Asp Trp Val Pro Gln Leu Ala Ile Leu Arg Gln Ala Asp Leu Phe Val

Thr His Ala Gly Ala Gly Gly Ser Gln Glu Gly Leu Ala Thr Ala Thr

Pro Met Ile Ala Val Pro Gln Ala Val Asp Gln Phe Gly Asn Ala Asp

Met Leu Gln Gly Leu Gly Val Ala Arg Lys Leu Ala Thr Glu Glu Ala

Thr Ala Asp Leu Leu Arg Glu Thr Ala Leu Ala Leu Val Asp Asp Pro

Glu Val Ala Arg Arg Leu Arg Arg Ile Gln Ala Glu Met Ala Gln Glu

Gly Gly Thr Arg Arg Ala Ala Asp Leu Ile Glu Ala Glu Leu Pro Ala

Arg His Glu Arg Gln Glu Pro Val Gly Asp Arg Pro Asn Gly Gly

<210>2

<211>418

<212>PRT

<213> Artificial sequence

<400>2

Met His Thr Thr Gln Thr Thr Pro Ala His Ile Ala Met Phe Ser Ile

Ala Ala His Gly His Val Asn Pro Ser Leu Glu Val Ile Arg Glu Leu

Val Ala Arg Gly His Arg Val Thr Tyr Ala Ile Pro Pro Val Phe Ala

Asp Lys Val Ala Ala Thr Gly Ala Arg Pro Val Leu Tyr His Ser Thr

Leu Pro Gly Thr Asp Ala Asp Pro Glu Ala Trp Gly Ser Thr Leu Leu

Asp Asn Val Glu Pro Phe Leu Asn Asp Ala Ile Gln Ala Leu Pro Gln

Leu Ala Asp Ala Tyr Ala Asp Asp Ile Pro Asp Leu Val Leu His Asp

Ile Thr Ser Tyr Pro Ala Arg Val Leu Ala Arg Arg Trp Gly Val Pro

Ala Val Ser Leu Phe Pro Asn Leu Val Ala Trp Lys Gly Tyr Glu Glu

Glu Val Ala Glu Pro Met Trp Arg Glu Pro Arg Gln Thr Glu Arg Gly

Arg Ala Tyr Tyr Ala Arg Phe Glu Ala Trp Leu Lys Glu Asn Gly Ile

Thr Glu His Pro Asp Thr Phe Ala Ser His Pro Pro Arg Ser Leu Val

Leu Ile Pro Lys Ala Leu Gln Pro His Ala Asp Arg Val Asp Glu Asp

Val Tyr Thr Phe Val Gly Ala Cys Gln Gly Asp Ala Ala Glu Glu Gly

Gly Trp Gln Arg Pro Ala Gly Ala Glu Lys Val Val Leu Val Ser Leu

Gly Ser Val Phe Thr Lys Gln Pro Ala Phe Tyr Arg Glu Cys Val Arg

Ala Phe Gly Asn Leu Pro Gly Trp His Leu Val Leu Gln Ile Gly Arg

Lys Val Thr Pro Ala Glu Leu Gly Glu Leu Pro Asp Asn Val Glu Val

His Asp Trp Val Pro Gln Leu Ala Ile Leu Arg Gln Ala Asp Leu Phe

Val Thr His Ala Gly Ala Gly Gly Ser Gln Glu Gly Leu Ala Thr Ala

Thr Pro Met Ile Ala Val Pro Gln Ala Val Asp Gln Phe Gly Asn Ala

Asp Met Leu Gln Gly Leu Gly Val Ala Arg Lys Leu Ala Thr Glu Glu

Ala Thr Ala Asp Leu Leu Arg Glu Thr Ala Leu Ala Leu Val Asp Asp

Pro Glu Val Ala Arg Arg Leu Arg Arg Ile Gln Ala Glu Met Ala Gln

Glu Gly Gly Thr Arg Arg Ala Ala Asp Leu Ile Glu Ala Glu Leu Pro

Ala Arg His Glu Arg Gln Glu Pro Val Gly Asp Arg Pro Asn Gly Gly

His Gly

<210>3

<211>408

<212>PRT

<213> Artificial sequence

<400>3

Met Thr Ser Glu His Arg Ser Ala Ser Val Thr Pro Ala His Ile Ala

Met Phe Ser Ile Ala Ala His Gly His Val Asn Pro Ser Leu Glu Val

Ile Arg Glu Leu Val Ala Arg Gly His Arg Val Thr Tyr Ala Ile Pro

ProVal Phe Ala Asp Lys Val Ala Ala Thr Gly Ala Arg Pro Val Leu

Tyr His Ser Thr Leu Pro Lys Pro Ser Asn Pro Glu Glu Ser Trp Pro

Glu Asp Gln Glu Ser Ala Met Gly Leu Phe Leu Asn Asp Ala Ile Gln

Ala Leu Pro Gln Leu Ala Asp Ala Tyr Ala Asp Asp Ile Pro Asp Leu

Val Leu His Asp Ile Thr Ser Tyr Pro Ala Arg Val Leu Ala Arg Arg

Trp Gly Val Pro Ala Val Ser Leu Ser Pro Asn Leu Val Ala Trp Lys

Gly Tyr Glu Glu Glu Val Ala Glu Pro Met Trp Arg Glu Pro Arg Gln

Thr Glu Arg Gly Arg Ala Tyr Tyr Ala Arg Phe Glu Ala Trp Leu Lys

Glu Asn Gly Ile Thr Glu His Pro Asp Thr Phe Ala Ser His Pro Pro

Arg Ser Leu Val Leu Ile Pro Lys Ala Leu Gln Pro His Ala Asp Arg

Val Asp Glu Asp Val Tyr Thr Phe Val Gly Ala Cys Gln Gly Asp Arg

Ala Glu Glu Gly Gly Trp Gln Arg Pro Ala Gly Ala Glu Lys Val Val

Leu Val Ser Leu Gly Ser Ala Phe Thr Lys Gln Pro Ala Phe Tyr Arg

Glu Cys Val Arg Ala Phe Gly Asn Leu Pro Gly Trp His Leu Val Leu

Gln Ile Gly Arg Lys Val Thr Pro Ala Glu Leu Gly Glu Leu Pro Pro

Asn Val Glu Val His Gln Trp Val Pro Gln Leu Asp Ile Leu Thr Lys

Ala Ser Ala Phe Ile Thr His Ala Gly Met Gly Ser Thr Met Glu Ala

Leu Ser Asn Ala Val Pro Met Ile Ala Val Pro Gln Ala Val Asp Gln

Phe Gly Asn Ala Asp Met Leu Gln Gly Leu Gly Val Ala Arg Lys Leu

Ala Thr Glu Glu Ala Thr Ala Asp Leu Leu Arg Glu Thr Ala Leu Ala

Leu Val Asp Asp Pro Glu Val Ala Arg Arg Leu Arg Arg Ile Gln Ala

Glu Met Ala Gln Glu Gly Gly Thr Arg Arg Ala Ala Asp Leu Ile Glu

Ala Glu Leu Pro Ala Arg His Gly

<210>4

<211>470

<212>PRT

<213> Artificial sequence

<400>4

Met Lys Arg Lys Glu Leu His Glu Thr Ser Arg Leu Ala Tyr Gly His

Arg Met Thr Thr Arg Thr His Met Lys Arg Lys Glu Leu His Glu Thr

Ser Arg Leu Ala Tyr Gly His Arg Met Thr Thr Arg Thr Ser Glu His

Arg Ser Ala Ser Val Ser Glu His Arg Ser Ala Ser Val Thr Pro Arg

His Ile Ser Phe Phe Asn Ile Pro Gly His Gly His Val Asn Pro Ser

Leu Gly Ile Val Gln Glu Leu Val Ala Arg Gly His Arg Val Ser Tyr

Ala Ile Thr Asp Glu Phe Ala Ala Gln Val Lys Ala Ala Gly Ala Thr

Pro Val Val Tyr Asp Ser Ile Leu Pro Lys Pro Ser Asn Pro Glu Glu

Ser Trp Pro Glu Asp Gln Glu Ser Ala Met Gly Leu Phe Leu Asp Glu

Ala Val Arg Val Leu Pro Gln Leu Glu Asp Ala Tyr Ala Asp Asp Arg

Pro Asp Leu Ile Val Tyr Asp Ile Ala Ser Trp Pro Ala Pro Val Leu

Gly Arg Lys Trp Asp Ile Pro Phe Val Gln Leu Ser Pro Thr Phe Val

Ala Tyr Glu Gly Phe Glu Glu Asp Val Glu Pro Met Trp Arg Glu Pro

Arg Gln Thr Glu ArgGly Arg Ala Tyr Tyr Ala Arg Phe Glu Ala Trp

Leu Lys Glu Asn Gly Ile Thr Glu His Pro Asp Thr Phe Ala Ser His

Pro Pro Arg Ser Leu Val Leu Ile Pro Lys Ala Leu Gln Pro His Ala

Asp Arg Val Asp Glu Asp Val Tyr Thr Phe Val Gly Ala Cys Gln Gly

Asp Arg Ala Glu Glu Gly Gly Trp Gln Arg Pro Ala Gly Ala Glu Lys

Val Val Leu Val Ser Leu Gly Ser Ala Phe Thr Lys Gln Pro Ala Phe

Tyr Arg Glu Cys Val Arg Ala Phe Gly Asn Leu Pro Gly Trp His Leu

Val Leu Gln Ile Val Gly Arg Phe Val Asp Pro Ala Asp Leu Gly Glu

Val Pro Pro Asn Val Glu Val His Gln Trp Val Pro Gln Leu Asp Ile

Leu Thr Lys Ala Ser Ala Phe Ile Thr His Ala Gly Met Gly Ser Thr

Met Glu Ala Leu Ser Asn Ala Val Pro Met Ile Ala Val Pro Gln Ile

Ala Glu Gln Thr Met Asn Ala Glu Arg Ile Val Glu Leu Gly Leu Gly

Arg His Ile Pro Arg Asp Gln Val Thr Ala Lys Ala Leu Arg Thr Ala

Ala Leu Ala Leu Val Asp Asp Pro Glu Ala Ala Ala Arg Leu Lys Glu

Ile Gln Ala Arg Met Ala Gln Glu Gly Gly Thr Arg Arg Ala Ala Asp

Leu Ile Glu Ala Glu Leu Ala Ala Ala Arg His His Gly Ala Ala Ala

Ala Arg His His Gly Ala

<210>5

<211>426

<212>PRT

<213> Artificial sequence

<400>5

Met His ThrSer Glu His Arg Ser Ala Ser Val Thr Pro Arg His Ile

Ser Phe Phe Asn Ile Pro Gly His Gly His Val Asn Pro Ser Leu Gly

Ile Val Gln Glu Leu Val Ala Arg Gly His Arg Val Ser Tyr Ala Ile

Thr Asp Glu Phe Ala Ala Gln Val Lys Ala Ala Gly Ala Thr Pro Val

Val Tyr Asp Ser Ile Leu Pro Lys Glu Ser Asn Pro Glu Glu Ser Trp

Pro Glu Asp Gln Glu Ser Ala Ala Gly Leu Phe Leu Asp Glu Ala Val

Arg Val Leu Pro Gln Leu Glu Asp Ala Tyr Ala Asp Asp Arg Pro Asp

Leu Ile Val Tyr Asp Ile Ala Ser Trp Pro Ala Pro Val Leu Gly Arg

Lys Trp Asp Ile Pro Phe Val Gln Leu Ser Pro Thr Phe Val Ala Tyr

Glu Gly Phe Glu Glu Asp Val Pro Ala Val Gln Asp Pro Thr Ala Asp

Arg Gly Glu Glu Ala Ala Ala Pro Ala Gly Thr Gly Asp Ala Glu Glu

Gly Ala Glu Ala Glu Asp Gly Leu Val Arg Phe Phe Thr Arg Leu Ser

Ala Phe Leu Glu Glu His Gly Val Asp Thr Pro Ala Thr Glu Phe Leu

Ile Ala Pro Asn Arg Cys Ile Val Ala Leu Pro Arg Thr Phe Gln Ile

Lys Gly Asp Thr Val Gly Asp Asn Tyr Thr Phe Val Gly Pro Thr Tyr

Gly Asp Ala Ser His Gln Gly Thr Trp Glu Gly Pro Gly Asp Gly Arg

Pro Val Leu Leu Ile Ala Leu Gly Ser Ala Phe Thr Asp His Leu Asp

Phe Tyr Arg Thr Cys Leu Ser Ala Val Asp Gly Leu Asp Trp His Val

Val Leu Ser Val Gly Arg Phe Val Asp Pro Ala Asp Leu Gly Glu Val

Pro Pro Asn Val Glu Val His Gln Trp Val Pro Gln Leu Asp Ile Leu

Thr Lys Ala Ser Ala Phe Ile Thr His Ala Gly Met Gly Ser Thr Met

Glu Ala Leu Ser Asn Ala Val Pro Met Val Ala Val Pro Gln Ile Ala

Glu Gln Thr Met Asn Ala Glu Arg Ile Val Glu Leu Gly Leu Gly Arg

His Ile Pro Arg Asp Gln Val Thr Ala Glu Lys Leu Arg Glu Ala Val

Leu Ala Val Ala Ser Asp Pro Gly Val Ala Glu Arg Leu Ala Ala Val

Arg Gln Glu Ile Arg Glu Ala Gly Gly Ala Arg Ala Ala Ala Asp Ile

Leu Glu Gly Ile Leu Ala Glu Ala Gly His

<210>6

<211>1248

<212>DNA

<213> Artificial sequence

<400>6

ATGACCACCCAGACCACTCCCGCCCACATCGCCATGTTCTCCATCGCCGCCCACGGCCATGTGAACCCCAGCCTGGAGGTGATCCGTGAACTCGTCGCCCGCGGCCACCGGGTCACGTACGCCATTCCGCCCGTCTTCGCCGACAAGGTGGCCGCCACCGGCGCCCGGCCCGTCCTCTACCACTCCACCCTGCCCGGCCCCGACGCCGACCCGGAGGCATGGGGAAGCACCCTGCTGGACAACGTCGAACCGTTCCTGAACGACGCGATCCAGGCGCTCCCGCAGCTCGCCGATGCCTACGCCGACGACATCCCCGATCTCGTCCTGCACGACATCACCTCCTACCCGGCCCGCGTCCTGGCCCGCCGCTGGGGCGTCCCGGCGGTCTCCCTCTCCCCGAACCTCGTCGCCTGGAAGGGTTACGAGGAGGAGGTCGCCGAGCCGATGTGGCGCGAACCCCGGCAGACCGAGCGCGGACGGGCCTACTACGCCCGGTTCGAGGCATGGCTGAAGGAGAACGGGATCACCGAGCACCCGGACACGTTCGCCAGTCATCCGCCGCGCTCCCTGGTGCTCATCCCGAAGGCGCTCCAGCCGCACGCCGACCGGGTGGACGAAGACGTGTACACCTTCGTCGGCGCCTGCCAGGGAGACCGCGCCGAGGAAGGCGGCTGGCAGCGGCCCGCCGGCGCGGAGAAGGTCGTCCTGGTGTCGCTCGGCTCGGCGTTCACCAAGCAGCCCGCCTTCTACCGGGAGTGCGTGCGCGCCTTCGGGAACCTGCCCGGCTGGCACCTCGTCCTCCAGATCGGCCGGAAGGTGACCCCCGCCGAACTGGGGGAGCTGCCGGACAACGTGGAGGTGCACGACTGGGTGCCGCAGCTCGCGATCCTGCGCCAGGCCGATCTGTTCGTCACCCACGCGGGCGCCGGCGGCAGCCAGGAGGGGCTGGCCACCGCGACGCCCATGATCGCCGTACCGCAGGCCGTCGACCAGTTCGGCAACGCCGACATGCTCCAAGGGCTCGGCGTCGCCCGGAAGCTGGCGACCGAGGAGGCCACCGCCGACCTGCTCCGCGAGACCGCCCTCGCTCTGGTGGACGACCCGGAGGTCGCGCGCCGGCTCCGGCGGATCCAGGCGGAGATGGCCCAGGAGGGCGGCACCCGGCGGGCGGCCGACCTCATCGAGGCCGAACTGCCCGCGCGCCACGAGCGGCAGGAGCCGGTGGGCGACCGACCCAACGGTGGGTGA

<210>7

<211>1257

<212>DNA

<213> Artificial sequence

<400>7

ATGCATACCACCCAGACCACCCCGGCCCATATCGCCATGTTTAGCATTGCAGCCCACGGCCATGTGAACCCGAGCTTAGAAGTGATCCGCGAACTGGTGGCACGTGGTCATCGCGTTACCTACGCCATTCCGCCTGTGTTCGCAGACAAAGTGGCAGCCACAGGCGCCCGTCCGGTTCTGTATCACAGCACCCTGCCGGGTACCGATGCAGATCCGGAGGCATGGGGTAGCACATTACTGGACAACGTTGAGCCGTTTCTGAACGATGCAATCCAGGCACTGCCGCAGCTGGCCGATGCTTATGCTGATGACATCCCTGACCTGGTGCTGCATGACATCACCAGTTATCCGGCACGTGTGCTGGCACGTCGCTGGGGTGTTCCGGCAGTGAGCTTATTTCCGAACCTGGTGGCCTGGAAGGGCTATGAAGAGGAAGTGGCCGAACCTATGTGGCGCGAACCGCGTCAAACCGAACGTGGTCGCGCCTACTACGCACGCTTTGAAGCATGGCTGAAGGAGAATGGCATCACCGAACATCCGGATACCTTCGCAAGTCATCCGCCGCGCAGTCTGGTGCTGATTCCGAAAGCCCTGCAGCCGCATGCAGATCGTGTGGACGAGGATGTGTACACCTTCGTGGGTGCATGTCAGGGCGATGCAGCAGAAGAAGGTGGTTGGCAGCGCCCGGCCGGTGCAGAAAAAGTGGTGCTGGTGAGCCTGGGCAGCGTGTTCACCAAACAGCCGGCCTTTTATCGCGAATGCGTGCGCGCATTCGGTAACCTGCCGGGCTGGCATCTGGTTCTGCAGATCGGTCGTAAAGTGACCCCTGCCGAGCTGGGTGAACTGCCGGATAACGTTGAGGTGCATGATTGGGTGCCGCAACTGGCCATTCTGCGTCAGGCCGATCTGTTCGTTACCCATGCCGGTGCAGGTGGTAGCCAGGAAGGTTTAGCCACAGCAACCCCGATGATCGCCGTTCCGCAGGCAGTGGATCAGTTTGGCAATGCCGATATGCTGCAGGGTCTGGGTGTGGCACGCAAACTGGCCACCGAAGAGGCCACCGCCGATCTGCTGCGTGAAACCGCACTGGCACTGGTGGATGATCCTGAAGTTGCACGCCGCTTACGTCGCATTCAGGCCGAAATGGCACAGGAAGGTGGCACACGCCGTGCAGCAGATCTGATTGAAGCAGAATTACCGGCCCGCCACGAACGCCAGGAACCTGTTGGCGATCGCCCGAATGGCGGCCATGGTTAA

<210>8

<211>1227

<212>DNA

<213> Artificial sequence

<400>8

ATGACCAGTGAGCATCGTAGTGCCAGCGTTACCCCGGCACATATCGCCATGTTTAGCATCGCCGCACACGGTCACGTGAATCCGAGCCTGGAAGTTATTCGCGAACTGGTGGCACGTGGCCACCGTGTTACCTACGCCATTCCGCCTGTTTTCGCCGATAAAGTTGCCGCAACCGGTGCACGTCCGGTGCTGTACCATAGCACCCTGCCGAAACCGAGTAATCCGGAAGAAAGCTGGCCGGAAGATCAGGAAAGCGCCATGGGCCTGTTTCTGAATGACGCCATTCAGGCACTGCCGCAGTTAGCCGATGCCTACGCCGATGATATCCCTGATCTGGTGCTGCACGATATCACCAGTTATCCGGCACGTGTTCTGGCACGTCGCTGGGGTGTGCCTGCCGTGAGCCTGAGCCCGAATCTGGTGGCCTGGAAAGGCTACGAAGAAGAAGTTGCCGAGCCGATGTGGCGTGAACCGCGTCAGACAGAACGTGGTCGCGCCTACTATGCCCGCTTCGAAGCCTGGCTGAAAGAGAACGGCATCACCGAACATCCGGATACCTTCGCAAGCCATCCGCCGCGCAGTCTGGTTCTGATCCCGAAAGCCCTGCAGCCGCATGCCGATCGTGTGGATGAGGACGTTTACACCTTCGTTGGCGCCTGTCAGGGTGATCGTGCCGAAGAAGGTGGCTGGCAGCGCCCTGCAGGTGCAGAGAAAGTGGTGCTGGTGAGCCTGGGCAGTGCCTTTACCAAGCAGCCGGCATTCTATCGCGAATGTGTGCGTGCCTTTGGCAACCTGCCGGGCTGGCACCTGGTTCTGCAGATCGGCCGTAAAGTGACCCCGGCCGAACTGGGTGAACTGCCGCCTAATGTGGAAGTGCATCAGTGGGTTCCGCAGCTGGATATCCTGACCAAAGCCAGTGCCTTCATCACCCATGCAGGTATGGGCAGCACAATGGAAGCCCTGAGTAATGCCGTTCCGATGATCGCCGTTCCGCAGGCCGTGGACCAGTTTGGCAACGCAGATATGCTGCAGGGTCTGGGCGTGGCACGTAAACTGGCCACCGAAGAAGCAACCGCAGATCTGCTGCGTGAGACCGCCCTGGCCCTGGTTGACGATCCGGAAGTTGCCCGTCGCCTGCGTCGTATTCAGGCCGAAATGGCACAGGAAGGTGGCACCCGTCGTGCAGCCGATCTGATTGAGGCCGAACTGCCGGCCCGTCATGGCTAA

<210>9

<211>1413

<212>DNA

<213> Artificial sequence

<400>9

ATGAAACGTAAAGAACTGCACGAGACCAGCCGCCTGGCTTATGGTCACCGCATGACCACCCGTACCCACATGAAGCGCAAAGAGCTGCACGAAACCAGCCGCCTGGCCTATGGCCATCGCATGACCACCCGTACCAGCGAGCATCGCAGCGCAAGTGTTAGCGAACATCGCAGCGCCAGTGTGACACCGCGCCATATCAGCTTCTTCAACATCCCGGGTCACGGCCACGTTAACCCGAGCCTGGGCATCGTGCAAGAACTGGTGGCACGCGGCCATCGCGTGAGCTATGCCATTACCGATGAGTTTGCAGCCCAGGTGAAGGCAGCAGGCGCCACACCGGTGGTGTACGACAGTATCCTGCCGAAACCGAGCAACCCGGAGGAAAGCTGGCCGGAGGACCAGGAGAGCGCAATGGGCTTATTCCTGGATGAAGCCGTTCGCGTGCTGCCGCAGCTGGAGGATGCTTATGCTGATGATCGCCCGGATCTGATCGTGTACGATATTGCCAGCTGGCCTGCACCGGTTCTGGGTCGTAAATGGGACATCCCGTTTGTGCAGCTGAGCCCGACATTCGTTGCCTACGAAGGTTTCGAGGAAGACGTGGAACCGATGTGGCGTGAACCTCGCCAGACAGAACGCGGCCGTGCCTATTATGCCCGTTTCGAAGCCTGGCTGAAAGAGAATGGCATCACCGAACACCCGGATACCTTTGCCAGCCACCCTCCGCGCAGCCTGGTGTTAATCCCGAAAGCACTGCAGCCGCATGCAGACCGTGTGGATGAGGATGTTTACACCTTCGTGGGTGCATGTCAGGGCGACCGCGCAGAAGAAGGCGGTTGGCAGCGCCCTGCAGGTGCAGAAAAAGTGGTTCTGGTGAGCCTGGGTAGCGCCTTTACCAAACAGCCGGCCTTTTACCGTGAATGCGTGCGTGCCTTTGGTAACCTGCCGGGCTGGCATCTGGTGCTGCAGATTGTGGGTCGCTTTGTTGATCCGGCCGATCTGGGTGAGGTTCCGCCGAACGTGGAAGTGCACCAGTGGGTTCCTCAGCTGGACATTCTGACCAAGGCAAGCGCCTTTATTACCCACGCCGGTATGGGCAGCACCATGGAAGCACTGAGCAACGCCGTTCCGATGATCGCAGTGCCGCAGATTGCAGAGCAGACCATGAACGCCGAACGTATTGTGGAGCTGGGCCTGGGTCGTCATATCCCTCGCGATCAGGTGACAGCAAAAGCACTGCGTACCGCAGCCCTGGCCCTGGTTGATGATCCGGAGGCCGCAGCCCGTCTGAAGGAAATTCAGGCCCGTATGGCCCAGGAAGGCGGTACCCGTCGTGCAGCCGACTTAATTGAAGCCGAACTGGCAGCCGCACGTCATCATGGTGCAGCAGCAGCCCGTCACCATGGCGCCTAA

<210>10

<211>1281

<212>DNA

<213> Artificial sequence

<400>10

ATGCATACCAGCGAACATCGCAGCGCCAGTGTTACCCCGCGTCATATTTCCTTTTTTAATATTCCGGGCCACGGTCATGTGAACCCGAGTCTGGGTATTGTTCAGGAACTGGTTGCCCGTGGCCATCGTGTGAGTTATGCCATCACCGATGAATTTGCCGCACAGGTTAAAGCCGCCGGTGCCACCCCGGTTGTGTATGACAGCATCCTGCCGAAGGAAAGCAATCCTGAGGAGAGTTGGCCGGAAGATCAGGAAAGCGCAGCAGGTCTGTTCTTAGACGAAGCAGTGCGCGTGCTGCCGCAGCTGGAAGATGCCTACGCAGATGACCGTCCGGATCTGATCGTGTATGACATCGCCAGCTGGCCGGCACCGGTTTTAGGCCGTAAGTGGGACATCCCGTTTGTGCAGCTGAGCCCGACCTTCGTTGCCTACGAAGGCTTCGAAGAAGATGTGCCGGCAGTGCAGGATCCGACCGCAGATCGTGGTGAAGAAGCCGCCGCACCTGCAGGTACCGGTGATGCAGAAGAAGGTGCAGAGGCCGAAGACGGCCTGGTGCGCTTTTTTACCCGTCTGAGCGCCTTCCTGGAAGAACATGGTGTTGATACCCCGGCCACCGAGTTTCTGATCGCACCGAACCGTTGCATTGTGGCCCTGCCGCGCACCTTCCAAATCAAAGGTGATACCGTGGGCGACAACTATACCTTCGTGGGCCCTACATACGGCGATGCCAGCCATCAGGGTACCTGGGAAGGTCCTGGTGATGGTCGTCCGGTGCTGCTGATTGCACTGGGCAGCGCCTTCACCGATCACCTGGATTTCTACCGCACATGTCTGAGCGCAGTGGATGGTCTGGACTGGCATGTGGTGCTGAGCGTTGGCCGCTTTGTTGATCCGGCCGATCTGGGTGAGGTGCCGCCTAATGTGGAAGTGCATCAGTGGGTGCCGCAGTTAGACATTCTGACCAAGGCCAGCGCCTTTATCACACATGCCGGCATGGGTAGCACCATGGAGGCACTGAGCAACGCCGTGCCTATGGTTGCCGTGCCGCAGATTGCAGAGCAGACAATGAACGCAGAGCGCATCGTGGAACTGGGCCTGGGTCGTCATATTCCGCGTGATCAGGTGACCGCAGAGAAGCTGCGCGAAGCCGTTCTGGCAGTGGCAAGTGATCCGGGCGTTGCCGAACGTCTGGCAGCCGTGCGTCAGGAAATTCGCGAAGCAGGTGGTGCACGTGCAGCAGCCGATATCCTGGAAGGCATCCTGGCCGAAGCCGGTCACTAA

Claims (6)

1. The preparation method of rebaudioside KA is characterized in that UDP-glucose is used as an active sugar donor, and rubusoside is modified through site-directed glycosylation by using UDP-G dependent glycosyltransferase OleD or a homologous protein of OleD, wherein the amino acid sequence of the UDP-G dependent glycosyltransferase OleD is shown as SEQ ID NO. 1, and the amino acid sequence of the homologous protein of OleD is shown as SEQ ID NO. 2-4.

2. The process according to claim 1, wherein said UDP-G-dependent glycosyltransferase OleD is derived from Streptomyces antibioticus.

3. The method of claim 1, wherein the rebaudioside KA is prepared by recombinantly expressing glycosyltransferase and its homologous protein or enzyme using escherichia coli, yeast, bacillus subtilis, lactobacillus, or streptomyces.

4. The production method according to claim 1, wherein an exogenous active sugar donor UDP-glucose is added to the reaction system; or the sucrose-sucrose synthase-UDP-glucose regeneration circulation system generates UDP-glucose; or UDP-glucose is produced by a bacterial endogenous UDP-glucose synthesis pathway; or designing a modified UDP-glucose synthetic pathway to generate UDP-glucose.

5. The method according to claim 1, wherein the reaction system is constructed using a cell extract containing glycosyltransferase; or constructing an in-situ or resting cell reaction system by using thalli containing glycosyltransferase; or an immobilized enzyme is used for constructing a reaction system.

6. An OleD homologous protein, which is characterized in that the amino acid sequence of the protein is shown as SEQ ID NO. 2-4.

Images