CN111117988A

CN111117988A - Amino acid mutant of thermophilic xylosidase and application thereof

Info

Publication number: CN111117988A
Application number: CN202010059242.3A
Authority: CN
Inventors: 赵林果; 李琦; 李冬冬; 童欣怡; 蒋玉洁
Original assignee: Nanjing Forestry University
Current assignee: Nanjing Forestry University
Priority date: 2020-01-18
Filing date: 2020-01-18
Publication date: 2020-05-08
Anticipated expiration: 2040-01-18
Also published as: CN111117988B

Abstract

An amino acid mutant of thermophilic xylosidase and application thereof. The invention mutates a gene from a streptococcus thermophilus (A)Dictyoglomus thermophilum) β -xylosidase of DSM 3960GH39 family, and specific hydrolysis of notoginsenoside R1 to generate ginsenoside Rg1 by β -xylosidase multi-site mutant containing 2 mutation sites, wherein HIS284 is mutated into ASP and ALA respectively, so that sugar tolerance of β -xylosidase is increased by 1.35 and 1.09 times respectively, and the mutant has high sugar tolerance, and good stabilityKiThe coefficients respectively reach 4.6 mol/L and 3.7 mol/L; CYS202 is mutated into LEU and PHE, and the enzyme activities are respectively improved by 3.28 and 2.97 times.

Description

Amino acid mutant of thermophilic xylosidase and application thereof

Technical Field

The invention relates to the field of genetic engineering and biological engineering, in particular to an amino acid mutant of thermophilic xylosidase and application thereof.

Background

β -xylosidase (β -xylosidase, EC3.2.1.37) is a more critical exoglycosidase hydrolase in xylan degrading enzyme system, can decompose xylooligosaccharide and xylobiose at non-reducing end into xylose, and has been widely applied in multiple fields through synergistic action with xylanase. in energy industry, xylan in plant fiber raw materials can be converted into xylose by xylanase system and further converted into valuable fuels or chemicals such as ethanol, furfural and the like, in paper industry, β -xylosidase and xylanase synergistic action can effectively improve bleaching performance, in recent years, β -xylosidase has been expanded and applied to medical industry for hydrolyzing xylose at glycosyl terminal of some natural compounds (glycoside such as steroid, terpenoid and the like and glycosidic bond formed by xylose) so as to be converted into products with important application value, but the enzyme has specificity, strong specificity, compounds with different skeleton structures, even if the compounds with the same skeleton, xylose-connected bond types are different (such as β -1, 2-glycosidic bond, 354-3578- β, and the effect of xylose-357-358-a more important point of xylose-358-3-7-a more-7-three-one-three-one-three.

Pseudo-ginseng (Panax notoginseng) is a plant of Araliaceae, has a long history for treating diseases, and is a traditional precious medicinal material in China, so far more than 70 monomeric saponins are separated and identified from root, stem, leaf, flower and fruit of pseudo-ginseng, wherein, the contents of ginsenoside Rg1 and Rb1 and notoginsenoside R1 are the highest, and in view of molecular structure, the main structures of ginsenoside Rg1 and notoginsenoside R1 are the same, and only the notoginsenoside R1 is a xylose linked on the glucose group at the 6 th position of Rg1 through β -1,2 glycosidic bond.

The common β -xylosidase does not have the ability to cleave the β -1, 2-xyloside bond linked to glucosyl group at position 6 in the structure of notoginsenoside R1 to generate Rg 1.

Disclosure of Invention

The invention solves the technical problem that the common β -xylosidase does not have the capacity of cutting β -1, 2-xylosidic bond connected with glucosyl group at the 6 th position in a notoginsenoside R1 structure to generate Rg1, and has poor tolerance to xylose in the enzymolysis process and the problem of generating a terminal product to inhibit enzyme catalytic activity.

The technical scheme is that the amino acid mutant of β -xylosidase derived from a Rhodococcus thermophilus DSM 3960GH39 family is characterized in that 2 mutation sites are provided, wherein HIS284 is mutated into A and D, and CYS202 is mutated into L and F.

The nucleotide sequence of the mutant is shown as SEQ ID NO. 4-7.

The application of the amino acid mutant H284D/C202L (representing that HIS284 is mutated into D and CYS202 is mutated into L) of β -xylosidase derived from a Thermococcus thermophilus DSM 3960GH39 family in specifically hydrolyzing notoginsenoside R1 to generate ginsenoside Rg 1.

The hydrolysis conditions comprise that the reaction temperature is 25-95 ℃, the pH is 4.0-7.0, the concentration of the notoginsenoside R1 substrate is 0.2-5 g/L, and β -xylosidase of 0.1-2U/mL is added for reaction for 0.5-12 h.

The preferable hydrolysis conditions are that the reaction temperature is 75 ℃, the pH value is 6.0, the concentration of the notoginsenoside R1 substrate is 1g/L, and 1U/mL β -xylosidase is added for reaction for 30 min.

The application of the amino acid mutant H284D/C202L of β -xylosidase derived from the family DSM 3960GH39 of Thermococcus thermophilus (Dictyoglycomus thermophilus) in preparing an anti-fatigue product after hydrolyzing notoginsenoside R1 is disclosed.

The method has the beneficial effects that 1, the heat-resistant β -xylosidase gene is obtained by cloning from a Dictyoglycous thermophilum DSM 3960 genome, compared with the prior art, the xylosidase provided by the invention has excellent heat resistance, the enzyme activity is highest under the conditions of 75 ℃ and pH6.0, the xylosidase has higher enzyme activity at the temperature of 70-80 ℃ and the pH of 5.0-7.0, the xylosidase has good heat resistance, the enzyme activity is basically kept unchanged after 2 hours of heat preservation at the temperature of 75 ℃, the xylosidase is suitable for degradation under the conditions of high temperature above 70 ℃ and partial neutrality, and has potential application value 2. the enzyme has the advantages that the HIS284 Rg is mutated into ASP and ALA respectively on the basis of Xln-DT, the sugar resistance efficiency of the xylosidase is improved by 1.35 and 1.09 times, the CYS202 is mutated into LEU and the mutant respectively on the basis of β -PHS 284ALA, the enzyme activity of the xylosidase is improved by 3.97 to 3.97 times, and the anti-fatigue ginsenoside mutant is prepared by a mode of transforming the polysaccharnoside into panax ginseng strain β, and the polysaccharoside prepared by the method is obviously higher than a method for transforming panax ginseng strain.

Drawings

FIG. 1 is a schematic diagram of enzymatic conversion of notoginsenoside R1 to generate ginsenoside Rg 1;

FIG. 2 is a graph showing the conversion efficiency of β -xylosidase from different sources to notoginsenoside R1;

FIG. 3 is a comparison of the sugar tolerance factors of the recombinant enzyme and the mutant enzyme;

FIG. 4 is a graph showing comparison of enzyme activities of a recombinase and a mutant enzyme;

FIG. 5 is HPLC chromatogram of notoginsenoside R1 and ginsenoside Rg 1;

FIG. 6 is HPLC chromatogram before and after the conversion of notoginsenoside R1 by β -xylosidase multi-site mutant;

FIG. 7 is a graph comparing the anti-fatigue activity of notoginsenoside R1 and ginsenoside Rg1 after transformation, illustrating the dosage: R1-L/Rg 1-L: 5 mg/kg. d; R1-H/Rg 1-H: 20 mg/kg. d.

Detailed Description

The invention provides a method for generating ginsenoside Rg1 by converting notoginsenoside R1 with mutant enzyme, and a person skilled in the art can use the content for reference and appropriately improve process parameters. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be described in further detail below with reference to the accompanying drawings and embodiments.

A series of mutations β -xylosidase genes, the nucleotide sequences of which are shown in the following table.

Mutant genes

The series of recombinant plasmids pET-28a-Xln-DT-284A, pET-28a-Xln-DT-284D, pET-28a-Xln-DT-284A/202L, pET-28a-Xln-DT-284D/202L, pET-28a-Xln-DT-284A/202F and pET-28a-Xln-DT-284D/202F containing the nucleotide sequence.

The preparation method of the recombinant plasmid containing the SEQ ID NO. 2-3 comprises the following construction steps: the recombinant plasmid pET-28a-Xln-DT which is constructed by experiments and carries Xln-DT gene is taken as a template, and Y284A and Y284D are further mutated by inverse PCR to obtain recombinant plasmids pET-28a-Xln-DT-284A and pET-28a-Xln-DT-284D which carry mutated gene SEQ ID NO. 2-3.

The preparation method of the recombinant plasmid containing the SEQ ID NO. 4-7 comprises the following construction steps: the recombinant plasmids pET-28a-Xln-DT-284A and pET-28a-Xln-DT-284D are respectively used as templates, and the reverse PCR is further utilized to mutate C202L and C202F to obtain the recombinant plasmids pET-28a-Xln-DT-284A/202L, pET-28a-Xln-DT-284D/202L, pET-28a-Xln-DT-284A/202F and pET-28a-Xln-DT-284D/202F which carry mutant genes SEQ ID NO. 4-7.

DNA polymerase used in the examples (Prime STAR HS DN)A Polymerase), deoxyribonucleic acid (dNTP), ligase (T)₄DNA ligase), phosphorylase (T)₄Polynuceotide Kinase) and related buffers were purchased from TaKaRa, Bio-engineering (Dalian) Ltd.

A sugar-tolerant mutant of β -xylosidase from the Neurospora thermophila DSM 3960GH39 family, containing the following 2 mutation sites HIS284 (to ALA and ASP) and CYS202 (to LEU and PHE).

Application of β -xylosidase glucose-resistant mutant HIS284ASP/CYS202LEU derived from Pyrococcus thermophilus (Dictyoglycomus thermophilus) DSM 3960GH39 family in specifically hydrolyzing notoginsenoside R1 to generate ginsenoside Rg1 is provided.

Mutants 1-2: HIS284 was mutated to ALA and ASP based on Xln-DT.

The nucleotide sequence of the mutant is shown in SEQ ID NO 2-3.

Mutants 3 to 6: its CYS202 was mutated to LEU and PHE based on HIS284ALA and HIS284 ASP.

The nucleotide sequence of the mutant is shown in SEQ ID NO. 4-7.

The hydrolysis conditions are that the reaction temperature is 25-95 ℃, the pH value is 4.0-7.0, the concentration of the notoginsenoside R1 substrate is 0.2-5 g/L, and β -xylosidase of 0.1-2U/mL is added for reaction for 0.5-12 h.

The hydrolysis conditions comprise that the reaction temperature is 75 ℃, the pH value is 6.0, the substrate concentration of the notoginsenoside R1 is 1g/L, 1U/mL β -xylosidase is added for reaction for 30min, and β -xylosidase is used for preparing the ginsenoside Rg1 by converting the notoginsenoside R1.

The β -xylosidase can be derived from microorganisms such as bacteria and fungi, can be obtained by means of culture, fermentation, separation and purification and the like, and can also be obtained by means of gene cloning, expression, separation and purification.

The method screens β -xylosidase from various families, including Aspergillus niger NL-1GH 3 family, Thermotoga thermophilum DSM5069 GH3 family, Thermotoga thermophilum DSM13995 GH3 family, Dictyoglyces thermophilum DSM 3960GH39 family and Thermoanaerobacterium thermosaccharolyticum DSM 571 120 family, and determines β -xylosidase from Dictyoglyces thermophilum DSM 3960GH39 family can specifically hydrolyze notoginsenoside R1 to generate ginsenoside Rg 1.

EXAMPLE 1 screening of β -xylosidase of the invention

1.1 cloning, plasmid construction and preparation of recombinase of GH3 family β -xylosidase gene derived from Aspergillus niger NL-1

1.1.1 culture of Aspergillus niger NL-1

Aspergillus niger NL-1 was stored in this laboratory and its liquid medium formulation was: 3g/L glucose, 0.1g/L dipotassium phosphate trihydrate, 0.05g/L potassium chloride, 0.05g/L magnesium sulfate heptahydrate, 0.001g/L ferrous sulfate heptahydrate and 0.02g/L sodium nitrate. The strain is activated by PDA culture medium, then the activated Aspergillus niger NL-1 spore is resuspended by sterile normal saline, inoculated in 50mL liquid seed shake flask culture medium, cultivated for 72h at 28 ℃, 150rpm constant temperature shaking, and the thallus is collected.

1.1.2 extraction of Aspergillus niger NL-1 genomic DNA

(1) Inoculating the activated Aspergillus niger strain on liquid culture medium, and culturing at 28-30 deg.C for 2 days.

(2) Filtering to collect mycelium, washing with sterile water for 3-4 times until the culture medium is completely cleaned, draining, wrapping with tinfoil, and freezing in liquid nitrogen.

(3) 2g of mycelium is put into a precooled mortar, and a proper amount of liquid nitrogen is added for grinding until the mycelium is ground into powder.

(4) Placing the fully ground mycelium into an EP tube, adding CTAB extraction solution (2% mercaptoethanol) preheated to 65 ℃, shaking and uniformly mixing, and carrying out warm bath at 65 ℃ for 45-60 min.

(5) Adding the phenol/chloroform/isoamyl alcohol (25:24:1) mixed solution with the same volume, mixing uniformly, and centrifuging for 20-30min at the rotating speed of 12,000 rpm.

(6) The upper aqueous phase was extracted with suction and extracted repeatedly with a phenol/chloroform/isoamyl alcohol (25:24:1) mixture.

(7) Simultaneously, 0.5 volume times of ice-cold 5M LiCl and 0.6 volume times of isopropanol were added, mixed well, left to stand at room temperature for 20min, centrifuged at 12,000rpm for 10min, and the supernatant was discarded.

(8) 1mL of 70% ethanol was added, the precipitate was suspended thoroughly, left to stand for 10min, centrifuged at 12,000rpm for 10min, and the supernatant was discarded. Repeating the steps once, air-drying and recovering the precipitate.

(9) Redissolved in 50. mu.L of TE buffer containing 50. mu.g/mL of RNAase and incubated at 37 ℃ for 1 h.

(10) Adding 0.1 time volume of 3mol/L sodium acetate (pH 5.2) and 3 times volume of absolute ethyl alcohol, mixing uniformly, and keeping the temperature at-20 ℃ for 1 h.

(11) Centrifuge at 12,000rpm at 4 ℃ for 30min and carefully pour off the supernatant.

(12) Adding 500 μ L70% ethanol, standing at room temperature for 10min, and centrifuging at 4 deg.C and 12,000rpm for 30 min.

(13) And (5) discarding the supernatant, and air-drying on a superclean bench.

(14) Add 50. mu.L of TE buffer for resuspension and store at-20 ℃.

1.1.3 obtaining of Aspergillus niger NL-1 xylosidase xlnD

Carrying out homology analysis by referring to an Aspergillus niger xylosidase gene published on NCBI, and designing 2 upstream primers of upstream and downstream specific primers of the Aspergillus niger xylosidase gene xlnD according to a conserved sequence: CCCGAA TTCCAG GCC AAC ACCAGC TAC GTC and the downstream primer: CCCTCT AGACTA CTC CTT CCC CGG CCA CTT, the enzyme cutting sites EcoR I and Xba I are underlined, PCR amplification is carried out by using synthesized primers, the amplification conditions are 94 ℃, 5min, 30 cycles (94 ℃, 30 s; 59 ℃, 30 s; 72 ℃, 3min), 72 ℃, 10min, reaction stop, heat preservation at 4 ℃, PCR amplification products are purified by a gel recovery kit, and the β -xylosidase gene from Aspergillus niger NL-1 is obtained.

The β -xylosidase gene and pPICZ α A from Aspergillus niger NL-1 are subjected to double enzyme digestion by EcoR I and Xba I respectively, tapping recovery is carried out respectively, the mixture is concentrated and then connected at 16 ℃ overnight, the transformation liquid is coated on a LLB plate containing Zencin (the final concentration is 25 mu g/mL), inversion culture is carried out at 37 ℃ for 12h, and after positive clone sequencing is selected, the obtained recombinant expression plasmid is named as pPICZ α A-xlnD.

1.1.4 preparation of recombinant enzymes

Extracting recombinant plasmid pPICZ α A-xlnD, linearizing by BxtX I, introducing into Pichia pastoris GS115(Novagen) by electric transformation method, screening positive clone, inoculating into YPD culture medium for activation, transferring into BMGY culture medium for continuous activation, collecting OD₆₀₀Transferring 2.0-3.0 thallus into BMMY culture medium, placing in a shaking table at 30 ℃, carrying out induction expression of β -xylosidase at 180rpm, adding sterile methanol into the induced bacterial liquid every 24 hours according to the volume ratio of 0.6%, culturing for 15 days, centrifuging, and taking supernatant to obtain crude enzyme liquid, purifying recombinant protein, (1) adding ammonium sulfate with the final concentration of 80% into the crude enzyme liquid to precipitate protein, centrifuging, removing supernatant, dissolving the precipitated protein with a Tris-HCl buffer solution with the pH of 7.550mM, (2) dialyzing with a Tris-HCl buffer solution with the pH of 7.550mM at 4 ℃ for four times and 8 hours each time to remove a salt solution, (3) adding the dialyzed enzyme liquid into a packed DEAE SFF column, carrying out gradient elution with NaCl with the concentration of 20-300mM, and (4) taking the enzyme liquid eluted with NaCl with the proper concentration, dialyzing with a PB buffer solution with the pH of 6.510 mM at the temperature of 4 ℃ for 8 hours each time to remove the salt solution to obtain pure enzyme.

1.2Thermotoga thermomarum DSM 5069-derived β -xylosidase clone of GH3 family and preparation of recombinase

1.2.1 culture of Thermotoga thermomarum DSM5069

Thermotoga thermomarum DSM5069 is available from the German Collection of microorganisms. The serial numbers are: DSM 5069. The formula of the culture medium is as follows: 5g/L soluble starch, 1g/L yeast powder and 1.5g/L KH₂PO₄，4.2g/L Na₂HPO₄·12H₂O，3.4g/L NaCl，1g/L MgSO₄·7H₂O, 0.76g/L EDTA, 1mL/L microelement, 0.5g/L Na₂S·9H₂O, 0.5g/L Cysteine HCl and 1mg/L resazurin, adjusting the pH to 7.0, boiling and flushing with nitrogen, removing oxygen, and placing the culture medium into an anaerobic bottle for sterilization under anaerobic conditions. Trace elements (1000 ×) formulation: FeCl₃2.0g/L；H₃BO₃0.05g/L；ZnCl₂0.05g/L；CuCl₂·2H₂O 0.03g/L；MnCl₂·4H₂O 0.05g/L；(NH₄)₂MoO₄0.05g/L；AlK(SO₄)₂·2H₂O is 0.05 g/L. ) Inoculating with 0.5% inoculating amount by syringe, static culturing at 82 deg.C for 24 hr, and collecting cells.

1.2.2 extraction of genomic DNA

(1) Performing static culture on Thermotoga thermomarum DSM 506924 h, and centrifuging 30mL of bacterial liquid at 6,000rpm for 10min to collect cells.

(2) The cells were resuspended in 9.5mL of TE buffer, 0.5mL of 10% Sodium Dodecyl Sulfate (SDS) and 50. mu.L of proteinase K (20mg/mL) were added, mixed well, and incubated at 37 ℃ for 1 h.

(3) 1.8mL of 5mol/L NaCl, 1.5mL of cetyltriethylammonium bromide (CTAB)/NaCl were added, mixed well and incubated at 65 ℃ for 20 min.

(4) Adding equal volume of chloroform/isoamyl alcohol, mixing, and centrifuging at 6,000rpm for 10 min.

(5) To prevent genomic DNA fragmentation due to shear forces, the supernatant was transferred to another centrifuge tube using a wide-mouthed pipette, mixed with an equal volume of phenol/chloroform/isoamyl alcohol and centrifuged at 6,000rpm for 10 min.

(6) In another centrifuge tube, 0.6 volume of isopropanol was added and gently shaken until white filamentous DNA precipitate was clearly visible.

(7) The DNA was wound with a pipette and washed in 70% alcohol.

(8) The DNA was scraped from the pipette with a sterile toothpick and transferred to a 1.5mL centrifuge tube.

(9) Air-dried at room temperature, and dissolved in 500. mu.L of TE buffer.

(10) 50. mu.L of the DNA was assayed by a nucleic acid protein detector.

1.2.3 construction of recombinant plasmid pET-20b-xynB3

Designing a primer according to GH3 family β -xylosidase gene derived from Thermotoga thermomarum DSM5069, wherein an upstream primer is CATGCCA TGGATC TTT ACA AGA ATC CAA A and the downstream primer: CC (challenge collapsar)CTC GAGCTC GATCTT TGT ATT TGT GA are provided. The restriction sites NcoI and XhoI are underlined. Using the extracted genomic DNA of Thermotoga thermomrumumDSM 5069 as a templateThe synthesized primer is used for PCR amplification under the conditions of 94 ℃, 3min, 30 cycles (94 ℃, 30s, 55 ℃, 30s, 72 ℃, 2min20s), 72 ℃, 10min, reaction stop, and heat preservation at 4 ℃, PCR amplification products are purified by a gel recovery kit, and the GH3 family β -xylosidase gene from Thermotoga thermomarum DSM5069 is obtained.

Obtaining GH3 family β -xylosidase gene and pET-20b from Thermotoga thermomarum DSM5069, performing double enzyme digestion by NcoI and XhoI respectively, tapping and recovering the gel respectively, concentrating the gel, connecting the gel at 16 ℃ overnight, transforming the connection product into escherichia coli Top 10F' competent cells, coating the transformation product on an LB solid culture medium containing Amp (100 mu g/mL) for overnight culture at 37 ℃, inoculating a plurality of single bacteria to an LB liquid culture medium containing Amp (100 mu g/mL) for culture for 8-10h, collecting bacteria extraction plasmids, performing enzyme digestion verification to remove unloaded plasmids, and performing nucleic acid sequence determination on the recombinant plasmids to obtain a correct recombinant expression vector pET-20b-xynB 3.

1.2.4 preparation of recombinant enzymes

Transforming a recombinant plasmid pET-20b-xynB3 into Escherichia coli BL21(DE3) host bacteria (Novagen), culturing overnight at 37 ℃ on an LB plate containing Amp (100 mu g/mL), picking up transformants into 200mL LB medium (100 mu g/mLAmp), carrying out shaking culture at 37 ℃ and 180rpm until OD600 is 0.6, adding an isopropyl β -D-thiogalactopyranoside (IPTG) inducer with a final concentration of 0.5mM, carrying out induction culture at 30 ℃ for 8h, centrifuging the culture solution at 4 ℃ for 15min at 13,000rpm by using a high-speed refrigerated centrifuge, collecting thalli, removing supernatant, adding sterile water, carrying out ultrasonic cell disruption, carrying out heat treatment at 70 ℃ for 30min, centrifuging the culture solution at 4 ℃ for 15min at 13,000rpm by using a high-speed refrigerated centrifuge, and obtaining the supernatant which is the recombinant β -xylosidase derived from DSM 3 family derived from Thermota thermum 5069.

1.3 cloning of β -xylosidase from GH3 family from Thermotoga petrophila DSM13995 and preparation of recombinase

1.3.1 culture of Thermotoga petrophila DSM13995

Thermotoga petrophila DSM13995 was purchased from the German collection of microorganisms. The serial numbers are: DSM 13995. The formula of the culture medium is as follows: 10g/L of starch and 5g/L of tryptone，3g/L yeast extract，5g/L meatextract，10g/L2-morpholinoethanesulfonic,10mg/L FeSO₄·7H₂O, 1mg/L resazurin, and the pH was adjusted to 7.2. Inoculating with 0.5% inoculating amount by syringe, static culturing at 85 deg.C for 24 hr, and collecting cells.

1.3.2 extraction of genomic DNA

(1) The Thermotoga petrophila DSM13995 was cultured by standing for about 24 hours, and 30mL of the lysate was centrifuged at 4,000g for 10min to collect cells.

(4) Adding equal volume of chloroform/isoamyl alcohol, mixing, and centrifuging at 6,000g for 10 min.

(5) To prevent genomic DNA fragmentation due to shear forces, the supernatant was transferred to another centrifuge tube using a wide-mouthed pipette, mixed with an equal volume of phenol/chloroform/isoamyl alcohol and centrifuged at 6,000g for 10 min.

(7) The DNA was wound with a pipette and washed in 70% alcohol.

(9) Air-dried at room temperature, and dissolved in 500. mu.L of TE buffer.

(10) 50. mu.L of the DNA was assayed by a nucleic acid protein detector.

1.3.3 construction of recombinant plasmid pET-28a-xln3

Designing a primer according to GH3 family β -xylosidase gene derived from Thermotoga petrophila DSM13995, wherein an upstream primer is CATGCCA TGGAAC TGT ACA GGG ATC CTT CG and the downstream primer: CCGCTC GAGCTCCTC GCA GGC TTC CGT GAA are provided. The restriction sites NcoI and XhoI are underlined. Using the extracted genome DNA of Thermotogatephrilla DSM13995 as template, and performing PC with synthesized primerAnd R, amplifying at 94 ℃ for 3min under 30 cycles (94 ℃, 30s, 55 ℃, 30s, 72 ℃, 2min and 20s), at 72 ℃, for 10min, stopping the reaction, keeping the temperature at 4 ℃, and purifying the PCR amplification product by using a gel recovery kit to obtain the GH3 family β -xylosidase gene derived from Thermotoga petrophila DSM 13995.

Obtaining GH3 family β -xylosidase gene and pET-28a from Thermotoga petrophila DSM13995, performing double enzyme digestion by NcoI and XhoI respectively, tapping and recovering the gel respectively, concentrating the gel, connecting the gel at 16 ℃ overnight, transforming the connection product into escherichia coli Top 10F' competent cells, coating the transformation product on an LB solid culture medium containing Kana (100 mu g/mL) for overnight culture at 37 ℃, inoculating a plurality of single bacteria to an LB liquid culture medium containing Kana (100 mu g/mL) for culture for 8-10h, collecting bacteria to extract plasmids, verifying enzyme digestion to remove the unloaded plasmids, and performing nucleic acid sequence determination on the recombinant plasmids to obtain the correct recombinant expression vector pET-28a-xln 3.

1.3.4 preparation of recombinant enzymes

The recombinant plasmid pET-28a-xln3 was transformed into E.coli BL21(DE3) host bacteria (Novagen), cultured overnight at 37 ℃ on an LB plate containing Kana (100. mu.g/mL), and transformants were picked up in 200mL of LB medium (100. mu.g/mLkana) at 37 ℃ and cultured with shaking at 180rpm to OD₆₀₀At 0.6, adding isopropyl β -D-thiogalactopyranoside (IPTG) inducer to a final concentration of 0.5mM, carrying out induction culture at 30 ℃ for 8h, centrifuging the culture solution at 4 ℃ for 15min at 13,000rpm by using a high-speed refrigerated centrifuge, collecting the thalli, removing the supernatant, adding sterile water, carrying out ultrasonic cell disruption, carrying out heat treatment at 70 ℃ for 30min, and purifying by using a Ni-NTA affinity chromatography column to finally obtain the purified recombinant β -xylosidase of GH3 family derived from Thermotoga pegophila DSM 13995.

1.4 cloning of β -xylosidase from GH120 family from Thermoanaerobacterium thermosaccharolyticum DSM 571 and preparation of recombinase

1.4.1 cultivation of Thermoanaerobacterium thermosaccharolyticum DSM 571

Thermoanaerobacterium thermosaccharolyticum DSM 571 is available from the German Collection of microorganisms. The serial numbers are: DSM 571. The formula of the culture medium is: 5g/L soluble starch, 1g/L yeast powder and 1.5g/LKH₂PO₄，4.2g/L Na₂HPO₄·12H₂O，3.4g/L NaCl，1g/L MgSO₄·7H₂O, 0.76g/L EDTA, 1mL/L microelement, 0.5g/L Na₂S·9H₂O, 0.5g/L Cysteine HCl and 1mg/L resazurin, adjusting the pH to 7.0, boiling and flushing with nitrogen, removing oxygen, and placing the culture medium into an anaerobic bottle for sterilization under anaerobic conditions. Trace elements (1000 ×) formulation: FeCl₃2.0g/L；H₃BO₃0.05g/L；ZnCl₂0.05g/L；CuCl₂·2H₂O 0.03g/L；MnCl₂·4H₂O 0.05g/L；(NH₄)₂MoO₄0.05g/L；AlKSO₄·2H₂O is 0.05 g/L. Inoculating with 0.5% inoculating amount by syringe, static culturing at 82 deg.C for 24 hr, and collecting cells.

1.4.2 extraction of genomic DNA

(1) Culturing Thermoanaerobacterium thermosaccharolyticum DSM 571 at 69 deg.C for 8 hr, centrifuging 30mL of the bacterial liquid at 6,000rpm for 10min, and collecting cells.

(5) To prevent genomic DNA fragmentation due to shear forces, the supernatant was transferred to another centrifuge tube using a wide-mouthed pipette, mixed with an equal volume of phenol/chloroform/isoamyl alcohol and centrifuged at 10,000rpm for 10 min.

(7) The DNA was wound with a pipette and washed in 70% alcohol.

(9) Air-dried at room temperature, and dissolved in 500. mu.L of TE buffer.

(10) 50. mu.L of the DNA was assayed by a nucleic acid protein detector.

1.4.3 construction of recombinant plasmid pET-20b-xyl

Designing a primer according to GH120 family β -xylosidase gene derived from Thermoanaerobacterium thermosaccharolyticum DSM 571, wherein the upstream primer is CCCCAT ATGGAA TAT CAT GTA GCG AA and the downstream primer: CCCCTC GAGCCA AAC TTT AAT ATA ATT ATC G, underline shows enzyme cutting sites NdeI and XhoI, the extracted genome DNA of Thermoanaerobacterium thermosaccharolyticum DSM 571 is used as a template, PCR amplification is carried out by using a synthesized primer, the amplification conditions are 95 ℃, 5min, 25 cycles (95 ℃, 30s, 57 ℃, 30s, 72 ℃, 2min), 72 ℃, 10min, reaction stop, 4 ℃ heat preservation, PCR amplification products are purified by a gel recovery kit, and the GH120 family β -xylosidase gene from Thermoanaerobacterium thermosaccharolyticum DSM 571 is obtained.

Obtaining GH120 family β -xylosidase gene and pET-20b from Thermoanaerobacterium thermosaccharolyticum DSM 571, performing double enzyme digestion by NdeI and XhoI respectively, tapping and recovering the gel respectively, concentrating the gel, connecting the gel at 16 ℃ overnight, transforming the connection product into escherichia coli Top 10F' competent cells, coating the transformation product on an LB solid culture medium containing Amp (100 mu g/mL) for overnight culture at 37 ℃, inoculating a plurality of single bacteria to an LB liquid culture medium containing Amp (100 mu g/mL) for culture for 8-10h, collecting bacteria extraction plasmids, performing enzyme digestion verification to remove the unloaded plasmids, and performing nucleic acid sequence determination on the recombinant plasmids to obtain the correct recombinant expression vector pET-20 b-xyl.

1.4.4 preparation of recombinant enzymes

The recombinant plasmid pET-20b-xyl is transformed into a host bacterium (Novagen) of Escherichia coli BL21(DE3), the host bacterium is cultured on an LB plate containing Amp (100 mu g/mL) at 37 ℃ overnight, and the transformant is picked up into 200mL of LB medium (100 mu g/mLAmp) at 37 ℃ and cultured with shaking at 180rpm until OD is achieved₆₀₀Adding isopropyl β -D-thiogalactopyranoside (IPTG) inducer with final concentration of 0.5mM when the concentration is 0.6, performing induction culture at 30 ℃ for 8h, centrifuging the culture solution at 13,000rpm for 15min at 4 ℃ by using a high-speed refrigerated centrifuge,the crude enzyme is firstly thermally treated at 75 ℃ for 1h to remove heat-labile foreign protein, and then purified by an Ni-NTA affinity chromatography column, and finally purified GH120 family β -xylosidase derived from Thermoanaerobacterium thermosaccharolyticum DSM 571 is obtained.

1.5 Dictyoglycomus thermophilum DSM 3960-derived β -xylosidase clone of GH39 family and recombinase preparation

1.5.1 extraction of Dictyoglycous thermophilum DSM 3960 genomic DNA

Adopting 10g of fresh dictyosphaea thermophilum DSM 3960 (purchased from German culture collection center of microorganisms) suspended in 9.5mL of TE buffer solution, adding 0.5mL of 10% Sodium Dodecyl Sulfate (SDS) and 50 μ L of proteinase K (20mg/mL), uniformly mixing, and keeping the temperature at 37 ℃ for 1 h; adding 1.8mL of 5mol/L NaCl and 1.5mL of hexadecyltriethylammonium bromide (CTAB)/NaCl, uniformly mixing, and incubating at 65 ℃ for 20 min; adding equal volume of chloroform/isoamyl alcohol, mixing, centrifuging at 6,000g for 10 min; transferring the supernatant into another centrifuge tube by a thick-mouth pipette, adding equal volume of phenol/chloroform/isoamylol, mixing uniformly, and centrifuging for 10min at 6,000 g; adding isopropanol with 0.6 times volume, and gently shaking until white filiform DNA precipitate is clearly visible; DNA was wound on it with a pipette and washed in 70% alcohol; scraping the DNA from a suction tube by using a sterile toothpick, and transferring the DNA into a 1.5mL centrifuge tube; air-drying at room temperature, and dissolving with 500 μ L TE buffer solution; 50. mu.L of the DNA was assayed by a nucleic acid protein detector.

1.5.2 preparation of β -xylosidase xln-DT

Can be prepared by the following method or obtained by artificial synthesis.

PCR amplification was performed using the following primer pair, using the total DNA of tennis thermophilus Dictyoglomycotus thermophilum DSM 3960 (1.1 preparation) as template: CGC GGA TCC ATG AAC CAT ATA AAG ATT GAA A as upstream primer; the downstream primer is CCG CTC GAG ATA TCC ACC TGG TAT TTT GCT ATC. The cleavage sites BamHI and XhoI are underlined. The PCR system is as follows: dictyoglomyus thermophilum DSM 3960 genomic DNA 1.0. mu.L, supraDownstream primers (10. mu. mol/L) each 2.0. mu.L, dNTP mix 4.0. mu.L, 10 XEx Taq buffer (Mg)²⁺free)5.0μL，MgCl₂4.0. mu.L, Ex Taq enzyme (5U/. mu.L) 0.5. mu.L, and ultrapure water 31.5. mu.L. And (3) PCR reaction conditions: 94 ℃ for 3 min; 30 cycles (94 ℃, 30 s; 60 ℃, 30 s; 72 ℃, 1min30 s); 72 ℃ for 10 min; the reaction was stopped and the temperature was maintained at 4 ℃.

The PCR product was checked for yield and specificity by electrophoresis on a 1% agarose gel and purified using a PCR product recovery kit.

1.5.3 construction and validation of recombinant clone and expression vector pET-20b-xln-DT

The purified PCR product, pET-20b (Novagen), was digested with BamHI and XhoI, respectively, and the digested PCR and vector-sized fragments were recovered by 1% agarose gel electrophoresis. Concentrating the target fragment and the carrier after tapping recovery, connecting overnight at 16 ℃, converting the connecting product into escherichia coli Top 10F' competent cells, coating the competent cells on a culture medium of 100 mu g/mL Amp, culturing for 12h at 37 ℃, screening positive clones, and carrying out sequence analysis; selecting the clone with correct sequence to extract plasmid, and obtaining the recombinant plasmid pET-28a-xln-DT containing the heat-resistant glycosidase gene.

1.5.4 preparation and purification of recombinant enzyme

The recombinant plasmid pET-28a-xln-DT is transformed into Escherichia coli BL21(DE3) host bacteria (Novagen), cultured for 12h at 37 ℃ on an LB plate containing Amp (100 mu g/mL), and the transformants are picked into 200mL of LB medium (100 mu g/mLAmp) at 37 ℃ and cultured with shaking at 200rpm until OD is achieved₆₀₀When the concentration is 0.6, adding isopropyl β -D-thiogalactopyranoside (IPTG) inducer with the final concentration of 0.5mM, carrying out induction culture at 28 ℃ for 8h, centrifuging the culture solution at 4 ℃ by using a high-speed refrigerated centrifuge for 15min at 13,000rpm, collecting thalli, removing supernatant, adding sterile water, carrying out ultrasonic cell disruption, centrifuging and taking supernatant, purifying by using His-tag label in recombinant plasmid pET20b-xln-DT, using His-Bind Purification Kit (Novagen), carrying out heat treatment on crude enzyme at 75 ℃ for 1h, removing heat-labile hybrid protein, purifying by using Ni-NTA affinity chromatography column to finally obtain purified β -xylosidase of GH39 family from Dictglomus thermophilum DSM 3960, identifying the purity of the purified enzyme and measuring the molecular weight by adopting SDS-The PAGE method is carried out, and the result is shown in FIG. 3, and the molecular weight is about 55kDa, which is close to the theoretical value.

Example 2 determination of mutation site of recombinant β -xylosidase Xln-DT

The research shows that the sugar tolerance and the expression capacity of β -xylosidase are closely related to key sites around an active pocket in a protein structure, a three-dimensional structure of β -xylosidase Xln-DT is obtained through homologous modeling, sugar-resistant mutation sites are designed based on the theory, mutation capacity of virtual mutation sites is analyzed by using a bioinformatics software Discovery Studio, the mutation sites with high xylose affinity are screened as research objects, and the mutation sites are finally determined to be H284 and C202.

Designing a mutation primer, namely changing β -xylosidase Xln-DT molecular part of amino acids by utilizing bioinformatics analysis and homologous modeling comparison, designing mutation points, obtaining a mutation sequence by utilizing a reverse PCR technology, designing positive and negative oligonucleotide sequences at each mutation point, selecting a yeast preferred codon as the mutation point, and designing the mutation primer as shown in the following table.

TABLE 1 site-directed mutagenesis Table

Example 3 construction of a series of recombinant plasmids carrying a mutant Gene

The recombinant plasmid pET-28a-Xln-D is used as a template, and HIS284ALA and HIS284ASP are further mutated by reverse PCR to obtain recombinant plasmids pET-28a-Xln-DT-284A and pET-28a-Xln-DT-284D carrying mutant genes SEQ ID NO. 2-3. Recombinant plasmids pET-28a-Xln-DT-284A and pET-28a-Xln-DT-284D are used as templates, and further reverse PCR is utilized to mutate C202L and C202F, so that recombinant plasmids pET-28a-Xln-DT-284A/202L, pET-28a-Xln-DT-284D/202L, pET-28a-Xln-DT-284A/202F and pET-28a-Xln-DT-284D/202F carrying mutant genes SEQ ID NO. 4-7 are obtained.

TABLE 2 preparation of reverse PCR reaction solution (50. mu.L in total)

TABLE 3 inverse PCR reaction conditions

The PCR fragment 5' end phosphorylation reaction was performed at 37 ℃ for 1 hour as shown in the following Table.

TABLE 4 preparation of phosphorylation reaction solution

After phosphorylation at 37 ℃ 1. mu. L T4 ligase was added and ligation was performed at 16 ℃ for 3 h. Plasmid DNA transformation, selection of mutants, and identification by sequencing.

Example 4 analysis of xylose tolerance coefficients of recombinant enzymes

In a reaction system added with xylose with different concentrations, enzyme activity values of the recombinase and the mutant enzyme are measured according to a standard method, and relative enzyme activity values of the recombinase and the mutant enzyme under different xylose concentrations are calculated and obtained by taking the activity values of the recombinase and the mutant enzyme measured without adding xylose as 100%.

The enzyme activity is measured by taking p-nitrophenol- β -xylopyranoside (pNPX) as a substrate, carrying out color reaction on the p-nitrophenol obtained by hydrolysis and sodium carbonate, measuring the absorbance of the product at the wavelength of 405nm, wherein a 100 mu L reaction system comprises 90 mu L buffer solution with 100mmol/L optimal pH and 5 mu L substrate with 20mmol/L, uniformly mixing, preheating, adding 5 mu L diluted enzyme solution, reacting at the optimal temperature for 10min, and then adding 0.3mL Na with 1mol/L Na₂CO₃The reaction is stopped, and the mixture is evenly mixed and then is measured by an enzyme-labeling instrument under the condition of 405 nm. A control with enzyme solution and no substrate and a control with substrate and no enzyme solution were performed simultaneously.

One unit of enzyme activity (U) is defined as the amount of enzyme required to hydrolyze p-nitrophenol- β -xylopyranoside (pNPX) within 1min to release 1. mu. mol of p-nitrophenol (pNP).

Enzyme activity was calculated against the standard curve:

enzyme activity (U/mL) ═ cxV₁/(t×V₂)×N

c: the p-nitrophenol content (mu mol/mL) after the enzyme reaction is calculated by a p-nitrophenol standard equation;

V₁: total reaction system volume (mL);

t: enzyme and substrate reaction time (min);

V₂: volume of enzyme solution (mL) at the time of enzyme reaction;

n: and (5) diluting the enzyme solution by multiple times.

Example 5 comparison of the ability of recombinant β -xylosidase from different sources to convert notoginsenoside R1

The concentration of notoginsenoside R1 is 1g/L, β -xylosidase from 5 different sources is converted under the respective optimum temperature and optimum pH conditions, 1U/mL of enzyme is added for reaction for 2h, and detection is carried out by HPLC, the result shows that after the reaction for 2h, β -xylosidase derived from Aspergillus niger NL-1, Thermotoga thermarum DSM5069, Thermotoga petri DSM13995 and Thermoanaerobacterium thermosaccharolyticum DSM 571 is converted into notoginsenoside R1 with the conversion rate of almost 0, and β -xylosidase mutant derived from Dictyoglyces therophilum DSMZ 3960GH39 family is converted into notoginsenoside R1 to generate ginsenoside 1, see FIG. 2.

Example 6 β transformation Process of converting xylosidase Xln-DT mutant 284D into notoginsenoside R1 and HPLC detection before and after reaction

HPLC liquid phase detection of Notoginseng radix saponin R1 and ginsenoside Rg1 standard product is shown in FIG. 5. The peak emergence time of notoginsenoside R1 and ginsenoside Rg1 was 10.022min and 10.949min, respectively.

The recombinant β -xylosidase Xln-DT mutant 284D is applied to conversion of notoginsenoside R1, the conversion system is that the concentration of notoginsenoside R1 is 1g/L, the pH value is 6.050 mmol/L, citric acid-disodium hydrogen phosphate buffer solution is added, 1U/mL β -xylosidase Xln-DT is added to react for 30min at 75 ℃, detection is carried out by HPLC, and the method and conditions are the same as the HPLC liquid phase detection conditions of the standard products of notoginsenoside R1 and ginsenoside Rg 1.

The result shows that β -xylosidase Xln-DT mutant 284D has significant conversion capability to notoginsenoside R1, and after 0.5 hour of reaction, the ginsenoside R1 is almost completely converted, and the molar conversion rate is close to 100% (fig. 6).

Example 7 comparison of anti-fatigue Activity of notoginsenoside R1 before and after transformation

The antifatigue activity of notoginsenoside R1 and ginsenoside Rg1 is shown in figure 7. The body weight of five groups of mice steadily increased after the continuous administration for 14 days, which indicates that the drug has no toxic effect on the mice. After 14 days of administration, the mice have obviously prolonged exhaustion swimming time after 12.5 percent of the weight of the mice, wherein the low dose (5 mg/kg. d) and the high dose group (20 mg/kg. d) of Rg1 are respectively improved by 14.5 percent and 16.4 percent. After exercise, the hemoglobin concentration and the contents of liver glycogen and muscle glycogen after exercise of the mice of the administration group are obviously higher than those of the mice of the control group. The results show that the ginsenoside Rg1 and the notoginsenoside R1 both have certain anti-fatigue effect, and the Rg1 effect is superior to that of R1.

In conclusion, the invention carries out multi-site mutation on the heat-resistant β -xylosidase cloned from Dictyoglossus thermophilum DSM 3960 genome and utilizes the mutant to efficiently convert notoginsenoside R1 to generate ginsenoside Rg 1. the invention has the technical advantages that (1) the sugar resistance coefficient of the obtained novel β -xylosidase mutant is improved by 1.35 times, and K is K_iThe enzyme activity is improved by 3.28 times when reaching 4.602mol/L, (2) the mutant can specifically hydrolyze β -1, 2-glycosidic bonds at the tail end, has high optimal action temperature and is beneficial to improving the solubility of a substrate, (3) enzymatic conversion is safe and efficient, has short time and high conversion rate, and (4) a conversion product has stronger anti-fatigue biological activity.

Sequence listing

<110> Nanjing university of forestry

<120> thermophilic xylosidase amino acid mutant and application thereof

<160>23

<170>SIPOSequenceListing 1.0

<210>1

<211>1509

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atgaaccata taaagattga aaaaggcaaa tatgttggtg tttttcctga caattggaag 60

ttttgcgtag gaagtggaag aataggtctt gctctccaaa aagaatatat agatgccctc 120

tcttttgtaa aaaggcatat agattttaaa tatctaagag cccacggatt actccatgac 180

gatgtgggaa tttacagaga agacatagta gacggaaaaa caatcccttt ttataatttc 240

acctacattg acagaatata cgattccttt ttagaaattg gaataagacc tttcgttgaa 300

attggattta tgccctcaaa acttgcctct ggagatcaaa cagtatttta ctggagaggc 360

aatgttactc cccctaaaga ttataaagaa tgggaaaagt taataaaaaa tgtggtgaaa 420

catttcatag atagatatgg agaaaaagag gttactcaat ggccttttga gatttggaat 480

gagcccaatt taaccgtatt ttggaaagat gcaaatcagg cagaatactt caaattatac 540

gaggttacag taaaagcaat aaaagaggta aatgaaaaca taaaggttgg aggacctgca 600

atctgtggtg gatcagacta ttggataact gattttctaa atttctgtta taagaacaat 660

gtacctgtag actttttaac tcgacatgcc tatacaggca aacctcctat atatacccct 720

cactttgtat accaagatgt gcatcccatc gaatacatgt taaatgaatt caaaaccgtt 780

agagagatgg tgaaaaattc tccattccct aacctaccaa tacatattac tgaatttaac 840

agttcttacc atcccctctg ccccatacac gatactccct tcaatgctgc ttacttagca 900

agggtactaa gtgagggagg agactatgtt gactccttct cttattggac ctttagtgat 960

gtgtttgagg aagcagacgt tccaagatca ctcttccatg gtggatttgg tcttgtagca 1020

ttccacaata ttccaaaacc agttttccat atgttcacct tctttaatgc tatgggagaa 1080

aagatcctct atagagatga ccatatctta ataaccgaaa gagaagacaa gtcagttgcc 1140

ttaattgctt ggaatgaagt catgacaaaa gaagaaaatc aagaaagaaa atatagaata 1200

gagatacccg tagattacaa agaggttttc ataaaacaaa agttaattga tgaggaatac 1260

ggaaatccat ggcgcacctg gattcaaatg ggcaggccga gatttccaag caaaaagcaa 1320

atagaaacat taagagaagt agcaactcct aaagtaacta ctttcagaaa aacagtagaa 1380

aatggacata ttactcttga atttacatta ggtaaaaatg ctgttaccct ctttgaaata 1440

agcaaggtta ttgatgaatc acatacctat ataggtctcg acgatagcaa aataccaggt 1500

ggatattaa 1509

<210>2

<211>1509

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

atgaaccata taaagattga aaaaggcaaa tatgttggtg tttttcctga caattggaag 60

ttttgcgtag gaagtggaag aataggtctt gctctccaaa aagaatatat agatgccctc 120

tcttttgtaa aaaggcatat agattttaaa tatctaagag cccacggatt actccatgac 180

gatgtgggaa tttacagaga agacatagta gacggaaaaa caatcccttt ttataatttc 240

acctacattg acagaatata cgattccttt ttagaaattg gaataagacc tttcgttgaa 300

attggattta tgccctcaaa acttgcctct ggagatcaaa cagtatttta ctggagaggc 360

aatgttactc cccctaaaga ttataaagaa tgggaaaagt taataaaaaa tgtggtgaaa 420

catttcatag atagatatgg agaaaaagag gttactcaat ggccttttga gatttggaat 480

gagcccaatt taaccgtatt ttggaaagat gcaaatcagg cagaatactt caaattatac 540

gaggttacag taaaagcaat aaaagaggta aatgaaaaca taaaggttgg aggacctgca 600

atctgtggtg gatcagacta ttggataact gattttctaa atttctgtta taagaacaat 660

gtacctgtag actttttaac tcgacatgcc tatacaggca aacctcctat atatacccct 720

cactttgtat accaagatgt gcatcccatc gaatacatgt taaatgaatt caaaaccgtt 780

agagagatgg tgaaaaattc tccattccct aacctaccaa tacatattac tgaatttaac 840

agttcttacg ctcccctctg ccccatacac gatactccct tcaatgctgc ttacttagca 900

agggtactaa gtgagggagg agactatgtt gactccttct cttattggac ctttagtgat 960

gtgtttgagg aagcagacgt tccaagatca ctcttccatg gtggatttgg tcttgtagca 1020

ttccacaata ttccaaaacc agttttccat atgttcacct tctttaatgc tatgggagaa 1080

aagatcctct atagagatga ccatatctta ataaccgaaa gagaagacaa gtcagttgcc 1140

ttaattgctt ggaatgaagt catgacaaaa gaagaaaatc aagaaagaaa atatagaata 1200

gagatacccg tagattacaa agaggttttc ataaaacaaa agttaattga tgaggaatac 1260

ggaaatccat ggcgcacctg gattcaaatg ggcaggccga gatttccaag caaaaagcaa 1320

atagaaacat taagagaagt agcaactcct aaagtaacta ctttcagaaa aacagtagaa 1380

aatggacata ttactcttga atttacatta ggtaaaaatg ctgttaccct ctttgaaata 1440

agcaaggtta ttgatgaatc acatacctat ataggtctcg acgatagcaa aataccaggt 1500

ggatattaa 1509

<210>3

<211>1509

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

atgaaccata taaagattga aaaaggcaaa tatgttggtg tttttcctga caattggaag 60

ttttgcgtag gaagtggaag aataggtctt gctctccaaa aagaatatat agatgccctc 120

tcttttgtaa aaaggcatat agattttaaa tatctaagag cccacggatt actccatgac 180

gatgtgggaa tttacagaga agacatagta gacggaaaaa caatcccttt ttataatttc 240

acctacattg acagaatata cgattccttt ttagaaattg gaataagacc tttcgttgaa 300

attggattta tgccctcaaa acttgcctct ggagatcaaa cagtatttta ctggagaggc 360

aatgttactc cccctaaaga ttataaagaa tgggaaaagt taataaaaaa tgtggtgaaa 420

catttcatag atagatatgg agaaaaagag gttactcaat ggccttttga gatttggaat 480

gagcccaatt taaccgtatt ttggaaagat gcaaatcagg cagaatactt caaattatac 540

gaggttacag taaaagcaat aaaagaggta aatgaaaaca taaaggttgg aggacctgca 600

atctgtggtg gatcagacta ttggataact gattttctaa atttctgtta taagaacaat 660

gtacctgtag actttttaac tcgacatgcc tatacaggca aacctcctat atatacccct 720

cactttgtat accaagatgt gcatcccatc gaatacatgt taaatgaatt caaaaccgtt 780

agagagatgg tgaaaaattc tccattccct aacctaccaa tacatattac tgaatttaac 840

agttcttacg atcccctctg ccccatacac gatactccct tcaatgctgc ttacttagca 900

agggtactaa gtgagggagg agactatgtt gactccttct cttattggac ctttagtgat 960

gtgtttgagg aagcagacgt tccaagatca ctcttccatg gtggatttgg tcttgtagca 1020

ttccacaata ttccaaaacc agttttccat atgttcacct tctttaatgc tatgggagaa 1080

aagatcctct atagagatga ccatatctta ataaccgaaa gagaagacaa gtcagttgcc 1140

ttaattgctt ggaatgaagt catgacaaaa gaagaaaatc aagaaagaaa atatagaata 1200

gagatacccg tagattacaa agaggttttc ataaaacaaa agttaattga tgaggaatac 1260

ggaaatccat ggcgcacctg gattcaaatg ggcaggccga gatttccaagcaaaaagcaa 1320

atagaaacat taagagaagt agcaactcct aaagtaacta ctttcagaaa aacagtagaa 1380

aatggacata ttactcttga atttacatta ggtaaaaatg ctgttaccct ctttgaaata 1440

agcaaggtta ttgatgaatc acatacctat ataggtctcg acgatagcaa aataccaggt 1500

ggatattaa 1509

<210>4

<211>1509

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

atgaaccata taaagattga aaaaggcaaa tatgttggtg tttttcctga caattggaag 60

ttttgcgtag gaagtggaag aataggtctt gctctccaaa aagaatatat agatgccctc 120

tcttttgtaa aaaggcatat agattttaaa tatctaagag cccacggatt actccatgac 180

gatgtgggaa tttacagaga agacatagta gacggaaaaa caatcccttt ttataatttc 240

acctacattg acagaatata cgattccttt ttagaaattg gaataagacc tttcgttgaa 300

attggattta tgccctcaaa acttgcctct ggagatcaaa cagtatttta ctggagaggc 360

aatgttactc cccctaaaga ttataaagaa tgggaaaagt taataaaaaa tgtggtgaaa 420

catttcatag atagatatgg agaaaaagag gttactcaat ggccttttga gatttggaat 480

gagcccaatt taaccgtatt ttggaaagat gcaaatcagg cagaatactt caaattatac 540

gaggttacag taaaagcaat aaaagaggta aatgaaaaca taaaggttgg aggacctgca 600

atcctcggtg gatcagacta ttggataact gattttctaa atttctgtta taagaacaat 660

gtacctgtag actttttaac tcgacatgcc tatacaggca aacctcctat atatacccct 720

cactttgtat accaagatgt gcatcccatc gaatacatgt taaatgaatt caaaaccgtt 780

agagagatgg tgaaaaattc tccattccct aacctaccaa tacatattac tgaatttaac 840

agttcttacg ctcccctctg ccccatacac gatactccct tcaatgctgc ttacttagca 900

agggtactaa gtgagggagg agactatgtt gactccttct cttattggac ctttagtgat 960

gtgtttgagg aagcagacgt tccaagatca ctcttccatg gtggatttgg tcttgtagca 1020

ttccacaata ttccaaaacc agttttccat atgttcacct tctttaatgc tatgggagaa 1080

aagatcctct atagagatga ccatatctta ataaccgaaa gagaagacaa gtcagttgcc 1140

ttaattgctt ggaatgaagt catgacaaaa gaagaaaatc aagaaagaaa atatagaata 1200

gagatacccg tagattacaa agaggttttc ataaaacaaa agttaattga tgaggaatac 1260

ggaaatccat ggcgcacctg gattcaaatg ggcaggccga gatttccaag caaaaagcaa 1320

atagaaacat taagagaagt agcaactcct aaagtaacta ctttcagaaa aacagtagaa 1380

aatggacata ttactcttga atttacatta ggtaaaaatg ctgttaccct ctttgaaata 1440

agcaaggtta ttgatgaatc acatacctat ataggtctcg acgatagcaa aataccaggt 1500

ggatattaa 1509

<210>5

<211>1509

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

atgaaccata taaagattga aaaaggcaaa tatgttggtg tttttcctga caattggaag 60

ttttgcgtag gaagtggaag aataggtctt gctctccaaa aagaatatat agatgccctc 120

tcttttgtaa aaaggcatat agattttaaa tatctaagag cccacggatt actccatgac 180

gatgtgggaa tttacagaga agacatagta gacggaaaaa caatcccttt ttataatttc 240

acctacattg acagaatata cgattccttt ttagaaattg gaataagacc tttcgttgaa 300

attggattta tgccctcaaa acttgcctct ggagatcaaa cagtatttta ctggagaggc 360

aatgttactc cccctaaaga ttataaagaa tgggaaaagt taataaaaaa tgtggtgaaa 420

catttcatag atagatatgg agaaaaagag gttactcaat ggccttttga gatttggaat 480

gagcccaatt taaccgtatt ttggaaagat gcaaatcagg cagaatactt caaattatac 540

gaggttacag taaaagcaat aaaagaggta aatgaaaaca taaaggttgg aggacctgca 600

atcctcggtg gatcagacta ttggataact gattttctaa atttctgtta taagaacaat 660

gtacctgtag actttttaac tcgacatgcc tatacaggca aacctcctat atatacccct 720

cactttgtat accaagatgt gcatcccatc gaatacatgt taaatgaatt caaaaccgtt 780

agagagatgg tgaaaaattc tccattccct aacctaccaa tacatattac tgaatttaac 840

agttcttacg atcccctctg ccccatacac gatactccct tcaatgctgc ttacttagca 900

agggtactaa gtgagggagg agactatgtt gactccttct cttattggac ctttagtgat 960

gtgtttgagg aagcagacgt tccaagatca ctcttccatg gtggatttgg tcttgtagca 1020

ttccacaata ttccaaaacc agttttccat atgttcacct tctttaatgc tatgggagaa 1080

aagatcctct atagagatga ccatatctta ataaccgaaa gagaagacaa gtcagttgcc 1140

ttaattgctt ggaatgaagt catgacaaaa gaagaaaatc aagaaagaaa atatagaata 1200

gagatacccg tagattacaa agaggttttc ataaaacaaa agttaattga tgaggaatac 1260

ggaaatccat ggcgcacctg gattcaaatg ggcaggccga gatttccaag caaaaagcaa 1320

atagaaacat taagagaagt agcaactcct aaagtaacta ctttcagaaa aacagtagaa 1380

aatggacata ttactcttga atttacatta ggtaaaaatg ctgttaccct ctttgaaata 1440

agcaaggtta ttgatgaatc acatacctat ataggtctcg acgatagcaa aataccaggt 1500

ggatattaa 1509

<210>6

<211>1509

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

atgaaccata taaagattga aaaaggcaaa tatgttggtg tttttcctga caattggaag 60

ttttgcgtag gaagtggaag aataggtctt gctctccaaa aagaatatat agatgccctc 120

tcttttgtaa aaaggcatat agattttaaa tatctaagag cccacggatt actccatgac 180

gatgtgggaa tttacagaga agacatagta gacggaaaaa caatcccttt ttataatttc 240

acctacattg acagaatata cgattccttt ttagaaattg gaataagacc tttcgttgaa 300

attggattta tgccctcaaa acttgcctct ggagatcaaa cagtatttta ctggagaggc 360

aatgttactc cccctaaaga ttataaagaa tgggaaaagt taataaaaaa tgtggtgaaa 420

catttcatag atagatatgg agaaaaagag gttactcaat ggccttttga gatttggaat 480

gagcccaatt taaccgtatt ttggaaagat gcaaatcagg cagaatactt caaattatac 540

gaggttacag taaaagcaat aaaagaggta aatgaaaaca taaaggttgg aggacctgca 600

atcttcggtg gatcagacta ttggataact gattttctaa atttctgtta taagaacaat 660

gtacctgtag actttttaac tcgacatgcc tatacaggca aacctcctat atatacccct 720

cactttgtat accaagatgt gcatcccatc gaatacatgt taaatgaatt caaaaccgtt 780

agagagatgg tgaaaaattc tccattccct aacctaccaa tacatattac tgaatttaac 840

agttcttacg ctcccctctg ccccatacac gatactccct tcaatgctgc ttacttagca 900

agggtactaa gtgagggagg agactatgtt gactccttct cttattggac ctttagtgat 960

gtgtttgagg aagcagacgt tccaagatca ctcttccatg gtggatttgg tcttgtagca 1020

ttccacaata ttccaaaacc agttttccat atgttcacct tctttaatgc tatgggagaa 1080

aagatcctct atagagatga ccatatctta ataaccgaaa gagaagacaa gtcagttgcc 1140

ttaattgctt ggaatgaagt catgacaaaa gaagaaaatc aagaaagaaa atatagaata 1200

gagatacccg tagattacaa agaggttttc ataaaacaaa agttaattga tgaggaatac 1260

ggaaatccat ggcgcacctg gattcaaatg ggcaggccga gatttccaag caaaaagcaa 1320

atagaaacat taagagaagt agcaactcct aaagtaacta ctttcagaaa aacagtagaa 1380

aatggacata ttactcttga atttacatta ggtaaaaatg ctgttaccct ctttgaaata 1440

agcaaggtta ttgatgaatc acatacctat ataggtctcg acgatagcaa aataccaggt 1500

ggatattaa 1509

<210>7

<211>1509

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

atgaaccata taaagattga aaaaggcaaa tatgttggtg tttttcctga caattggaag 60

ttttgcgtag gaagtggaag aataggtctt gctctccaaa aagaatatat agatgccctc 120

tcttttgtaa aaaggcatat agattttaaa tatctaagag cccacggatt actccatgac 180

gatgtgggaa tttacagaga agacatagta gacggaaaaa caatcccttt ttataatttc 240

acctacattg acagaatata cgattccttt ttagaaattg gaataagacc tttcgttgaa 300

attggattta tgccctcaaa acttgcctct ggagatcaaa cagtatttta ctggagaggc 360

aatgttactc cccctaaaga ttataaagaa tgggaaaagt taataaaaaa tgtggtgaaa 420

catttcatag atagatatgg agaaaaagag gttactcaat ggccttttga gatttggaat 480

gagcccaatt taaccgtatt ttggaaagat gcaaatcagg cagaatactt caaattatac 540

gaggttacag taaaagcaat aaaagaggta aatgaaaaca taaaggttgg aggacctgca 600

atcttcggtg gatcagacta ttggataact gattttctaa atttctgtta taagaacaat 660

gtacctgtag actttttaac tcgacatgcc tatacaggca aacctcctat atatacccct 720

cactttgtat accaagatgt gcatcccatc gaatacatgt taaatgaatt caaaaccgtt 780

agagagatgg tgaaaaattc tccattccct aacctaccaa tacatattac tgaatttaac 840

agttcttacg atcccctctg ccccatacac gatactccct tcaatgctgc ttacttagca 900

agggtactaa gtgagggagg agactatgtt gactccttct cttattggac ctttagtgat 960

gtgtttgagg aagcagacgt tccaagatca ctcttccatg gtggatttgg tcttgtagca 1020

ttccacaata ttccaaaacc agttttccat atgttcacct tctttaatgc tatgggagaa1080

aagatcctct atagagatga ccatatctta ataaccgaaa gagaagacaa gtcagttgcc 1140

ttaattgctt ggaatgaagt catgacaaaa gaagaaaatc aagaaagaaa atatagaata 1200

gagatacccg tagattacaa agaggttttc ataaaacaaa agttaattga tgaggaatac 1260

ggaaatccat ggcgcacctg gattcaaatg ggcaggccga gatttccaag caaaaagcaa 1320

atagaaacat taagagaagt agcaactcct aaagtaacta ctttcagaaa aacagtagaa 1380

aatggacata ttactcttga atttacatta ggtaaaaatg ctgttaccct ctttgaaata 1440

agcaaggtta ttgatgaatc acatacctat ataggtctcg acgatagcaa aataccaggt 1500

ggatattaa 1509

<210>8

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

cccgaattcc aggccaacac cagctacgtc 30

<210>9

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

ccctctagac tactccttcc ccggccactt 30

<210>10

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

catgccatgg atctttacaa gaatccaaa 29

<210>11

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

ccctcgagct cgatctttgt atttgtga 28

<210>12

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

catgccatgg aactgtacag ggatccttcg 30

<210>13

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

ccgctcgagc tcctcgcagg cttccgtgaa 30

<210>14

<211>26

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

ccccatatgg aatatcatgt agcgaa 26

<210>15

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

cccctcgagc caaactttaa tataattatc g 31

<210>16

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

cgcggatcca tgaaccatat aaagattgaa a 31

<210>17

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

ccgctcgaga tatccacctg gtattttgct atc 33

<210>18

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

gctcccctct gccccataca cgatact 27

<210>19

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

gatcccctct gccccataca cgatact 27

<210>20

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

gtaagaactg ttaaattcag taatatgtat 30

<210>21

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

ctcggtggat cagactattg gataactgat tt 32

<210>22

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>22

ttcggtggat cagactattg gataactgat tt 32

<210>23

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>23

gattgcaggt cctccaacct ttatgttttc 30

Claims

1. From Pyrenophora teres (Dictyoglomus thermophilum) Amino acid mutant of β -xylosidase of the DSM 3960GH39 family, characterized in that there are 2 of said mutation sites, of which the HIS284 is mutated to a and D and the CYS202 is mutated to L and F.

2. The nucleotide sequence of the mutant of claim 1, which is represented by SEQ ID NOS 4-7.

3. The method according to claim 1, wherein the polypeptide is derived from Pyrococcus thermophilus (A), (B), (CDictyoglomus thermophilum) DSM 3960GH39 familyApplication of amino acid mutant H284D/C202L of family β -xylosidase in specifically hydrolyzing notoginsenoside R1 to generate ginsenoside Rg 1.

4. The use of claim 3, wherein the hydrolysis conditions comprise a reaction temperature of 25-95 ℃, a pH of 4.0-7.0, a substrate concentration of notoginsenoside R1 of 0.2-5 g/L, and an addition of β -xylosidase of 0.1-2U/mL for 0.5-12 h.

5. The use of claim 4, wherein the hydrolysis conditions comprise a reaction temperature of 75 deg.C, a pH of 6.0, a substrate concentration of notoginsenoside R1 of 1g/L, and an addition of β -xylosidase of 1U/mL for 30 min.

6. The method according to claim 1, wherein the polypeptide is derived from Pyrococcus thermophilus (A), (B), (CDictyoglomus thermophilum) Application of amino acid mutant H284D/C202L of β -xylosidase in DSM 3960GH39 family in preparing antifatigue product by hydrolyzing notoginsenoside R1 is provided.