CN107365794A

CN107365794A - Pseudo-ginseng chitinase gene PnCHI1 application

Info

Publication number: CN107365794A
Application number: CN201710540050.2A
Authority: CN
Inventors: 刘迪秋; 唐笔锋; 普丽梅; 崔秀明; 曲媛
Original assignee: Kunming University of Science and Technology
Current assignee: Kunming University of Science and Technology
Priority date: 2017-07-05
Filing date: 2017-07-05
Publication date: 2017-11-21
Anticipated expiration: 2037-07-05
Also published as: CN107365794B

Abstract

The invention discloses pseudo-ginseng chitinase genePnCHI1Tobacco is improved to the application in grape seat chamber bacterium, colletotrichum gloeosporioides Penz resistance,PnCHI1The nucleotide sequence of gene such as SEQ ID NO：Shown in 1, chitinase encoding；The present invention is confirmed by functional genomics relation technological researchingPnCHI1Gene, which has, improves function of the plant to disease fungus resistance, by anti-fungal gene of the present inventionPnCHI1It is building up on plant expression vector and is transferred to overexpression in tobacco, transgenic tobacco plant has very strong extracorporeal antifungal activity；PnCHI1Growth of the transgene tobacco of overexpression to grape seat chamber bacterium and colletotrichum gloeosporioides Penz is respectively provided with very strong inhibitory action.

Description

Pseudo-ginseng chitinase genePnCHI1Application

Technical field

The present invention relates to molecular biology and genetic engineering field correlation technique, particularly a kind of pseudo-ginseng chitinase base CausePnCHI11Application.

Background technology

Plant can be coerced in growth and development process by many biologies and abiotic component, and such as arid, cold, UV is penetrated Line, wound, pathogen（Fungi, bacterium, virus）Infect, go out series of defence mechanism for this biological evolution to resist the adverse circumstance side of body Compel, pathogenesis-related proteins（pathogenesis-related protein, PR）Activation and accumulation be plant defense response Important component（Singh A, Kirubakaran S I, Sakthivel N. Heterologous expression of New antifungal chitinase from wheat. Protein Expr Purif, 2007,56 (1):100.）.Plant A variety of PR genes are expressed to tackle the harm of a variety of adverse circumstance factors such as pathogen, wherein PR3 gene families encode Chitinase (chitinase) received much concern in plant disease-resistant defense response.

Chitin, also known as chitin or chitin, it is to be connected by N-Acetyl-D-glucosamine (GlcNAc) by β-Isosorbide-5-Nitrae glycosidic bond The linear polysaccharide connect, it is the second abundant biopolymer that cellulose is only second on the earth.3 kinds of forms be present in it, point Not Wei α-chitin, β-chitin and γ-chitin, these various forms of chitins assemble and adjacent chain polarization in terms of It is different（Bussink A P, Speijer D, Aerts J M F G, et al. Evolution of mammalian chitinase (-like) members of family 18 glycosylhydrolases. Genetics, 2007, 177(2): 959-970.）.α-chitin is its main existence form, by N-Acetyl-D-glucosamine in a manner of antiparallel Linear array forms, and β-chitin is by two cocurrent and parallel chain arrangement forms, and γ-chitin is then made up of 3 chains, Two in the same direction, and one reversely（The microbiological deterioration microorganisms of the latent chitins of Wang Shikui, Wang Han and chitan Learn circular, 1994,21 (3): 180-183.）.Chitinase is the size distribution of a kind of hydrolyzable chitin in 20-90kD Glycosyl hydrolase（Bhattacharya D, Nagpure A, Gupta R K. Bacterial chitinases: properties and potential. Critical Reviews in Biotechnology, 2007, 27(1): 21- 28.）.Wherein microorganism chitinase is mostly 20~60kD, and plant chitinase is in 20~45kD, insect chitinase 40 ~85ku.Plant chitinase is present in the stem, seed, Hua Zhong of plant, and their expression has tissue specificity.Most plants Chitinase relative molecular mass is all smaller than insect chitinase relative molecular mass, wherein minimum chitinase size is 22 kD.It is different according to the mode for acting on chitinase, chitinase can be divided into endochitinase and circumscribed chitin The major class of enzyme two, chitinase can be divided into the family of glycoside hydrolase 18 and glycoside hydrolase according to primary series and catalyst mechanism 19 families, 7 major classes can be divided into chitinase according to the presence or absence of the similitude of amino acid sequence and chitin binding structural domain： Class I~ Class VII.Typical chitinase has a N-terminal signal peptide（signal peptide）, a catalysis knot Structure domain（catalytic domain）With the C-terminal domain existed only in vacuole chitinase（C-terminal extension）.Some chitinase N-terminal signal peptides contain one or more chitin binding domain for being rich in half Guang sweet acid （chitin-blinding domains, CBD）, in addition, there is a variable cross-linking zone between CBD and catalytic domain （flexible hinge region）（Yang Haixia, Deng Jianjun, Zhang Jian, the purifying of plant chitinases, measure and application is waited to grind Study carefully progress food industry science and technology, 2011,32 (6):431.）.

Chitinase continuously produces in vacuole and apoplast in the plant of health.The generation of chitinase is by more The induction of kind biology and abiotic component, including pathogen infection, wound, arid, cold, ozone, heavy metal, salt stress and purple Outer light etc..In arabidopsis（Arabidopsis thaliana）In, non-affine pathogen Xanthomonas campestris (Xanthomonas campestris) infect make the chitinase genes of Class IV in blade mRNA Rapid Accumulations (de A Gerhardt L B, Sachetto-Martins G, Contarini M G, et al.Arabidopsis thaliana class IV chitinase is early induced during the interaction with Xanthomonas campestrisFEBS Lett, 1997,419 (1):69.), beetBeta vulgarisInoculationCercospora beticolaAfterwards, the transcriptional level of the chitinase genes of Class IV rises.In addition, plant hormone ethylene（ethylene, ETH）, jasmonic（jasmonic acid, JA）, salicylic acid（salicylic acid, SA）Also the table of chitinase is induced Reach.Ethephon (CEPHA),2-(chloroethyl) phosphonic acid can be with the accumulation of inducing cucumber blade cell gap chitinase, and the effect and cucumber leaves of induction are to ethephon (CEPHA),2-(chloroethyl) phosphonic acid The impression of mass concentration is directly related.Use methyl jasmonate（methyl jasmonate, MeJA）Handle ginsengPanax ginsengC.A.Meyer, ginseng root system chitinase activity substantially increase compared with the control.Salicylic Acid acid treatment can lure Lead bananaMusa paradisiacaThe activity of chitinase and the up-regulated expression of chitinase gene.

Pseudo-ginseng (Panax notoginseng) it is Araliaceae Araliaceae PanaxesPanaxPlant, it is China's tradition name Your Chinese medicine, main product is in Yunnan mountain of papers area.Due to long-term plantation, the germ plasm resource of pseudo-ginseng is seriously degenerated, while disease also day Benefit is serious, especially fungal disease.Major Fungus Diseases are root rot, black rot, Northern leaf spot, phytophthora root rot and gray mold, pseudo-ginseng Loss extremely serious all caused by the harm of disease pest every year.Therefore, it is to ensure pseudo-ginseng crude drug to strengthen the pseudo-ginseng prevention and control of plant diseases, pest control One major measure of yield and quality.

The content of the invention

It is an object of the invention to provide pseudo-ginseng chitinase genePnCHI1New application, i.e., improve tobacco to grape seat Chamber bacterium（Botryosphaeria dothidea）And colletotrichum gloeosporioides Penz（Colletotrichum gloeosporioides）Resistance In application.

The present invention clones the chitinase gene with antifungal activity obtained from pseudo-ginsengPnCHI1Full-length genePnCHI1,PnCHI1Nucleotide sequence such as SEQ ID NO:Shown in 1, the long 1022bp of sequence, its ORF comprising a 822bp, The 5 ' of 26bp-non-translational region（untranslated region, UTR）And 174bp 3 '-UTR, coding one have 273 The protein of individual amino acid, protein sequence such as SEQ ID NO：Shown in 2.

Chitinase gene of the present inventionPnCHI1Code area be sequence table SEQ ID NO：27-848 positions institute in 1 The nucleotide sequence shown.

The global cDNA fragment of an antimycotic related gene for present invention separation clone pseudo-ginseng, passes through Agrobacterium tumefaciems (Agrobacterium tumefaciens) target gene is transferred to overexpression in recipient plant tobacco by mediation, and by entering Whether the one step experimental verification gene has antimycotic activity, is resisted for the later-stage utilization improvement of genes tobacco and other plant The ability of fungal disease lays the foundation.This unnamed gene is by inventorPnCHI1。

The present invention relates to separation to includePnCHI1DNA fragmentation and identify its function, the sequence of the gene is analyzed, ShowPnPGIPFull-length cDNA is 1022bp, 5 '-non-translational region of ORFs, 26bp comprising a 822bp (untranslated region, UTR) and 174bp 3 '-UTR, wherein ORF encode an egg with 273 amino acid White matter.BLASTp analysis showsPnCHI1Coded protein sequence and lettuce（Lactuca sativa）chitinase （ACX94236.1）, arabidopsis（Arabidopsis thaliana） class IV chitinase （NP_191010.1）, can Can（Theobroma cacao）chitinase（XP_007033803.1）, European Chinese white poplar（Populus trichocarpa） class IV chitinase（XP_006376418.1）And capsicum（Capsicum annuum）class IV chitinase （AJF11981.1）Homology is higher, respectively 74%, 73%, 72%, 71% and 70%.PnCHI1The protein sequence of coding has The conserved domain of CHI superfamilies, this shows its chitinase gene belonged in pseudo-ginseng.Overexpress sequence table SEQ ID NO： Sequence shown in 1 can strengthen resistance of the tobacco to grape seat chamber bacterium and colletotrichum gloeosporioides Penz.

The present invention is by pseudo-ginseng chitinase family genePnCHI1Apply and improving tobacco to grape seat chamber bacterium and glue spore charcoal In subcutaneous ulcer bacterium resistance, concrete operations are as follows：

（1）Using the total serum IgE of guanidine isothiocyanate method extraction pseudo-ginseng blade.Using the RNA of extraction as template, it is with oligo (dT) 18 Reverse transcription primer, pass through reverse transcriptase chain reaction (reverse transcription-polymerase chain Reaction, RT-PCR) amplifyPnCHI1Code area, it is subsequently attached on pMD-18T carriers, is had through sequencing The clone of target gene；

（2）Use restriction enzymeBamHI andEcoRI digestions pMD-18T-PnCHI1, target gene piece is obtained by glue reclaim Section, with same endonuclease digestion plant expression vector pCAMBIA2300s, glue reclaim obtain needed for carrier large fragment, then by institute ObtainPnCHI1Genetic fragment is connected with pCAMBIA2300s fragments, plant overexpression vector is built, afterwards by constructed weight Group carrier is expressed by Agrobacterium tumefaciens mediated be transferred in tobacco；

（3）Transformant is screened with the resistance marker having on recombinant vector T-DNA, and detects to obtain by PCR and RT-PCR Real transfer-gen plant, the inhibitory activity that analysis genetically modified plants albumen grows to fungi, is finally filtered out to fungus resistant The transfer-gen plant being remarkably reinforced.

The present invention provides a kind of new method to improve the resistance of plant against fungal disease, is trained by genetic engineering means Traditional breeding method can be overcome the shortcomings of by educating disease-resistant plants, and not only breeding cycle shortens, and simple to operate, is readily available Gao Kangcai Material.From pseudo-ginseng in the present inventionPnCHI1Gene can strengthen resistance of the plant to several disease funguses, by the channel genes cigarette In grass, antimycotic new varieties and new material can be produced.Resistance plant kind and material tool are cultivated using technique for gene engineering There are obvious advantage and the importance do not replaced.It can be not only that large-scale production crop, flowers, medicinal plant etc. provide It is convenient, the use of chemical pesticide is reduced, can also be that agricultural production is cost-effective, reduces environmental pollution, therefore the present invention has Wide market application foreground.

Brief description of the drawings

Fig. 1 is part in the present inventionPnCHI1The PCR testing results of transgene tobacco genomic DNA, wherein Marker are DL2000 DNA Marker (Dalian precious biology), by 2,000 bp, 1,000 bp, 750 bp, 500 bp, 250 bp and 100 DNA fragmentations of bp six form；Positive control is plasmid pGEM-T-PnCHI1Reacted for the PCR of template；WT is non-transgenic Tobacco (wild type, wild type) STb gene is the PCR that template is carried out；

Fig. 2 is some positive in the present inventionPnCHI1In transgene tobaccoPnCHI1The expression analysis result figure of transcriptional level, its Middle Marker is DL2000 DNA Marker (the precious biology in Dalian)；WT is that non-transgenic tobacco total serum IgE reverse transcription cDNA is template PCR primer；Positive control：Plasmid pGEM-T-PnCHI1For the PCR primer of template；

Fig. 3 is in the present inventionPnCHI1The fungistatic effect figure of transgene tobacco extracorporeal antifungal activity；It is wherein true in a, b diagram Bacterium is grape seat chamber bacterium, colletotrichum gloeosporioides Penz respectively；WT is the total protein of wild-type tobacco；Buffer is blank control, i.e., without egg White control (being used for the buffer solution for extracting albumen).

Embodiment

Below by drawings and examples, the present invention is further described, but the scope of the present invention is not limited in described Hold, method operating according to a conventional method unless otherwise specified in the present embodiment, the use of agents useful for same unless otherwise specified is normal Rule reagent or the reagent configured according to a conventional method.

Embodiment 1：PnCHI1Full length cDNA clone and sequence analysis

3 years raw sangqi ginseng blade extraction total serum IgEs are taken, with liquid nitrogen then sanchi leaf slice lapping is transferred in centrifuge tube, adopted into powder Total serum IgE is extracted with guanidine isothiocyanate method, uses reverse transcriptase M-MLV (promega) using total serum IgE as templated synthesis cDNA first Chain, reaction system and operating process are：5 μ g Total RNA are taken, sequentially add 50 ng oligo（dT）, 2 μ L dNTP （2.5mM each）, DEPC water to reaction volume be 14.5 μ L；It is cold on ice rapidly after 70 DEG C of min of heat denatured 5 after mixing But 5 min, 4 μ L 5 × First-stand buffer, 0.5 μ L RNasin are then sequentially added（200U）、1μL M-MLV （200U）, mix and centrifuge in short-term, 42 DEG C of h of warm bath 1.5,70 DEG C of 10 min of heating, terminating reaction after taking-up.The chains of cDNA first - 20 DEG C are placed in after synthesis to save backup.

Using the first chain cDNA of synthesis as template, amplifying target genesPnCHI1, upstream and downstream primer sequence used is respectively 5 ' CTTTCATAAAAATGGCAACCCTCA3 ' and 5 ' CCTAACATCTGAGGTTATCACCAGG3 '.Using Advantage^TM 2 PCR Enzyme（Clontech）Amplify target gene；PCR reaction conditions：95℃ 1 min；95 DEG C of 30 s, 61 DEG C 30 S, 72 DEG C of 50 s, 30 circulations；72℃ 5 min；Reaction system（10μL）For 1 μ L cDNA, 1 μ L10 × Advantage 2 PCR Buffer、0.5μL 50×dNTP Mix （10mM each）, 0.2 μ L forward primers（10μM）, 0.2 μ L reverse primers （10μM）、0.2μL Advantage 2 PCR Polymerase Mix、6.9μL PCR-Grade water；After PCR terminates, 5 μ L are taken to be used for agarose gel electrophoresis, to detect the specificity of amplified production and size.

Resulting PCR primer only has a DNA band, therefore directly carries out TA clones to PCR primer, and the kit used is pMD18-T vector kit（The precious biology in Dalian）, reaction system and operating process are：1.5 μ L PCR primers are taken, sequentially add 1 μL pMD18-T vector（50 ng/μL）With 2.5 μ L 2 × Ligation solution I, 16 DEG C are placed in after mixing overnight Reaction.Connection product is transferred in bacillus coli DH 5 alpha using heat-shock transformed method.Using containing ampicillin （Ampicillin, Amp）LB solid medium screening positive clones, select several single bacterium colonies, shake after bacterium with amplificationPnCHI1Special primer identify multiple cloning sites insertionPnCHI1Clone, the clone identified is sequenced, finally ObtainPnCHI1Full-length cDNA is 1022bp, passes through NCBI ORF finder（http:// www.ncbi.nlm.nih.gov/gorf/gorf.html）Analysis finds that it includes 822bp opening code-reading frame（See sequence List）,PnCHI1One protein containing 273 amino acid of coding,PnCHI1Its protein is about 29.36 k D, isoelectric point (p I) are about that the analysis results of 4.77, SignalP 4.1 showPnCHI1In signal peptide be present（1st ~ 21 ammonia Base acid residue）.In addition, PredictProtein forecast analysis is shownPnCHI1Encoding proteins matter is secretory protein, it is understood that there may be In apoplast.According to PredictProtein analysis results, alpha-helix in PnCHI1 albumen（α-helix）, beta sheet（β- strand）And random coil（Loop）Percentage is respectively 23.44%, 6.32% and 70.33%.

Embodiment 2：Plant overexpression vector is built

Using a small amount of extraction agent boxes of SanPrep pillar DNAs（Give birth to work in Shanghai）Extraction insertionPnCHI1Escherichia coli matter Grain pMD-18T-PnCHI1And plant expression vector pCAMBIA2300s plasmid, take 1 μ L be used for agarose gel electrophoresis with The integrality and concentration level of plasmid are extracted in detection；Use restriction enzymeBamHI（TaKaRa）WithEcoRI（TaKaRa）Point It is other to plasmid pMD-18T-PnCHI1Double digestion is carried out with pCAMBIA2300s（100 μ L systems）, reaction system and operating process For：Take 20 μ L pMD-18T-PnCHI1With pCAMBIA2300s plasmids, sequentially add 10 μ L 10 × K buffer, 4 μ LBamHI、6 μL EcoRI、60 μL ddH₂O, centrifuged in short-term after mixing, be placed in 37 DEG C of reaction overnights；By all digestion products points Electrophoresis is carried out in Ago-Gel, it is then rightPnCHI1Fragment and pCAMBIA2300s carriers large fragment carry out glue and returned respectively Receive, whole process uses SanPrep pillar DNA glue reclaim kits（Give birth to work in Shanghai）；1 μ L recovery products are taken to be coagulated by agarose The size and concentration of gel electrophoresis detection recovery fragment, are placed in -20 DEG C and save backup.

Utilize T4 DNA Ligase（TaKaRa）, by recoveryPnCHI1DNA fragmentation and pCAMBIA2300s carrier segments Connect, reaction system（20μL）It is with operating process：Take 10 μ LPnCHI1 DNA fragmentation sequentially adds 2 μ L PCAMBIA2300s carrier DNAs, 2 μ L 10 × T4 DNA Ligase Buffer, 1 μ L T4 DNA Ligase, 5 μ L ddH₂O, Centrifuged in short-term after mixing, then 16 DEG C of water-bath reaction overnights.Then connection product is transferred to by Escherichia coli using heat-shock transformed method In DH5 α, with containing 50mg/L kanamycins（Kanamycin, Km）Solid medium screening positive clone.Picking individual colonies Bacterium is shaken, is expanded by template of bacterium solutionPnCHI1Special primer enter performing PCR, pick outPnCHI1With pCAMBIA2300s successes The clone of connection, the bacterial strain detected are placed in -80 DEG C and saved backup if the positive, addition glycerine.

Using SanPrep pillar plasmid extraction kits（Give birth to work in Shanghai）Extract and purify in above-mentioned Escherichia coli pCAMBIA2300s-PnCHI1Plasmid.Frozen-thawed method is then used by the plant expression vector pCAMBIA2300s- of above-mentioned structurePnCHI1It is transferred in agrobacterium tumefaciens lba4404 competent cell.Operating procedure is：Take 2 μ g pCAMBIA2300s-PnCHI1 Plasmid is added in the centrifuge tube containing 200 μ L competent cells, the min of ice bath 5 after gently mixing, then continues at and 1 is freezed in liquid nitrogen Min, 37 DEG C of min of water-bath 5 are then immediately placed in, the min of ice bath 2,800 μ L LB Liquid Cultures of addition are based on 28 DEG C immediately afterwards The h of shaken cultivation 4.Agrobacterium after activation is applied on the LB solid mediums containing 50 mg/L Km, 28 DEG C of static gas wave refrigerators. Picking individual colonies shake bacterium, then with amplificationPnCHI1Specific primer enter performing PCR, detect pCAMBIA2300s-PnCHI1Whether It is transferred in Agrobacterium, being placed in -80 DEG C for positive colony, after addition glycerine saves backup.

Embodiment 3：Agriculture bacillus mediated Genetic Transformation in Higher Plants and genetically modified plants screening

The transgene receptor of this experiment is tobacco, by tobacco seed with 75% alcohol-pickled 30s, with being used after sterile water washing 0.1% HgCl₂Soak 8 min, then again with sterile water washing several times, be seeded on 1/2 MS culture mediums, 28 DEG C of light cultures 6d, illumination box is gone to after germination（25 DEG C, 16h/d illumination）, monthly use 1/2MS culture mediums subculture once later.

That preservation is taken out from -80 DEG C of refrigerators contains pCAMBIA2300s-PnCHI1The Agrobacterium LBA4404 bacterium of plasmid Kind, it is inoculated in the LB fluid nutrient mediums that 5 mL contain 50 mg/L Km and 20 mg/L rifampins, 28 DEG C of cultures are muddy to culture medium It is turbid.The muddy bacterium solutions of 1mL are drawn to the LB solid mediums containing 50mg/L Km, 28 DEG C of 48 h of culture；Then by LB solids Agrobacterium on culture medium scrapes to be inoculated in the MGL fluid nutrient mediums for the acetosyringone for being attached with 20 mg/L in right amount, 28 DEG C Shaken cultivation 2-3 h are to activate Agrobacterium.

Tobacco aseptic seedling leaf is taken to be cut into 1cm²The leaf dish of left and right, it is completely soaked in the above-mentioned MGL containing activation Agrobacterium In fluid nutrient medium, immerged time 15min, the bacterium solution of blade surface is blotted with aseptic filter paper, leaf dish is placed in co-cultivation base Upper carry out incubated at room temperature, the co-cultivation base of Transformation of tobacco is MS+0.02mg/L 6-BA+2.1 mg/L NAA+30 g/L Sucrose+6 g/L agar, co-culture 2 days under 22 DEG C of dark conditions.

Leaf dish after co-cultivation is gone into seedling differentiation in the MS screening and culturing mediums added with antibiotic, while screening transgenic Plant.Tobacco screening and culturing medium is MS+0.5mg/L 6-BA+0.1mg/L NAA+30g/L sucrose+6g/L agar+50mg/ L Km+200 mg/L cephalosporins（Cefotaxime sodium salt, Cef）；Blake bottle is transferred to light during screening and culturing According to incubator culture（25 DEG C, 16h/d illumination, 8h/d dark）, used after tobacco length budding and contain 50 mg/L Km and 200 mg/ L Cef MS culture medium squamous subcultures, because tobacco callus differentiation rate is higher, therefore need further to screen regeneration plant, Tobacco regrowth, which is moved on the MS culture mediums containing 50 mg/L Km, makes it take root, and is finally done from preferable regrowth of taking root Further detection.

Using the genomic DNA of CTAB methods extraction transgenic tobacco plant blade, 1 μ L are taken to lead to the genomic DNA of extraction Cross agarose gel electrophoresis and detect its integrality and concentration, expanded by template of the genomic DNA of transfer-gen plantPnCHI1 Special primer enter performing PCR, after PCR terminates, take 8 μ L products be used for agarose gel electrophoresis to detect positive transgenic plant, The amplification of Partial Tobacco transfer-gen plant as shown in figure 1,PnCHI1Transgene tobacco screens 47 plants of positive transgenics altogether Plant.

Embodiment 4：In transgene tobaccoPnCHI1Expression analysis and transfer-gen plant antifungal activity analysis

Take positive transgenic individual plant and non-transgenic tobacco（Wild type）Tender leaf extraction total serum IgE, reverse transcription generation cDNA the One chain, and expanded as templatePnCHI1Special primer enter performing PCR, according in each transgenosis individual plant of PCR interpretations of resultPnCHI1The expression of transcriptional level, Total RNAs extraction and RT-PCR method are in the same manner as in Example 1, after PCR terminates, take 5 μ L are used for agarose gel electrophoresis, and the testing result of part individual plant as shown in Fig. 2 detect in 30 transgenosis individual plants altogetherPnCHI1In transcriptional level great expression, the numbering of these individual plants is T1~T30.

Several fungies that laboratory preserves are inoculated in PDA solid mediums（200 g/L potatos, 15 g/L agar, 20 G/L glucose）On, 28 DEG C of light cultures, albumen is added when colony growth to diameter is about 2 ~ 3cm, analyze transfer-gen plant body Outer antifungal activity.In order to prevent albumen that other living contaminantses are extracted, whole vegetable protein extraction process is sterile behaviour Make, take 1 g transgene tobacco individual plants first（Numbering is respectively T2, T8, T14, T26）And wild-type leaves are put into mortar, add Enter 1mL protein extracts（1M NaCl, 0.1M sodium acetates, 1% PVP, pH6）, it is fully ground；It is transferred in 1.5 mL centrifuge tubes, 4 DEG C stand overnight after mixing, 4 DEG C of 30 min of centrifugation（12,000 g/min）, supernatant is taken in 1.5 new mL centrifuge tubes, and is taken In right amount total protein concentration is determined with UV detector.The total protein concentration of transgenosis and WT lines is adjusted to 0.2 μ G/ μ L, 20 μ L drops are then taken respectively on the aseptic filter paper of each fungi culture medium, except adding not on the flat board of each fungi With the total protein of transgenic tobacco plant, while the total protein of parallel addition wild-type tobacco and blank control（Extract albumen institute Solution）, the situation of each processing fungi growth is after a few days observed in 28 DEG C of cultures, and is evaluated accordinglyPnCHI1Transgene tobacco Extracorporeal antifungal activity, as a result as shown in figure 3,PnCHI1Transgene tobacco albumen is to grape seat chamber bacterium and colletotrichum gloeosporioides Penz Growth has very strong inhibitory action.

Sequence table

<110>Kunming University of Science and Technology

<120>Pseudo-ginseng chitinase gene PnCHI1 application

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 1022

<212> DNA

<213> Panax notoginseng

<220>

<221> mRNA

<222> (1)..(1022)

<220>

<221> 5'UTR

<222> (1)..(26)

<220>

<221> CDS

<222> (27)..(848)

<220>

<221> 3'UTR

<222> (849)..(1022)

<400> 1

ggacacaccc ttaatctttc ataaaaatgg caaccctcaa tataacaaac agcttaataa 60

caatacttct cgccggagta cttgccggag aattgataac agctcaagat tgtggttgca 120

ccgccgacct atgttgtagt cggtttggtt attgtggcaa cggcacagat tactgtggca 180

cagggtgcca aggtggtcca tgttacgcac caccaccgca aaacggtgtt tcggtttccg 240

atattgttac cgatggtttc tttaatggga ttattgatca agccgagtcg agttgtgccg 300

gaaaagggtt ctactcaagg gctgtttttc ttgaggctct taaatcttat ccttcgtttg 360

gtagggttgg tacggaagat gattctaaac gtgagattgc tgcttttttt gcccatgcta 420

ctcatgaaac tggacacttt tgctatatag aagagataaa cggtacatct agagactact 480

gtgatgaaac taacacacaa tatccatgcg taccaaataa ggcctactac ggccgaggcc 540

caattcaact ctcatggaat ttcaattatg ggccggccgg aaaaatcatc ggattcgatg 600

ggctaaataa tcctgaaatt gtggcccaag acccggttgt ttccttcaag acagccttgt 660

ggtactggat gaacaatgtt caatctgcca tagtttcggg ccaaggtttc ggggcaacca 720

ttcgggccat taacggggct cttgagtgtg atggtgcaaa cccggcaacg gttactaatc 780

gggtcaggta ttacaccgag tattgtaagc agattggtgt tttgcctggt gataacctca 840

gatgttagga gggcaaaatt gtaaggaagt gattgtaaca aataaaaggt ttcaccttta 900

ttattattta gctagcttta atagtatttg tccattactt gttatgtaat aaattcatta 960

atatcctaat aataataaag tgttttggtt tgtggattaa aaaaaaaaaa aaaaaaaaaa 1020

aa 1022

<210> 2

<211> 273

<212> PRT

<213> Panax notoginseng

<400> 2

Met Ala Thr Leu Asn Ile Thr Asn Ser Leu Ile Thr Ile Leu Leu Ala

1 5 10 15

Gly Val Leu Ala Gly Glu Leu Ile Thr Ala Gln Asp Cys Gly Cys Thr

20 25 30

Ala Asp Leu Cys Cys Ser Arg Phe Gly Tyr Cys Gly Asn Gly Thr Asp

35 40 45

Tyr Cys Gly Thr Gly Cys Gln Gly Gly Pro Cys Tyr Ala Pro Pro Pro

50 55 60

Gln Asn Gly Val Ser Val Ser Asp Ile Val Thr Asp Gly Phe Phe Asn

65 70 75 80

Gly Ile Ile Asp Gln Ala Glu Ser Ser Cys Ala Gly Lys Gly Phe Tyr

85 90 95

Ser Arg Ala Val Phe Leu Glu Ala Leu Lys Ser Tyr Pro Ser Phe Gly

100 105 110

Arg Val Gly Thr Glu Asp Asp Ser Lys Arg Glu Ile Ala Ala Phe Phe

115 120 125

Ala His Ala Thr His Glu Thr Gly His Phe Cys Tyr Ile Glu Glu Ile

130 135 140

Asn Gly Thr Ser Arg Asp Tyr Cys Asp Glu Thr Asn Thr Gln Tyr Pro

145 150 155 160

Cys Val Pro Asn Lys Ala Tyr Tyr Gly Arg Gly Pro Ile Gln Leu Ser

165 170 175

Trp Asn Phe Asn Tyr Gly Pro Ala Gly Lys Ile Ile Gly Phe Asp Gly

180 185 190

Leu Asn Asn Pro Glu Ile Val Ala Gln Asp Pro Val Val Ser Phe Lys

195 200 205

Thr Ala Leu Trp Tyr Trp Met Asn Asn Val Gln Ser Ala Ile Val Ser

210 215 220

Gly Gln Gly Phe Gly Ala Thr Ile Arg Ala Ile Asn Gly Ala Leu Glu

225 230 235 240

Cys Asp Gly Ala Asn Pro Ala Thr Val Thr Asn Arg Val Arg Tyr Tyr

245 250 255

Thr Glu Tyr Cys Lys Gln Ile Gly Val Leu Pro Gly Asp Asn Leu Arg

260 265 270

Cys

<210> 3

<211> 24

<212> DNA

<213>Artificial sequence

<400> 3

ctttcataaa aatggcaacc ctca 24

<210> 4

<211> 25

<212> DNA

<213>Artificial sequence

<400> 4

cctaacatct gaggttatca ccagg 25

Claims

A kind of 1. pseudo-ginseng chitinase genePnCHI1Tobacco is being improved to grape seat chamber bacterium（Botryosphaeria dothidea）, colletotrichum gloeosporioides Penz（Colletotrichum gloeosporioides）Application in resistance, the pseudo-ginseng chitin Matter enzyme genePnCHI1Nucleotide sequence such as SEQ ID NO:Shown in 1.