CN103937819B - A kind of lilium regale wilson glutathione S-transferase gene LrGSTL1 and application thereof - Google Patents

Abstract

The invention discloses a kind of lilium regale wilson disease-resistant gene <i>LrGSTL1</iGre atT.GreaT.GT and application thereof, is <i>LrGSTL1</iGre atT.GreaT.GT gene nucleotide series as SEQ? ID? shown in NO:1, coding Lambda class glutathione S-transferase, by functional genomics correlation technique, the present invention confirms that lilium regale wilson <i>LrGSTL1</iGre atT.GreaT.GT gene has the function improving plant fungal resistance, lilium regale wilson glutathione S-transferase gene <i>LrGSTL1</iGre atT.GreaT.GT of the present invention to be building up on plant expression vector and to proceed to overexpression in tobacco, transgene tobacco has very strong anti-mycotic activity, the transgenic tobacco leaf of expressing <i>LrGSTL1</iGre atT.GreaT.GT has obvious resistance to Fusarium oxysporum and infecting of Botrytis cinerea two kinds of pathogenic fungies.

Description

A kind of lilium regale wilson glutathione S-transferase gene LrGSTL1 and application thereof

Technical field

The present invention relates to a kind of lilium regale wilson glutathione S-transferase gene with anti-mycotic activity lrGSTL1and application, belong to molecular biology and genetically engineered relation technological researching field.

Technical background

Along with the continuous increase of world population, day by day increase the demand of grain, therefore improving grain yield is a problem in the urgent need to address.Farm crop are constantly subject to the infringement of various pathogenic micro-organism in growth and development process, accounted for more than 80% of the total disease of plant, and badly influenced the output of grain by fungus-caused disease.In addition, in all kinds of disease, the type of fungal disease is in the majority, and fungi can instruction plant any Organ and tissue and cause its morbidity.The traditional method of controlling plant diseases mainly uses chemical pesticide and cultivates resistant variety, although two kinds of methods all serve certain effect, also all there is serious drawback.A large amount of uses of chemical pesticide cause the severe contamination of environment, bring disadvantageous effect to human and livestock health; And conventional breeding exists the shortcomings such as the cycle is grown, wastes time and energy, the favorable variation of plant resources is few, make them fundamentally can not solve a difficult problem for Plant diseases.Along with foundation and the development of recombinant DNA technology, adopting molecular biological method to obtain the gene with anti-mycotic activity, and cultivated the farm crop with disease resistance by transgenic technology in a short time, is a kind of novel method improving disease resistance of plant.

During pathogenic agent instruction plant, plant resists the invasion of pathogenic micro-organism mainly through the expression of Analysis of Defence Genes Involved, allergy (hypersensitivityresponse, HR) and systemic acquired resistance (Sytemicacquiredresistance, SAR).Oxidative burst is one of early stage reaction of pathogenic infection plant, produces allergy subsequently and carries out self-defense.After oxidative burst, the growing amount of active oxygen (reactiveoxygenspecies, ROS) the class material in plant materials significantly increases, as super oxygen root negatively charged ion (O ^2-), hydroxide ion (HO ^-), (H such as hydroxyl radical free radical (-OH), hydrogen peroxide ₂o ₂).These active oxygens can injury protein matter, film fat and other cellular component, and causes oxidative damage to plant.In order to prevent the damage of active oxygen, plant is by glutathione S-transferase (glutathioneS-transferase, GSTs), superoxide-dismutase (superoxidedismutase, SOD), catalase (catalase, CAT), glutathione reductase (glutathionereductase, GR), Selenoperoxidase (glutathioneperoxidase, GPX) etc. is removed free radical in plant materials, thus is alleviated stress effect.

GSTs is extensively present in animal, plant, bacterium and fungi, and composition has the supergene family of different physiological roles.The soluble proteins of GST monomer to be molecular weight be 22-27kDa, mainly exists with the form of homology or heterodimer.Plant GSTs is divided into phi, tau, theta, zeta, lambda class and DHAR 6 class according to the amino-acid residue of the similarity of aminoacid sequence, the composition of gene and avtive spot.Wherein phi class and tau class are specific to plant.Gsh exists with the form of reductive glutathione (glutathione, GSH) usually under normal circumstances, and a small amount of exists with the form of Sleep-promoting factor B (GSSH).Sulphur atom on GSTs energy catalysis GSH and the partly conjugated combination of the second substrate electrophilic, produce composite advantageous soluble in water to excrete in them, thus eliminate the accumulation of toxic substance in the cells such as ROS, maintain the balance (ArmstongRN of born of the same parents' internal oxidition reduced state, 1997.Structure, catalyticmechanism, andevolutionoftheglutathionetransferases.ChemicalResearc hinToxicology, 10:2-18).The research of plant GST is started late, 1970 corn ( zeamays) middle Late Cambrian plant GST(EdwardsR, DixonDP, WalbotV.PlantglutathioneS-transferases:enzymeswithmultip lefunctionsinsicknessandinhealth.TrendsinPlantScience, 2000:193-198), after this tobacco ( nicotianatabacum), Arabidopis thaliana ( arabidopsisthaliana), wheat ( triticumaestivum), potato ( solanumtuberosum) etc. in succession find the GSTs with functionally active in crop.Due to GSTs involved in plant reply biotic and the defensive raction of abiotic stress, the gene clone of GSTs and be applied in agriculture production there is important value, and be day by day subject to people's attention.

GSTs plays an important role in plant resistant fungi is coerced.With late disease bacteria ( phytophthorainfestans) inoculation potato after, prp1-1the GST expressing quantity of coding significantly increases, and this albumen and indole-3-acetic acid react, show that indole-3-acetic acid can be used as regulator or the substrate participation disease resistance response (HahnK of GST, StrittmatterG.Pathogen-defensegeneprp1-1frompotatoencode sanauxinresponsiveglutathioneS-transferase.EurJBiochem.1 994,226:619-626).Corn inoculation India pyriform spore ( piriformosporaindica) after 10 days, plant root catalase (CAT), GST and superoxide-dismutase (SOD) activity improve 44 times, 92 times and 48 times respectively compared with control group, thus strengthen plant resistance of oxidation, and then improve the disease resistance (KumarM of corn, YadavV, TutejaN, JohriAK.Antioxidantenzymeactivitiesinmaizeplantscolonize dwith piriformosporaindica.Microbiology.2009,155:780-790).With plant hormone, weedicide, oxidative stress and Pseudoperonospora cubensis ( peronosporaparasitica) process Arabidopis thaliana, find atGSTF16under these process, equal up-regulated expression, shows atGSTF16certain effect (WagnerU is had in Arabidopis thaliana biotic and abiotic stress, EdwardsR, DixonDP, MauchF.ProbingthediversityoftheArabidopsisglutathioneS-t ransferasegenefamily.PlantMolBiol.2002,49:515-532).From infection anthrax bacteria ( colletotrichumdestructivum) Tobacco cDNA library in cloned 4 gst genes, tobacco inoculation anthrax bacteria after, nbGSTU1with nbGSTU3expression increase, gene constructed on the PVP virus vector of induced gene silence by these 4, find nbGSTU1the reticent susceptibility of tobacco plant to germ significantly increases, and shows gSTgene is at Resistance In Tobacco c.destructivumplay an important role in infection (DeanJD, GoodwinPH, HsiangT.InductionofglutathioneS-transferasegenesof nicotianabenthamianafollowinginfectionby colletotrichumdestructivumand c.orbiculareandinvolvementofoneinresistance.JournalofExperimentalBot any.2005,56:1525-1533).

Summary of the invention

The object of the invention is from lilium regale wilson ( liliumregalewilson) in, clone obtains the lambda class glutathione sulfurtransferase gene with anti-mycotic activity lrGSTL1, lrGSTL1nucleotide sequence as shown in SEQIDNO:1, the cDNA full length sequence of this gene is 1076bp, contain the open reading frame (openreadingframe of a 717bp, ORF), the 5 ' non-translational region of 22bp and the 3 ' non-translational region of 337bp, coding is containing 238 amino acid whose protein, and the aminoacid sequence of coding is as shown in SEQIDNO:2.

Lilium regale wilson glutathione S-transferase gene in the present invention lrGSTL1coding region be the nucleotide sequence shown in 23-739 position in sequence table SEQ IDNO:1.

Of the present invention lrGSTL1gene is from lilium regale wilson.Lilium regale wilson has another name called regallity, is Liliaceae lilium perennial herb bulbous plant, is the distinctive Lilium Germplasm of China, is distributed in Sichuan Minjiang River Basin.Lilium regale wilson has extremely strong resistance to fungi, virus and drought stress, is rare lily breeding for disease resistance genetic resources.

The present invention is separated and has cloned the global cDNA fragment of the antimycotic genes involved carried in lilium regale wilson, utilize agrobacterium tumefaciens to mediate goal gene to be proceeded in recipient plant and overexpression, and then verify whether this gene has anti-mycotic activity by experiment, the ability resisting fungal disease for this improvement of genes tobacco of later-stage utilization and other plant lays the foundation.This unnamed gene is by contriver lrGSTL1.

When plants by phytopathogenic fungi is coerced, active oxygen outburst in plant materials, GSTs catalysis GSH is combined with electrophilic compound, produce mixture soluble in water thus be conducive to electrophilic compound and excrete, thus reduce the level of toxic substance in the cells such as ROS, maintain the balance of born of the same parents' internal oxidition reduced state.In addition GSTs also has activity of glutathione peroxidase, thus plays an important role in Plant defense responses.

The present invention relates to separation lrGSTL1full-length cDNA fragment and identify its function, the plant with this gene fragment has the phenotype of resisting specific fungal infection to a certain extent.Wherein said DNA fragmentation is as shown in sequence table SEQ IDNO:1.Sequential analysis is carried out to this gene, finds lrGSTl1full-length cDNA is 1076bp, has the open reading frame of 717bp, the 5 ' non-translational region (untranslatedregion, UTR) of 22bp and the 3 ' UTR of 337bp, and coding is containing 238 amino acid whose protein. lrGSTL1proteins encoded has the conserved domain of GSTs family, with from banana ( musaacuminata), the GSTs albumen homology of the plant such as corn and paddy rice is higher, cluster analysis simultaneously will lrGSTL1be attributed to plant lambda class GSTs(GSTL), above-mentioned analytical results shows lrGSTL1belong to the lambda class gst gene in lilium regale wilson.Aminoacid sequence protein shown in overexpression sequence table SEQ IDNO:2 can strengthen tobacco to Botrytis cinerea ( botrytiscinerea), Fusarium oxysporum ( fusariumoxysporum) resistance of two kinds of pathogenic fungies.

Another object of the present invention is by lilium regale wilson glutathione S-transferase gene lrGSTL1be applied in and improve tobacco in Fusarium oxysporum, Botrytis cinerea resistance, concrete operations are as follows:

(1) acquisition of gene: adopt amplification lrGSTL1special primer, from inoculation Fusarium oxysporum after lilium regale wilson root extract total serum IgE, amplified by reverse transcriptase chain reaction (reversetranscription-polymerasechainreaction, RT-PCR) lrGSTL1full length coding region, be then connected on pMD-18T carrier, obtain through sequence verification and there is the clone of goal gene.

(2) plant expression vector construction and genetic transformation: use restriction enzyme ecor I He psti enzyme cuts pMD-18T- lrGSTL1plasmid, is reclaimed by glue and obtains goal gene fragment, and with same endonuclease digestion cleaving plant expression vector pCAMBIA2300S, glue reclaims and obtains required carrier large fragment; Subsequently goal gene fragment is connected with pCAMBIA2300S carrier large fragment, builds plant overexpression vector pCAMBIA2300s- lrGSTL1; By frozen-thawed method by pCAMBIA2300S- lrGSTL1plasmid imports in agrobacterium strains LBA4404; The genetic transformation utilizing agrobacterium tumefaciens to mediate will lrGSTL1import in tobacco and express; Positive transgenic plant is screened by antibiotic-screening, genomic dna PCR and RT-PCR.

(3) transfer-gen plant anti-mycotic activity is analyzed: get transfer-gen plant and WT lines (non-transgenic reference) blade, inoculate the spore suspension of different fungi respectively, detect the incidence of the rear transgenic leaf of inoculation, finally filter out the transfer-gen plant that fungus resistant is obviously strengthened.

The present invention is that the resistance strengthening plant against fungal disease provides a kind of novel method, and cultivate by genetic engineering means the deficiency that disease-resistant plants can make up traditional breeding method, not only breeding cycle is short, simple to operate, and easily obtains resistance plant.By from lilium regale wilson lrGSTL1express in channel genes tobacco, the novel material and new variety with antifungal property can be produced, and transgene tobacco has very strong anti-mycotic activity.Overexpression lrGSTL1transgene tobacco to Fusarium oxysporum, infecting of Botrytis cinerea, all there is obvious resistance.Utilize genetic engineering technique to cultivate and there is the plant variety of resistance thus the method for controlling plant diseases has significant advantage and irreplaceable importance.It can be provided convenience for the scale operation such as crop, flowers, and substantially reduce the number the use of chemical pesticide, reduces environmental pollution, can also be cost-saving for agriculture production, and therefore the present invention has wide market application foreground.

Accompanying drawing explanation

Fig. 1 is part in the present invention lrGSTL1the PCR detected result of transgene tobacco genomic dna, wherein Marker:DL2000DNAMarker (Dalian is precious biological), by 2,000bp, 1,000bp, 750bp, 500bp, 250bp and 100bp six DNA fragmentation compositions, positive control: with plasmid pMD-18T- lrGSTL1for the PCR primer of template; WT: be the PCR primer of template with non-transgenic tobacco (wild-type) STb gene;

Fig. 2 is that the present invention is positives lrGSTL1in transgene tobacco lrGSTL1the expression analysis result of transcriptional level, wherein Marker:DL2000DNAMarker (Dalian is precious biological); WT: non-transgenic tobacco total serum IgE reverse transcription cDNA is the PCR primer of template; Positive control: plasmid pMD-18T- lrGSTL1for the PCR primer of template; All the other swimming lanes are the different positives lrGSTL1transgene tobacco individual plant;

Fig. 3 is in the present invention lrGSTL1analysis of Resistance result after transgenic tobacco leaf and WT blade inoculation fungi, the fungi wherein scheming to inoculate in a, b is Botrytis cinerea and Fusarium oxysporum respectively; L-1, L-5, L-8, L-10, L-13 be 5 different lrGSTL1transgene tobacco individual plant, WT is non-transgenic tobacco individual plant.

Embodiment

Below by embodiment, the present invention is described in further detail, but content of the present invention is not limited thereto, method operating all according to a conventional method if no special instructions in the present embodiment, agents useful for same employing conventional reagent if no special instructions or the reagent configured according to a conventional method.

Embodiment 1: lrGSTL1the clone of full-length gene and sequential analysis

Inoculate lilium regale wilson with Fusarium oxysporum, extract total serum IgE with the root after inoculation 24h.With liquid nitrogen by after the root grind into powder of lilium regale wilson that processed, proceed in centrifuge tube, guanidine isothiocyanate method is adopted to extract total serum IgE, reversed transcriptive enzyme M-MLV (promega) is adopted to take total serum IgE as templated synthesis cDNA first chain, reaction system and operating process are: get 5 μ gTotalRNA, add 50ngoligo (dT) 15,2 μ LdNTP (2.5mMeach) successively, DEPC water to reaction volume is 13.5 μ L; After mixing, rapidly at cooled on ice 5min after 70 DEG C of heat denatured 5min, then 4 μ L5 × First-standbuffer, 0.5 μ LRNasin (200U), 1 μ LM-MLV (200U) is added successively, mixing is also centrifugal in short-term, 42 DEG C of temperature bath 1.5h, take out rear 70 DEG C of heating 10min, termination reaction, the synthesis of cDNA first chain is placed on-20 DEG C and saves backup.

With the first chain cDNA of synthesis for template, amplifying target genes lrGSTL1, upstream and downstream primer sequence used is 5 ' CAAGCAGTGGTATCAACGCAGAGT3 ' and 5 ' CACCACCTGTGAGACGATGAAGA3 '.Adopt Advantage ^tM2PCREnzyme (Clontech) amplifies goal gene.PCR reaction conditions: 94 DEG C of 2min; 94 DEG C of 30s, 62 DEG C of 30s, 72 DEG C of 1min, 30cycles; 72 DEG C of 5min.Reaction system (20 μ L) is 1 μ L first chain cDNA, 2 μ L10 × Buffer, 0.5 μ LdNTP (10mMeach), 0.3 μ L forward primer (10 μMs), 0.3 μ L reverse primer (10 μMs), 0.25 μ LAdvantage ^tM2PCREnzyme, 15.65 μ LPCR-GradeWater.After PCR terminates, get 5 μ L for agarose gel electrophoresis, detect specificity and the size of amplified production.

Gel electrophoresis display PCR primer is single specific band, therefore direct TA clone is carried out to PCR primer, the test kit used is pMD18-Tvectorkit (Dalian is precious biological), reaction system and operating process are: get 1.5 μ LPCR products, add 1 μ LpMD-18Tvector (50ng/ μ L) and 2.5 μ L2 × LigationsolutionI successively, mixing is placed in 16 DEG C of reaction overnight.Heat-shock transformed method is adopted to be proceeded in bacillus coli DH 5 alpha by connection product.With the LB solid medium screening positive clone containing X-Gal, IPTG, penbritin (ampicillin, Amp), select several white colonies, with increasing after shaking bacterium lrGSL1special primer identify multiple clone site insert lrGSTL1clone.The clone of qualification is checked order, final acquisition lrGSTL1full-length cDNA is 1076bp, is analyzed find that it comprises the ORF (see sequence table) of a 717bp by NCBIORFfinder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). lrGSTL1encode one containing 238 amino acid whose protein, the molecular weight of LrGSTL1 is about 27.28KDa, and iso-electric point is 5.21.SignalP3.0 analytical results shows lrGSTL1there is no signal peptide, and the protein positioning display LrGSTL1 that predicts the outcome may be positioned in chloroplast(id).

Embodiment 2: plant expression vector construction

Adopt extraction agent box (the raw work in Shanghai) the extraction insertion in a small amount of SanPrep pillar plasmid DNA lrGSTL1escherichia coli plasmid pMD-18T- lrGSTL1and the plasmid of plant expression vector pCAMBIA2300S, get 1 μ L for agarose gel electrophoresis with detect the integrity of extraction plasmid and concentration.With ecorI (TaKaRa) and psti (TaKaRa) is respectively to plasmid pMD-18T- lrGSTL1carry out double digestion (100 μ L system) with pCAMBIA2300S, reaction system and operating process are: get 20 μ LpMD-18T- lrGSTL1or pCAMBIA2300S plasmid, add 10 μ L10 × Hbuffer, 5 μ L successively ecoRi, 5 μ L psti, 60 μ LddH ₂o, centrifugal in short-term after mixing, be placed in 37 DEG C of reaction overnight.All digestion products points are carried out electrophoresis in sepharose, then right lrGSTL1fragment and pCAMBIA2300S large fragment carry out glue recovery respectively, and whole process uses SanPrep pillar DNA glue to reclaim test kit (the raw work in Shanghai).Get 1 μ L and reclaim product detects recovery fragment size and concentration by agarose gel electrophoresis.

Utilize T4DNALigase (TaKaRa), by what reclaim lrGSTL1dNA fragmentation and pCAMBIA2300S carrier segments couple together, and reaction system (20 μ L) and operating process are: get 10 μ L lrGSTL1gene fragment adds 2 μ LpCAMBIA2300S carrier DNAs, 2 μ L10 × T4DNALigaseBuffer, 1 μ LT4DNALigase, 5 μ LddH successively ₂o, centrifugal in short-term after mixing, be placed in 16 DEG C of metal bath reaction overnight.Then heat-shock transformed method is adopted to proceed in bacillus coli DH 5 alpha by connection product, with the solid medium screening positive clone containing 50mg/L kantlex (kanamycin, Km).Picking individual colonies shakes bacterium, with bacterium liquid for template amplification lrGSTL1special primer carry out PCR, pick out lrGSTL1the clone be successfully connected with pCAMBIA2300S, if the bacterial strain that detects is positive, adds 20% glycerine mixing and is placed on-80 DEG C and saves backup.

With the pCAMBIA2300S in SanPrep pillar plasmid extraction test kit (the raw work in Shanghai) the extraction also above-mentioned intestinal bacteria of purifying -LrGSTL1plasmid.Prepare the competent cell of Agrobacterium LBA4404 bacterial strain and be sub-packed in 1.5mL centrifuge tube, often pipe 200 μ L, liquid nitrogen flash freezer is placed on-80 DEG C and saves backup.Adopt frozen-thawed method by the plant expression vector pCAMBIA2300S-of above-mentioned structure lrGSTL1proceed in Agrobacterium LBA4404 competent cell.Operation steps is: get 200ngpCAMBIA2300S- lrGSTL1plasmid adds in the centrifuge tube containing 200 μ L competent cells, and ice bath 5min after mixing, then proceeds to freezing 1min in liquid nitrogen gently, then 37 DEG C of water-bath 5min are placed in rapidly, ice bath 2min immediately afterwards, adds 800 μ LLB liquid nutrient mediums, 28 DEG C of shaking culture 4h.Agrobacterium after activation is applied on the LB solid medium containing 50mg/LKm, 28 DEG C of static gas wave refrigerator.Select mono-clonal and shake bacterium, with amplification lrGSTL1special primer carry out PCR, detect pCAMBIA2300S- lrGSTL1whether proceed in Agrobacterium.For positive colony, add glycerine and be placed on-80 DEG C and save backup.

Embodiment 3: agriculture bacillus mediated Genetic Transformation in Higher Plants and transgenic plant screening

The transgene receptor of this experiment is tobacco, by tobacco seed with 75% alcohol-pickled 30s, with sterilized water washing after with 0.1% HgCl ₂surface sterilization 8min, and then wash several times with sterilized water, be seeded on 1/2MS substratum, 28 DEG C of light culture 5-8d, go to illumination box (25 DEG C, 16h/d illumination) after germination, monthly use 1/2MS substratum subculture once later.

That from-80 DEG C of refrigerators, takes out preservation contains pCAMBIA2300S -LrGSTL1the Agrobacterium LBA4404 bacterial classification of plasmid, be inoculated in 5mL and contain in the LB liquid nutrient medium of 50mg/LKm and 20mg/L Rifampin, 28 DEG C are cultured to muddiness.The bacterium liquid drawing 1mL muddiness, to containing on the LB solid medium of 50mg/LKm, cultivates 48h for 28 DEG C.Scraped by Agrobacterium on LB solid medium in the MGL liquid nutrient medium be inoculated in right amount containing 20mg/L Syringylethanone, 28 DEG C of shaking culture 2-3h are to activate Agrobacterium.

Get tobacco aseptic seedling tender leaf and be cut into 1cm ²the leaf dish of left and right, is soaked in completely in the above-mentioned MGL liquid nutrient medium containing activation Agrobacterium, contaminates 15min.Blot the bacterium liquid of leaf panel surface with aseptic filter paper, leaf dish to be arranged on Transformation of tobacco Dual culture base and in 22 DEG C of light culture 2 days.Dual culture base is MS+0.02mg/L6-BA+2.1mg/LNAA+30g/L sucrose+6g/L agar.

Leaf dish after Dual culture is forwarded to and is added with seedling differentiation in antibiotic MS screening culture medium, simultaneously screening transgenic plant.Screening culture medium is MS+0.5mg/L6-BA+0.1mg/LNAA+30g/L sucrose+6g/L agar+50mg/LKm+200mg/L cephamycin (cefotaximesodiumsalt, Cef); During screening and culturing, culturing bottle is transferred to illumination box (25 DEG C, 16h/d illumination, 8h/d dark).With the MS substratum succeeding transfer culture containing 50mg/LKm and 200mg/LCef after leaf dish sprouts, because tobacco callus differentiation rate is higher, therefore need to screen further regeneration plant, being moved to by tobacco regrowth on the MS substratum containing 50mg/LKm makes it take root, the detection that good regrowth of finally selecting to take root carries out below.

Adopt CTAB method to extract the genomic dna of transgenic tobacco plant blade, get 1 μ L genomic dna and detect its integrity and concentration by agarose gel electrophoresis.With the genomic dna of transfer-gen plant for template amplification lrGSTL1special primer carry out PCR.After PCR terminates, get 8 μ L products for agarose gel electrophoresis to detect positive transgenic plant.The amplification of partial transgenic tobacco plant as shown in Figure 1, lrGSTL1transformation of tobacco screens 62 strain positive transgenic plant altogether.

Embodiment 4: in transgene tobacco lrGSTL1expression analysis and transfer-gen plant anti-mycotic activity analyze

Random choose 30 strain positive transgenic individual plant and a strain non-transgenic tobacco (wild-type, WT), get tender leaf respectively and extract total serum IgE, reverse transcription generates the first chain cDNA, and increases as template lrGSTL1special primer carry out PCR, according in each transgenosis individual plant of RT-PCR interpretation of result lrGSTL1the expression of transcriptional level.Method and the step of Total RNAs extraction and RT-PCR are in the same manner as in Example 1, and after PCR terminates, get 8 μ L for agarose gel electrophoresis, the detected result of part individual plant as shown in Figure 2.Detect altogether in 16 strain transgenosis individual plants lrGSTL1have expression at transcriptional level, these plant are numbered 1 ~ 16 respectively.

Several pathogenic fungies that laboratory is preserved are inoculated in PDA solid medium (200g/L potato, 15g/L agar, 20g/L glucose) on, be inverted light culture 6 days for 28 DEG C, with sterilized water, conidium is eluted from substratum, after blood counting chamber counting, conidiospore suspension is diluted to 10 ⁶individual spore mL ^-1concentration, for inoculating tobacco leaf to analyze the anti-mycotic activity of transfer-gen plant.7 kinds are had for examination fungi: grape seat chamber bacterium ( botrosphaeriadothidea), Fusarium oxysporum ( fusariumoxysporum), Phomopsis ( phomopsissp.) fungi, Alternaria ( alternariasp.) fungi, Botrytis cinerea ( botrytiscinerea), colletotrichum gloeosporioides Penz ( colletorichumgloeosporioides), beading gibberella ( gibberellamoniliformis).Get the young leaflet tablet of different transgenic line and WT, after injured process, inoculating spores suspension 20 μ L, is laid in postvaccinal tobacco leaf on wet filter paper, is placed in 28 DEG C of incubator 3-5 days, observe the occurring degree of the rear tobacco leaf of fungi inoculation afterwards, and evaluate accordingly lrGSTl1the anti-mycotic activity of transgene tobacco.Result as shown in Figure 3, lrGSTL1transgene tobacco has obvious restraining effect to the pathogen of Botrytis cinerea, infecting of Fusarium oxysporum.

Sequence table (SEQID)

<110> Kunming University of Science and Technology

<120> lilium regale wilson glutathione S-transferase gene lrGSTL1and application

<160>4

<170>PatentInversion3.5

<210>1

<211>1076

<212>DNA

<213>Liliumregale

<220>

<221>gene

<222>(1)..(1076)

<220>

<221>5'UTR

<222>(1)..(22)

<220>

<221>CDS

<222>(23)..(739)

<220>

<221>3'UTR

<222>(740)..(1076)

<400>1

acatggggaacaacattcatccatggcggcgctcacccttagtccacacctgcctcagcc60

cctgactgccagctccgatccgcctccgatcttcgacgggactacccggttgtatatatc120

ttacatttgcccgttcgtacaacggacatggattgccaggaactataagggattgcaaga180

taagattgagttggtgccgattgatctgcaagataggccggtttggtataaggagaaggt240

ttaccccgagaataaggtgccctctttggagcataacaacaaagtcaagggagagagcct300

agatttgctcaagtacattgatgaaaatttcgaaggccctgcattacttccaaatgatcc360

tgcaaagcaaaagtttgcagaggagcttttgtcatacacagatcacttcactagaataat420

gtttcctgcgataatgtctaaagctgatctgggggatgaaatttattctgctttcgataa480

actagaagaagccctttcaaaattcgatgatggccctttcttcttgggacagtttagcct540

ggttgatatagcatatgcaccatttatcgaaaggtttcaaactttgtttttggatgtgaa600

aagctttgacattactaagggcaggccgaagttggcaacatggattgaggagttgaacaa660

gattgatagctactcacagaccaaactggatccacaagagctacttgctcacagtaagaa720

gcgactggggatcgcatgaagtcttcatcgtctcacaggtggtgcgaatgtgagttctcg780

agaacactagcatgatactgcaataaaatggtgtccctggcattgccagagccaattcgg840

acatcatcagttgatttatattttgtacttgttaaagttgatggcctttgtttgaagtat900

taagttgtggactatccaacagtgtgtatttagagtatgataactgtttcttactggtta960

tgtgttaaaaggttatgtattccttttctctattgtatgtcccctatctctaaaacactc1020

gagcaatcatacataaccgagattcttcagaaaaaaaaaaaaaaaaaaaaaaaaaa1076

<210>2

<211>238

<212>PRT

<213>Liliumregale

<400>2

MetAlaAlaLeuThrLeuSerProHisLeuProGlnProLeuThrAla

151015

SerSerAspProProProIlePheAspGlyThrThrArgLeuTyrIle

202530

SerTyrIleCysProPheValGlnArgThrTrpIleAlaArgAsnTyr

354045

LysGlyLeuGlnAspLysIleGluLeuValProIleAspLeuGlnAsp

505560

ArgProValTrpTyrLysGluLysValTyrProGluAsnLysValPro

65707580

SerLeuGluHisAsnAsnLysValLysGlyGluSerLeuAspLeuLeu

859095

LysTyrIleAspGluAsnPheGluGlyProAlaLeuLeuProAsnAsp

100105110

ProAlaLysGlnLysPheAlaGluGluLeuLeuSerTyrThrAspHis

115120125

PheThrArgIleMetPheProAlaIleMetSerLysAlaAspLeuGly

130135140

AspGluIleTyrSerAlaPheAspLysLeuGluGluAlaLeuSerLys

145150155160

PheAspAspGlyProPhePheLeuGlyGlnPheSerLeuValAspIle

165170175

AlaTyrAlaProPheIleGluArgPheGlnThrLeuPheLeuAspVal

180185190

LysSerPheAspIleThrLysGlyArgProLysLeuAlaThrTrpIle

195200205

GluGluLeuAsnLysIleAspSerTyrSerGlnThrLysLeuAspPro

210215220

GlnGluLeuLeuAlaHisSerLysLysArgLeuGlyIleAla

225230235

<210>3

<211>24

<212>DNA

<213> artificial sequence

<400>3

caagcagtggtatcaacgcagagt24

<210>4

<211>23

<212>DNA

<213> artificial sequence

<400>4

caccacctgtgagacgatgaaga23

Claims (3)

1. a lilium regale wilson glutathione S-transferase gene lrGSTL1, it is characterized in that: its nucleotide sequence as shown in SEQIDNO:1, the protein of as shown in the SEQIDNO:2 aminoacid sequence of encoding.

2. lilium regale wilson glutathione S-transferase gene described in claim 1 lrGSTL1raising tobacco to the application in Fusarium oxysporum, Botrytis cinerea resistance.

3. lilium regale wilson glutathione S-transferase gene according to claim 2 lrGSTL1application, it is characterized in that the concrete operations of fungal resistance improving tobacco are as follows:

(1) by above-mentioned glutathione S-transferase gene lrGSTL1be connected with plant overexpression vector pCAMBIA2300S, build recombinant vectors;

(2) recombinant vectors of above-mentioned structure is proceeded in tobacco by Agrobacterium tumefaciens mediated;

(3) screen transformant by kantlex, and adopt amplification lrGSTL1special primer carry out polymerase chain reaction and obtain real transfer-gen plant, get the blade inoculation fungi of different transgenic line, and detect the occurring degree of transgenic tobacco leaf, finally filter out the transfer-gen plant that fungus resistant is obviously strengthened.