CN107312761A

CN107312761A - A kind of AsCpf1 mutant proteins, encoding gene, recombinant expression carrier and preparation method and application

Info

Publication number: CN107312761A
Application number: CN201710586386.2A
Authority: CN
Inventors: 不公告发明人
Original assignee: Jiangsu Pu Bo Biological Technology Co Ltd
Current assignee: Jiangsu Pu Bo Biological Technology Co Ltd
Priority date: 2017-07-18
Filing date: 2017-07-18
Publication date: 2017-11-03
Anticipated expiration: 2037-07-18
Also published as: CN107312761B

Abstract

The invention discloses a kind of AsCpf1 mutant proteins, encoding gene, recombinant expression carrier and preparation method and application.The AsCpf1 mutant proteins are the protein of the amino acid sequence composition shown in sequence 1；Its encoding gene is the DNA molecular shown in sequence 2；Recombinant expression carrier containing the encoding gene is to enter performing PCR amplification with the AsCpf1 (S589Q/P711T) shown in sequence 2 for template design primer, then the PCR primer of purifying is obtained between the multiple cloning sites NcoI and XhoI of seamless cloning process insertion pET15b carriers；The AsCpf1 mutant proteins and its encoding gene, recombinant expression carrier of the present invention can be used for gene editing primary T cells PD 1.It can realize that primary T cells PD's 1 strikes drop using the AsCpf1 mutant proteins of the present invention, be that the genes of gene editing T cell PD 1 and cancer immunotherapy lay the first stone.

Description

A kind of AsCpf1 mutant proteins, encoding gene, recombinant expression carrier and its preparation side Method and application

Technical field

The invention belongs to Biochemistry and Molecular Biology technical field, and in particular to a kind of AsCpf1 mutant proteins, Encoding gene, recombinant expression carrier and preparation method and application.

Background technology

Gene editing is a kind of technology accurately modified in genomic level, can complete gene site-directed delete and dash forward Change, gene site-directed insertion mutation, many site simultaneous mutations and small fragment delete mistake etc..Gene editing technology can be used for gene function And disease pathogenesis research, structure disease animal model, biological therapy, heredity and tumor-related illness research, integration virus Disease research and improvement farming animals herd species.CRISPR-Cas9 is after " zinc finger endonuclease (ZFN) ", " class activating transcription factor The third generation genome fixed point editing technique occurred after effector nuclease (TALEN) ".

AsCpf1 (Acidaminococc μ s sp.Cpf1) is a kind of V-type CRISPR-Cas9 intra-system handoffs of RNA mediations Enzyme, in the presence of single-stranded crRNA (CRISPR RNA), AsCpf1 recognizes the 5 '-TTTN-3 ' PAM of double-stranded DNA (protospacer adjacent motif), and in the 18th base and incomplementarity chain with crRNA complementary strands of double-stranded DNA The 23rd base at DNA is cut.Compared with CRISPR-Cas9 gene editing systems, CRISPR-AsCpf1 systems tool TracrRNA (trans-activating crRNA), cutting targeting DNA efficiency highs, cutting is not needed to produce cohesive end etc. Feature, is the potential, instrument available for eukaryotic gene group editor.

PD-1 (programmed death 1), programmed death acceptor is a kind of important immunosuppression molecule, is CD28 superfamily members, are initially to clone to come from the mouse Tcell hybridoma 2B4.11 of apoptosis.It is used as cancer immunotherapy Important target spot, the immunological regulation using the PD-1 genes of gene editing T cell as target spot is to antitumor, anti-infective, anti-autoimmunity Property disease and organ transplant survival etc. have important meaning.

The content of the invention

An object of the present invention is to provide a kind of AsCpf1 mutant proteins, the PD-1 genes available for editor's T cell.

To achieve the above object, the AsCpf1 mutant proteins that the present invention is provided, its amino acid sequence such as SEQ ID NO：1 It is shown.

The second object of the present invention is to provide a kind of restructuring AsCpf1 gene mutation bodies, and carrying out structure to AsCpf1 genes changes Make, available for encoding above-mentioned AsCpf1 mutant proteins.

To achieve the above object, a kind of restructuring AsCpf1 gene mutation body AsCpf1 (S589Q/ that the present invention is provided P711T), its nucleotide sequence such as SEQ ID NO：Shown in 2.AsCpf1 (S589Q/P711T) is close to the progress of AsCpf1 genes Numeral optimizes, and two amino acid sites (S598Q and P711T) mutation in wild type AsCpf1 is obtained.

The third object of the present invention is to provide a kind of recombinant expression carrier of the AsCpf1 gene mutation bodies containing restructuring.

To achieve the above object, the recombinant expression carrier pET15b-AsCpf1 (S589Q/P711T) that the present invention is provided, be With SEQ ID NO：AsCpf1 (S589Q/P711T) shown in 2 enters performing PCR amplification for template design primer, then by the PCR of purifying Product is inserted with seamless cloning process to be obtained between the multiple cloning sites NcoI and XhoI of pET15b carriers.

The fourth object of the present invention is to provide the preparation method of AsCpf1 mutant proteins, and the AsCpf1 for obtaining high-purity dashes forward Misfolded proteins.

To achieve the above object, the preparation method for the AsCpf1 mutant proteins that the present invention is provided, comprises the following steps：

1. the structure of AsCpf1 mutant protein prokaryotic expression carriers is encoded：With the AsCpf1 (S589Q/P711T) of synthesis Genomic DNA is template, expands AsCpf1 (S589Q/P711T) coded sequence with PCR method, obtained PCR primer is entered Row purifying, between multiple cloning sites NcoI and XhoI that pET15b carriers are inserted with seamless cloning process, obtains recombination expression and carries Body, it is all correct through sequence verification reading frame and DNA sequence dna, i.e., successfully construct the protokaryon of the AsCpf1 gene mutation bodies containing restructuring Expression vector, is named as pET15b-AsCpf1 (S589Q/P711T)；

2. the expression of AsCpf1 mutant proteins：Prokaryotic expression carrier pET15b-AsCpf (S589Q/P711T) is transferred to Expressive host bacterium Escherichiacoli BL21 (DE3), picking monoclonal is seeded to fresh ampicillin containing 50mg/l LB culture mediums, through 37 DEG C of shaking table cultures to OD₆₀₀For 0.6, the final concentration of 0.6mM of addition IPTG induction AsCpf1 (S589Q/ P711T expression)；

3. the purifying of AsCpf1 mutant proteins：The cell of one liter of zymotic fluid is collected, and with the Buffer A of 40ml ice baths It is resuspended, ice-bath ultrasonic cell lysis, centrifuging and taking supernatant, supernatant passes through Ni-IDA posts；Loading is finished is washed with 50ml Buffer E Ni-IDA posts；50ml Buffer G elute Ni-IDA posts, are in charge of collection；The destination protein being eluted to is crossed into CM ion columns； 100ml Buffer D wash CM ion columns；10ml Buffer B elute CM ion columns, are in charge of collection；It is soft using specialty analysis Part Grab-it 2.5 analyzes TAT-As-cpf1 purity of protein；The AsCpf1 (S589Q/P711T) of elution is saturating by albumen after merging Analysis is to 20mM Tris, in 50mM NaCl pH7.5,20%glycerol；Wherein, Buffer A composition is：20mM Tris- HCl, 50mM NaCl, 1%Triton-100,20%glycerol pH7.5；Buffer E composition is：20mM Tris-HCl PH7.5,2M NaCl, 0.1%TritonX-100,20%glycerol；Buffer G composition is：20mM Tris-HCl PH7.5,50mM NaCl, 0.1%TritonX-100,500mM imidazoles, 20%glycerol；Buffer D composition is：20mM Tris-HCl pH7.5,50mM NaCl, 0.1%TritonX-100,20%glycerol；Buffer B composition is：20mM Tris-HCl pH7.5,50mM NaCl, 0.1%TritonX-100,20%glycerol.

The present invention is carried AsCpf1 (S589Q/P711T) gene clonings of codon optimization to pET15b by vector construction In body, AsCpf1 (S589Q/P711T) expressing quantities in Escherichia coli can reach 18%, solubility under cryogenic Reach 95%.

The fifth object of the present invention is to provide AsCpf1 mutant proteins, restructuring AsCpf1 gene mutation bodies and recombination expression Application of the carrier in terms of gene editing primary T cells PD-1.

The sixth object of the present invention is to provide AsCpf1 mutant protein editor's primary T cells PD-1 method, can more have Effect, easily editor's primary T cells PD-1 gene.

Specifically include following steps：

(1) primary T cells PD-1 Gene Partials sequence amplification

Primary T cells PD-1 genomic DNAs using extraction is templates, and PCR is expanded and reclaimed amplified fragments, PCR amplifications institute It is with forward primer：5’-ACTCCCCAGACAGGCCCTG-3’(SEQ ID NO：6), reverse primer is：5’- CAGGGGCTGGCCGGTGCG-3’(SEQ ID NO：7)；PCR reaction systems are：Genomic DNA template 100ng, 20 μM of forward directions Primer 1 μ l, 20 μM of μ l of 1 μ l, 2X Ultra Pfu Mix of reverse primer 25, plus ddH₂O to the μ l of cumulative volume 50；PCR reaction conditions For：94 DEG C of thermal denaturations 5 minutes, 56 DEG C are annealed 30 seconds, and 72 DEG C extend 1 minute, and 30 circulations are carried out altogether；

(2) AsCpf1 mutant proteins In vitro digestion PD-1

Take 1 μ g steps (1) reclaim PD-1 products, 1 μ l purifying AsCpf1 mutant proteins, 1 μ g synthesis crRNA, 2 μ l 10*Reaction Buffer, are configured to after 20 μ l In vitro digestion reaction systems, 37 DEG C of water-bath 30min, and 2% agarose coagulates Gel electrophoresis detection cutting；Wherein 10*Reaction B μ ffer composition is：500mM KAc, 200mM Tris- acetic acid, 100mM Mg(Ac)₂、1mg/ml BSA pH7.9@25℃；

(3) Western Blotting detect after AsCpf1 mutant proteins processing primary T cells that PD-1 expressions become Change

Take 1 × 10⁶Individual primary T cells PD-1, adds the AsCpf1 mutant proteins of 20 μ g purifying, 10 μ g synthesis CrRNA mixes ice bath, and electric conversion instrument, which is clicked on to spread after conversion, extracts albumen after 6 orifice plates, 72h, Western Blotting detections PD- 1 protein expression level changes.

The AsCpf1 mutant proteins cutting efficiency that present invention purifying is obtained is high, the tracrRNA that cutting need not be complicated, It is easy to operate, it is cost-effective；It is found that two new PD-1 gene editings sites；It can be realized using AsCpf1 mutant proteins Primary T cells PD-1's strikes drop, is that gene editing T cell PD-1 genes and cancer immunotherapy lay the first stone.

Brief description of the drawings

Fig. 1 is recombinant expression carrier pET15b-AsCpf1 (S589Q/P711T) plasmid map；

Fig. 2 is the SDS-PAGE analyses for recombinating AsCpf1 (S589Q/P711T) protein expression：Swimming lane M is albumen marker (KD) before, swimming lane 1 is IPTG inductions, swimming lane 2 and 3 is that the whole bacterial protein of AsCpf1 (S589Q/P711T) after IPTG is induced is expressed；

Fig. 3 is the AsCpf1 (S589Q/P711T) of Ni-IDA posts after purification SDS-PAGE (13%) analyses：Swimming lane 1：It is super Sound supernatant；Swimming lane 2：Outflow；Swimming lane 3：50mM imidazoles is eluted；Swimming lane 4：500mM imidazoles elution 1；Swimming lane 5：500mM imidazoles is eluted 2；Swimming lane 6：Residual；Swimming lane M is albumen marker (KD)；

Fig. 4 is the AsCpf1 (S589Q/P711T) of CM posts after purification SDS-PAGE (13%) analyses：Swimming lane 1：Ni-IDA Purify AsCpf1 (S589Q/P711T)；Swimming lane 2：CM flows out；Swimming lane 3：CM elutions 1；Swimming lane 4：CM elutions 2；Swimming lane 5：CM is eluted 3；Swimming lane 6：Residual；Swimming lane M is albumen marker (KD)；

Fig. 5 is that the AsCpf1 (S589Q/P711T) of purifying and wild type AsCpf1 (WT) cleavage activity in vitro contrast (external The greedy copper bacterium copR genetic fragments of cutting)：

Swimming lane M：DL2000；Swimming lane 1：copR+AsCpf1(WT)；Swimming lane 2：copR+crRNA；Swimming lane 3：copR+AsCpf1 (WT)+crRNA；Swimming lane 4：copR+AsCpf1(S589Q)+crRNA；Swimming lane 5：copR+AsCpf1(P117T)+crRNA；Swimming lane 6：copR+AsCpf1(S589Q/P711T)+crRNA；

Fig. 6 is AsCpf1 (S589Q/P711T) the In vitro digestions PD-1 of purifying：Swimming lane M is DNA marker (DL2000)； Swimming lane 1：PD-1+AsCpf1(S589Q/P711T)；Swimming lane 2：PD-1+AsCpf1(S589Q/P711T)+crRNA1；Swimming lane 3： PD-1+AsCpf1(S589Q/P711T)+crRNA2；Swimming lane 4：PD-1+AsCpf1(S589Q/P711T)+crRNA3；

Fig. 7 is that AsCpf1 (S589Q/P711T) is handled after primary T cells, Western Blotting detection PD-1 expression Level：

Swimming lane 1：Con groups 1 (primary T cells are without any processing)；Swimming lane 2：Con groups 2 (primary T cells+shock treatment)； Swimming lane 3：Con groups 3 (primary T cells+AsCpf1 (S589Q/P711T)+shock treatment)；Swimming lane 4：CrRNA1 (primary T cells+ AsCpf1 (S589Q/P711T)+crRNA1+ shock treatments)；Swimming lane 5：CrRNA2 (primary T cells+AsCpf1 (S589Q/ P711T)+crRNA2+ shock treatments)；Swimming lane 6：CrRNA3 (primary T cells+AsCpf1 (S589Q/P711T)+crRNA3+ electricity Hit processing).

Embodiment

Below in conjunction with the accompanying drawings and specific embodiment to invention be described in further detail.

Experimental method used is conventional method unless otherwise specified in following examples.

Material, reagent used etc., unless otherwise specified, are commercially obtained in following examples.

Embodiment 1：AsCpf1 optimization design and synthesis

Sequence first to wild type AsCpf1 carries out following optimize：

5 ' ends add cell-penetrating peptide TAT coded sequences, and coded sequence is TACGGTCGTAAAAAACGTCGTCAGCGTCGTCGT (SEQ ID NO：3).

3 ' ends add nuclear localization sequence (NLS), and coded sequence is：AAAAGGCCGGCGGCCACGAAAAAGGCCGGCCAGG CAAAAAAGAAAAAGGGATCC(SEQ ID NO：4).

3 ' ends add 6*His sequence labels, and coded sequence is：CATCATCATCATCATCAC(SEQ ID NO：5).

Two amino acid sites in wild type AsCpf1 are mutated again：S598Q and P711T.

AsCpf1 genes carry out full genome synthesis after codon optimization, and commission Shanghai JiMa pharmacy Technology Co., Ltd closes Into being named as AsCpf1 (S589Q/P711T).The AsCpf1 (S589Q/P711T) of synthesis nucleotide sequence such as SEQ ID NO：Shown in 2.

Embodiment 2：Prokaryotic expression carrier pET15b-AsCpf1 (S589Q/P711T) structure

AsCpf1 (S589Q/P711T) genomic DNAs using synthesis expand AsCpf1 as template with PCR method (S589Q/P711T) coded sequence, the forward primer of design is：

5’-GTTTAACTTTAAGAAGGAGATATACCATGTACGGTCGTAAAAAACGTCGTCAGCGTCGTCGTACAC AGTTCGAGGGCTTTAC-3’(SEQ ID NO：6)

Reverse primer is：

5’-TCGGGCTTTGTTAGCAGCCGGATCCTCGAGTTAGTGATGATGATGATGATGG-3’(SEQ ID NO： 7)

PCR reaction systems are：AsCpf1 (S589Q/P711T) template 50ng of synthesis, the μ l of forward primer (20 μM) 1, instead To the μ l of 1 μ l, 2X Ultra Pfu Mix of primer (20 μM) 25, plus ddH₂O to the μ l of cumulative volume 50；

PCR amplification conditions are：94 DEG C of thermal denaturations 5 minutes, 60 DEG C are annealed 30 seconds, and 72 DEG C extend 5 minutes, carry out 30 altogether and follow Ring.

Obtained PCR primer is purified, pET15b carriers (being purchased from Novagen companies) are inserted with seamless cloning process Multiple cloning sites NcoI and XhoI between, obtain recombinant expression carrier.DNA sequencing is carried out to recombinant expression carrier, it is analyzed The correctness of reading frame and coded sequence.

By AsCpf1 (S589Q/P711T) gene clonings of codon optimization into pET15b carriers, recombinant plasmid is through life Work bioengineering (Shanghai) limited company sequence verification, reading frame and DNA sequence dna are all correct, i.e., successfully construct containing weight The prokaryotic expression carrier of group AsCpf1 gene mutation bodies, is named as pET15b-AsCpf1 (S589Q/P711T), its sketch referring to Fig. 1.

Embodiment 3：The expression and purifying of AsCpf1 mutant proteins

(1) expression of AsCpf1 mutant proteins

Prokaryotic expression carrier pET15b-AsCpf (S589Q/P711T) and control vector pET15b are transferred to expression place respectively Main bacterium Escherichiacoli BL21 (DE3) (being purchased from New England Biolabs companies), picking monoclonal is seeded to newly Fresh LB culture mediums (ampicillin containing 50mg/l).Treat bacterium length to OD₆₀₀For 0.6 or so, it is separately added into final concentration of 0.6mM IPTG (isopropyl-β-D-thiogalactoside) induction AsCpf1 (S589Q/P711T) expression.Induction is two small When after collect thalline, the mycoprotein sample after processing uses gel imaging system UVP through 13%SDS-PAGE electrophoresis White/ultraviolet transilluminator (being purchased from Upland companies of the U.S.) are to the gel of coomassie brilliant blue staining Record is scanned, the ratio of bacterial protein is accounted for using specialty analysis software Grab-it 2.5 and Gelwork analysis purpose albumen Example.

In the application, solubility is defined as：Soluble destination protein/general purpose albumen × 100%.In IPTG inductions Afterwards, occur in that an about 155kD protein band, and theoretical molecular size coincide, through gel image scanning gray analysis, AsCpf1 (S589Q/P711T) albumen accounts for 18% (Fig. 2) of bacterial protein, and solubility reaches 95%.

(2) purifying of AsCpf1 mutant proteins

Collect the cell of one liter of zymotic fluid, and with the Buffer A of 40ml ice baths (20mM Tris-HCl, 50mM NaCl, 1%Triton-100,20%glycerol pH7.5) it is resuspended, ice-bath ultrasonic cell lysis, centrifuging and taking supernatant, supernatant passes through Ni- IDA posts；Loading finish with 50ml Buffer E (20mM Tris-HCl pH7.5,2M NaCl, 0.1%TritonX-100, 20%glycerol) wash Ni-IDA posts；50ml Buffer G (20mM Tris-HCl pH7.5,50mM NaCl, 0.1% TritonX-100,500mM imidazoles, 20%glycerol) elution Ni-IDA posts, it is in charge of collection；By the destination protein mistake being eluted to CM ion columns；100ml Buffer D (20mM Tris-HCl pH7.5,50mM NaCl, 0.1%TritonX-100,20% Glycerol CM ion columns) are washed；10ml Buffer B (20mM Tris-HCl pH7.5,50mM NaCl, 0.1% TritonX-100,20%glycerol) elution CM ion columns, it is in charge of collection.Use 2.5 points of specialty analysis software Grab-it It is 90% to analyse TAT-As-cpf1 purity of protein.The AsCpf1 (S589Q/P711T) of elution dialyses albumen to 20mM after merging In Tris, 50mM NaCl pH7.5,20%glycerol.

The AsCpf1 (S589Q/P711T) of Ni-IDA posts after purification SDS-PAGE (13%) analyses are as shown in Figure 3；CM posts SDS-PAGE (13%) analyses of AsCpf1 (S589Q/P711T) after purification are as shown in Figure 4.

Embodiment 4：The AsCpf1 mutant proteins of purifying are contrasted with wild type AsCpf1 (WT) cleavage activity

(1) copR gene orders are expanded

Greedy copper bacterium is extracted from bitumen using conventional method, and using the greedy copper bacterium genomic DNA of extraction as template, PCR is expanded and is reclaimed copR genetic fragments, and PCR amplifications forward primer used is：

5’-ATGAAATTGCTGGTAGTCGAAGA-3’(SEQ ID NO：8), reverse primer is：5’- TCAGTCGCCTTCCTCCGGAT-3’(SEQ ID NO：9).PCR amplification system is：Genomic DNA template 100ng, forward direction is drawn The μ l of thing (20 μM) 1,1 μ l, 2X Ultra Pfu Mix of reverse primer (20 μM) 25 μ l, plus ddH₂O to the μ l of cumulative volume 50；PCR is anti- The condition is answered to be：94 DEG C of thermal denaturations 10 minutes, 58 DEG C are annealed 30 seconds, and 72 DEG C extend 1 minute, and 35 circulations are carried out altogether.PCR amplification productions Thing is reclaimed, and is tested for AsCpf1 (S589Q/P711T) and wild type AsCpf1 (WT) In vitro digestion.

(2) cleavage activity is contrasted

What copR products, the AsCpf1 mutant proteins of 1 μ l purifying or AsCpf1 (WT), the 1 μ g for taking 1 μ g to reclaim were synthesized CrRNA, 2 μ l 10*Reaction Buffer, are configured to after 20 μ l In vitro digestion reaction systems, 37 DEG C of water-bath 30min, 2% fine jade Sepharose electrophoresis detection is cut；Wherein 10*Reaction Buffer composition is：500mM KAc, 200mM Tris- vinegar Acid, 100mM Mg (Ac)₂、1mg/ml BSA pH7.9@25℃。

Wherein crRNA commissions Shanghai JiMa pharmacy Technology Co., Ltd synthesizes, and its sequence is：

5’-CGCGGGCCAGCAGTTCGGCAAAGGATCTACAACAGTAGAAATTCCCTATAGTGAGTCGTATTAATT TC-3’(SEQ ID NO：10)

As a result In vitro digestion experimental result as shown in figure 5, show AsCpf1 mutant proteins compared to wild type AsCpf1 (WT), cleavage activity is significantly improved.

Embodiment 5：AsCpf1 mutant protein editor's primary T cells PD-1

(1) PD-1 Gene Partials sequence amplification

Primary T cells are separated from human peripheral using conventional method, and using the primary T cells genomic DNA of extraction as Template, PCR is expanded and is reclaimed amplified fragments, and PCR amplifications forward primer used is：5’-ACTCCCCAGACAGGCCCTG-3’ (SEQ ID NO：11), reverse primer is：5’-CAGGGGCTGGCCGGTGCG-3’(SEQ ID NO：12).PCR amplification system： Genomic DNA template 100ng, the μ l of forward primer (20 μM) 1, the μ l of 1 μ l, 2X Ultra Pfu Mix of reverse primer (20 μM) 25, Plus ddH2O to the μ l of cumulative volume 50；PCR reaction conditions are：94 DEG C of thermal denaturations 5 minutes, 56 DEG C are annealed 30 seconds, and 72 DEG C extend 1 minute, 30 circulations are carried out altogether.Pcr amplification product is reclaimed, for the experiment of AsCpf1 (S589Q/P711T) In vitro digestion.

(2) AsCpf1 (S589Q/P711T) In vitro digestions PD-1

Take PD-1 products, crRNA, the 2 μ l of AsCpf1 (S589Q/P711T), 1 μ the g synthesis of 1 μ l purifying that 1 μ g are reclaimed 10*Reaction B μ ffer, are configured to after 20 μ l In vitro digestion reaction systems, 37 DEG C of water-bath 30min, 2% Ago-Gel electricity Swimming detection cutting.Wherein 10*Reaction B μ ffer composition is：500mM KAc, 200mM Tris- acetic acid, 100mM Mg (Ac)₂、1mg/ml BSA pH7.9@25℃。

The crRNA of 3 targeting different locis is devised according to PD-1 gene orders, the lucky agate pharmaceutical technology in commission Shanghai is limited Company synthesizes：

crRNA1：AAUUUCUACUCUUGUAGAUGCACGAAGCUCUCCGAUGUGUUGG(SEQ ID NO：13)；

crRNA2：AAUUUCUACUCUUGUAGAUAUCUGCGCCUUGGGGGCCAGGGAG(SEQ ID NO：14)；

crRNA3：AAUUUCUACUCUUGUAGAUGAACUGGCCGGCUGGCCUGGGUGA(SEQ ID NO：15)；

In vitro digestion experiment, experimental result are carried out to PD-1 using the AsCpf1 mutant proteins of purifying as shown in fig. 6, knot Fruit shows that 3 crRNA can mediate AsCpf1 (S589Q/P711T) to cut PD-1, illustrates AsCpf1 (S589Q/ P711T) recognize and cut PD-1 efficiency highs.

Take 1 × 10⁶Individual primary T cells PD-1, adds the AsCpf1 mutant proteins of 20 μ g purifying, 10 μ g synthesis CrRNA mixes ice bath, electric conversion instrument (BIO-RAD MicroPilser^TM) click on conversion after spread 6 orifice plates, 72h after extract albumen Western Blotting detection PD-1 protein expression level changes.

Primary T cells are handled respectively with 3 crRNA of design synthesis, Western Blotting testing results As shown in fig. 7, after crRNA2 and crRNA3 processing primary T cells, PD-1 protein expression levels are substantially reduced, show that AsCpf1 dashes forward Misfolded proteins and two targeting crRNA for PD-1 genes of design can effectively strike drop primary T cells PD-1 expression.

<110>Jiangsu Pu Bo bio tech ltd

<120>A kind of AsCpf1 mutant proteins, encoding gene, recombinant expression carrier and preparation method and application

<160> 15

<210> 1

<211> 1342

<212> PRT

<213>Artificial sequence

<220>

<223>

<400> 1

Met Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Thr Gln Phe Glu

1 5 10 15

Gly Phe Thr Asn Leu Tyr Gln Val Ser Lys Thr Leu Arg Phe Glu Leu

20 25 30

Ile Pro Gln Gly Lys Thr Leu Lys His Ile Gln Glu Gln Gly Phe Ile

35 40 45

Glu Glu Asp Lys Ala Arg Asn Asp His Tyr Lys Glu Leu Lys Pro Ile

50 55 60

Ile Asp Arg Ile Tyr Lys Thr Tyr Ala Asp Gln Cys Leu Gln Leu Val

65 70 75 80

Gln Leu Asp Trp Glu Asn Leu Ser Ala Ala Ile Asp Ser Tyr Arg Lys

85 90 95

Glu Lys Thr Glu Glu Thr Arg Asn Ala Leu Ile Glu Glu Gln Ala Thr

100 105 110

Tyr Arg Asn Ala Ile His Asp Tyr Phe Ile Gly Arg Thr Asp Asn Leu

115 120 125

Thr Asp Ala Ile Asn Lys Arg His Ala Glu Ile Tyr Lys Gly Leu Phe

130 135 140

Lys Ala Glu Leu Phe Asn Gly Lys Val Leu Lys Gln Leu Gly Thr Val

145 150 155 160

Thr Thr Thr Glu His Glu Asn Ala Leu Leu Arg Ser Phe Asp Lys Phe

165 170 175

Thr Thr Tyr Phe Ser Gly Phe Tyr Glu Asn Arg Lys Asn Val Phe Ser

180 185 190

Ala Glu Asp Ile Ser Thr Ala Ile Pro His Arg Ile Val Gln Asp Asn

195 200 205

Phe Pro Lys Phe Lys Glu Asn Cys His Ile Phe Thr Arg Leu Ile Thr

210 215 220

Ala Val Pro Ser Leu Arg Glu His Phe Glu Asn Val Lys Lys Ala Ile

225 230 235 240

Gly Ile Phe Val Ser Thr Ser Ile Glu Glu Val Phe Ser Phe Pro Phe

245 250 255

Tyr Asn Gln Leu Leu Thr Gln Thr Gln Ile Asp Leu Tyr Asn Gln Leu

260 265 270

Leu Gly Gly Ile Ser Arg Glu Ala Gly Thr Glu Lys Ile Lys Gly Leu

275 280 285

Asn Glu Val Leu Asn Leu Ala Ile Gln Lys Asn Asp Glu Thr Ala His

290 295 300

Ile Ile Ala Ser Leu Pro His Arg Phe Ile Pro Leu Phe Lys Gln Ile

305 310 315 320

Leu Ser Asp Arg Asn Thr Leu Ser Phe Ile Leu Glu Glu Phe Lys Ser

325 330 335

Asp Glu Glu Val Ile Gln Ser Phe Cys Lys Tyr Lys Thr Leu Leu Arg

340 345 350

Asn Glu Asn Val Leu Glu Thr Ala Glu Ala Leu Phe Asn Glu Leu Asn

355 360 365

Ser Ile Asp Leu Thr His Ile Phe Ile Ser His Lys Lys Leu Glu Thr

370 375 380

Ile Ser Ser Ala Leu Cys Asp His Trp Asp Thr Leu Arg Asn Ala Leu

385 390 395 400

Tyr Glu Arg Arg Ile Ser Glu Leu Thr Gly Lys Ile Thr Lys Ser Ala

405 410 415

Lys Glu Lys Val Gln Arg Ser Leu Lys His Glu Asp Ile Asn Leu Gln

420 425 430

Glu Ile Ile Ser Ala Ala Gly Lys Glu Leu Ser Glu Ala Phe Lys Gln

435 440 445

Lys Thr Ser Glu Ile Leu Ser His Ala His Ala Ala Leu Asp Gln Pro

450 455 460

Leu Pro Thr Thr Leu Lys Lys Gln Glu Glu Lys Glu Ile Leu Lys Ser

465 470 475 480

Gln Leu Asp Ser Leu Leu Gly Leu Tyr His Leu Leu Asp Trp Phe Ala

485 490 495

Val Asp Glu Ser Asn Glu Val Asp Pro Glu Phe Ser Ala Arg Leu Thr

500 505 510

Gly Ile Lys Leu Glu Met Glu Pro Ser Leu Ser Phe Tyr Asn Lys Ala

515 520 525

Arg Asn Tyr Ala Thr Lys Lys Pro Tyr Ser Val Glu Lys Phe Lys Leu

530 535 540

Asn Phe Gln Met Pro Thr Leu Ala Ser Gly Trp Asp Val Asn Lys Glu

545 550 555 560

Lys Asn Asn Gly Ala Ile Leu Phe Val Lys Asn Gly Leu Tyr Tyr Leu

565 570 575

Gly Ile Met Pro Lys Gln Lys Gly Arg Tyr Lys Ala Leu Ser Phe Glu

580 585 590

Pro Thr Glu Lys Thr Gln Glu Gly Phe Asp Lys Met Tyr Tyr Asp Tyr

595 600 605

Phe Pro Asp Ala Ala Lys Met Ile Pro Lys Cys Ser Thr Gln Leu Lys

610 615 620

Ala Val Thr Ala His Phe Gln Thr His Thr Thr Pro Ile Leu Leu Ser

625 630 635 640

Asn Asn Phe Ile Glu Pro Leu Glu Ile Thr Lys Glu Ile Tyr Asp Leu

645 650 655

Asn Asn Pro Glu Lys Glu Pro Lys Lys Phe Gln Thr Ala Tyr Ala Lys

660 665 670

Lys Thr Gly Asp Gln Lys Gly Tyr Arg Glu Ala Leu Cys Lys Trp Ile

675 680 685

Asp Phe Thr Arg Asp Phe Leu Ser Lys Tyr Thr Lys Thr Thr Ser Ile

690 695 700

Asp Leu Ser Ser Leu Arg Thr Ser Ser Gln Tyr Lys Asp Leu Gly Glu

705 710 715 720

Tyr Tyr Ala Glu Leu Asn Pro Leu Leu Tyr His Ile Ser Phe Gln Arg

725 730 735

Ile Ala Glu Lys Glu Ile Met Asp Ala Val Glu Thr Gly Lys Leu Tyr

740 745 750

Leu Phe Gln Ile Tyr Asn Lys Asp Phe Ala Lys Gly His His Gly Lys

755 760 765

Pro Asn Leu His Thr Leu Tyr Trp Thr Gly Leu Phe Ser Pro Glu Asn

770 775 780

Leu Ala Lys Thr Ser Ile Lys Leu Asn Gly Gln Ala Glu Leu Phe Tyr

785 790 795 800

Arg Pro Lys Ser Arg Met Lys Arg Met Ala His Arg Leu Gly Glu Lys

805 810 815

Met Leu Asn Lys Lys Leu Lys Asp Gln Lys Thr Pro Ile Pro Asp Thr

820 825 830

Leu Tyr Gln Glu Leu Tyr Asp Tyr Val Asn His Arg Leu Ser His Asp

835 840 845

Leu Ser Asp Glu Ala Arg Ala Leu Leu Pro Asn Val Ile Thr Lys Glu

850 855 860

Val Ser His Glu Ile Ile Lys Asp Arg Arg Phe Thr Ser Asp Lys Phe

865 870 875 880

Phe Phe His Val Pro Ile Thr Leu Asn Tyr Gln Ala Ala Asn Ser Pro

885 890 895

Ser Lys Phe Asn Gln Arg Val Asn Ala Tyr Leu Lys Glu His Pro Glu

900 905 910

Thr Pro Ile Ile Gly Ile Asp Arg Gly Glu Arg Asn Leu Ile Tyr Ile

915 920 925

Thr Val Ile Asp Ser Thr Gly Lys Ile Leu Glu Gln Arg Ser Leu Asn

930 935 940

Thr Ile Gln Gln Phe Asp Tyr Gln Lys Lys Leu Asp Asn Arg Glu Lys

945 950 955 960

Glu Arg Val Ala Ala Arg Gln Ala Trp Ser Val Val Gly Thr Ile Lys

965 970 975

Asp Leu Lys Gln Gly Tyr Leu Ser Gln Val Ile His Glu Ile Val Asp

980 985 990

Leu Met Ile His Tyr Gln Ala Val Val Val Leu Glu Asn Leu Asn Phe

995 1000 1005

Gly Phe Lys Ser Lys Arg Thr Gly Ile Ala Glu Lys Ala Val Tyr Gln

1110 1015 1020

Gln Phe Glu Lys Met Leu Ile Asp Lys Leu Asn Cys Leu Val Leu Lys

1125 1030 1035 1040

Asp Tyr Pro Ala Glu Lys Val Gly Gly Val Leu Asn Pro Tyr Gln Leu

1045 1050 1055

Thr Asp Gln Phe Thr Ser Phe Ala Lys Met Gly Thr Gln Ser Gly Phe

1060 1065 1070

Leu Phe Tyr Val Pro Ala Pro Tyr Thr Ser Lys Ile Asp Pro Leu Thr

1075 1080 1085

Gly Phe Val Asp Pro Phe Val Trp Lys Thr Ile Lys Asn His Glu Ser

1090 1095 1100

Arg Lys His Phe Leu Glu Gly Phe Asp Phe Leu His Tyr Asp Val Lys

1105 1110 1115 1120

Thr Gly Asp Phe Ile Leu His Phe Lys Met Asn Arg Asn Leu Ser Phe

1125 1130 1135

Gln Arg Gly Leu Pro Gly Phe Met Pro Ala Trp Asp Ile Val Phe Glu

1140 1145 1150

Lys Asn Glu Thr Gln Phe Asp Ala Lys Gly Thr Pro Phe Ile Ala Gly

1155 1160 1165

Lys Arg Ile Val Pro Val Ile Glu Asn His Arg Phe Thr Gly Arg Tyr

1170 1175 1180

Arg Asp Leu Tyr Pro Ala Asn Glu Leu Ile Ala Leu Leu Glu Glu Lys

1185 1190 1195 1200

Gly Ile Val Phe Arg Asp Gly Ser Asn Ile Leu Pro Lys Leu Leu Glu

1205 1210 1215

Asn Asp Asp Ser His Ala Ile Asp Thr Met Val Ala Leu Ile Arg Ser

1220 1225 1230

Val Leu Gln Met Arg Asn Ser Asn Ala Ala Thr Gly Glu Asp Tyr Ile

1235 1240 1245

Asn Ser Pro Val Arg Asp Leu Asn Gly Val Cys Phe Asp Ser Arg Phe

1250 1255 1260

Gln Asn Pro Glu Trp Pro Met Asp Ala Asp Ala Asn Gly Ala Tyr His

1265 1270 1275 1280

Ile Ala Leu Lys Gly Gln Leu Leu Leu Asn His Leu Lys Glu Ser Lys

1285 1290 1295

Asp Leu Lys Leu Gln Asn Gly Ile Ser Asn Gln Asp Trp Leu Ala Tyr

1300 1305 1310

Ile Gln Glu Leu Arg Asn Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly

1315 1320 1325

Gln Ala Lys Lys Lys Lys Gly Ser His His His His His His ***

1330 1335 1340

<210> 2

<211> 4029

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 2

atgtacggtc gtaaaaaacg tcgtcagcgt cgtcgtacac agttcgaggg ctttaccaac 60

ctgtatcagg tgagcaagac actgcggttt gagctgatcc cacagggcaa gaccctgaag 120

cacatccagg agcagggctt catcgaggag gacaaggccc gcaatgatca ctacaaggag 180

ctgaagccca tcatcgatcg gatctacaag acctatgccg accagtgcct gcagctggtg 240

cagctggatt gggagaacct gagcgccgcc atcgactcct atagaaagga gaaaaccgag 300

gagacaagga acgccctgat cgaggagcag gccacatatc gcaatgccat ccacgactac 360

ttcatcggcc ggacagacaa cctgaccgat gccatcaata agagacacgc cgagatctac 420

aagggcctgt tcaaggccga gctgtttaat ggcaaggtgc tgaagcagct gggcaccgtg 480

accacaaccg agcacgagaa cgccctgctg cggagcttcg acaagtttac aacctacttc 540

tccggctttt atgagaacag gaagaacgtg ttcagcgccg aggatatcag cacagccatc 600

ccacaccgca tcgtgcagga caacttcccc aagtttaagg agaattgtca catcttcaca 660

cgcctgatca ccgccgtgcc cagcctgcgg gagcactttg agaacgtgaa gaaggccatc 720

ggcatcttcg tgagcacctc catcgaggag gtgttttcct tcccttttta taaccagctg 780

ctgacacaga cccagatcga cctgtataac cagctgctgg gaggaatctc tcgggaggca 840

ggcaccgaga agatcaaggg cctgaacgag gtgctgaatc tggccatcca gaagaatgat 900

gagacagccc acatcatcgc ctccctgcca cacagattca tccccctgtt taagcagatc 960

ctgtccgata ggaacaccct gtctttcatc ctggaggagt ttaagagcga cgaggaagtg 1020

atccagtcct tctgcaagta caagacactg ctgagaaacg agaacgtgct ggagacagcc 1080

gaggccctgt ttaacgagct gaacagcatc gacctgacac acatcttcat cagccacaag 1140

aagctggaga caatcagcag cgccctgtgc gaccactggg atacactgag gaatgccctg 1200

tatgagcgga gaatctccga gctgacaggc aagatcacca agtctgccaa ggagaaggtg 1260

cagcgcagcc tgaagcacga ggatatcaac ctgcaggaga tcatctctgc cgcaggcaag 1320

gagctgagcg aggccttcaa gcagaaaacc agcgagatcc tgtcccacgc acacgccgcc 1380

ctggatcagc cactgcctac aaccctgaag aagcaggagg agaaggagat cctgaagtct 1440

cagctggaca gcctgctggg cctgtaccac ctgctggact ggtttgccgt ggatgagtcc 1500

aacgaggtgg accccgagtt ctctgcccgg ctgaccggca tcaagctgga gatggagcct 1560

tctctgagct tctacaacaa ggccagaaat tatgccacca agaagcccta ctccgtggag 1620

aagttcaagc tgaactttca gatgcctaca ctggcctctg gctgggacgt gaataaggag 1680

aagaacaatg gcgccatcct gtttgtgaag aacggcctgt actatctggg catcatgcca 1740

aagcagaagg gcaggtataa ggccctgagc ttcgagccca cagagaaaac ccaggagggc 1800

tttgataaga tgtactatga ctacttccct gatgccgcca agatgatccc aaagtgcagc 1860

acccagctga aggccgtgac agcccacttt cagacccaca caacccccat cctgctgtcc 1920

aacaatttca tcgagcctct ggagatcaca aaggagatct acgacctgaa caatcctgag 1980

aaggagccaa agaagtttca gacagcctac gccaagaaaa ccggcgacca gaagggctac 2040

agagaggccc tgtgcaagtg gatcgacttc acaagggatt ttctgtccaa gtataccaag 2100

acaacctcta tcgatctgtc tagcctgcgg acttcctctc agtataagga cctgggcgag 2160

tactatgccg agctgaatcc cctgctgtac cacatcagct tccagagaat cgccgagaag 2220

gagatcatgg atgccgtgga gacaggcaag ctgtacctgt tccagatcta taacaaggac 2280

tttgccaagg gccaccacgg caagcctaat ctgcacacac tgtattggac cggcctgttt 2340

tctccagaga acctggccaa gacaagcatc aagctgaatg gccaggccga gctgttctac 2400

cgccctaagt ccaggatgaa gaggatggca caccggctgg gagagaagat gctgaacaag 2460

aagctgaagg atcagaaaac cccaatcccc gacaccctgt accaggagct gtacgactat 2520

gtgaatcaca gactgtccca cgacctgtct gatgaggcca gggccctgct gcccaacgtg 2580

atcaccaagg aggtgtctca cgagatcatc aaggataggc gctttaccag cgacaagttc 2640

tttttccacg tgcctatcac actgaactat caggccgcca attccccatc taagttcaac 2700

cagagggtga atgcctacct gaaggagcac cccgagacac ctatcatcgg catcgatcgg 2760

ggcgagagaa acctgatcta tatcacagtg atcgactcca ccggcaagat cctggagcag 2820

cggagcctga acaccatcca gcagtttgat taccagaaga agctggacaa cagggagaag 2880

gagagggtgg cagcaaggca ggcctggtct gtggtgggca caatcaagga tctgaagcag 2940

ggctatctga gccaggtcat ccacgagatc gtggacctga tgatccacta ccaggccgtg 3000

gtggtgctgg agaacctgaa tttcggcttt aagagcaaga ggaccggcat cgccgagaag 3060

gccgtgtacc agcagttcga gaagatgctg atcgataagc tgaattgcct ggtgctgaag 3120

gactatccag cagagaaagt gggaggcgtg ctgaacccat accagctgac agaccagttc 3180

acctcctttg ccaagatggg cacccagtct ggcttcctgt tttacgtgcc tgccccatat 3240

acatctaaga tcgatcccct gaccggcttc gtggacccct tcgtgtggaa aaccatcaag 3300

aatcacgaga gccgcaagca cttcctggag ggcttcgact ttctgcacta cgacgtgaaa 3360

accggcgact tcatcctgca ctttaagatg aacagaaatc tgtccttcca gaggggcctg 3420

cccggcttta tgcctgcatg ggatatcgtg ttcgagaaga acgagacaca gtttgacgcc 3480

aagggcaccc ctttcatcgc cggcaagaga atcgtgccag tgatcgagaa tcacagattc 3540

accggcagat accgggacct gtatcctgcc aacgagctga tcgccctgct ggaggagaag 3600

ggcatcgtgt tcagggatgg ctccaacatc ctgccaaagc tgctggagaa tgacgattct 3660

cacgccatcg acaccatggt ggccctgatc cgcagcgtgc tgcagatgcg gaactccaat 3720

gccgccacag gcgaggacta tatcaacagc cccgtgcgcg atctgaatgg cgtgtgcttc 3780

gactcccggt ttcagaaccc agagtggccc atggacgccg atgccaatgg cgcctaccac 3840

atcgccctga agggccagct gctgctgaat cacctgaagg agagcaagga tctgaagctg 3900

cagaacggca tctccaatca ggactggctg gcctacatcc aggagctgcg caacaaaagg 3960

ccggcggcca cgaaaaaggc cggccaggca aaaaagaaaa agggatccca tcatcatcat 4020

catcactaa 4029

<210> 3

<211> 33

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 3

tacggtcgta aaaaacgtcg tcagcgtcgt cgt 33

<210> 4

<211> 54

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 4

aaaaggccgg cggccacgaa aaaggccggc caggcaaaaa agaaaaaggg atcc 54

<210> 5

<211> 18

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 5

catcatcatc atcatcac 18

<210> 6

<211> 82

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 6

gtttaacttt aagaaggaga tataccatgt acggtcgtaa aaaacgtcgt cagcgtcgtc 60

gtacacagtt cgagggcttt ac 82

<210> 7

<211> 52

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 7

tcgggctttg ttagcagccg gatcctcgag ttagtgatga tgatgatgat gg 52

<210> 8

<211> 23

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 8

atgaaattgc tggtagtcga aga 23

<210> 9

<211> 23

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 9

atgaaattgc tggtagtcga aga 23

<210> 10

<211> 68

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 10

cgcgggccag cagttcggca aaggatctac aacagtagaa attccctata gtgagtcgta 60

ttaatttc 68

<210> 11

<211> 19

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 11

actccccaga caggccctg 19

<210> 12

<211> 18

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 12

caggggctgg ccggtgcg 18

<210> 13

<211> 43

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 13

aauuucuacu cuuguagaug cacgaagcuc uccgaugugu ugg 43

<210> 14

<211> 43

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 14

aauuucuacu cuuguagaua ucugcgccuu gggggccagg gag 43

<210> 15

<211> 43

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 15

aauuucuacu cuuguagaug aacuggccgg cuggccuggg uga 43

Claims

1. a kind of AsCpf1 mutant proteins, it is characterised in that its amino acid sequence such as SEQ ID NO：Shown in 1.

2. a kind of restructuring AsCpf1 gene mutation bodies for encoding AsCpf1 mutant proteins described in claim 1.

3. restructuring AsCpf1 gene mutation bodies according to claim 2, it is characterised in that its nucleotide sequence such as SEQ ID NO：Shown in 2.

4. a kind of recombinant expression carrier of the restructuring AsCpf1 gene mutation bodies containing described in Claims 2 or 33.

5. recombinant expression carrier according to claim 4, it is characterised in that the recombinant expression carrier is with SEQ ID NO：AsCpf1 (S589Q/P711T) shown in 2 enters performing PCR amplification for template design primer, then by the PCR primer nothing of purifying Obtained between the multiple cloning sites NcoI and XhoI of seam cloning process insertion pET15b carriers.

6. the preparation method of AsCpf1 mutant proteins described in a kind of claim 1, it is characterised in that comprise the following steps：

1. the structure of AsCpf1 mutant protein prokaryotic expression carriers described in claim 1 is encoded：With the AsCpf1 of synthesis (S589Q/P711T) genomic DNA is template, and AsCpf1 (S589Q/P711T) coded sequence is expanded with PCR method, will To PCR primer purified, with seamless cloning process insert pET15b carriers multiple cloning sites NcoI and XhoI between, obtain It is all correct through sequence verification reading frame and DNA sequence dna to recombinant expression carrier, i.e., successfully construct the AsCpf1 genes containing restructuring The prokaryotic expression carrier of mutant, is named as pET15b-AsCpf1 (S589Q/P711T)；

2. the expression of AsCpf1 mutant proteins：Prokaryotic expression carrier pET15b-AsCpf (S589Q/P711T) is transferred to expression Host Strains Escherichiacoli BL21 (DE3), picking monoclonal is seeded to the LB of the fresh ampicillin containing 50mg/l Culture medium, through 37 DEG C of shaking table cultures to OD₆₀₀For 0.6, the final concentration of 0.6mM of addition IPTG induction AsCpf1 (S589Q/ P711T expression)；

3. the purifying of AsCpf1 mutant proteins：The cell of one liter of zymotic fluid is collected, and is resuspended with the Buffer A of 40ml ice baths, Ice-bath ultrasonic cell lysis, centrifuging and taking supernatant, supernatant passes through Ni-IDA posts；Loading is finished washs Ni- with 50ml Buffer E IDA posts；50ml Buffer G elute Ni-IDA posts, are in charge of collection；The destination protein being eluted to is crossed into CM ion columns；100ml Buffer D wash CM ion columns；10ml Buffer B elute CM ion columns, are in charge of collection；Use specialty analysis software Grab- It 2.5 analyzes TAT-As-cpf1 purity of protein；The AsCpf1 (S589Q/P711T) of elution dialyses albumen to 20mM after merging In Tris, 50mM NaCl pH7.5,20%glycerol；Wherein, Buffer A composition is：20mM Tris-HCl, 50mM NaCl, 1%Triton-100,20%glycerol pH7.5；Buffer E composition is：20mM Tris-HCl pH7.5,2M NaCl, 0.1%TritonX-100,20%glycerol；Buffer G composition is：20mM Tris-HCl pH7.5,50mM NaCl, 0.1%TritonX-100,500mM imidazoles, 20%glycerol；Buffer D composition is：20mM Tris-HCl PH7.5,50mM NaCl, 0.1%TritonX-100,20%glycerol；Buffer B composition is：20mM Tris-HCl PH7.5,50mM NaCl, 0.1%TritonX-100,20%glycerol.

7. the restructuring AsCpf1 gene mutation bodies described in AsCpf1 mutant proteins and Claims 2 or 3 described in claim 1 With application of the recombinant expression carrier described in claim 4 or 5 in terms of gene editing primary T cells PD-1.

8. the method for AsCpf1 mutant protein editor's primary T cells PD-1 genes described in claim 1, it is characterised in that Comprise the following steps：

(1) primary T cells PD-1 Gene Partials sequence amplification

Primary T cells PD-1 genomic DNAs using extraction is templates, and PCR is expanded and reclaimed amplified fragments, used in PCR amplifications just It is to primer：5’-ACTCCCCAGACAGGCCCTG-3’(SEQ ID NO：6), reverse primer is：5’- CAGGGGCTGGCCGGTGCG-3’(SEQ ID NO：7)；PCR reaction systems are：Genomic DNA template 100ng, 20 μM of forward directions Primer 1 μ l, 20 μM of μ l of 1 μ l, 2X Ultra Pfu Mix of reverse primer 25, plus ddH₂O to the μ l of cumulative volume 50；PCR reaction conditions For：94 DEG C of thermal denaturations 5 minutes, 56 DEG C are annealed 30 seconds, and 72 DEG C extend 1 minute, and 30 circulations are carried out altogether；

(2) AsCpf1 mutant proteins In vitro digestion PD-1

Take PD-1 products, the AsCpf1 mutant proteins of 1 μ l purifying, crRNA, the 2 μ l of 1 μ g synthesis that 1 μ g steps (1) are reclaimed 10*Reaction Buffer, are configured to after 20 μ l In vitro digestion reaction systems, 37 DEG C of water-bath 30min, 2% Ago-Gel electricity Swimming detection cutting；Wherein 10*Reaction B μ ffer composition is：500mM KAc, 200mM Tris- acetic acid, 100mM Mg (Ac)₂、1mg/ml BSA pH7.9@25℃；

(3) Western Blotting are detected after AsCpf1 mutant proteins processing primary T cells, the change of PD-1 expressions

Take 1 × 10⁶Individual primary T cells PD-1, adds the AsCpf1 mutant proteins of 20 μ g purifying, and the crRNA of 10 μ g synthesis is mixed Ice bath, electric conversion instrument, which is clicked on to spread after conversion, extracts albumen after 6 orifice plates, 72h, Western Blotting detection PD-1 protein expressions Level changes.