CN106589134A - Chimeric protein pAgoE, construction method and applications thereof, chimeric protein pAgoE using guide, and construction method and applications thereof - Google Patents

Chimeric protein pAgoE, construction method and applications thereof, chimeric protein pAgoE using guide, and construction method and applications thereof Download PDF

Info

Publication number
CN106589134A
CN106589134A CN201610996972.XA CN201610996972A CN106589134A CN 106589134 A CN106589134 A CN 106589134A CN 201610996972 A CN201610996972 A CN 201610996972A CN 106589134 A CN106589134 A CN 106589134A
Authority
CN
China
Prior art keywords
leu
glu
pagoe
lys
gly
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201610996972.XA
Other languages
Chinese (zh)
Other versions
CN106589134B (en
Inventor
仪宏
冯惠勇
李天明
刘金雷
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN201610996972.XA priority Critical patent/CN106589134B/en
Publication of CN106589134A publication Critical patent/CN106589134A/en
Application granted granted Critical
Publication of CN106589134B publication Critical patent/CN106589134B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
    • C12N9/1007—Methyltransferases (general) (2.1.1.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2497—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing N- glycosyl compounds (3.2.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/11—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (1.14.11)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y201/00—Transferases transferring one-carbon groups (2.1)
    • C12Y201/01—Methyltransferases (2.1.1)
    • C12Y201/01037—DNA (cytosine-5-)-methyltransferase (2.1.1.37)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/21—Endodeoxyribonucleases producing 5'-phosphomonoesters (3.1.21)
    • C12Y301/21004—Type II site-specific deoxyribonuclease (3.1.21.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/02—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2) hydrolysing N-glycosyl compounds (3.2.2)
    • C12Y302/02021—DNA-3-methyladenine glycosylase II (3.2.2.21)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/04—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
    • C12Y305/04005—Cytidine deaminase (3.5.4.5)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies

Abstract

The invention relates to biological technology, specifically relates to a chimeric protein pAgoE, a construction method and applications thereof, and at the same time, relates to a chimeric protein pAgoE using a guide, a construction method and applications thereof, and a chimeric protein, which is based on the chimeric protein pAgoE and has a genome targeting editing function. The chimeric protein pAgoE contains a pAgo structural domain with a genome targeting positioning function and an effect structural domain E, which is connected to the pAgo structural domain and has a genome cutting or modifying activity. The pAgo structural domain with a genome targeting positioning function and the effect structural domain E with a genome cutting or modifying activity are fused to establish the chimeric protein pAgoE; the chimeric protein pAgoE maintains the original targeting binding performance of the genome (DNA) having a targeting positioning function in the pAgo structural domain and the genome catalytic or modifying performance of the effect structural domain E at the same time, and an sufficient space is provided for the structural domain E to fully exert the effect.

Description

Chimeric protein pAgoE and construction method, application and using the chimeric protein of guide PAgoE and construction method, application
Technical field
The present invention relates to biotechnology, specifically, the present invention relates to a kind of chimeric protein pAgoE and its construction method and Using, meanwhile, the invention further relates to a kind of chimeric protein pAgoE of use guide and its construction method and application, and be based on The chimeric protein with genome targeting editting function of chimeric protein pAgoE.
Technical background
Target gene group editing technique and targeted genomic modification technology are the total of a class High-efficiency gene group rewriting technology Claim, it is with the main advantage of gene recombination technology in general sense：Genome targeting high precision, gene editing efficiency It is high, have wide range of applications, mammalian cell can be operated.Target gene group editing technique and targeted genomic modification technology can To grind for microorganism, plant, the cell of animal (including mammal) or individuality, development genome and apparent group of function Study carefully, genetic modification；Further, target gene group editing technique and targeted genomic modification technology can be real to a certain extent Existing species customization.
The development of gene editing technology, mainly after the evolution of ZFN, TALEN, CRISPR three generations's technological system, up to Today, CRISPR-CAS9 technologies are widely used.Above-mentioned ZFN and TALEN technologies interosculate, they be all employ it is chimeric Albumen strategy, the domain of responsible DNA identifications, can be with special in target gene group after engineer edits in chimeric protein Fixed DNA sequence, so as to realize that genome is positioned；The catalyst structure domain (CD) of chimeric protein, in II S type restriction nucleases The cleavage activity domain of enzyme cutting Fok I, it is possible to achieve the cutting to target site, causes genome double-strand break (DSB), compels Make cell start homologous mediation reparation (HDR) or non-homologous end joining (NHEJ) saving the integrity of genome. It is low that NHEJ repairs fidelity, it is possible to causes the mistakes such as base deletion, displacement near DSB, so as to introduce mutation or inactivation Gene.On the premise of homologous sequence serves as recovery template, being repaired by HDR can realize the accurate quiding gene of exogenous gene Group.But, it is low that the high cost of editor, efficiency are carried out in the dependence of ZFN and TALEN technologies to protein domain.
In the past few years made substantial progress based on the genome editor of CRISPR and extensively applied, accumulated and defined and be big That what is measured publishes document.CRISPR is that the primary of the defence foreign DNA invasion being evolved in antibacterial evolutionary process can originally Acquired immune system, from 2012, it was quickly developed into High-efficiency gene editing technique of new generation, wherein CAS9 albumen The single-stranded guide RNA (sgRNA) of an engineer can be captured, the specific target area of genome is entered using this sgRNA Row identification is simultaneously combined, afterwards, two nuclease site cutting DNAs of CAS9 albumen itself, cause double-strand break (DSB) and Cause NHEJ or HDR, realize gene editing.
Agronautes albumen is that a kind of being prevalent in include mammal from low protokaryon antibacterial to higher organism A kind of nuclease for having an evolution pedigree.With short chain oligonucleotide interaction and realize guide property targeting to respective complementary nucleotide sequence With reference to being a universal biological property of Agronaute.Agronautes albumen take part in ncRNA in Higher cells Related many important physiological process, such as RNAi.
In recent years, the correlational study from pArgonaute (pAgo) albumen of prokaryotic micro-organisms also achieved interesting Progress, defines some documents published, but compared with CRISPR, the current document of research of pAgo is simultaneously not rich enough It is rich.
The disclosed scientific paper delivered mainly has：On August 25th, 2009, Kira S Makarova etc. are according to raw The depth of thing informaticss is excavated, and is predicted and is likely to a kind of antagonism foreign heredity substance from procaryotic pArgonaute The original system of defense of invasion.On September 12nd, 2013, Ivan Olovnikov etc. are reported from Rhodobacter The RsAgo of sphaeroides can be by the identification monitoring foreign DNA to transcript profile " sampling ".On March 13rd, 2014, Daan C.Swarts etc. reports the TtAgo from Thermophilic Bacteria Thermus thermophilus) with the 5 ' phosphorylations of 13-25nt GDNA is that guide cuts targeting DNA, and this host defense system is referred to as into the DNA interference of guide DNA, abbreviation DNAi. On April 29th, 2015, Daan C.Swarts etc. have delivered online the PfAgo from archeobacteria Pyrococcus furiosus, The PfAgo utilize 5 ' phosphorylations single stranded DNA be guide, can targeting cutting single-chain or double-stranded DNA, play defence foreign DNA The effect of invasion.On April 12nd, 2016, Emine Kayaa etc. report from Marinitoga piezophila with CRISPR related MpAgo, the MpAgo are capable of identify that and cut institute's target with 15 to 40nt 5 ' hydroxylating single stranded RNAs guide To single stranded DNA or single stranded RNA.On May 2nd, 2016, Feng Gao etc. are reported from halophilic microorganism The NgAgo of Natronobacterium gregoryi, the paper is claimed with the single stranded DNA of the 5 ' phosphorylations of 24nt as guide The NgAgo, can at normal temperatures cause the double-strand break (DSB) in mammalian cell target gene group site and cause high efficiency Genome editor, but the paper has suffered from serious repeatable crisis.On June 21st, 2016, Tomohiro Miyoshi etc. withResolution parsed the structure of the RsAgo from Rhodobacter sphaeroides, the RsAgo knows The gRNA of other 18nt.According to limited research report, some pAgo may cause expression in heterogenous expression because of self targeting Difficulty, such as RsAgo.
Disclosed patent documentation mainly has：Inventor VAN DER OOST, the WO/2014/189628A1 of John Patent discloses the DNA perturbation techniques of guide DNA, but does not adopt from thermophilic prokaryotic micro-organisms at normal temperatures The TtAgo of Thermus thermophilus completes the embodiment of genes within cells group editor.Inventor VALTON, Julien WO2015/140347A1 patents, disclose using guide DNA the suckling of Argonaute EVACs (DAIS) through engineering approaches move The technology of thing genome, two can be added using after sequence optimisation in the TtAgo of 30 DEG C to 40 DEG C work with a TtAgo To 5 ' phosphorylations single-stranded guide DNA mode, implement including mammalian cell gene group editor including T cell. The WO2015/157534A1 patents of inventor DOUDNA, Jennifer are disclosed using from prokaryotic micro-organisms The MpAgo of Marinitoga piezophila carries out the technical method of single-stranded target nucleic acid (DNA or RNA) cutting, only body Outer experimental verification (in vitro) embodiment, the embodiment for lacking (in vivo) in active somatic cell.
These documents show that pAgo may be with the function of the defence foreign DNA and poisoning intrusion similar with CRISPR, its In, a part of pAgo take part in DNAi, such as TtAgo, AfAgo, PfAgo etc. with the ssDNA of 5 ' end phosphorylations as guide；Minority PAgo exist in the CRISPR regions of host, and with the ssRNA of 5 ' terminal hydroxy groups as guide, be capable of targeting cutting single-chain DNA or RNA.
Analyze from protein structure, pAgo albumen has relatively conservative domain, usually, from the nitrogen of pAgo albumen Carbon teminal is held to be respectively N-terminal, L1, PAZ, L2, MID, PIWI domain.Wherein PAZ domains are mainly guide widow's core Thuja acid recognizes and binding domain that lacking the pAgo in PAZ domains can not recognize alone and with reference to short chain guide oligonucleotide.For protokaryon For Agronaute, region the most conservative is middle L2, MID, PIWI to carbon teminal.
The PIWI domains of a part of pAgo maintain nuclease, such as from high temperature microbe Thermus The PfAgo of the TtAgo and Pyrococcus furiosus of thermophilus, existing bioinformatics software can divide The avtive spot of the PIWI domains of analysis and prediction pAgo.Also there is another kind of pAgo in nature, its PIWI domain but loses Nuclease is removed, such as from the RsAgo of Rhodobacter sphaeroides.
Existing result of study shows, PAZ domains is retained in pathogenic microorganism host and PIWI enzymatically active nucleic acids are kept Property Argonaute the role of the defence exotic invasive DNA such as virus is played in the way of DNAi；And in pathogenic microorganism host The Argonaute for retaining PAZ domains but PIWI forfeiture nucleases is then likely to still not very clear mode and machine System take part in defence to external invader dna, or even, persistently to sample host's all DNA in the way of gene to overacfivity Element is monitored.
The content of the invention
In view of this, the present invention is intended to provide a kind of chimeric protein pAgoE, with being capable of targeting cutting or modifying gene group.
For achieving the above object, chimeric protein pAgoE of the invention, containing the pAgo with genome targeting positioning function Domain, and be connected with the pAgo domains, with genome cutting or modification activities effector domain E.
Further, the effector domain E is using with nuclease sample DNA cleavage activities (Nuclease-like DNA Cleavage activity), domain N for genome targeting editor, to constitute the chimeric protein of pAgoE-N types pAgoE。
Further, the effector domain N is from nuclease, transposase, site differential recombination enzyme.
Further, the effector domain N is in the II S type restriction nucleases of EC 3.1.21.4 from zymetology numbering Enzyme cutting.
Further,：The effector domain N using Planomicrobium okeanokoites, GenBank steps on Mark is:383rd to the 579th aminoacid of II S types restriction endonuclease FOK I of AAA24934.1.
Further, the effector domain E contains with genome or apparent group of modification activities (Modification Activity), domain M for genome targeting modification.
Further, the effector domain M is using with DNA nucleotide modifications activity (Nucleotide Modification activity) domain NM, can be used for genome targeted nucleotide modification or genome targeting accelerate into Change.
Further, it is EC that the domain NM adopt zymetology to number to number for the AID or zymetology of EC 3.5.4.5 3.2.2.21 MAG1.
Further, the domain M is using with apparent group of modification activities (Epigenome Modification Activity domain EM), can be used for apparent group of editor.
Further, it is EC that the domain EM adopt zymetology to number to number for the TET1 or zymetology of EC 1.14.11.n2 2.1.1.37 DBMt3a/b.
Further, the pAgo domains with any one using guide natural protokaryon Argonaute albumen ammonia Base acid sequence homology is more than 30%.
Further, the pAgo that the pAgo domains are inactivated using PIWI domain centers phytase activity.
Further, the pAgo domains using from Rhodobacter sphaeroides ATCC 17025, The RsAgo of NCBI Serial No. ABP72561.1, to build the chimeric protein pAgoE for obtaining RsAgoE types.
Further, the pAgo domains are using the natural pAgo for having nuclease in PIWI domains.
Further, the pAgo domains are adopted from Marinitoga piezophila, NCBI Serial No. The MpAgo of WP_014295921.1, to build the chimeric protein pAgoE for obtaining MpAgoE types.
Further, the pAgo domains have the artificial deactivation of the natural pAgo of nuclease using PIWI domains Mutant.
Further, the artificial mutation that the pAgo domains are inactivated using the PIWI domains nuclease of MpAgo Body dMpAgo, to build the chimeric protein pAgoE for obtaining dMpAgoE types.
Further, mistakes of the artificial mutant dMpAgo from least one of the following four site of MpAgo It is living：D446、E482、D516、N624.
Further, the artificial mutant dMpAgo contains at least in following four alanine replacement mutational site It is individual：D446A、E482A、D516A、N624A.
Further, the pAgo domains adopt the artificial mutant of the PIWI domain nuclease-deads of NgAgo DNgAgo, to build the chimeric protein pAgoE of the dNgAgoE types for obtaining.
Further, mistakes of the artificial mutant dNgAgo from least one of the following four site of NgAgo It is living：D663、D738、D863、S665.
Further, the artificial mutant dNgAgo contains at least in following four alanine replacement mutational site It is individual：D663A、D738A、D863A、S665A.
Using technical scheme, its effect is as follows：
The chimeric protein pAgoE of the present invention, is, by the pAgo domains with genome targeting positioning function, and have Effector domain Effector Domain (hereinafter referred to as E) fusions of the catalysis activity such as genome cutting or modification activities, build " Argonaute-effector domain " chimeric protein (pAgoE), chimeric protein pAgoE maintains pAgo domains Central Plains The genome catalysis of the targeting binding ability of the genome (DNA) with targeting positioning function having and effector domain E or Modifying Capability, provides locus and ensures basis to play a role for effector domain E.
Invention also provides a kind of construction method of chimeric protein pAgoE, the method is by with genome targeting The pAgo domains of positioning function, and the effector domain E connections with genome cutting or modification activities.
Further, the pAgo domains adopt artificial connection with the effector domain E.
Further, the pAgo domains are covalently bonded with the effector domain E.
Further, the connection between carbon teminal and nitrogen end is formed between the pAgo domains and the effector domain E.
Further, the nitrogen end of the pAgo domains is connected with the carbon teminal of effector domain E, to build E-pAgo types pAgoE；Or the carbon teminal of the pAgo domains is connected with the nitrogen end of effector domain E, the pAgoE of pAgo-E types is built；Or institute The carbon teminal and nitrogen end for stating pAgo domains is connected respectively with the nitrogen end and carbon teminal of effector domain E, builds E1-pAgo-E2 types PAgoE, wherein, E1 is identical or different with E2.
Further, the pAgoE is built into the chimeric protein (split-pAgoE) of separate form, between split with The mode of non-covalent bond connects.
Further, between the pAgo domains and the effector domain E of the chimeric protein pAgoE, adopt Mxe GryA Intein build, to form the chimeric protein pAgoE of split-pAgoE types.
Present invention simultaneously relates to a kind of application of chimeric protein pAgoE, the chimeric protein pAgoE uses guide, targeting Editor or modifying gene group.
Further, it is another object of the present invention to provide a kind of chimeric protein pAgoE of use guide, it contains as above The chimeric protein pAgoE, and combined with the chimeric protein pAgoE, with assisting pAgoE identifications and combine genome The guide of ability.
Further, the guide is oligonucleotide gNA.
Further, the oligonucleotide gNA is arranged according to the principle complementary with target gene group site sequence is intended.
Further, the nucleotide sequence of the genome of the nucleotide sequence of the oligonucleotide gNA and plan target area Homology be more than 40%.
Further, the chimeric protein pAgoE of RsAgoE types, it is single-stranded using 5 ' the end phosphorylations that length is 18 nucleotide GRNA is gNA.
Further, the chimeric protein pAgoE of MpAgoE types or dMpAgoE types, is 10 to 40 nucleotide using length The single-stranded gRNA of 5 ' terminal hydroxy groupizations be gNA.
Further, the chimeric protein pAgoE of dNgAgoE types, using 5 ' the end phosphorylation lists that length is 24 nucleotide Chain gDNA is gNA.
The chimeric protein pAgoE of the use guide of the present invention, is based on the basis of chimeric protein pAgoE as above, knot Close guide to form, protokaryon Argonaute albumen (pAgo) with genome targeting positioning can be made, under the guiding of guide, Combined with the target area in genes within cells group so as to realize the positioning of genome, it is ensured that effector domain E can it is determined that Locus under play a role.
Specifically, in as described above, pAgo domains can come from PIWI nucleases weaken or inactivate it is natural DArgonaute (abbreviation dAgo domains) obtains PIWI nucleases and weakens or inactivate hanging oneself artificial reconstructed DArgonaute, E domain can come from the catalysiss that are able to carry out outside Argonaute albumen itself PIWI domains Albumen, such as, but not limited to：The apparent group of modification relevant enzyme such as DNA base modification enzyme, the TET1 such as the grade nucleases of FOK I, AID.To Leading can be using oligonucleotide gNA, and such as under single-stranded guide oligonucleotide gNA assistance, this kind of chimeric protein pAgoE can be utilized DAgo domains targeting in molecule combines the specific site of genome, and using the E domains in molecule to target site phase Close region to be specifically catalyzed, can be used for genome targeting editor, genome targeting modification (including single base editor, apparent Group editor, genome artificial evolution etc.).
Additionally, using as above technology, it is possible to achieve the application under room temperature, and the application in live body eukaryotic cell.
Additionally, invention also provides a kind of construction method of the chimeric protein pAgoE of use guide, the method be by Chimeric protein pAgoE is combined with guide.
Further, it is applied to genome targeting editor or genome targeting modification.
Meanwhile, the invention further relates to a kind of application process of the chimeric protein pAgoE of use guide, the method be guide with The directly mode of transcription is expressed in vivo or polymerized nucleoside acid precursors mode processed again is transcribed out realizes.
Further, it is characterised in that：The precursor polynucleotide shearing system, be from zymetology numbering The CSY4 of the EC3.1.-.- or RsAgo from NCBI Serial No. ABP72561.1.
Further, at least one in chimeric protein pAgoE, the prerequisite knowledge of guide oligonucleotide gNA, gNA, with The mode or external preparation for implementing intracellular normal expression or abduction delivering is re-fed into intracellular mode, makes pAgoE to tie Close guide state come across it is intracellular.
Further, the cell is live body eukaryotic cell.
Further, the live body eukaryotic cell is live body eukaryotic microbial cell, plant cell, zooblast.
Further, the cell is living mammal cell.
Further, the method is carried out at normal temperatures.
It is a further object of the invention to provide a kind of chimeric protein with genome targeting editting function, it contains Chimeric protein pAgoE as described above, the chimeric protein pAgoE contain the effector domain E with genome cutting.
Further, also containing it is being combined with the chimeric protein pAgoE, with assisting pAgoE identifications and combine gene The guide of group ability.
Meanwhile, the invention further relates to a kind of application of the chimeric protein with genome targeting editting function, pAgoE-N types The chimeric protein pAgoE, at normal temperatures, in the active somatic cell including including eukaryotic cell, carry out based on homologous recombination The genome targeting editor or the genome targeting editor based on non-homologous end joining (NHEJ) for repairing (HDR).
Further, chimeric protein pAgoE, guide oligonucleotide gNA and homologous recombination fragment HR of pAgoE-N types are made Come across it is intracellular, complete based on homologous recombination repair (HDR), including endogenous gene targeting delete or exogenous gene targeting strike The genome targeting editor for entering.
Based on as described above, using the technical scheme of the chimeric protein with genome targeting editting function of the present invention, Using the effector domain E with cleavage activity, when such as from DNA cleavage activity domains, chimeric protein pAgoE-N can be built, The chimeric protein can cut genome target site, genome double-strand break (DSB) be caused, so as to cause under gNA guiding By non-homologous end joining (NHEJ) homologous recombination repair (HDR), cause change, the disappearance of target area DNA sequence, or In the presence of DNA homologous recombination fragment, cause the gene elmination of target area or exogenous gene to insert, compile so as to complete gene Volume.During from apparent group of modification activities domain of DNA (Epigenome Modification Domain) as E domains, can build embedding Hop protein pAgoE-EM, apparent group of modification of the genome target site under gNA guiding, chimeric protein performs apparent group of volume Volume.
In sum, technical scheme according to the present invention, from entirety or particularly, with following features：
First, the chimeric protein pAgoE formed on the Integral Thought of Technology design or the chimeric protein with guide PAgoE, or the chimeric protein with genome targeting editting function, there is provided a kind of abundant technology platform and tool kit.
Second, in particular technique, there are various pAgo albumen available, such as include what natural PIWI was inactivated PAgo, the activated pAgo of natural PIWI, the activated pAgo artificial deactivations mutants of natural PIWI；There are three kinds of guide oligonucleoside The selection of acids type：The gRNA of 5 ' end phosphorylations, the gRNA of 5 ' terminal hydroxy groups, 5 ' end phosphorylations gDNA；External source can be selected Guide oligonucleotide, the guide oligonucleotide that endogenousization can also be selected.
3rd, can select to realize that the synchronous of multiple endogenousization guides produces by an expression cassette.
4th, guide (such as 24 cores longer than 21 nucleotide that CRISPR-CAS9 system is adopted can be selected Thuja acid), further reduce effect (off-targetting) of missing the target.
5th, in terms of protein molecular weight, pAgoE is generally smaller, and by taking dMpAgo-Fok as an example, it only has 842 Individual aminoacid, it is less than SpCas9 and SaCas9, advantageously account for ZFN, TALEN, CRISPR-CAS9 protein too big caused Some problems, be easy to use the means of delivery such as adeno-associated viruses (AAV) and realize in vivo gene editing (or gene therapy), also It is easy to assembled in vitro nucleic acid-protein granule, realizes participating in the safety under the premise of (DNA-free) without foreign DNA with rotaring transfecting mode Editor.
Description of the drawings
The accompanying drawing for constituting the part of the present invention is used for providing a further understanding of the present invention, the schematic reality of the present invention Apply example and its illustrate, for explaining the present invention, not constituting inappropriate limitation of the present invention.In the accompanying drawings：
Fig. 1 pAgoE chimeric protein structure ＆ working mechanism figures；
Fig. 2 PIWI binding residues analysis figures；
The DNA cleavage activities domain of Fig. 3 FokI；
The structure collection of illustrative plates of Fig. 4 (a) plasmid foki-rsago-pRS424-TRP；
The structure collection of illustrative plates of Fig. 4 (b) plasmid gNA-HR-pESCG-LEU；
Fig. 4 (c) gNA shot designs and homologous recombination fragment HR design diagram；
The gene knock-in that Fig. 4 (d) chimeric proteins Fok-RsAgo causes and the PCR locating verifications for knocking out；
The screening of muton physiological phenotype and checking that Fig. 4 (e) chimeric proteins Fok-RsAgo is obtained；
The structure collection of illustrative plates of Fig. 5 (a) plasmid foki-mpago-pRS424-TRP；
The screening of muton physiological phenotype and checking that Fig. 5 (b) chimeric proteins Fok-MpAgo is obtained；
The structure collection of illustrative plates of Fig. 6 (a) plasmid foki-dmpago-pRS424-TRP；
The gene knock-in that Fig. 6 (b) chimeric proteins Fok-dMpAgo causes and the PCR locating verifications for knocking out；
The muton sequence verification that Fig. 6 (c) chimeric proteins Fok-dMpAgo is obtained；
The screening of muton physiological phenotype and checking that Fig. 6 (d) chimeric proteins Fok-dMpAgo is obtained；
The structure collection of illustrative plates of Fig. 7 (a) plasmid foki-dngago-pRS424-TRP；
The structure collection of illustrative plates of Fig. 7 (b) plasmid HR-pESCG-LEU；
The phosphoric acid guides of Fig. 7 (c) 5 ' DNA is designed and homologous recombination fragment HR design diagram；
The screening of the orifice plate physiological phenotype of muton 24 and checking that Fig. 7 (d) chimeric proteins Fok-dNgAgo is obtained；
The structure collection of illustrative plates of Fig. 8 (a) plasmid foki-rsago-foki2-pRS424-TRP；
The screening of muton physiological phenotype and checking that Fig. 8 (b) chimeric proteins Fok-RsAgo-Fok is obtained；
The structure collection of illustrative plates of Fig. 9 (a) plasmid foki-dmpago-foki2-pRS424-TRP；
The gene knock-in that Fig. 9 (b) chimeric proteins Fok-dMpAgo-Fok causes and knockout PCR locating verifications；
The screening of muton physiological phenotype and checking that Fig. 9 (c) chimeric proteins Fok-dMpAgo-Fok is obtained；
The structure collection of illustrative plates of Figure 10 (a) plasmid foki-dngago-foki2-pRS424-TRP；
The gene knock-in that Figure 10 (b) chimeric proteins Fok-dNgAgo-Fok causes and knockout PCR locating verifications；
The screening of muton physiological phenotype and checking that Figure 10 (c) chimeric proteins Fok-dNgAgo-Fok is obtained；
The screening of the orifice plate physiological phenotype of muton 24 and checking that Figure 10 (d) chimeric proteins Fok-dNgAgo-Fok is obtained；
The structure collection of illustrative plates of Figure 11 (a) plasmid rsago-foki2-pRS424-TRP；
The gene knock-in that Figure 11 (b) chimeric proteins RsAgo-Fok causes and knockout PCR locating verifications；
The screening of muton physiological phenotype and checking that Figure 11 (c) chimeric proteins RsAgo-Fok is obtained；
The structure collection of illustrative plates of Figure 12 (a) plasmid dngago-foki2-pRS424-TRP；
The screening of the orifice plate physiological phenotype of muton 24 and checking that Figure 12 (b) chimeric proteins RsAgo-Fok is obtained.
Specific embodiment
It should be noted that in the case where not conflicting, the embodiment and the feature in embodiment in the present invention can phase Mutually combination.
Below with reference to the accompanying drawings and specific embodiment, the present invention is described in detail as follows：
The global design thought of the present invention, there is provided a kind of chimeric protein pAgoE, and chimeric protein pAgoE contains tool Have a pAgo domains of genome targeting positioning function, and be connected with the pAgo domains, with genome cutting or The effector domain E of modification activities.When effector domain E has cleavage activity, chimeric protein pAgoE can be applied in base Because on editor；When effector domain E has modification activities, chimeric protein pAgoE can be applied on genetic modification.
Further, based on chimeric protein pAgoE, with reference to guide gNA, to form the editor of the DNA under targeting is positioned Or the concrete application structure of modification, its application sketch under combining is as shown in Figure 1.
It is specifically as follows using example under based on as above global design thought：
Using PSI-Blast, 398 candidate pAgo are have found in ncbi database, be shown in Table 1.
The 398 candidate pAgo found in the ncbi database of table 1
Host's situation of above-mentioned 398 pAgo is analyzed, 43 pAgo for being derived from Thermophilic Bacteria such as TtAgo are rejected, obtain 355 Individual candidate pAgo, then pAgo of the aminoacid number less than 300 is rejected, 350 candidate pAgo are obtained, it is shown in Table 2.
Table 2 rejects the 350 candidate pAgo obtained after the pAgo of the pAgo and aminoacid number of Thermophilic Bacteria less than 300
Above-mentioned 350 candidate pAgo are searched, by pAgo group of between the different genera, amino acid sequence homology more than 99% Merge, leave representational pAgo, and by the different bases of the same species with Microcystis aeruginosa as representative Because serial number or protein sequence number are compared, representative series number are left, obtain 319 candidate pAgo, be shown in Table 3.
Table 3 merges 319 candidate pAgo that the sequence homology between different genera is more than after 99% pAgo
In 319 candidate pAgo listed in table 3, including PIWI domains have the active of nuclease PAgo, the dead pAgo also including PIWI domains without nuclease.Therein 55 using bioinformatic analysis The avtive spot of individual active pAgo predicts, as a result sees Fig. 2.
Microorganism fungus kind, basal medium and screening culture medium, condition of culture used by EXPERIMENTAL EXAMPLE：
(a) escherichia coli Escherichia coli DH5 α etc.：LB culture medium, 37 DEG C of cultures.
(b) amphiploid Saccharomyces Cerevisiae in S accharomyces cerevisiae SC4 (His-, Leu-, Trp-, Ura-)：YNB Culture medium, YPD culture medium, 30 DEG C, solid plate culture, during liquid submerged culture, using 30mL/250mL triangular flasks, shaking flask turns Fast 180rpm.
Experimental technique used by embodiment
The microbiology operating technology of involved saccharomyces cerevisiae and flow process and plasmid construction in the following example, turn Change, PCR is verified, gene sequencing verifies equimolecular biologic operation technology and flow process, in addition to the situation of following additional description, Carried out using conventional method, these conventional methods are the people that life sciences and biological technical field live through professional education or training The member institute basic fundamental being familiar with and grasped, translates, scientific publication referring to work, the Huang Peitangs such as Pehanorm Brooker (Sambrook, J.) etc. Society's publication of in August, 2002《Molecular Cloning:A Laboratory guide》(upper and lower volume) third edition, this specification is no longer specifically been described by.
For rapid evaluation genes of brewing yeast editorial efficiency, from the can1 that its coded product is arginine transport albumen Used as pattern target, this target is also that medical college George Qiu Qi professors seminar of Harvard University delivered in 2013 to gene Pattern target (the doi that CRISPR is used for employed in genes of brewing yeast editor's paper first：10.1093/nar/gkt135). Can1 genes can be with rapid screening phenotype as pattern target, and its ultimate principle is：If can1 gene mutation, losing will be thin Extracellular arginine transport enters the ability of cell, and the mutant can continue survival by self synthesis arginine, meanwhile, Because the disappearance of above-mentioned arginine transport ability, this kind of mutant can not transport canavanine this poisonous arginine class Like thing, thus can survive in the culture medium containing canavanine and normal growth；It is corresponding, can1 bases Starting strain because not edited (unmutated), but will be poisoned canavanine because possessing arginine transport ability, it is impossible to It is enough to survive in the culture medium containing canavanine.In order to improve the accuracy that canavanine assesses can1 gene editings, In following examples, related embodiment has been done further to the methodology that canavanine method assesses can1 gene editings in the present invention Improve, mainly include：1st, the canavanine concentration in culture medium brings up to 100ug/ml by the 60ug/ml in conventional method, with Just false positive is excluded.In order to preferably exclude false positive, in new method, the not direct screening-gene editor on canavanine flat board Transformant, for the gene editing that various pAgo cause, this improvement is even more important, because natural pAgo is very likely Only cause the single-strand break of institute targeting DNA and the probability of instantaneous single-stranded editor subsequently occur, this kind of possible transient single strand Editor's mutant, under the screening pressure that 60ug/ml brings up to 100ug/ml, it is possible to be further evolved into double-strand and edit completely True mutant phenotypic mutation strain screening and checking, and under the truth without screening pressure, this kind of possible transient single strand is compiled It is completely CAN genes wild type to collect the general always back mutation of mutant.Therefore, as a rule, complete to wine brewing After the chemical conversion of yeast or electric conversion operation and necessary incubation culture, avoid being coated with canavanine flat board as far as possible Screening operation, but only with auxotroph screening scheme, filter out on the flat board without canavanine and carry correlation The transformant of the purpose plasmid of the related genetic elements such as p, gNA, HR, afterwards, by these without the monoclonal on canavanine flat board It is diluted to bacteria suspension and implements photocopy process, screens phenotypic mutation strain.
On the basis of improving more than, with saccharomyces cerevisiae can1 genes as pattern gene, establish 3 physiological phenotypes and quickly sieve The experiment flow and method of choosing, it is specific as follows：
(a) flat board microdroplet photolithography.One traditional spread plate is represented with each microdroplet, so as on each flat board Carry out multiple experimental verification screenings.Comprise the following steps that：The liquid culture of bacteria suspension to be tested or bacterial strain to be tested is taken 500ul, in being placed at 96 orifice plates, is diluted to OD600Value 0.10, according to this on the basis of bacterium it is dense, then dilute 10 successively‐1、10‐2、10‐3、 10‐4Four dilution factors, respectively photocopy is to containing 100mg/mL canavanine and the LEU for not containing canavanine‐TRP‐YNB sieve Select on the flat board of culture medium, can grow on the flat board containing 100mg/mL canavanine screening culture medium for muton, and The number of the single bacterium colony of transformant can be passed through, not contain the single bacterium colony data for compareing flat board of canavanine as denominator, calculated Gene editing efficiency.
The micro- culture Evaluation Method of (b) 24 orifice plate.In order to judge the situation with the relatively low recombination fraction of rapid evaluation, the party is established Method：In the NaCl solution of picking single bacterium colony to 80 μ L, it is suspended, takes 35 μ L bacterium solutions and be injected separately into containing and do not contain 100mg/mL knives The LEU of conavanine‐TRP‐YNB solids select on 24 orifice plates of culture medium, can containing canavanine 24 orifice plate solid mediums on The as muton of growth.Jing dilution spreads demarcate the cfu numerical value per μ L bacterium solutions, according in the 24 orifice plate solids containing canavanine The clump count grown in culture medium, estimates gene editing efficiency.
C () flat board microdroplet counts culture method.One traditional spread plate is represented with each microdroplet, so as to flat at each Carry out multiple experimental verification screenings on plate.But unlike that above-mentioned flat board microdroplet photolithography, no longer respectively photocopy to containing 100mg/mL canavanine and the LEU for not containing canavanine‐TRP‐YNB screening culture medium flat board on, it is but every to demarcate Microlitre cfu numerical value, according to containing canavanine cultured on solid medium clump count, estimate gene editing efficiency.
5 '-PO of endogenousization employed in embodiment4- gRNA design principles
5 '-PO of 18 nucleotide that RsAgoE is used4- gRNA gNA, this guide oligonucleotide of cellular endogenous can Particular process of the RsAgo domains in rely on RsAgoE to 5 ' hydroxyl RNA after high abundance transcription, the course of processing is to quilt The RNA of processing has base Preference：Its 5 ' end start, be U, the 2nd nucleoside by the 1st nucleotide in 5 ' to 3 ' directions Acid is U or C.
Basic plasmid used is shown in Table 4：
The Basic plasmid list that the embodiment of table 4 is adopted
The plasmid of constructed pAgoE expression plasmids, carrying gNA expression cassettes and homologous recombination fragment, is shown in Table 5：
The plasmid table of chimeric protein expression plasmid, carrying gNA expression cassettes and homologous recombination fragment constructed by the embodiment of table 5
The gNA situations that constructed several representative chimeric protein pAgoE is used, are shown in Table 6：
The source of the pAgo of the representativeness pAgoE of table 6 and the gNA situation classification charts for being used
Constructed engineering bacterial strain is shown in Table 7：
Engineering bacterial strain table constructed by the embodiment of table 7
Embodiment one：The structure of chimeric protein Fok-RsAgo and genome editor.
From 319 candidate pAgo of table three, from RsAgo as pAgo domains；Made from the Fok I in Cobra venom endonuclease N-pAgo types pAgoE (hereinafter referred to as Fok-RsAgo) are built for E domains, using the Fok-RsAgo and carrying corresponding gNA and HR The plasmid cooperation of fragment, transformed yeast and successive transfer culture, detect gene editing situation.
1st, the structure of Fok-RsAgo expression plasmids and expression：
According to RsAgo albumen (the NCBI accession number of Rhodobacter sphaeroides ATCC 17025： ABP72561.1 the such as SEQ ID NO of aminoacid sequence):1, according to the base Preference of yeast, devise coding RsAgo albumen Rsago gene orders, and using overlap extension pcr, carried out the gene order synthetic and T clone, obtain rsago‐pEASY.According to endonuclease FokI albumen (the NCBI accession number of Planomicrobium okeanokoites: AAA24934.1 aminoacid sequence).Have chosen the PROTEIN C ends of Fok I from the 383rd aminoacid to the 579th aminoacid The DNA cleavage activity domains (Nuclease domains) of fokiC as the E domains (abbreviation Fok domains) in pAgoE, such as Fig. 3, according to ferment Female base Preference devises the gene order for encoding the domain.Using overlap extension pcr, synthetic is carried out And T clones, obtain foki-pEASY.From GGGGS as linker, using Overlapping round pcr promoter, fusions TEF, NLS, foki, linker, rsago and terminator CYC1, using Gibson Assembly methods, with linear plasmid The skeleton of pRS424-TRP assembles into plasmid foki-rsago-pRS424-TRP (as shown in fig. 4 a), and constructed is chimeric The aminoacid sequence of albumen Fok-RsAgo is shown in SEQ ID NO:4, it presses the encoding chimera protein of yeast base Preference design The gene order of Fok-RsAgo is shown in SEQ ID NO:13.By foki-rsago-pRS424-TRP using chemical method conversion wine brewing ferment Female SC4, obtains the chassis cell SC4-FRs of expression Fok-RsAgo chimeric proteins.
2nd, the structure of gNA expression cassettes and homology arm HR cloned plasmids
With reference to the genomic information of saccharomyces cerevisiae type strain Saccharomyces cerevisiae288c in NCBI, choosing Take coding arginine permease CAN1 gene can1 be target gene, coding strand choose the 30nt sequences 5 ' containing TT- CAAAGACATATTGGTATGATTGCCCTTGGT merges with SNR52 promoteres and SUP43FLANK sequences, then merges 30nt targets Brigade commander 596bp is same under the long 583bp homologous sequences of site upstream, the donor dna of the 20bp containing termination codon and 30nt target sites Source sequence, is connected to pESCG-LEU plasmid backbones, is built into gNA expression cassettes and homology arm cloned plasmids gNA30F-HR- PESCG-LEU (such as Fig. 4 b).- the CCTTCATCTTCATCACCTATGCCATC of 30nt sequences 5 ' for including TT is chosen in noncoding strand CTCC and SNR52 promoteres and SUP43FLANK sequences merge, then merge brigade commander 583bp homologous sequences on 30nt target sites, Brigade commander's 596bp sequences under the donor dna and 30nt target sites of 20bp, obtain homologous recombination fragment (HR), are connected to pESCG-LEU Plasmid backbone, is built into gNA expression cassettes and homology arm cloned plasmids gNA30R-HR-pESCG-LEU (see Fig. 4 b).Shot design See Fig. 4 c with the design of homologous recombination fragment HR.
3rd, SC4-FRs cell of the gNA-HR-pESCG-LEU plasmids translation table up to chimeric protein Fok-RsAgo
The competent cell of the SC4-FRs of the present embodiment step 1 acquisition is prepared, chemical transformation converts the present embodiment step The 2 gNA expression cassettes for preparing and homology arm cloned plasmids gNA30F-HR-pESCG-LEU or gNA30R-HR-pESCG-LEU.Specifically Including：By cell culture to OD600=0.5-1.0, is harvested by centrifugation cell, and cell is washed once with 1 × TE buffer, with 30 μ L 1 × LiAc/0.5 × TE is resuspended, is stored at room temperature 10min, adds 1 μ g plasmids gNA30F-HR-pESCG-LEU and 3 μ g HR fragments DNA (or plasmid gNA30R-HR-pESCG-LEU and 3 μ g HR piece segment DNAs) and 3 μ L ss-DNA (10.0mg/mL), adds 250 μ 1 × LiAc/40%PEG3350/1 of L × TE, mix homogeneously, 30 DEG C of incubation culture 30min add 30 μ L DMSO, and mixing is equal Even, 42 DEG C of heat shock 7min, centrifugation, supernatant discarded, 1 × TE of 1mL are washed once, are centrifuged, and supernatant discarded, 30 μ L bacterium solutions are coated in LEU‐ TRP‐YNB screening culture medium flat board on, 30 DEG C, cultivate 72 hours.
4th, muton molecular biology checking
By the present embodiment step 3 obtain in LEU‐TRP‐YNB screening culture medium on the transformant that grows, mixing makes Bacteria suspension, is inoculated in LEU‐TRP‐YNB fluid mediums in, 30 DEG C, 180rpm, shaking table culture, per 48 hours subcultures once, Culture line is isolated single bacterium colony by accumulative culture to after 264 hours, chooses single bacterium colony, and the micro- culture of 96 orifice plates 20 hours respectively takes 5 μ L bacterium solutions, packet mixing, dilution is cracked using homogenizer concussion, uses locating verification primer：CANYYF:5’‐ GATTGATAACTAGGCTGACGGGGT and CNXDYR:The inactivation of 5 '-GCAGTGATACCAACTAGTTCAGTACCT checking insertions The presence of gene, with knocking out primer is verified：CNAYWF:5’‐AGGATGGCATAGGTGATGAAGAT CNXDYR:5’‐ GCAGTGATACCAACTAGTTCAGTACCT checkings are knocked gene.The result such as Fig. 4 d, gNA30F experimental grouies：In 84 There are 21 for muton.There are 63 for WT.Recombination fraction is 25%.
5th, the physiological phenotype screening and checking of muton
Using flat board microdroplet photolithography, 192h, 216h, 240h in the successive transfer culture for respectively carrying out above-mentioned steps 4, The culture of 264h samples 500 μ L, is diluted to OD values 0.1, then successively according to 10‐1、10‐2、10‐3、10‐4Totally four dilution factors enter Row dilution, respectively photocopy is to containing 100mg/mL canavanine and the LEU for not containing canavanine‐TRP‐YNB culture medium flat plates On, gene editing efficiency is assessed, as a result such as Fig. 4 e.From the culture situation analysis of 264 hours, 10‐4Under dilution factor, contain 3 mutons are grown on the flat board of 100mg/mL canavanine screening culture medium, is grown on canavanine flat board is not contained 10, estimation gene editing efficiency 30%, the gene editing efficiency calculated with Molecular is coincide substantially.
Embodiment two：The structure of chimeric protein Fok-MpAgo and genome editor.
From 319 candidate pAgo of table three, from MpAgo as pAgo domains；Made from the Fok I in Cobra venom endonuclease N-pAgo types pAgoE (hereinafter referred to as Fok-MpAgo) are built for E domains, using the Fok-MpAgo and carrying corresponding gNA and HR The plasmid of fragment coordinates, and transformed yeast simultaneously edits its genome.
1st, the structure of Fok-MpAgo expression plasmids and expression：
According to MpAgo albumen (the NCBI accession number of Marinitoga piezophila：WP_014295921.1 amino) Acid sequence such as SEQ ID NO:2, according to the base Preference of yeast, the mpago gene orders of coding MpAgo albumen are devised, And using overlap extension pcr, carried out the gene order synthetic and T clone, obtain mpago-pEASY.Utilize The foki-pEASY that the step 1 of embodiment one is obtained, from GGGGS as linker, is melted using overlapping round pcrs Promoter TEF, NLS, foki, linker, mpago and terminator CYC1 are closed, it is and linear using Gibson Assembly methods The skeleton of plasmid pRS424-TRP assembles into plasmid foki-mpago-pRS424-TRP (as shown in Figure 5 a), constructed The aminoacid sequence of chimeric protein Fok-MpAgo is shown in SEQ ID NO:5, by the encoding chimera protein that yeast base Preference is designed The gene order of Fok-MpAgo is shown in SEQ ID NO:14.By foki-mpago-pRS424-TRP using chemical method conversion wine brewing ferment Female SC4, obtains the chassis cell SC4-FMp of expression Fok-MpAgo fusion protein.
2nd, the structure of gNA expression cassettes and homology arm cloned plasmids
With reference to the genomic information of saccharomyces cerevisiae type strain Saccharomyces cerevisiae288c in NCBI, choosing The gene can1 for taking coding arginine permease CAN1 is target gene, coding strand choose 30nt sequences 5 '- CAAAGACATATTGGTATGATTGCCCTTGGT merges with SNR52 promoteres and SUP43FLANK sequences, then merges 30nt targets Brigade commander 596bp is same under the long 583bp homologous sequences of site upstream, the donor dna of the 20bp containing termination codon and 30nt target sites Source sequence, is connected to pESCG-LEU plasmid backbones, is built into gNA expression cassettes and homology arm cloned plasmids gNA30F-HR- PESCG-LEU (such as Fig. 4 b).Noncoding strand choose the-CCTTCATCTTCATCACCTATGCCATCCTCC of 30nt sequences 5 ' with SNR52 promoteres and SUP43FLANK sequences merge, then merge brigade commander 583bp homologous sequences, the confession of 20bp on 30nt target sites Body DNA and long 596bp30nt target sites downstream sequence, obtain homologous recombination fragment (HR), are connected to pESCG-LEU plasmid bones Frame, is built into gNA expression cassettes and homology arm cloned plasmids gNA30R-HR-pESCG-LEU (such as Fig. 4 b).Shot design with it is homologous Recombinant fragment HR design such as Fig. 4 c.
3rd, SC4-FMp cell of the gNA-HR-pESCG-LEU plasmids translation table up to chimeric protein Fok-MpAgo
According to the method described by the step 3 of embodiment one, the competence of the SC4-FMp of the present embodiment step 1 acquisition is prepared Cell, chemical transformation converts the gNA expression cassettes and homology arm cloned plasmids gNA30F-HR- of the present embodiment step 2 preparation PESCG-LEU or gNA30R-HR-pESCG-LEU.
4th, the physiological phenotype screening and checking of muton
According to the method described by the step 5 of embodiment one, using flat board microdroplet photolithography, the liquid obtained to above-mentioned steps 3 Body culture carries out successive transfer culture, to 196h samplings, carries out physiological phenotype screening and checking, estimation conversion gNA30F-HR- PESCG-LEU experimental group gene editing efficiency is about 1%, converts gNA30R-HR-pESCG-LEU experimental group gene editing efficiency About 20%, as a result such as Fig. 5 b.
Embodiment three：The structure of chimeric protein Fok-dMpAgo and genome editor.
From 319 candidate pAgo of table three, from MpAgo PIWI inactive mutants dMpAgo as pAgo domains, choosing N-pAgo types pAgoE (hereinafter referred to as Fok-dMpAgo) are built as E domains with the Fok I in Cobra venom endonuclease, using the Fok- The plasmid of dMpAgo gNA and HR fragments corresponding with carrying coordinates, and transformed yeast simultaneously edits its genome.
1st, the structure of Fok-dMpAgo expression plasmids and expression：
According to MpAgo albumen (the NCBI accession number of Marinitoga piezophila：WP_014295921.1 amino) Acid sequence such as SEQ ID NO:2, according to the base Preference of yeast, the mpago gene orders of coding MpAgo albumen are devised, And using overlap extension pcr, carried out the gene order synthetic and T clone, obtain mpago-pEASY.With institute The mpago-pEASY plasmids of acquisition are template, the MpAgo albumen coded by mpago are carried out into point mutation in 446 sites, by Asp Ala is replaced into, T clonal mutation genes obtain dmpago-pEASY.The foki-pEASY obtained using the step 1 of embodiment one, From GGGGS as linker, using overlapping round pcr promoter, fusion TEF, NLS, foki, linker, Dmpago and terminator CYC1, using Gibson Assembly methods, assembles with the skeleton of linear plasmid pRS424-TRP Into plasmid foki-dmpago-pRS424-TRP (see shown in Fig. 6 a), the aminoacid sequence of constructed chimeric protein Fok-dMpAgo Row are shown in SEQ ID NO:The gene order of 6, its encoding chimera protein Fok-dMpAgo designed by yeast base Preference is shown in SEQ ID NO:15.Foki-dmpago-pRS424-TRP is utilized into chemical method transformed saccharomyces cerevisiae SC4, expression Fok-dMpAgo is obtained The chassis cell SC4-FdMp of fusion protein.
2nd, the structure of gNA expression cassettes and homology arm HR cloned plasmids
According to the method described by the step 2 of embodiment one, gNA expression cassettes and homology arm HR cloned plasmids gNA30F- are built HR-pESCG-LEU (see Fig. 4 b) and gNA30R-HR-pESCG-LEU (see Fig. 4 b).The design of target spot and homologous recombination fragment HR Design, see Fig. 4 c.
3rd, SC4-FdMp cell of the gNA-HR-pESCG-LEU plasmids translation table up to chimeric protein Fok-dMpAgo
According to the method described by the step 3 of embodiment one, the competence of the SC4-FdMp of the present embodiment step 1 acquisition is prepared Cell, chemical transformation converts the gNA expression cassettes and homology arm cloned plasmids gNA30F-HR- of the present embodiment step 2 preparation PESCG-LEU or gNA30R-HR-pESCG-LEU.
4th, the molecular biology checking of muton
Molecular is carried out according to the method described by the step 4 of embodiment one, as a result such as Fig. 6 b.Conversion gNA30F-HR- PESCG-LEU experimental grouies：There are 78 in 94 bacterial strains for muton, there are 16 for WT, recombination fraction is 82.97%.Choose 10 Muton is sequenced, and as a result shows that donor DNA sequences are all inserted into set target area, and target sequence is included in can1 genes 168bp gene orders are knocked, and 10 transformants are all knocked in and knocked out it is anticipated that realizing targeting, as a result such as Fig. 6 c.
5th, the physiological phenotype screening and checking of muton
According to the method described by the step 5 of embodiment one, using flat board microdroplet photolithography, the present embodiment step 4 is obtained Liquid culture carry out successive transfer culture, the culture of 192h, 216h, 240h, 264h samples 500 μ L, is diluted to OD values 0.1, then successively according to 10‐1、10‐2、10‐3、10‐4Totally four dilution factors are diluted, and respectively photocopy is to containing 100mg/mL Semen Canavaliaes Propylhomoserin and the LEU for not containing canavanine‐TRP‐YNB culture medium flat plates on, gene editing efficiency is assessed, as a result such as Fig. 6 d.From The culture situation analysis of 264 hours, 10‐4Under dilution factor, on the flat board containing 100mg/mL canavanine screening culture medium 14 mutons are grown, without growing 22 on canavanine flat board, gene editing efficiency 63.6% is estimated, with molecule The gene editing efficiency that checking is calculated is coincide substantially.
Example IV：The structure of chimeric protein Fok-dNgAgo and genome editor.
From 319 candidate pAgo of table three, from NgAgo PIWI mutants dNgAgo as pAgo domains；From core Fok I in sour restriction endonuclease builds N-pAgo types pAgoE (hereinafter referred to as Fok-dNgAgo) as E domains, using the Fok-dNgAgo Coordinate with the plasmid of 5 ' phosphoric acid guide DNA and HR fragments, transformed yeast simultaneously edits its genome.
1st, the structure of Fok-dNgAgo expression plasmids and expression：
According to the NgAgo albumen (NCBI accession number WP_005580376.1) of Natronobacterium gregoryi Aminoacid sequence such as SEQ ID NO:3, gene order is designed according to the base Preference of yeast, using overlap extension pcr, The synthetic and T clone of the gene order has been carried out, ngago-pEASY has been obtained.It is with the ngago-pEASY plasmids for being obtained Template, point mutation is carried out by the NgAgo albumen coded by ngago in 663 sites, and Asp is replaced into into Ala, T clone's point mutation bases Cause, obtains dngago-pEASY.The foki-pEASY obtained using the step 1 of embodiment one, from GGGGS as linker, Using overlapping PCR promoter, fusions TEF, NLS, foki, linker, dngago and terminator CYC1, adopt Gibson Assembly methods, with the skeleton of linear plasmid pRS424-TRP plasmid foki-dngago- is assembled into The aminoacid sequence of pRS424-TRP (as shown in Figure 7a), constructed chimeric protein Fok-dNgAgo is shown in SEQ ID NO:7, its The gene order of the encoding chimera protein Fok-dNgAgo designed by yeast base Preference is shown in SEQ ID NO:16.By foki- Dngago-pRS424-TRP utilizes chemical method transformed saccharomyces cerevisiae SC4, and the chassis for obtaining expression Fok-dNgAgo fusion protein is thin Born of the same parents SC4-FdNg.
2nd, 5 ' phosphoric acid guide DNA and homology arm HR are designed
Choose the gene can1 that arginine permease CAN1 is encoded in Saccharomyces cerevisiae 288c genomes For target gene, the guide DNA of the synthesis 5 ' phosphorylations homologous with 24bp on coding strand:Rv‐5’‐PO4‐gDNA:5’p‐ The guide DNA of CACTTCAGCGTTCTGTACTTCTCC and the 5 ' phosphorylations homologous with 24bp on noncoding strand：Fw‐5’‐PO4‐ gDNA:5’p‐GTAAATGGCGAGGATACGTTCTCT.Fusion target site on brigade commander's 583bp homologous sequences, containing termination codon 20bp donor dnas and 30nt target sites under brigade commander's 596bp homologous sequences, be connected to pESCG-LEU plasmid backbones, build homologous Arm cloned plasmids HR-pESCG-LEU (see Fig. 7 b).Shot design is shown in Fig. 7 c with HR designs.
3rd, SC4-FdNg of 5 ' the phosphoric acid guide DNA and HR-pESCG-LEU plasmid translation tables up to chimeric protein Fok-dNgAgo
The competent cell of the SC4-FdNg of the present embodiment step 1 acquisition is prepared, chemical transformation conversion above-mentioned steps 2 are same Guide DNA Rv-5 '-PO4-gDNA or the Fw-5 '-PO4-gDNA of the source arm cloned plasmids phosphorylations of HR-pESCG-LEU and 5 '.It is right HR-pESCG-LEU plasmids are only converted according to group.Concrete grammar：By cell culture to OD600=0.5-1, harvesting, with 1 × TE buffer washes cell once, resuspended with 30 μ 1 × LiAc/0.5 of L × TE, is stored at room temperature 10min, adds 1 μ g plasmid HR- PESCG-LEU, 3 μ g HR piece segment DNAs, guide DNA Rv-5 '-PO4-gDNA or the Fw-5 '-PO4-gDNA of the phosphorylations of 2 μ g 5 ' With 3 μ L ss-DNA (10.0mg/ml), 250 μ 1 × LiAc/40%PEG3350/1 of L × TE, mix homogeneously, 30 DEG C of incubations are added 30min, adds 30 μ L DMSO, mix homogeneously, 42 DEG C of thermal shock 7min, centrifugation, supernatant discarded, 1mL1 × TE to wash once, is centrifuged, Supernatant discarded, 30 μ L bacterium solutions are coated in LEU‐TRP‐YNB screening culture medium flat board on, at 30 DEG C, cultivate 72 hours.
4th, the physiological phenotype screening and checking of muton
Using the micro- culture Evaluation Method of 24 orifice plates.The F-5 '-PO4-gRNA experimental grouies that the present embodiment step 3 is obtained and control Group is in LEU‐TRP‐YNB screening culture medium on the single bacterium colony of transformant that grows, carry out the micro- culture of 24 orifice plates.As a result Fig. 7 d are seen. As a result show, Fok-dNgAgo has faint gene editing activity：In culture medium containing canavanine, matched group does not grow any Bacterium colony, has 9 holes to grow 16 bacterium colonies in 24 holes of experimental group, with the bacterium that sets out it is dense be every hole 2.74X105Cfu is calculated, and estimates base Because editorial efficiency is 0.24X10‐5.Embodiment five：The structure of chimeric protein Fok-RsAgo-Fok and genome editor.
From 319 candidate pAgo of table three, from RsAgo as pAgo domains；Made from the Fok I in Cobra venom endonuclease N-pAgo-N types pAgoE (hereinafter referred to as Fok-RsAgo-Fok) are built for E domains, it is corresponding to carrying using the Fok-RsAgo-Fok The plasmid of gNA and HR fragments coordinate, transformed yeast simultaneously edits its genome.
1st, the structure of Fok-RsAgo-Fok expression plasmids and expression：
According to endonuclease FokI albumen (the NCBI accession number of Planomicrobium okeanokoites: AAA24934.1 aminoacid sequence).The foki-pEASY obtained using the step 1 of embodiment one, and according to the alkali of yeast Base Preference devises the foki2 genes of consensus amino acid sequence that is different from foki gene orders but keeping expressed albumen domain Sequence, using overlap extension pcr, has carried out synthetic and T clones, obtains foki2-pEASY.With the institute of embodiment one The rsago-pEASY of structure is template, and from GGGGS as linker, C-terminal selects GGGGSGGGGS as linker2 to N-terminal, Using overlapping PCR promoter, fusions TEF, NLS, foki, linker, rsago, linker2, foki2 and terminator CYC1, using Gibson Assembly methods, with the skeleton of linear plasmid pRS424-TRP plasmid foki- is assembled into The aminoacid sequence of rsago-foki2-pRS424-TRP (as shown in Figure 8 a), constructed chimeric protein Fok-RsAgo-Fok See SEQ ID NO:The gene order of 8, its encoding chimera protein Fok-RsAgo-Fok designed by yeast base Preference is shown in SEQ ID NO:17.Foki-rsago-foki2-pRS424-TRP is utilized into chemical method transformed saccharomyces cerevisiae SC4, is expressed The chassis cell SC4-FRsF of Fok-RsAgo-Fok chimeric proteins.
2nd, the structure of gNA expression cassettes and homology arm HR cloned plasmids
Carry out according to the method described by the step 2 of embodiment one.
3rd, chassis cell SC4-FRsF of the gNA-HR-pESCG-LEU plasmids translation table up to chimeric protein Fok-RsAgo-Fok
According to the method described by the step 3 of embodiment one, the chassis cell SC4-FRsF of the present embodiment step 1 acquisition is prepared Competent cell, chemical transformation convert the present embodiment step 2 preparation gNA expression cassettes and homology arm cloned plasmids GNA30F-HR-pESCG-LEU or gNA30R-HR-pESCG-LEU.
4th, the physiological phenotype screening and checking of muton
Using flat board microdroplet photolithography, by the present embodiment step 3 obtain in LEU‐TRP‐YNB screening culture medium on it is long The transformant for going out, mixing, makes bacterial suspension inoculation in LEU‐TRP‐YNB fluid mediums in, 30 DEG C, 180rpm, shaking table training Support, sample and subculture within 48 hours, carry out physiological phenotype screening and verify respectively at sampling in 48h and 72 hour, as a result show Fok- RsAgo-Fok has gene editing activity, such as Fig. 8 b.
Embodiment six：The structure of chimeric protein Fok-dMpAgo-Fok and genome editor.
From 319 candidate pAgo of table three, from MpAgo PIWI inactive mutants dMpAgo as pAgo domains；Choosing N-pAgo-N types pAgoE (hereinafter referred to as Fok-dMpAgo-Fok) are built as E domains with the Fok I in Cobra venom endonuclease, adopting should The plasmid of Fok-dMpAgo-Fok gNA and HR fragments corresponding with carrying coordinates, and transformed yeast simultaneously edits its genome.
1st, the structure of Fok-dMpAgo-Fok expression plasmids and expression：
According to the method described by step 1 in embodiment five, with the step 1 of embodiment three acquisition dmpago-pEASY as mould Plate, N-terminal from GGGGS as linker, from GGGGSGGGGS, as linker2, using overlapping PCR melted by C-terminal Promoter TEF, NLS, foki, linker, dmpago, linker2, foki2 and terminator CYC1 are closed, using Gibson Assembly methods, with the skeleton of linear plasmid pRS424-TRP plasmid foki-dmpago-foki2- is assembled into The aminoacid sequence of pRS424-TRP (as illustrated in fig. 9), constructed chimeric protein Fok-dMpAgo-Fok is shown in SEQ ID NO: The gene order of 9, its encoding chimera protein Fok-dMpAgo-Fok designed by yeast base Preference is shown in SEQ ID NO:18. Foki-dmpago-foki2-pRS424-TRP is utilized into chemical method transformed saccharomyces cerevisiae SC4, expression Fok-dMpAgo- is obtained The chassis cell SC4-FdMpF of Fok chimeric proteins.
2nd, the structure of gNA expression cassettes and homology arm HR cloned plasmids
Carry out according to the method described by the step 2 of embodiment two.
3rd, chassis cell of the gNA-HR-pESCG-LEU plasmids translation table up to chimeric protein Fok-dMpAgo-Fok
SC4‐FdMpF。
According to the method described by the step 3 of embodiment one, the chassis cell SC4- of the present embodiment step 1 acquisition is prepared The competent cell of FdMpF, chemical transformation converts the gNA expression cassettes and homology arm cloned plasmids of the present embodiment step 2 preparation GNA30F-HR-pESCG-LEU or gNA30R-HR-pESCG-LEU.
4th, the molecular biology checking of muton
According to the method described by the step 4 of embodiment one, by the present embodiment step 3 obtain in LEU‐TRP‐YNB sieve The transformant grown in culture medium, picking single bacterium colony is selected to be inoculated in 96 orifice plate LEU‐TRP‐YNB fluid mediums in, 30 DEG C, 180rpm, micro- culture carries out molecular biology checking after 20 hours, as a result sees Fig. 9 b, converts gNA30F-HR-pESCG-LEU realities Test group：The all WT of 48 monoclonals, fail to obtain muton.Have 1 in conversion gNA30R-HR-pESCG-LEU experimental grouies 40 Individual muton, has 39 for WT, and recombination fraction is 2.5%.
5th, the screening of muton physiological phenotype and checking
According to the method described by the step 5 of embodiment one, using flat board microdroplet photolithography, the present embodiment step 3 is obtained In LEU‐TRP‐YNB screening culture medium on grow transformant mixing, make bacterial suspension inoculation in LEU‐TRP‐YNB In fluid medium, 30 DEG C, 180rpm, shaking table culture, was carried out per 48 hours subcultures once respectively at sampling in 48h and 72 hour Physiological phenotype is screened and checking, as a result shows the gNA30F-HR-pESCG-LEU experimental grouies and gNA30R- of Fok-RsAgo-Fok HR-pESCG-LEU experimental grouies detect gene editing activity, such as Fig. 9 c.
Embodiment seven：The structure of chimeric protein Fok-dNgAgo-Fok and genome editor.
From 319 candidate pAgo of table three, from NgAgo PIWI inactive mutants dNgAgo as pAgo domains；Choosing N-pAgo-N types pAgoE (hereinafter referred to as Fok-dNgAgo-Fok) are built as E domains with the Fok I in Cobra venom endonuclease, adopting should The plasmid of the phosphoric acid guide DNA and HR fragments of Fok-dNgAgo-Fok and 5 ' coordinates, and transformed yeast simultaneously edits its genome.
1st, the structure of Fok-dNgAgo-Fok expression plasmids and expression：
According to the method described by step 1 in embodiment five, with example IV step 1 acquisition dngago-pEASY as mould Plate, N-terminal from GGGGS as linker, from GGGGSGGGGS, as linker2, using overlapping PCR melted by C-terminal Promoter TEF, NLS, foki, linker, dngago, linker2, foki2 and terminator CYC1 are closed, using Gibson Assembly methods, with the skeleton of linear plasmid pRS424-TRP plasmid foki-dngago-foki2- is assembled into PRS424-TRP (as shown in Figure 10 a), the aminoacid sequence of constructed chimeric protein Fok-dNgAgo-Fok is shown in SEQ ID NO:The gene order of 10, its encoding chimera protein Fok-dNgAgo-Fok designed by yeast base Preference is shown in SEQ ID NO:19.Foki-dngago-foki2-pRS424-TRP is utilized into chemical method transformed saccharomyces cerevisiae SC4, expression Fok- is obtained The chassis cell SC4-FdNgF of dNgAgo-Fok chimeric proteins.
2nd, 5 ' phosphoric acid guide DNA and homology arm HR are designed
Carried out using the method described by the step 2 of embodiment three.
3rd, SC4- of 5 ' the phosphoric acid guide DNA and HR-pESCG-LEU plasmid translation tables up to chimeric protein Fok-dNgAgo-Fok FdNgF
Using the method described by the step 3 of embodiment one, the chassis cell SC4- of the present embodiment step 1 acquisition is prepared The competent cell of FdNgF, chemical transformation converts the present embodiment step 2 homology arm cloned plasmids HR-pESCG-LEU and Fw- 5 '-PO4-gDNA or Rv-5 '-PO4-gDNA.Matched group only converts HR-pESCG-LEU plasmids.
4th, the physiological phenotype screening and checking of muton
Using flat board microdroplet count culture method, by appeal step 3 obtain in LEU‐TRP‐Grow in YNB screening culture medium Transformant, choose single bacterium colony, be suspended in 70ulNaCl solution and prepare bacteria suspension, bacteria suspension Jing dilution spreads demarcate measure bacterium It is dense for 7870cfu/ μ L.3 μ l bacterium solutions photocopy are taken respectively to containing 100mg/mL canavanine and the LEU for not containing canavanine‐ TRP‐YNB screening culture medium flat board on, can grow on the flat board containing 100mg/mL canavanine screening culture medium For muton.In Fw-5 '-PO4-gDNA experimental grouies, there are 25 to grow on canavanine flat board in 60 bacterium, it is dense with the bacterium that sets out It is every drop (3ul) 2.36 × 104Meter, average gene editorial efficiency is estimated as 1.76 × 10‐5.Rv-5 '-PO4-gDNA experimental grouies In, there are 21 to grow on canavanine flat board in 60 bacterium, estimation gene editing efficiency is 1.48 × 10‐5, as a result as schemed 10c.These transformants Jing PCR verifies that in addition to F-5 '-PO4-gRNA experimental grouies have 1 WT, remaining is and realizes external source base Because knocking in the muton knocked out with target gene, as a result such as Figure 10 b.
In order to further confirm that the gene editing activity of the Fok-dNgAgo-Fok, the micro- culture of 24 orifice plates, assessment weight are carried out Group rate, is as a result shown in Figure 10 d, as a result shows, Fok-dNgAgo-Fok has gene editing activity：In culture medium containing canavanine On, matched group does not grow any bacterium colony, has in 24 holes of experimental group on 14 holes and grows 65 bacterium colonies altogether, and Jing is demarcated, and is gone out It is every hole 2.54X10 to send out bacterium dense5Cfu is calculated, and estimation gene editing efficiency is 1.1X10‐5。
Embodiment eight：The structure of chimeric protein RsAgo-Fok and genome editor.
From 319 candidate pAgo of table three, from RsAgo as pAgo domains；Made from the Fok I in Cobra venom endonuclease For E domains, pAgo-N types pAgoE (hereinafter referred to as RsAgo-Fok) are built, it is corresponding to carrying using chimeric protein RsAgo-Fok The plasmid of gNA and HR fragments coordinate, transformed yeast simultaneously edits its genome.
1st, the structure of RsAgo-Fok expression plasmids and expression：
According to according to the method described by step 1 in embodiment one, foki2- is obtained using the step 1 of embodiment five , as template, N-terminal from GGGGS as linker, select by C-terminal for pEASY, the constructed rsago-pEASY with embodiment one GGGGSGGGGS as linker2, using overlapping PCR promoter, fusion TEF, NLS, rsago, linker2, Foki2 and terminator CYC1, using Gibson Assembly methods, assembles with the skeleton of linear plasmid pRS424-TRP Into plasmid rsago-foki2-pRS424-TRP (as shown in fig. 11a), the aminoacid sequence of constructed chimeric protein RsAgo-Fok Row are shown in SEQ ID NO:The gene order of 11, its encoding chimera protein RsAgo-Fok designed by yeast base Preference is shown in SEQ ID NO:20.Rsago-foki2-pRS424-TRP is utilized into chemical method transformed saccharomyces cerevisiae SC4, expression chimeric protein is obtained The chassis cell SC4-RsF of RsAgo-Fok.
2nd, the structure of gNA expression cassettes and homology arm HR cloned plasmids
Procedure is identical with the step 2 of embodiment one.
3rd, chassis cell SC4-RsF of the gNA-HR-pESCG-LEU plasmids translation table up to chimeric protein RsAgo-Fok
According to the method described by the step 3 of embodiment one, the chassis cell SC4-RsF of the present embodiment step 1 acquisition is prepared Competent cell, chemical transformation conversion above-mentioned steps 2 prepare gNA expression cassettes and homology arm cloned plasmids gNA30F-HR- PESCG-LEU or gNA30R-HR-pESCG-LEU.
4th, the molecular biology checking of muton
According to the method described by the step 4 of embodiment one, by the present embodiment step 3 obtain in LEU‐TRP‐YNB screening The transformant grown in culture medium, picking single bacterium colony is inoculated in 96 orifice plate LEU‐TRP‐YNB fluid mediums in, 30 DEG C, 180rpm, micro- culture carries out molecular biology checking after 20 hours, as a result sees Figure 11 b.As a result show, gNA30F-HR-pESCG- LEU experimental grouies：There is 1 muton in 48 bacterium colonies, there are 47 for WT, recombination fraction is 2.08%, gNA30R-HR-pESCG-LEU Experimental group fails to detect Positive mutants.
5th, the physiological phenotype screening and checking of muton
According to the method described by the step 5 of embodiment one, using flat board microdroplet photolithography, the present embodiment step 3 is obtained In LEU‐TRP‐YNB screening culture medium on the transformant that grows, mixing makes bacterial suspension inoculation in LEU‐TRP‐YNB liquid In body culture medium, 30 DEG C, 180rpm, shaking table culture, was given birth to per 48 hours subcultures once respectively at sampling in 48h and 72 hour Reason phenotypic screen and checking.As a result see Figure 11 c, as a result show RsAgo-Fok gNA30F-HR-pESCG-LEU experimental grouies and GNA30R-HR-pESCG-LEU experimental grouies detect gene editing activity.
Embodiment nine：The structure of chimeric protein dNgAgo-Fok and genome editor.
From 319 candidate pAgo of table three, from NgAgo PIWI mutants as pAgo domains；From endonuclease Fok I in enzyme builds pAgo-N types pAgoE (hereinafter referred to as dNgAgo-Fok) as E domains, using the dNgAgo-Fok and carrying The plasmid of 5 ' phosphoric acid guide DNA and HR fragments coordinates, and transformed yeast simultaneously edits its genome.
1st, the structure of dNgAgo-Fok expression plasmids and expression：
According to according to the method described by step 1 in embodiment one, foki2- is obtained using the step 1 of embodiment five PEASY, the dngago-pEASY obtained with the step 1 of embodiment three as template, C-terminal from GGGGSGGGGS as linker2, Using overlapping PCR promoter, fusions TEF, NLS, dngago, linker2, foki2 and terminator CYC1, adopt Gibson Assembly methods, with the skeleton of linear plasmid pRS424-TRP plasmid dngago-foki2- is assembled into The aminoacid sequence of pRS424-TRP (as figure 12 a shows), constructed chimeric protein dNgAgo-Fok is shown in SEQ ID NO:12, The gene order of its encoding chimera protein dNgAgo-Fok designed by yeast base Preference is shown in SEQ ID NO:21.Will Dngago-foki2-pRS424-TRP utilizes chemical method transformed saccharomyces cerevisiae SC4, obtains expression dNgAgo-Fok fusion protein Chassis cell SC4-dNgF.
2nd, 5 ' phosphoric acid guide DNA and homology arm HR are designed
Carry out according to the method described by the step 2 of embodiment three.
3rd, SC4-dNgF of 5 ' the phosphoric acid guide DNA and HR-pESCG-LEU plasmid translation tables up to dNgAgo-Fok fusion protein
According to the method described by the step 3 of embodiment one, the chassis cell SC4-dNgF of the present embodiment step 1 acquisition is prepared Competent cell, chemical transformation convert the present embodiment step 2 acquisition homology arm cloned plasmids HR-pESCG-LEU and 5 ' Guide DNA Fw-5 '-PO4-gDNA or the Rv-5 '-PO4-gDNA of phosphorylation.Matched group only converts HR-pESCG-LEU plasmids.
4th, the physiological phenotype screening and checking of muton
According to method described by example IV step 4, the micro- culture of 24 orifice plates is carried out, assess recombination fraction, as a result see 12b.Knot Fruit shows that dNgAgo-Fok has gene editing activity：Matched group does not grow any bacterium colony in culture medium containing canavanine, Experimental group has 22 holes to grow 320 bacterium colonies altogether in culture medium containing canavanine in 24 holes, with the bacterium that sets out it is dense be every hole 2.74X105Cfu is calculated, and estimation gene editing efficiency is 4.8X10‐5。
The initialism being related in patent specification collects, and is shown in Table 8.
Initialism catalog in the patent specification of table 8
Presently preferred embodiments of the present invention is the foregoing is only, not to limit the present invention, such as：If in pAgoE E domains using the EGFP with fluorescence display function, then can be used for genome spike, if the E domains in pAgoE are using having Module with transcriptional activation function or suppression, then can be used for transcript profile regulation and control, and these are all in the spirit and principles in the present invention Within, any modification, equivalent substitution and improvements made etc. should be included within the scope of the present invention.
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:1
<211> 777
<212> PRT
<213> Rhodobacter sphaeroides
<400> SEQ ID NO:1
Met Ala Pro Val Gln Ala Ala Asp Glu Met Tyr Asp Ser Asn Pro His
1 5 10 15
Pro Asp Arg Arg Gln Leu Val Ser Asn Gly Phe Glu Val Asn Leu Pro
20 25 30
Asp Gln Val Glu Val Ile Val Arg Asp Leu Pro Asp Pro Ser Lys Val
35 40 45
Lys Glu Glu Arg Thr Arg Leu Met Gly Tyr Trp Phe Val His Trp Phe
50 55 60
Asp Gly Lys Leu Phe His Leu Arg Ile Lys Ala Gly Gly Pro Asn Val
65 70 75 80
Asp Gly Glu His Arg Ala Ile Arg Thr Ala Glu His Pro Trp Leu Leu
85 90 95
Arg Ala Arg Leu Asp Asp Ala Leu Glu Glu Ala Leu Pro Lys Tyr Ala
100 105 110
Ala Val Lys Lys Arg Pro Phe Thr Phe Leu Ala Gln Lys Asp Glu Leu
115 120 125
Ile Asp Ala Ala Ala Thr Ala Ala Gly Leu Ser His Arg Leu Leu Asn
130 135 140
Ser Phe Lys Val Ile Pro Arg Phe Ala Leu Ser Pro Lys Ile Tyr Glu
145 150 155 160
Pro Val Asp Gly Thr Thr Arg Val Gly Val Phe Val Thr Ile Gly Met
165 170 175
Arg Tyr Asp Ile Glu Ala Ser Leu Arg Asp Leu Leu Glu Ala Gly Ile
180 185 190
Asp Leu Arg Gly Met Tyr Val Val Arg Arg Lys Arg Gln Pro Gly Glu
195 200 205
Arg Gly Leu Leu Gly Arg Val Arg Ala Ile Ser Asp Asp Met Val Gln
210 215 220
Leu Phe Glu Glu Thr Asp Leu Ala Ser Val Asn Val Asn Asp Ala Lys
225 230 235 240
Leu Glu Gly Ser Lys Glu Asn Phe Thr Arg Cys Leu Ser Ala Leu Leu
245 250 255
Gly His Asn Tyr Lys Lys Leu Leu Asn Ala Leu Asp Asp Gln Glu Ala
260 265 270
Gly Tyr Arg Thr Gly Pro Arg Phe Asp Asp Ala Val Arg Arg Met Gly
275 280 285
Glu Phe Leu Ala Lys Lys Pro Ile Arg Leu Ala Asp Asn Ile Asn Ala
290 295 300
Gln Val Gly Asp Arg Ile Val Phe Ser Asn Glu Gly Gln Ala Arg Asn
305 310 315 320
Val Arg Leu Ala Pro Lys Val Glu Tyr Val Phe Asp Arg Thr Gly Ala
325 330 335
Lys Ser Ala Glu Tyr Ala Trp Arg Gly Leu Ser Gln Phe Gly Pro Phe
340 345 350
Asp Arg Pro Ser Phe Ala Asn Arg Ser Pro Arg Ile Leu Val Val Tyr
355 360 365
Pro Ser Ser Thr Gln Gly Lys Val Glu Asn Phe Leu Ser Ala Phe Arg
370 375 380
Asp Gly Met Gly Ser Asn Tyr Ser Gly Phe Ser Lys Gly Phe Val Asp
385 390 395 400
Leu Met Gly Leu Thr Lys Val Glu Phe Val Met Cys Pro Val Glu Val
405 410 415
Ser Ser Ala Asp Arg Asn Gly Ala His Thr Lys Tyr Asn Ser Ala Ile
420 425 430
Glu Asp Lys Leu Ala Gly Ala Gly Glu Val His Ala Gly Ile Val Val
435 440 445
Leu Phe Glu Asp His Ala Arg Leu Pro Asp Asp Arg Asn Pro Tyr Ile
450 455 460
His Thr Lys Ser Leu Leu Leu Thr Leu Gly Val Pro Thr Gln Gln Val
465 470 475 480
Arg Met Pro Thr Val Leu Leu Glu Pro Lys Ser Leu Gln Tyr Thr Leu
485 490 495
Gln Asn Phe Ser Ile Ala Thr Tyr Ala Lys Leu Asn Gly Thr Pro Trp
500 505 510
Thr Val Asn His Asp Lys Ala Ile Asn Asp Glu Leu Val Val Gly Met
515 520 525
Gly Leu Ala Glu Leu Ser Gly Ser Arg Thr Glu Lys Arg Gln Arg Phe
530 535 540
Val Gly Ile Thr Thr Val Phe Ala Gly Asp Gly Ser Tyr Leu Leu Gly
545 550 555 560
Asn Val Ser Lys Glu Cys Glu Tyr Glu Gly Tyr Ser Asp Ala Ile Arg
565 570 575
Glu Ser Met Thr Gly Ile Leu Arg Glu Leu Lys Lys Arg Asn Asn Trp
580 585 590
Arg Pro Gly Asp Thr Val Arg Val Val Phe His Ala His Arg Pro Leu
595 600 605
Lys Arg Val Asp Val Ala Ser Ile Val Phe Glu Cys Thr Arg Glu Ile
610 615 620
Gly Ser Asp Gln Asn Ile Gln Met Ala Phe Val Thr Val Ser His Asp
625 630 635 640
His Pro Phe Val Leu Ile Asp Arg Ser Glu Arg Gly Leu Glu Ala Tyr
645 650 655
Lys Gly Ser Thr Ala Arg Lys Gly Val Phe Ala Pro Pro Arg Gly Ala
660 665 670
Ile Ser Arg Val Gly Arg Leu Thr Arg Leu Leu Ala Val Asn Ser Pro
675 680 685
Gln Leu Ile Lys Arg Ala Asn Thr Pro Leu Pro Thr Pro Leu Leu Val
690 695 700
Ser Leu His Pro Asp Ser Thr Phe Lys Asp Val Asp Tyr Leu Ala Glu
705 710 715 720
Gln Ala Leu Lys Phe Thr Ser Leu Ser Trp Arg Ser Thr Leu Pro Ala
725 730 735
Ala Thr Pro Val Thr Ile Phe Tyr Ser Glu Arg Ile Ala Glu Leu Leu
740 745 750
Gly Arg Leu Lys Ser Ile Pro Asn Trp Ser Ser Ala Asn Leu Asn Ile
755 760 765
Lys Leu Lys Trp Ser Arg Trp Phe Leu
770 775
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:2
<211> 639
<212> PRT
<213> Marinitoga piezophila
<400> SEQ ID NO:2
Met Tyr Leu Asn Leu Tyr Lys Ile Asp Ile Pro Lys Lys Ile Lys Arg
1 5 10 15
Leu Tyr Phe Tyr Asn Pro Asp Met Glu Pro Lys Leu Phe Ala Arg Asn
20 25 30
Leu Ser Arg Val Asn Asn Phe Lys Phe Gln Asp Ser Asn Asp Leu Val
35 40 45
Trp Ile Glu Ile Pro Asp Ile Asp Phe Gln Ile Thr Pro Lys Asn Val
50 55 60
Phe Gln Tyr Lys Val Glu Lys Glu Glu Ile Ile Lys Glu Glu Glu Asp
65 70 75 80
Lys Lys Leu Phe Val Lys Thr Leu Tyr Lys Tyr Ile Lys Lys Leu Phe
85 90 95
Leu Asp Asn Asp Phe Tyr Phe Lys Lys Gly Asn Asn Phe Ile Ser Asn
100 105 110
Ser Glu Val Phe Ser Leu Asp Ser Asn Glu Asn Val Asn Ala His Leu
115 120 125
Thr Tyr Lys Ile Lys Ile His Asn Ile Ser Asn Glu Tyr Tyr Leu Ser
130 135 140
Ile Leu Pro Lys Phe Thr Phe Leu Ser Lys Glu Pro Ala Leu Glu Ser
145 150 155 160
Ala Ile Lys Ser Gly Tyr Leu Tyr Asn Ile Lys Ser Gly Lys Ser Phe
165 170 175
Pro Tyr Ile Ser Gly Leu Asp Gly Ile Leu Lys Ile Asp Ile Gly Asn
180 185 190
Asn Gln Ile Val Glu Val Ala Tyr Pro Glu Asn Tyr Leu Phe Asn Phe
195 200 205
Thr Thr Arg Asp Ala Glu Lys Tyr Gly Phe Ser Lys Glu Val His Glu
210 215 220
Ile Tyr Lys Asn Lys Val Phe Glu Gly Phe Lys Lys Ile Pro Lys Thr
225 230 235 240
Leu Gly Phe Leu Asn Lys Ile Thr Asn Leu Asn Glu Asn Tyr Gln Leu
245 250 255
Lys Asp Gly Tyr Lys Ile Phe Ile Asn Val Ile Tyr Lys Phe Lys Asn
260 265 270
Gly Glu Ser Arg Tyr Ala Lys Asp Val Phe Lys Tyr Ser Phe Tyr Lys
275 280 285
Asn Glu Gln Pro Leu Lys Ala Ile Phe Phe Phe Ser Ser Lys Lys Gln
290 295 300
Phe Phe Glu Val Gln Lys Ser Leu Lys Glu Leu Phe His Asn Lys His
305 310 315 320
Ser Val Phe Tyr Arg Ala Ala Ala Glu Leu Gly Phe Ser Lys Val Glu
325 330 335
Phe Leu Arg Asp Ser Lys Thr Lys Ser Ser Ala Phe Leu Tyr Asn Pro
340 345 350
Glu Glu Phe Thr Val Lys Asn Thr Glu Phe Ile Asn Gln Ile Glu Asp
355 360 365
Asn Val Met Ala Ile Val Leu Leu Asp Lys Tyr Ile Gly Asn Ile Asp
370 375 380
Pro Leu Val Arg Asn Phe Pro Asp Asn Leu Ile Leu Gln Pro Ile Leu
385 390 395 400
Lys Glu Lys Leu Glu Asp Ile Lys Pro Phe Ile Ile Lys Ser Tyr Val
405 410 415
Tyr Lys Met Gly Asn Phe Ile Pro Glu Cys Lys Pro Phe Ile Leu Lys
420 425 430
Lys Met Glu Asp Lys Glu Lys Asn Leu Tyr Ile Gly Ile Asp Leu Ser
435 440 445
His Asp Thr Tyr Ala Arg Lys Thr Asn Leu Cys Ile Ala Ala Val Asp
450 455 460
Asn Thr Gly Asp Ile Leu Tyr Ile Gly Lys His Lys Asn Leu Glu Leu
465 470 475 480
Asn Glu Lys Met Asn Leu Asp Ile Leu Glu Lys Glu Tyr Ile Lys Ala
485 490 495
Phe Glu Lys Tyr Ile Glu Lys Phe Asn Val Ser Pro Glu Asn Val Phe
500 505 510
Ile Leu Arg Asp Gly Arg Phe Ile Glu Asp Ile Glu Ile Ile Lys Asn
515 520 525
Phe Ile Ser Tyr Asn Asp Thr Lys Tyr Thr Leu Val Glu Val Asn Lys
530 535 540
Asn Thr Asn Ile Asn Ser Tyr Asp Asp Leu Lys Glu Trp Ile Ile Lys
545 550 555 560
Leu Asp Glu Asn Thr Tyr Ile Tyr Tyr Pro Lys Thr Phe Leu Asn Gln
565 570 575
Lys Gly Val Glu Val Lys Ile Leu Glu Asn Asn Thr Asp Tyr Thr Ile
580 585 590
Glu Glu Ile Ile Glu Gln Ile Tyr Leu Leu Thr Arg Val Ala His Ser
595 600 605
Thr Pro Tyr Thr Asn Tyr Lys Leu Pro Tyr Pro Leu His Ile Ala Asn
610 615 620
Lys Val Ala Leu Thr Asp Tyr Glu Trp Lys Leu Tyr Ile Pro Tyr
625 630 635
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:3
<211> 887
<212> PRT
<213> Natronobacterium gregoryi
<400> SEQ ID NO:3
Met Thr Val Ile Asp Leu Asp Ser Thr Thr Thr Ala Asp Glu Leu Thr
1 5 10 15
Ser Gly His Thr Tyr Asp Ile Ser Val Thr Leu Thr Gly Val Tyr Asp
20 25 30
Asn Thr Asp Glu Gln His Pro Arg Met Ser Leu Ala Phe Glu Gln Asp
35 40 45
Asn Gly Glu Arg Arg Tyr Ile Thr Leu Trp Lys Asn Thr Thr Pro Lys
50 55 60
Asp Val Phe Thr Tyr Asp Tyr Ala Thr Gly Ser Thr Tyr Ile Phe Thr
65 70 75 80
Asn Ile Asp Tyr Glu Val Lys Asp Gly Tyr Glu Asn Leu Thr Ala Thr
85 90 95
Tyr Gln Thr Thr Val Glu Asn Ala Thr Ala Gln Glu Val Gly Thr Thr
100 105 110
Asp Glu Asp Glu Thr Phe Ala Gly Gly Glu Pro Leu Asp His His Leu
115 120 125
Asp Asp Ala Leu Asn Glu Thr Pro Asp Asp Ala Glu Thr Glu Ser Asp
130 135 140
Ser Gly His Val Met Thr Ser Phe Ala Ser Arg Asp Gln Leu Pro Glu
145 150 155 160
Trp Thr Leu His Thr Tyr Thr Leu Thr Ala Thr Asp Gly Ala Lys Thr
165 170 175
Asp Thr Glu Tyr Ala Arg Arg Thr Leu Ala Tyr Thr Val Arg Gln Glu
180 185 190
Leu Tyr Thr Asp His Asp Ala Ala Pro Val Ala Thr Asp Gly Leu Met
195 200 205
Leu Leu Thr Pro Glu Pro Leu Gly Glu Thr Pro Leu Asp Leu Asp Cys
210 215 220
Gly Val Arg Val Glu Ala Asp Glu Thr Arg Thr Leu Asp Tyr Thr Thr
225 230 235 240
Ala Lys Asp Arg Leu Leu Ala Arg Glu Leu Val Glu Glu Gly Leu Lys
245 250 255
Arg Ser Leu Trp Asp Asp Tyr Leu Val Arg Gly Ile Asp Glu Val Leu
260 265 270
Ser Lys Glu Pro Val Leu Thr Cys Asp Glu Phe Asp Leu His Glu Arg
275 280 285
Tyr Asp Leu Ser Val Glu Val Gly His Ser Gly Arg Ala Tyr Leu His
290 295 300
Ile Asn Phe Arg His Arg Phe Val Pro Lys Leu Thr Leu Ala Asp Ile
305 310 315 320
Asp Asp Asp Asn Ile Tyr Pro Gly Leu Arg Val Lys Thr Thr Tyr Arg
325 330 335
Pro Arg Arg Gly His Ile Val Trp Gly Leu Arg Asp Glu Cys Ala Thr
340 345 350
Asp Ser Leu Asn Thr Leu Gly Asn Gln Ser Val Val Ala Tyr His Arg
355 360 365
Asn Asn Gln Thr Pro Ile Asn Thr Asp Leu Leu Asp Ala Ile Glu Ala
370 375 380
Ala Asp Arg Arg Val Val Glu Thr Arg Arg Gln Gly His Gly Asp Asp
385 390 395 400
Ala Val Ser Phe Pro Gln Glu Leu Leu Ala Val Glu Pro Asn Thr His
405 410 415
Gln Ile Lys Gln Phe Ala Ser Asp Gly Phe His Gln Gln Ala Arg Ser
420 425 430
Lys Thr Arg Leu Ser Ala Ser Arg Cys Ser Glu Lys Ala Gln Ala Phe
435 440 445
Ala Glu Arg Leu Asp Pro Val Arg Leu Asn Gly Ser Thr Val Glu Phe
450 455 460
Ser Ser Glu Phe Phe Thr Gly Asn Asn Glu Gln Gln Leu Arg Leu Leu
465 470 475 480
Tyr Glu Asn Gly Glu Ser Val Leu Thr Phe Arg Asp Gly Ala Arg Gly
485 490 495
Ala His Pro Asp Glu Thr Phe Ser Lys Gly Ile Val Asn Pro Pro Glu
500 505 510
Ser Phe Glu Val Ala Val Val Leu Pro Glu Gln Gln Ala Asp Thr Cys
515 520 525
Lys Ala Gln Trp Asp Thr Met Ala Asp Leu Leu Asn Gln Ala Gly Ala
530 535 540
Pro Pro Thr Arg Ser Glu Thr Val Gln Tyr Asp Ala Phe Ser Ser Pro
545 550 555 560
Glu Ser Ile Ser Leu Asn Val Ala Gly Ala Ile Asp Pro Ser Glu Val
565 570 575
Asp Ala Ala Phe Val Val Leu Pro Pro Asp Gln Glu Gly Phe Ala Asp
580 585 590
Leu Ala Ser Pro Thr Glu Thr Tyr Asp Glu Leu Lys Lys Ala Leu Ala
595 600 605
Asn Met Gly Ile Tyr Ser Gln Met Ala Tyr Phe Asp Arg Phe Arg Asp
610 615 620
Ala Lys Ile Phe Tyr Thr Arg Asn Val Ala Leu Gly Leu Leu Ala Ala
625 630 635 640
Ala Gly Gly Val Ala Phe Thr Thr Glu His Ala Met Pro Gly Asp Ala
645 650 655
Asp Met Phe Ile Gly Ile Asp Val Ser Arg Ser Tyr Pro Glu Asp Gly
660 665 670
Ala Ser Gly Gln Ile Asn Ile Ala Ala Thr Ala Thr Ala Val Tyr Lys
675 680 685
Asp Gly Thr Ile Leu Gly His Ser Ser Thr Arg Pro Gln Leu Gly Glu
690 695 700
Lys Leu Gln Ser Thr Asp Val Arg Asp Ile Met Lys Asn Ala Ile Leu
705 710 715 720
Gly Tyr Gln Gln Val Thr Gly Glu Ser Pro Thr His Ile Val Ile His
725 730 735
Arg Asp Gly Phe Met Asn Glu Asp Leu Asp Pro Ala Thr Glu Phe Leu
740 745 750
Asn Glu Gln Gly Val Glu Tyr Asp Ile Val Glu Ile Arg Lys Gln Pro
755 760 765
Gln Thr Arg Leu Leu Ala Val Ser Asp Val Gln Tyr Asp Thr Pro Val
770 775 780
Lys Ser Ile Ala Ala Ile Asn Gln Asn Glu Pro Arg Ala Thr Val Ala
785 790 795 800
Thr Phe Gly Ala Pro Glu Tyr Leu Ala Thr Arg Asp Gly Gly Gly Leu
805 810 815
Pro Arg Pro Ile Gln Ile Glu Arg Val Ala Gly Glu Thr Asp Ile Glu
820 825 830
Thr Leu Thr Arg Gln Val Tyr Leu Leu Ser Gln Ser His Ile Gln Val
835 840 845
His Asn Ser Thr Ala Arg Leu Pro Ile Thr Thr Ala Tyr Ala Asp Gln
850 855 860
Ala Ser Thr His Ala Thr Lys Gly Tyr Leu Val Gln Thr Gly Ala Phe
865 870 875 880
Glu Ser Asn Val Gly Phe Leu
885
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:4
<211> 997
<212> PRT
<213>Artificial sequence
<300>
<308> NLS
<309> 2016-11-11
<313> (1)..(17)
<300>
<308> FOKI-C
<309> 2016-11-11
<313> (18)..(215)
<300>
<308> linker
<309> 2016-11-11
<313> (216)..(220)
<300>
<308> RsAgo
<309> 2016-11-11
<313> (221)..(997)
<400> SEQ ID NO:4
Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
1 5 10 15
Ala Ser Ser Gln Leu Val Lys Ser Glu Leu Glu Glu Lys Lys Ser Glu
20 25 30
Leu Arg His Lys Leu Lys Tyr Val Pro His Glu Tyr Ile Glu Leu Ile
35 40 45
Glu Ile Ala Arg Asn Ser Thr Gln Asp Arg Ile Leu Glu Met Lys Val
50 55 60
Met Glu Phe Phe Met Lys Val Tyr Gly Tyr Arg Gly Lys His Leu Gly
65 70 75 80
Gly Ser Arg Lys Pro Asp Gly Ala Ile Tyr Thr Val Gly Ser Pro Ile
85 90 95
Asp Tyr Gly Val Ile Val Asp Thr Lys Ala Tyr Ser Gly Gly Tyr Asn
100 105 110
Leu Pro Ile Gly Gln Ala Asp Glu Met Gln Arg Tyr Val Glu Glu Asn
115 120 125
Gln Thr Arg Asn Lys His Ile Asn Pro Asn Glu Trp Trp Lys Val Tyr
130 135 140
Pro Ser Ser Val Thr Glu Phe Lys Phe Leu Phe Val Ser Gly His Phe
145 150 155 160
Lys Gly Asn Tyr Lys Ala Gln Leu Thr Arg Leu Asn His Ile Thr Asn
165 170 175
Cys Asn Gly Ala Val Leu Ser Val Glu Glu Leu Leu Ile Gly Gly Glu
180 185 190
Met Ile Lys Ala Gly Thr Leu Thr Leu Glu Glu Val Arg Arg Lys Phe
195 200 205
Asn Asn Gly Glu Ile Asn Phe Gly Gly Gly Gly Ser Met Ala Pro Val
210 215 220
Gln Ala Ala Asp Glu Met Tyr Asp Ser Asn Pro His Pro Asp Arg Arg
225 230 235 240
Gln Leu Val Ser Asn Gly Phe Glu Val Asn Leu Pro Asp Gln Val Glu
245 250 255
Val Ile Val Arg Asp Leu Pro Asp Pro Ser Lys Val Lys Glu Glu Arg
260 265 270
Thr Arg Leu Met Gly Tyr Trp Phe Val His Trp Phe Asp Gly Lys Leu
275 280 285
Phe His Leu Arg Ile Lys Ala Gly Gly Pro Asn Val Asp Gly Glu His
290 295 300
Arg Ala Ile Arg Thr Ala Glu His Pro Trp Leu Leu Arg Ala Arg Leu
305 310 315 320
Asp Asp Ala Leu Glu Glu Ala Leu Pro Lys Tyr Ala Ala Val Lys Lys
325 330 335
Arg Pro Phe Thr Phe Leu Ala Gln Lys Asp Glu Leu Ile Asp Ala Ala
340 345 350
Ala Thr Ala Ala Gly Leu Ser His Arg Leu Leu Asn Ser Phe Lys Val
355 360 365
Ile Pro Arg Phe Ala Leu Ser Pro Lys Ile Tyr Glu Pro Val Asp Gly
370 375 380
Thr Thr Arg Val Gly Val Phe Val Thr Ile Gly Met Arg Tyr Asp Ile
385 390 395 400
Glu Ala Ser Leu Arg Asp Leu Leu Glu Ala Gly Ile Asp Leu Arg Gly
405 410 415
Met Tyr Val Val Arg Arg Lys Arg Gln Pro Gly Glu Arg Gly Leu Leu
420 425 430
Gly Arg Val Arg Ala Ile Ser Asp Asp Met Val Gln Leu Phe Glu Glu
435 440 445
Thr Asp Leu Ala Ser Val Asn Val Asn Asp Ala Lys Leu Glu Gly Ser
450 455 460
Lys Glu Asn Phe Thr Arg Cys Leu Ser Ala Leu Leu Gly His Asn Tyr
465 470 475 480
Lys Lys Leu Leu Asn Ala Leu Asp Asp Gln Glu Ala Gly Tyr Arg Thr
485 490 495
Gly Pro Arg Phe Asp Asp Ala Val Arg Arg Met Gly Glu Phe Leu Ala
500 505 510
Lys Lys Pro Ile Arg Leu Ala Asp Asn Ile Asn Ala Gln Val Gly Asp
515 520 525
Arg Ile Val Phe Ser Asn Glu Gly Gln Ala Arg Asn Val Arg Leu Ala
530 535 540
Pro Lys Val Glu Tyr Val Phe Asp Arg Thr Gly Ala Lys Ser Ala Glu
545 550 555 560
Tyr Ala Trp Arg Gly Leu Ser Gln Phe Gly Pro Phe Asp Arg Pro Ser
565 570 575
Phe Ala Asn Arg Ser Pro Arg Ile Leu Val Val Tyr Pro Ser Ser Thr
580 585 590
Gln Gly Lys Val Glu Asn Phe Leu Ser Ala Phe Arg Asp Gly Met Gly
595 600 605
Ser Asn Tyr Ser Gly Phe Ser Lys Gly Phe Val Asp Leu Met Gly Leu
610 615 620
Thr Lys Val Glu Phe Val Met Cys Pro Val Glu Val Ser Ser Ala Asp
625 630 635 640
Arg Asn Gly Ala His Thr Lys Tyr Asn Ser Ala Ile Glu Asp Lys Leu
645 650 655
Ala Gly Ala Gly Glu Val His Ala Gly Ile Val Val Leu Phe Glu Asp
660 665 670
His Ala Arg Leu Pro Asp Asp Arg Asn Pro Tyr Ile His Thr Lys Ser
675 680 685
Leu Leu Leu Thr Leu Gly Val Pro Thr Gln Gln Val Arg Met Pro Thr
690 695 700
Val Leu Leu Glu Pro Lys Ser Leu Gln Tyr Thr Leu Gln Asn Phe Ser
705 710 715 720
Ile Ala Thr Tyr Ala Lys Leu Asn Gly Thr Pro Trp Thr Val Asn His
725 730 735
Asp Lys Ala Ile Asn Asp Glu Leu Val Val Gly Met Gly Leu Ala Glu
740 745 750
Leu Ser Gly Ser Arg Thr Glu Lys Arg Gln Arg Phe Val Gly Ile Thr
755 760 765
Thr Val Phe Ala Gly Asp Gly Ser Tyr Leu Leu Gly Asn Val Ser Lys
770 775 780
Glu Cys Glu Tyr Glu Gly Tyr Ser Asp Ala Ile Arg Glu Ser Met Thr
785 790 795 800
Gly Ile Leu Arg Glu Leu Lys Lys Arg Asn Asn Trp Arg Pro Gly Asp
805 810 815
Thr Val Arg Val Val Phe His Ala His Arg Pro Leu Lys Arg Val Asp
820 825 830
Val Ala Ser Ile Val Phe Glu Cys Thr Arg Glu Ile Gly Ser Asp Gln
835 840 845
Asn Ile Gln Met Ala Phe Val Thr Val Ser His Asp His Pro Phe Val
850 855 860
Leu Ile Asp Arg Ser Glu Arg Gly Leu Glu Ala Tyr Lys Gly Ser Thr
865 870 875 880
Ala Arg Lys Gly Val Phe Ala Pro Pro Arg Gly Ala Ile Ser Arg Val
885 890 895
Gly Arg Leu Thr Arg Leu Leu Ala Val Asn Ser Pro Gln Leu Ile Lys
900 905 910
Arg Ala Asn Thr Pro Leu Pro Thr Pro Leu Leu Val Ser Leu His Pro
915 920 925
Asp Ser Thr Phe Lys Asp Val Asp Tyr Leu Ala Glu Gln Ala Leu Lys
930 935 940
Phe Thr Ser Leu Ser Trp Arg Ser Thr Leu Pro Ala Ala Thr Pro Val
945 950 955 960
Thr Ile Phe Tyr Ser Glu Arg Ile Ala Glu Leu Leu Gly Arg Leu Lys
965 970 975
Ser Ile Pro Asn Trp Ser Ser Ala Asn Leu Asn Ile Lys Leu Lys Trp
980 985 990
Ser Arg Trp Phe Leu
995
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:5
<211> 859
<212> PRT
<213>Artificial sequence
<300>
<308> NLS
<309> 2016-11-11
<313> (1)..(17)
<300>
<308> FOKI-C
<309> 2016-11-11
<313> (18)..(215)
<300>
<308> linker
<309> 2016-11-11
<313> (216)..(220)
<300>
<308> MpAgo
<309> 2016-11-11
<313> (221)..(859)
<400> SEQ ID NO:5
Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
1 5 10 15
Ala Ser Ser Gln Leu Val Lys Ser Glu Leu Glu Glu Lys Lys Ser Glu
20 25 30
Leu Arg His Lys Leu Lys Tyr Val Pro His Glu Tyr Ile Glu Leu Ile
35 40 45
Glu Ile Ala Arg Asn Ser Thr Gln Asp Arg Ile Leu Glu Met Lys Val
50 55 60
Met Glu Phe Phe Met Lys Val Tyr Gly Tyr Arg Gly Lys His Leu Gly
65 70 75 80
Gly Ser Arg Lys Pro Asp Gly Ala Ile Tyr Thr Val Gly Ser Pro Ile
85 90 95
Asp Tyr Gly Val Ile Val Asp Thr Lys Ala Tyr Ser Gly Gly Tyr Asn
100 105 110
Leu Pro Ile Gly Gln Ala Asp Glu Met Gln Arg Tyr Val Glu Glu Asn
115 120 125
Gln Thr Arg Asn Lys His Ile Asn Pro Asn Glu Trp Trp Lys Val Tyr
130 135 140
Pro Ser Ser Val Thr Glu Phe Lys Phe Leu Phe Val Ser Gly His Phe
145 150 155 160
Lys Gly Asn Tyr Lys Ala Gln Leu Thr Arg Leu Asn His Ile Thr Asn
165 170 175
Cys Asn Gly Ala Val Leu Ser Val Glu Glu Leu Leu Ile Gly Gly Glu
180 185 190
Met Ile Lys Ala Gly Thr Leu Thr Leu Glu Glu Val Arg Arg Lys Phe
195 200 205
Asn Asn Gly Glu Ile Asn Phe Gly Gly Gly Gly Ser Met Tyr Leu Asn
210 215 220
Leu Tyr Lys Ile Asp Ile Pro Lys Lys Ile Lys Arg Leu Tyr Phe Tyr
225 230 235 240
Asn Pro Asp Met Glu Pro Lys Leu Phe Ala Arg Asn Leu Ser Arg Val
245 250 255
Asn Asn Phe Lys Phe Gln Asp Ser Asn Asp Leu Val Trp Ile Glu Ile
260 265 270
Pro Asp Ile Asp Phe Gln Ile Thr Pro Lys Asn Val Phe Gln Tyr Lys
275 280 285
Val Glu Lys Glu Glu Ile Ile Lys Glu Glu Glu Asp Lys Lys Leu Phe
290 295 300
Val Lys Thr Leu Tyr Lys Tyr Ile Lys Lys Leu Phe Leu Asp Asn Asp
305 310 315 320
Phe Tyr Phe Lys Lys Gly Asn Asn Phe Ile Ser Asn Ser Glu Val Phe
325 330 335
Ser Leu Asp Ser Asn Glu Asn Val Asn Ala His Leu Thr Tyr Lys Ile
340 345 350
Lys Ile His Asn Ile Ser Asn Glu Tyr Tyr Leu Ser Ile Leu Pro Lys
355 360 365
Phe Thr Phe Leu Ser Lys Glu Pro Ala Leu Glu Ser Ala Ile Lys Ser
370 375 380
Gly Tyr Leu Tyr Asn Ile Lys Ser Gly Lys Ser Phe Pro Tyr Ile Ser
385 390 395 400
Gly Leu Asp Gly Ile Leu Lys Ile Asp Ile Gly Asn Asn Gln Ile Val
405 410 415
Glu Val Ala Tyr Pro Glu Asn Tyr Leu Phe Asn Phe Thr Thr Arg Asp
420 425 430
Ala Glu Lys Tyr Gly Phe Ser Lys Glu Val His Glu Ile Tyr Lys Asn
435 440 445
Lys Val Phe Glu Gly Phe Lys Lys Ile Pro Lys Thr Leu Gly Phe Leu
450 455 460
Asn Lys Ile Thr Asn Leu Asn Glu Asn Tyr Gln Leu Lys Asp Gly Tyr
465 470 475 480
Lys Ile Phe Ile Asn Val Ile Tyr Lys Phe Lys Asn Gly Glu Ser Arg
485 490 495
Tyr Ala Lys Asp Val Phe Lys Tyr Ser Phe Tyr Lys Asn Glu Gln Pro
500 505 510
Leu Lys Ala Ile Phe Phe Phe Ser Ser Lys Lys Gln Phe Phe Glu Val
515 520 525
Gln Lys Ser Leu Lys Glu Leu Phe His Asn Lys His Ser Val Phe Tyr
530 535 540
Arg Ala Ala Ala Glu Leu Gly Phe Ser Lys Val Glu Phe Leu Arg Asp
545 550 555 560
Ser Lys Thr Lys Ser Ser Ala Phe Leu Tyr Asn Pro Glu Glu Phe Thr
565 570 575
Val Lys Asn Thr Glu Phe Ile Asn Gln Ile Glu Asp Asn Val Met Ala
580 585 590
Ile Val Leu Leu Asp Lys Tyr Ile Gly Asn Ile Asp Pro Leu Val Arg
595 600 605
Asn Phe Pro Asp Asn Leu Ile Leu Gln Pro Ile Leu Lys Glu Lys Leu
610 615 620
Glu Asp Ile Lys Pro Phe Ile Ile Lys Ser Tyr Val Tyr Lys Met Gly
625 630 635 640
Asn Phe Ile Pro Glu Cys Lys Pro Phe Ile Leu Lys Lys Met Glu Asp
645 650 655
Lys Glu Lys Asn Leu Tyr Ile Gly Ile Asp Leu Ser His Asp Thr Tyr
660 665 670
Ala Arg Lys Thr Asn Leu Cys Ile Ala Ala Val Asp Asn Thr Gly Asp
675 680 685
Ile Leu Tyr Ile Gly Lys His Lys Asn Leu Glu Leu Asn Glu Lys Met
690 695 700
Asn Leu Asp Ile Leu Glu Lys Glu Tyr Ile Lys Ala Phe Glu Lys Tyr
705 710 715 720
Ile Glu Lys Phe Asn Val Ser Pro Glu Asn Val Phe Ile Leu Arg Asp
725 730 735
Gly Arg Phe Ile Glu Asp Ile Glu Ile Ile Lys Asn Phe Ile Ser Tyr
740 745 750
Asn Asp Thr Lys Tyr Thr Leu Val Glu Val Asn Lys Asn Thr Asn Ile
755 760 765
Asn Ser Tyr Asp Asp Leu Lys Glu Trp Ile Ile Lys Leu Asp Glu Asn
770 775 780
Thr Tyr Ile Tyr Tyr Pro Lys Thr Phe Leu Asn Gln Lys Gly Val Glu
785 790 795 800
Val Lys Ile Leu Glu Asn Asn Thr Asp Tyr Thr Ile Glu Glu Ile Ile
805 810 815
Glu Gln Ile Tyr Leu Leu Thr Arg Val Ala His Ser Thr Pro Tyr Thr
820 825 830
Asn Tyr Lys Leu Pro Tyr Pro Leu His Ile Ala Asn Lys Val Ala Leu
835 840 845
Thr Asp Tyr Glu Trp Lys Leu Tyr Ile Pro Tyr
850 855
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:6
<211> 859
<212> PRT
<213>Artificial sequence
<300>
<308> NLS
<309> 2016-11-11
<313> (1)..(17)
<300>
<308> FOKI-C
<309> 2016-11-11
<313> (18)..(215)
<300>
<308> linker
<309> 2016-11-11
<313> (216)..(220)
<300>
<308> dMpAgo
<309> 2016-11-11
<313> (221)..(859)
<400> SEQ ID NO:6
Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
1 5 10 15
Ala Ser Ser Gln Leu Val Lys Ser Glu Leu Glu Glu Lys Lys Ser Glu
20 25 30
Leu Arg His Lys Leu Lys Tyr Val Pro His Glu Tyr Ile Glu Leu Ile
35 40 45
Glu Ile Ala Arg Asn Ser Thr Gln Asp Arg Ile Leu Glu Met Lys Val
50 55 60
Met Glu Phe Phe Met Lys Val Tyr Gly Tyr Arg Gly Lys His Leu Gly
65 70 75 80
Gly Ser Arg Lys Pro Asp Gly Ala Ile Tyr Thr Val Gly Ser Pro Ile
85 90 95
Asp Tyr Gly Val Ile Val Asp Thr Lys Ala Tyr Ser Gly Gly Tyr Asn
100 105 110
Leu Pro Ile Gly Gln Ala Asp Glu Met Gln Arg Tyr Val Glu Glu Asn
115 120 125
Gln Thr Arg Asn Lys His Ile Asn Pro Asn Glu Trp Trp Lys Val Tyr
130 135 140
Pro Ser Ser Val Thr Glu Phe Lys Phe Leu Phe Val Ser Gly His Phe
145 150 155 160
Lys Gly Asn Tyr Lys Ala Gln Leu Thr Arg Leu Asn His Ile Thr Asn
165 170 175
Cys Asn Gly Ala Val Leu Ser Val Glu Glu Leu Leu Ile Gly Gly Glu
180 185 190
Met Ile Lys Ala Gly Thr Leu Thr Leu Glu Glu Val Arg Arg Lys Phe
195 200 205
Asn Asn Gly Glu Ile Asn Phe Gly Gly Gly Gly Ser Met Tyr Leu Asn
210 215 220
Leu Tyr Lys Ile Asp Ile Pro Lys Lys Ile Lys Arg Leu Tyr Phe Tyr
225 230 235 240
Asn Pro Asp Met Glu Pro Lys Leu Phe Ala Arg Asn Leu Ser Arg Val
245 250 255
Asn Asn Phe Lys Phe Gln Asp Ser Asn Asp Leu Val Trp Ile Glu Ile
260 265 270
Pro Asp Ile Asp Phe Gln Ile Thr Pro Lys Asn Val Phe Gln Tyr Lys
275 280 285
Val Glu Lys Glu Glu Ile Ile Lys Glu Glu Glu Asp Lys Lys Leu Phe
290 295 300
Val Lys Thr Leu Tyr Lys Tyr Ile Lys Lys Leu Phe Leu Asp Asn Asp
305 310 315 320
Phe Tyr Phe Lys Lys Gly Asn Asn Phe Ile Ser Asn Ser Glu Val Phe
325 330 335
Ser Leu Asp Ser Asn Glu Asn Val Asn Ala His Leu Thr Tyr Lys Ile
340 345 350
Lys Ile His Asn Ile Ser Asn Glu Tyr Tyr Leu Ser Ile Leu Pro Lys
355 360 365
Phe Thr Phe Leu Ser Lys Glu Pro Ala Leu Glu Ser Ala Ile Lys Ser
370 375 380
Gly Tyr Leu Tyr Asn Ile Lys Ser Gly Lys Ser Phe Pro Tyr Ile Ser
385 390 395 400
Gly Leu Asp Gly Ile Leu Lys Ile Asp Ile Gly Asn Asn Gln Ile Val
405 410 415
Glu Val Ala Tyr Pro Glu Asn Tyr Leu Phe Asn Phe Thr Thr Arg Asp
420 425 430
Ala Glu Lys Tyr Gly Phe Ser Lys Glu Val His Glu Ile Tyr Lys Asn
435 440 445
Lys Val Phe Glu Gly Phe Lys Lys Ile Pro Lys Thr Leu Gly Phe Leu
450 455 460
Asn Lys Ile Thr Asn Leu Asn Glu Asn Tyr Gln Leu Lys Asp Gly Tyr
465 470 475 480
Lys Ile Phe Ile Asn Val Ile Tyr Lys Phe Lys Asn Gly Glu Ser Arg
485 490 495
Tyr Ala Lys Asp Val Phe Lys Tyr Ser Phe Tyr Lys Asn Glu Gln Pro
500 505 510
Leu Lys Ala Ile Phe Phe Phe Ser Ser Lys Lys Gln Phe Phe Glu Val
515 520 525
Gln Lys Ser Leu Lys Glu Leu Phe His Asn Lys His Ser Val Phe Tyr
530 535 540
Arg Ala Ala Ala Glu Leu Gly Phe Ser Lys Val Glu Phe Leu Arg Asp
545 550 555 560
Ser Lys Thr Lys Ser Ser Ala Phe Leu Tyr Asn Pro Glu Glu Phe Thr
565 570 575
Val Lys Asn Thr Glu Phe Ile Asn Gln Ile Glu Asp Asn Val Met Ala
580 585 590
Ile Val Leu Leu Asp Lys Tyr Ile Gly Asn Ile Asp Pro Leu Val Arg
595 600 605
Asn Phe Pro Asp Asn Leu Ile Leu Gln Pro Ile Leu Lys Glu Lys Leu
610 615 620
Glu Asp Ile Lys Pro Phe Ile Ile Lys Ser Tyr Val Tyr Lys Met Gly
625 630 635 640
Asn Phe Ile Pro Glu Cys Lys Pro Phe Ile Leu Lys Lys Met Glu Asp
645 650 655
Lys Glu Lys Asn Leu Tyr Ile Gly Ile Ala Leu Ser His Asp Thr Tyr
660 665 670
Ala Arg Lys Thr Asn Leu Cys Ile Ala Ala Val Asp Asn Thr Gly Asp
675 680 685
Ile Leu Tyr Ile Gly Lys His Lys Asn Leu Glu Leu Asn Glu Lys Met
690 695 700
Asn Leu Asp Ile Leu Glu Lys Glu Tyr Ile Lys Ala Phe Glu Lys Tyr
705 710 715 720
Ile Glu Lys Phe Asn Val Ser Pro Glu Asn Val Phe Ile Leu Arg Asp
725 730 735
Gly Arg Phe Ile Glu Asp Ile Glu Ile Ile Lys Asn Phe Ile Ser Tyr
740 745 750
Asn Asp Thr Lys Tyr Thr Leu Val Glu Val Asn Lys Asn Thr Asn Ile
755 760 765
Asn Ser Tyr Asp Asp Leu Lys Glu Trp Ile Ile Lys Leu Asp Glu Asn
770 775 780
Thr Tyr Ile Tyr Tyr Pro Lys Thr Phe Leu Asn Gln Lys Gly Val Glu
785 790 795 800
Val Lys Ile Leu Glu Asn Asn Thr Asp Tyr Thr Ile Glu Glu Ile Ile
805 810 815
Glu Gln Ile Tyr Leu Leu Thr Arg Val Ala His Ser Thr Pro Tyr Thr
820 825 830
Asn Tyr Lys Leu Pro Tyr Pro Leu His Ile Ala Asn Lys Val Ala Leu
835 840 845
Thr Asp Tyr Glu Trp Lys Leu Tyr Ile Pro Tyr
850 855
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:7
<211> 1107
<212> PRT
<213>Artificial sequence
<300>
<308> NLS
<309> 2016-11-11
<313> (1)..(17)
<300>
<308> FOKI-C
<309> 2016-11-11
<313> (18)..(215)
<300>
<308> linker
<309> 2016-11-11
<313> (216)..(220)
<300>
<308> dNgAgo
<309> 2016-11-11
<313> (221)..(1107)
<400> SEQ ID NO:7
Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
1 5 10 15
Ala Ser Ser Gln Leu Val Lys Ser Glu Leu Glu Glu Lys Lys Ser Glu
20 25 30
Leu Arg His Lys Leu Lys Tyr Val Pro His Glu Tyr Ile Glu Leu Ile
35 40 45
Glu Ile Ala Arg Asn Ser Thr Gln Asp Arg Ile Leu Glu Met Lys Val
50 55 60
Met Glu Phe Phe Met Lys Val Tyr Gly Tyr Arg Gly Lys His Leu Gly
65 70 75 80
Gly Ser Arg Lys Pro Asp Gly Ala Ile Tyr Thr Val Gly Ser Pro Ile
85 90 95
Asp Tyr Gly Val Ile Val Asp Thr Lys Ala Tyr Ser Gly Gly Tyr Asn
100 105 110
Leu Pro Ile Gly Gln Ala Asp Glu Met Gln Arg Tyr Val Glu Glu Asn
115 120 125
Gln Thr Arg Asn Lys His Ile Asn Pro Asn Glu Trp Trp Lys Val Tyr
130 135 140
Pro Ser Ser Val Thr Glu Phe Lys Phe Leu Phe Val Ser Gly His Phe
145 150 155 160
Lys Gly Asn Tyr Lys Ala Gln Leu Thr Arg Leu Asn His Ile Thr Asn
165 170 175
Cys Asn Gly Ala Val Leu Ser Val Glu Glu Leu Leu Ile Gly Gly Glu
180 185 190
Met Ile Lys Ala Gly Thr Leu Thr Leu Glu Glu Val Arg Arg Lys Phe
195 200 205
Asn Asn Gly Glu Ile Asn Phe Gly Gly Gly Gly Ser Met Thr Val Ile
210 215 220
Asp Leu Asp Ser Thr Thr Thr Ala Asp Glu Leu Thr Ser Gly His Thr
225 230 235 240
Tyr Asp Ile Ser Val Thr Leu Thr Gly Val Tyr Asp Asn Thr Asp Glu
245 250 255
Gln His Pro Arg Met Ser Leu Ala Phe Glu Gln Asp Asn Gly Glu Arg
260 265 270
Arg Tyr Ile Thr Leu Trp Lys Asn Thr Thr Pro Lys Asp Val Phe Thr
275 280 285
Tyr Asp Tyr Ala Thr Gly Ser Thr Tyr Ile Phe Thr Asn Ile Asp Tyr
290 295 300
Glu Val Lys Asp Gly Tyr Glu Asn Leu Thr Ala Thr Tyr Gln Thr Thr
305 310 315 320
Val Glu Asn Ala Thr Ala Gln Glu Val Gly Thr Thr Asp Glu Asp Glu
325 330 335
Thr Phe Ala Gly Gly Glu Pro Leu Asp His His Leu Asp Asp Ala Leu
340 345 350
Asn Glu Thr Pro Asp Asp Ala Glu Thr Glu Ser Asp Ser Gly His Val
355 360 365
Met Thr Ser Phe Ala Ser Arg Asp Gln Leu Pro Glu Trp Thr Leu His
370 375 380
Thr Tyr Thr Leu Thr Ala Thr Asp Gly Ala Lys Thr Asp Thr Glu Tyr
385 390 395 400
Ala Arg Arg Thr Leu Ala Tyr Thr Val Arg Gln Glu Leu Tyr Thr Asp
405 410 415
His Asp Ala Ala Pro Val Ala Thr Asp Gly Leu Met Leu Leu Thr Pro
420 425 430
Glu Pro Leu Gly Glu Thr Pro Leu Asp Leu Asp Cys Gly Val Arg Val
435 440 445
Glu Ala Asp Glu Thr Arg Thr Leu Asp Tyr Thr Thr Ala Lys Asp Arg
450 455 460
Leu Leu Ala Arg Glu Leu Val Glu Glu Gly Leu Lys Arg Ser Leu Trp
465 470 475 480
Asp Asp Tyr Leu Val Arg Gly Ile Asp Glu Val Leu Ser Lys Glu Pro
485 490 495
Val Leu Thr Cys Asp Glu Phe Asp Leu His Glu Arg Tyr Asp Leu Ser
500 505 510
Val Glu Val Gly His Ser Gly Arg Ala Tyr Leu His Ile Asn Phe Arg
515 520 525
His Arg Phe Val Pro Lys Leu Thr Leu Ala Asp Ile Asp Asp Asp Asn
530 535 540
Ile Tyr Pro Gly Leu Arg Val Lys Thr Thr Tyr Arg Pro Arg Arg Gly
545 550 555 560
His Ile Val Trp Gly Leu Arg Asp Glu Cys Ala Thr Asp Ser Leu Asn
565 570 575
Thr Leu Gly Asn Gln Ser Val Val Ala Tyr His Arg Asn Asn Gln Thr
580 585 590
Pro Ile Asn Thr Asp Leu Leu Asp Ala Ile Glu Ala Ala Asp Arg Arg
595 600 605
Val Val Glu Thr Arg Arg Gln Gly His Gly Asp Asp Ala Val Ser Phe
610 615 620
Pro Gln Glu Leu Leu Ala Val Glu Pro Asn Thr His Gln Ile Lys Gln
625 630 635 640
Phe Ala Ser Asp Gly Phe His Gln Gln Ala Arg Ser Lys Thr Arg Leu
645 650 655
Ser Ala Ser Arg Cys Ser Glu Lys Ala Gln Ala Phe Ala Glu Arg Leu
660 665 670
Asp Pro Val Arg Leu Asn Gly Ser Thr Val Glu Phe Ser Ser Glu Phe
675 680 685
Phe Thr Gly Asn Asn Glu Gln Gln Leu Arg Leu Leu Tyr Glu Asn Gly
690 695 700
Glu Ser Val Leu Thr Phe Arg Asp Gly Ala Arg Gly Ala His Pro Asp
705 710 715 720
Glu Thr Phe Ser Lys Gly Ile Val Asn Pro Pro Glu Ser Phe Glu Val
725 730 735
Ala Val Val Leu Pro Glu Gln Gln Ala Asp Thr Cys Lys Ala Gln Trp
740 745 750
Asp Thr Met Ala Asp Leu Leu Asn Gln Ala Gly Ala Pro Pro Thr Arg
755 760 765
Ser Glu Thr Val Gln Tyr Asp Ala Phe Ser Ser Pro Glu Ser Ile Ser
770 775 780
Leu Asn Val Ala Gly Ala Ile Asp Pro Ser Glu Val Asp Ala Ala Phe
785 790 795 800
Val Val Leu Pro Pro Asp Gln Glu Gly Phe Ala Asp Leu Ala Ser Pro
805 810 815
Thr Glu Thr Tyr Asp Glu Leu Lys Lys Ala Leu Ala Asn Met Gly Ile
820 825 830
Tyr Ser Gln Met Ala Tyr Phe Asp Arg Phe Arg Asp Ala Lys Ile Phe
835 840 845
Tyr Thr Arg Asn Val Ala Leu Gly Leu Leu Ala Ala Ala Gly Gly Val
850 855 860
Ala Phe Thr Thr Glu His Ala Met Pro Gly Asp Ala Asp Met Phe Ile
865 870 875 880
Gly Ile Ala Val Ser Arg Ser Tyr Pro Glu Asp Gly Ala Ser Gly Gln
885 890 895
Ile Asn Ile Ala Ala Thr Ala Thr Ala Val Tyr Lys Asp Gly Thr Ile
900 905 910
Leu Gly His Ser Ser Thr Arg Pro Gln Leu Gly Glu Lys Leu Gln Ser
915 920 925
Thr Asp Val Arg Asp Ile Met Lys Asn Ala Ile Leu Gly Tyr Gln Gln
930 935 940
Val Thr Gly Glu Ser Pro Thr His Ile Val Ile His Arg Asp Gly Phe
945 950 955 960
Met Asn Glu Asp Leu Asp Pro Ala Thr Glu Phe Leu Asn Glu Gln Gly
965 970 975
Val Glu Tyr Asp Ile Val Glu Ile Arg Lys Gln Pro Gln Thr Arg Leu
980 985 990
Leu Ala Val Ser Asp Val Gln Tyr Asp Thr Pro Val Lys Ser Ile Ala
995 1000 1005
Ala Ile Asn Gln Asn Glu Pro Arg Ala Thr Val Ala Thr Phe Gly
1010 1015 1020
Ala Pro Glu Tyr Leu Ala Thr Arg Asp Gly Gly Gly Leu Pro Arg
1025 1030 1035
Pro Ile Gln Ile Glu Arg Val Ala Gly Glu Thr Asp Ile Glu Thr
1040 1045 1050
Leu Thr Arg Gln Val Tyr Leu Leu Ser Gln Ser His Ile Gln Val
1055 1060 1065
His Asn Ser Thr Ala Arg Leu Pro Ile Thr Thr Ala Tyr Ala Asp
1070 1075 1080
Gln Ala Ser Thr His Ala Thr Lys Gly Tyr Leu Val Gln Thr Gly
1085 1090 1095
Ala Phe Glu Ser Asn Val Gly Phe Leu
1100 1105
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:8
<211> 1205
<212> PRT
<213>Artificial sequence
<300>
<308> NLS
<309> 2016-11-11
<313> (1)..(17)
<300>
<308> FOKI-C
<309> 2016-11-11
<313> (18)..(215)
<300>
<308> linker
<309> 2016-11-11
<313> (216)..(220)
<300>
<308> RsAgo
<309> 2016-11-11
<313> (221)..(997)
<300>
<308> linker
<309> 2016-11-11
<313> (998)..(1007)
<300>
<308> FOKI-C
<309> 2016-11-11
<313> (1008)..(1205)
<400> SEQ ID NO:8
Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
1 5 10 15
Ala Ser Ser Gln Leu Val Lys Ser Glu Leu Glu Glu Lys Lys Ser Glu
20 25 30
Leu Arg His Lys Leu Lys Tyr Val Pro His Glu Tyr Ile Glu Leu Ile
35 40 45
Glu Ile Ala Arg Asn Ser Thr Gln Asp Arg Ile Leu Glu Met Lys Val
50 55 60
Met Glu Phe Phe Met Lys Val Tyr Gly Tyr Arg Gly Lys His Leu Gly
65 70 75 80
Gly Ser Arg Lys Pro Asp Gly Ala Ile Tyr Thr Val Gly Ser Pro Ile
85 90 95
Asp Tyr Gly Val Ile Val Asp Thr Lys Ala Tyr Ser Gly Gly Tyr Asn
100 105 110
Leu Pro Ile Gly Gln Ala Asp Glu Met Gln Arg Tyr Val Glu Glu Asn
115 120 125
Gln Thr Arg Asn Lys His Ile Asn Pro Asn Glu Trp Trp Lys Val Tyr
130 135 140
Pro Ser Ser Val Thr Glu Phe Lys Phe Leu Phe Val Ser Gly His Phe
145 150 155 160
Lys Gly Asn Tyr Lys Ala Gln Leu Thr Arg Leu Asn His Ile Thr Asn
165 170 175
Cys Asn Gly Ala Val Leu Ser Val Glu Glu Leu Leu Ile Gly Gly Glu
180 185 190
Met Ile Lys Ala Gly Thr Leu Thr Leu Glu Glu Val Arg Arg Lys Phe
195 200 205
Asn Asn Gly Glu Ile Asn Phe Gly Gly Gly Gly Ser Met Ala Pro Val
210 215 220
Gln Ala Ala Asp Glu Met Tyr Asp Ser Asn Pro His Pro Asp Arg Arg
225 230 235 240
Gln Leu Val Ser Asn Gly Phe Glu Val Asn Leu Pro Asp Gln Val Glu
245 250 255
Val Ile Val Arg Asp Leu Pro Asp Pro Ser Lys Val Lys Glu Glu Arg
260 265 270
Thr Arg Leu Met Gly Tyr Trp Phe Val His Trp Phe Asp Gly Lys Leu
275 280 285
Phe His Leu Arg Ile Lys Ala Gly Gly Pro Asn Val Asp Gly Glu His
290 295 300
Arg Ala Ile Arg Thr Ala Glu His Pro Trp Leu Leu Arg Ala Arg Leu
305 310 315 320
Asp Asp Ala Leu Glu Glu Ala Leu Pro Lys Tyr Ala Ala Val Lys Lys
325 330 335
Arg Pro Phe Thr Phe Leu Ala Gln Lys Asp Glu Leu Ile Asp Ala Ala
340 345 350
Ala Thr Ala Ala Gly Leu Ser His Arg Leu Leu Asn Ser Phe Lys Val
355 360 365
Ile Pro Arg Phe Ala Leu Ser Pro Lys Ile Tyr Glu Pro Val Asp Gly
370 375 380
Thr Thr Arg Val Gly Val Phe Val Thr Ile Gly Met Arg Tyr Asp Ile
385 390 395 400
Glu Ala Ser Leu Arg Asp Leu Leu Glu Ala Gly Ile Asp Leu Arg Gly
405 410 415
Met Tyr Val Val Arg Arg Lys Arg Gln Pro Gly Glu Arg Gly Leu Leu
420 425 430
Gly Arg Val Arg Ala Ile Ser Asp Asp Met Val Gln Leu Phe Glu Glu
435 440 445
Thr Asp Leu Ala Ser Val Asn Val Asn Asp Ala Lys Leu Glu Gly Ser
450 455 460
Lys Glu Asn Phe Thr Arg Cys Leu Ser Ala Leu Leu Gly His Asn Tyr
465 470 475 480
Lys Lys Leu Leu Asn Ala Leu Asp Asp Gln Glu Ala Gly Tyr Arg Thr
485 490 495
Gly Pro Arg Phe Asp Asp Ala Val Arg Arg Met Gly Glu Phe Leu Ala
500 505 510
Lys Lys Pro Ile Arg Leu Ala Asp Asn Ile Asn Ala Gln Val Gly Asp
515 520 525
Arg Ile Val Phe Ser Asn Glu Gly Gln Ala Arg Asn Val Arg Leu Ala
530 535 540
Pro Lys Val Glu Tyr Val Phe Asp Arg Thr Gly Ala Lys Ser Ala Glu
545 550 555 560
Tyr Ala Trp Arg Gly Leu Ser Gln Phe Gly Pro Phe Asp Arg Pro Ser
565 570 575
Phe Ala Asn Arg Ser Pro Arg Ile Leu Val Val Tyr Pro Ser Ser Thr
580 585 590
Gln Gly Lys Val Glu Asn Phe Leu Ser Ala Phe Arg Asp Gly Met Gly
595 600 605
Ser Asn Tyr Ser Gly Phe Ser Lys Gly Phe Val Asp Leu Met Gly Leu
610 615 620
Thr Lys Val Glu Phe Val Met Cys Pro Val Glu Val Ser Ser Ala Asp
625 630 635 640
Arg Asn Gly Ala His Thr Lys Tyr Asn Ser Ala Ile Glu Asp Lys Leu
645 650 655
Ala Gly Ala Gly Glu Val His Ala Gly Ile Val Val Leu Phe Glu Asp
660 665 670
His Ala Arg Leu Pro Asp Asp Arg Asn Pro Tyr Ile His Thr Lys Ser
675 680 685
Leu Leu Leu Thr Leu Gly Val Pro Thr Gln Gln Val Arg Met Pro Thr
690 695 700
Val Leu Leu Glu Pro Lys Ser Leu Gln Tyr Thr Leu Gln Asn Phe Ser
705 710 715 720
Ile Ala Thr Tyr Ala Lys Leu Asn Gly Thr Pro Trp Thr Val Asn His
725 730 735
Asp Lys Ala Ile Asn Asp Glu Leu Val Val Gly Met Gly Leu Ala Glu
740 745 750
Leu Ser Gly Ser Arg Thr Glu Lys Arg Gln Arg Phe Val Gly Ile Thr
755 760 765
Thr Val Phe Ala Gly Asp Gly Ser Tyr Leu Leu Gly Asn Val Ser Lys
770 775 780
Glu Cys Glu Tyr Glu Gly Tyr Ser Asp Ala Ile Arg Glu Ser Met Thr
785 790 795 800
Gly Ile Leu Arg Glu Leu Lys Lys Arg Asn Asn Trp Arg Pro Gly Asp
805 810 815
Thr Val Arg Val Val Phe His Ala His Arg Pro Leu Lys Arg Val Asp
820 825 830
Val Ala Ser Ile Val Phe Glu Cys Thr Arg Glu Ile Gly Ser Asp Gln
835 840 845
Asn Ile Gln Met Ala Phe Val Thr Val Ser His Asp His Pro Phe Val
850 855 860
Leu Ile Asp Arg Ser Glu Arg Gly Leu Glu Ala Tyr Lys Gly Ser Thr
865 870 875 880
Ala Arg Lys Gly Val Phe Ala Pro Pro Arg Gly Ala Ile Ser Arg Val
885 890 895
Gly Arg Leu Thr Arg Leu Leu Ala Val Asn Ser Pro Gln Leu Ile Lys
900 905 910
Arg Ala Asn Thr Pro Leu Pro Thr Pro Leu Leu Val Ser Leu His Pro
915 920 925
Asp Ser Thr Phe Lys Asp Val Asp Tyr Leu Ala Glu Gln Ala Leu Lys
930 935 940
Phe Thr Ser Leu Ser Trp Arg Ser Thr Leu Pro Ala Ala Thr Pro Val
945 950 955 960
Thr Ile Phe Tyr Ser Glu Arg Ile Ala Glu Leu Leu Gly Arg Leu Lys
965 970 975
Ser Ile Pro Asn Trp Ser Ser Ala Asn Leu Asn Ile Lys Leu Lys Trp
980 985 990
Ser Arg Trp Phe Leu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ser
995 1000 1005
Ser Gln Leu Val Lys Ser Glu Leu Glu Glu Lys Lys Ser Glu Leu
1010 1015 1020
Arg His Lys Leu Lys Tyr Val Pro His Glu Tyr Ile Glu Leu Ile
1025 1030 1035
Glu Ile Ala Arg Asn Ser Thr Gln Asp Arg Ile Leu Glu Met Lys
1040 1045 1050
Val Met Glu Phe Phe Met Lys Val Tyr Gly Tyr Arg Gly Lys His
1055 1060 1065
Leu Gly Gly Ser Arg Lys Pro Asp Gly Ala Ile Tyr Thr Val Gly
1070 1075 1080
Ser Pro Ile Asp Tyr Gly Val Ile Val Asp Thr Lys Ala Tyr Ser
1085 1090 1095
Gly Gly Tyr Asn Leu Pro Ile Gly Gln Ala Asp Glu Met Gln Arg
1100 1105 1110
Tyr Val Glu Glu Asn Gln Thr Arg Asn Lys His Ile Asn Pro Asn
1115 1120 1125
Glu Trp Trp Lys Val Tyr Pro Ser Ser Val Thr Glu Phe Lys Phe
1130 1135 1140
Leu Phe Val Ser Gly His Phe Lys Gly Asn Tyr Lys Ala Gln Leu
1145 1150 1155
Thr Arg Leu Asn His Ile Thr Asn Cys Asn Gly Ala Val Leu Ser
1160 1165 1170
Val Glu Glu Leu Leu Ile Gly Gly Glu Met Ile Lys Ala Gly Thr
1175 1180 1185
Leu Thr Leu Glu Glu Val Arg Arg Lys Phe Asn Asn Gly Glu Ile
1190 1195 1200
Asn Phe
1205
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:9
<211> 1067
<212> PRT
<213>Artificial sequence
<300>
<308> NLS
<309> 2016-11-11
<313> (1)..(17)
<300>
<308> FOKI-C
<309> 2016-11-11
<313> (18)..(215)
<300>
<308> linker
<309> 2016-11-11
<313> (216)..(220)
<300>
<308> dMpAgo
<309> 2016-11-11
<313> (221)..(859)
<300>
<308> linker
<309> 2016-11-11
<313> (860)..(869)
<300>
<308> FOKI-C
<309> 2016-11-11
<313> (870)..(1067)
<400> SEQ ID NO:9
Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
1 5 10 15
Ala Ser Ser Gln Leu Val Lys Ser Glu Leu Glu Glu Lys Lys Ser Glu
20 25 30
Leu Arg His Lys Leu Lys Tyr Val Pro His Glu Tyr Ile Glu Leu Ile
35 40 45
Glu Ile Ala Arg Asn Ser Thr Gln Asp Arg Ile Leu Glu Met Lys Val
50 55 60
Met Glu Phe Phe Met Lys Val Tyr Gly Tyr Arg Gly Lys His Leu Gly
65 70 75 80
Gly Ser Arg Lys Pro Asp Gly Ala Ile Tyr Thr Val Gly Ser Pro Ile
85 90 95
Asp Tyr Gly Val Ile Val Asp Thr Lys Ala Tyr Ser Gly Gly Tyr Asn
100 105 110
Leu Pro Ile Gly Gln Ala Asp Glu Met Gln Arg Tyr Val Glu Glu Asn
115 120 125
Gln Thr Arg Asn Lys His Ile Asn Pro Asn Glu Trp Trp Lys Val Tyr
130 135 140
Pro Ser Ser Val Thr Glu Phe Lys Phe Leu Phe Val Ser Gly His Phe
145 150 155 160
Lys Gly Asn Tyr Lys Ala Gln Leu Thr Arg Leu Asn His Ile Thr Asn
165 170 175
Cys Asn Gly Ala Val Leu Ser Val Glu Glu Leu Leu Ile Gly Gly Glu
180 185 190
Met Ile Lys Ala Gly Thr Leu Thr Leu Glu Glu Val Arg Arg Lys Phe
195 200 205
Asn Asn Gly Glu Ile Asn Phe Gly Gly Gly Gly Ser Met Tyr Leu Asn
210 215 220
Leu Tyr Lys Ile Asp Ile Pro Lys Lys Ile Lys Arg Leu Tyr Phe Tyr
225 230 235 240
Asn Pro Asp Met Glu Pro Lys Leu Phe Ala Arg Asn Leu Ser Arg Val
245 250 255
Asn Asn Phe Lys Phe Gln Asp Ser Asn Asp Leu Val Trp Ile Glu Ile
260 265 270
Pro Asp Ile Asp Phe Gln Ile Thr Pro Lys Asn Val Phe Gln Tyr Lys
275 280 285
Val Glu Lys Glu Glu Ile Ile Lys Glu Glu Glu Asp Lys Lys Leu Phe
290 295 300
Val Lys Thr Leu Tyr Lys Tyr Ile Lys Lys Leu Phe Leu Asp Asn Asp
305 310 315 320
Phe Tyr Phe Lys Lys Gly Asn Asn Phe Ile Ser Asn Ser Glu Val Phe
325 330 335
Ser Leu Asp Ser Asn Glu Asn Val Asn Ala His Leu Thr Tyr Lys Ile
340 345 350
Lys Ile His Asn Ile Ser Asn Glu Tyr Tyr Leu Ser Ile Leu Pro Lys
355 360 365
Phe Thr Phe Leu Ser Lys Glu Pro Ala Leu Glu Ser Ala Ile Lys Ser
370 375 380
Gly Tyr Leu Tyr Asn Ile Lys Ser Gly Lys Ser Phe Pro Tyr Ile Ser
385 390 395 400
Gly Leu Asp Gly Ile Leu Lys Ile Asp Ile Gly Asn Asn Gln Ile Val
405 410 415
Glu Val Ala Tyr Pro Glu Asn Tyr Leu Phe Asn Phe Thr Thr Arg Asp
420 425 430
Ala Glu Lys Tyr Gly Phe Ser Lys Glu Val His Glu Ile Tyr Lys Asn
435 440 445
Lys Val Phe Glu Gly Phe Lys Lys Ile Pro Lys Thr Leu Gly Phe Leu
450 455 460
Asn Lys Ile Thr Asn Leu Asn Glu Asn Tyr Gln Leu Lys Asp Gly Tyr
465 470 475 480
Lys Ile Phe Ile Asn Val Ile Tyr Lys Phe Lys Asn Gly Glu Ser Arg
485 490 495
Tyr Ala Lys Asp Val Phe Lys Tyr Ser Phe Tyr Lys Asn Glu Gln Pro
500 505 510
Leu Lys Ala Ile Phe Phe Phe Ser Ser Lys Lys Gln Phe Phe Glu Val
515 520 525
Gln Lys Ser Leu Lys Glu Leu Phe His Asn Lys His Ser Val Phe Tyr
530 535 540
Arg Ala Ala Ala Glu Leu Gly Phe Ser Lys Val Glu Phe Leu Arg Asp
545 550 555 560
Ser Lys Thr Lys Ser Ser Ala Phe Leu Tyr Asn Pro Glu Glu Phe Thr
565 570 575
Val Lys Asn Thr Glu Phe Ile Asn Gln Ile Glu Asp Asn Val Met Ala
580 585 590
Ile Val Leu Leu Asp Lys Tyr Ile Gly Asn Ile Asp Pro Leu Val Arg
595 600 605
Asn Phe Pro Asp Asn Leu Ile Leu Gln Pro Ile Leu Lys Glu Lys Leu
610 615 620
Glu Asp Ile Lys Pro Phe Ile Ile Lys Ser Tyr Val Tyr Lys Met Gly
625 630 635 640
Asn Phe Ile Pro Glu Cys Lys Pro Phe Ile Leu Lys Lys Met Glu Asp
645 650 655
Lys Glu Lys Asn Leu Tyr Ile Gly Ile Ala Leu Ser His Asp Thr Tyr
660 665 670
Ala Arg Lys Thr Asn Leu Cys Ile Ala Ala Val Asp Asn Thr Gly Asp
675 680 685
Ile Leu Tyr Ile Gly Lys His Lys Asn Leu Glu Leu Asn Glu Lys Met
690 695 700
Asn Leu Asp Ile Leu Glu Lys Glu Tyr Ile Lys Ala Phe Glu Lys Tyr
705 710 715 720
Ile Glu Lys Phe Asn Val Ser Pro Glu Asn Val Phe Ile Leu Arg Asp
725 730 735
Gly Arg Phe Ile Glu Asp Ile Glu Ile Ile Lys Asn Phe Ile Ser Tyr
740 745 750
Asn Asp Thr Lys Tyr Thr Leu Val Glu Val Asn Lys Asn Thr Asn Ile
755 760 765
Asn Ser Tyr Asp Asp Leu Lys Glu Trp Ile Ile Lys Leu Asp Glu Asn
770 775 780
Thr Tyr Ile Tyr Tyr Pro Lys Thr Phe Leu Asn Gln Lys Gly Val Glu
785 790 795 800
Val Lys Ile Leu Glu Asn Asn Thr Asp Tyr Thr Ile Glu Glu Ile Ile
805 810 815
Glu Gln Ile Tyr Leu Leu Thr Arg Val Ala His Ser Thr Pro Tyr Thr
820 825 830
Asn Tyr Lys Leu Pro Tyr Pro Leu His Ile Ala Asn Lys Val Ala Leu
835 840 845
Thr Asp Tyr Glu Trp Lys Leu Tyr Ile Pro Tyr Gly Gly Gly Gly Ser
850 855 860
Gly Gly Gly Gly Ser Ser Ser Gln Leu Val Lys Ser Glu Leu Glu Glu
865 870 875 880
Lys Lys Ser Glu Leu Arg His Lys Leu Lys Tyr Val Pro His Glu Tyr
885 890 895
Ile Glu Leu Ile Glu Ile Ala Arg Asn Ser Thr Gln Asp Arg Ile Leu
900 905 910
Glu Met Lys Val Met Glu Phe Phe Met Lys Val Tyr Gly Tyr Arg Gly
915 920 925
Lys His Leu Gly Gly Ser Arg Lys Pro Asp Gly Ala Ile Tyr Thr Val
930 935 940
Gly Ser Pro Ile Asp Tyr Gly Val Ile Val Asp Thr Lys Ala Tyr Ser
945 950 955 960
Gly Gly Tyr Asn Leu Pro Ile Gly Gln Ala Asp Glu Met Gln Arg Tyr
965 970 975
Val Glu Glu Asn Gln Thr Arg Asn Lys His Ile Asn Pro Asn Glu Trp
980 985 990
Trp Lys Val Tyr Pro Ser Ser Val Thr Glu Phe Lys Phe Leu Phe Val
995 1000 1005
Ser Gly His Phe Lys Gly Asn Tyr Lys Ala Gln Leu Thr Arg Leu
1010 1015 1020
Asn His Ile Thr Asn Cys Asn Gly Ala Val Leu Ser Val Glu Glu
1025 1030 1035
Leu Leu Ile Gly Gly Glu Met Ile Lys Ala Gly Thr Leu Thr Leu
1040 1045 1050
Glu Glu Val Arg Arg Lys Phe Asn Asn Gly Glu Ile Asn Phe
1055 1060 1065
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:10
<211> 1315
<212> PRT
<213>Artificial sequence
<300>
<308> NLS
<309> 2016-11-11
<313> (1)..(17)
<300>
<308> FOKI-C
<309> 2016-11-11
<313> (18)..(215)
<300>
<308> linker
<309> 2016-11-11
<313> (216)..(220)
<300>
<308> dNgAgo
<309> 2016-11-11
<313> (221)..(1107)
<300>
<308> linker
<309> 2016-11-11
<313> (1108)..(1117)
<300>
<308> FOKI-C
<309> 2016-11-11
<313> (1118)..(1315)
<400> SEQ ID NO:10
Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
1 5 10 15
Ala Ser Ser Gln Leu Val Lys Ser Glu Leu Glu Glu Lys Lys Ser Glu
20 25 30
Leu Arg His Lys Leu Lys Tyr Val Pro His Glu Tyr Ile Glu Leu Ile
35 40 45
Glu Ile Ala Arg Asn Ser Thr Gln Asp Arg Ile Leu Glu Met Lys Val
50 55 60
Met Glu Phe Phe Met Lys Val Tyr Gly Tyr Arg Gly Lys His Leu Gly
65 70 75 80
Gly Ser Arg Lys Pro Asp Gly Ala Ile Tyr Thr Val Gly Ser Pro Ile
85 90 95
Asp Tyr Gly Val Ile Val Asp Thr Lys Ala Tyr Ser Gly Gly Tyr Asn
100 105 110
Leu Pro Ile Gly Gln Ala Asp Glu Met Gln Arg Tyr Val Glu Glu Asn
115 120 125
Gln Thr Arg Asn Lys His Ile Asn Pro Asn Glu Trp Trp Lys Val Tyr
130 135 140
Pro Ser Ser Val Thr Glu Phe Lys Phe Leu Phe Val Ser Gly His Phe
145 150 155 160
Lys Gly Asn Tyr Lys Ala Gln Leu Thr Arg Leu Asn His Ile Thr Asn
165 170 175
Cys Asn Gly Ala Val Leu Ser Val Glu Glu Leu Leu Ile Gly Gly Glu
180 185 190
Met Ile Lys Ala Gly Thr Leu Thr Leu Glu Glu Val Arg Arg Lys Phe
195 200 205
Asn Asn Gly Glu Ile Asn Phe Gly Gly Gly Gly Ser Met Thr Val Ile
210 215 220
Asp Leu Asp Ser Thr Thr Thr Ala Asp Glu Leu Thr Ser Gly His Thr
225 230 235 240
Tyr Asp Ile Ser Val Thr Leu Thr Gly Val Tyr Asp Asn Thr Asp Glu
245 250 255
Gln His Pro Arg Met Ser Leu Ala Phe Glu Gln Asp Asn Gly Glu Arg
260 265 270
Arg Tyr Ile Thr Leu Trp Lys Asn Thr Thr Pro Lys Asp Val Phe Thr
275 280 285
Tyr Asp Tyr Ala Thr Gly Ser Thr Tyr Ile Phe Thr Asn Ile Asp Tyr
290 295 300
Glu Val Lys Asp Gly Tyr Glu Asn Leu Thr Ala Thr Tyr Gln Thr Thr
305 310 315 320
Val Glu Asn Ala Thr Ala Gln Glu Val Gly Thr Thr Asp Glu Asp Glu
325 330 335
Thr Phe Ala Gly Gly Glu Pro Leu Asp His His Leu Asp Asp Ala Leu
340 345 350
Asn Glu Thr Pro Asp Asp Ala Glu Thr Glu Ser Asp Ser Gly His Val
355 360 365
Met Thr Ser Phe Ala Ser Arg Asp Gln Leu Pro Glu Trp Thr Leu His
370 375 380
Thr Tyr Thr Leu Thr Ala Thr Asp Gly Ala Lys Thr Asp Thr Glu Tyr
385 390 395 400
Ala Arg Arg Thr Leu Ala Tyr Thr Val Arg Gln Glu Leu Tyr Thr Asp
405 410 415
His Asp Ala Ala Pro Val Ala Thr Asp Gly Leu Met Leu Leu Thr Pro
420 425 430
Glu Pro Leu Gly Glu Thr Pro Leu Asp Leu Asp Cys Gly Val Arg Val
435 440 445
Glu Ala Asp Glu Thr Arg Thr Leu Asp Tyr Thr Thr Ala Lys Asp Arg
450 455 460
Leu Leu Ala Arg Glu Leu Val Glu Glu Gly Leu Lys Arg Ser Leu Trp
465 470 475 480
Asp Asp Tyr Leu Val Arg Gly Ile Asp Glu Val Leu Ser Lys Glu Pro
485 490 495
Val Leu Thr Cys Asp Glu Phe Asp Leu His Glu Arg Tyr Asp Leu Ser
500 505 510
Val Glu Val Gly His Ser Gly Arg Ala Tyr Leu His Ile Asn Phe Arg
515 520 525
His Arg Phe Val Pro Lys Leu Thr Leu Ala Asp Ile Asp Asp Asp Asn
530 535 540
Ile Tyr Pro Gly Leu Arg Val Lys Thr Thr Tyr Arg Pro Arg Arg Gly
545 550 555 560
His Ile Val Trp Gly Leu Arg Asp Glu Cys Ala Thr Asp Ser Leu Asn
565 570 575
Thr Leu Gly Asn Gln Ser Val Val Ala Tyr His Arg Asn Asn Gln Thr
580 585 590
Pro Ile Asn Thr Asp Leu Leu Asp Ala Ile Glu Ala Ala Asp Arg Arg
595 600 605
Val Val Glu Thr Arg Arg Gln Gly His Gly Asp Asp Ala Val Ser Phe
610 615 620
Pro Gln Glu Leu Leu Ala Val Glu Pro Asn Thr His Gln Ile Lys Gln
625 630 635 640
Phe Ala Ser Asp Gly Phe His Gln Gln Ala Arg Ser Lys Thr Arg Leu
645 650 655
Ser Ala Ser Arg Cys Ser Glu Lys Ala Gln Ala Phe Ala Glu Arg Leu
660 665 670
Asp Pro Val Arg Leu Asn Gly Ser Thr Val Glu Phe Ser Ser Glu Phe
675 680 685
Phe Thr Gly Asn Asn Glu Gln Gln Leu Arg Leu Leu Tyr Glu Asn Gly
690 695 700
Glu Ser Val Leu Thr Phe Arg Asp Gly Ala Arg Gly Ala His Pro Asp
705 710 715 720
Glu Thr Phe Ser Lys Gly Ile Val Asn Pro Pro Glu Ser Phe Glu Val
725 730 735
Ala Val Val Leu Pro Glu Gln Gln Ala Asp Thr Cys Lys Ala Gln Trp
740 745 750
Asp Thr Met Ala Asp Leu Leu Asn Gln Ala Gly Ala Pro Pro Thr Arg
755 760 765
Ser Glu Thr Val Gln Tyr Asp Ala Phe Ser Ser Pro Glu Ser Ile Ser
770 775 780
Leu Asn Val Ala Gly Ala Ile Asp Pro Ser Glu Val Asp Ala Ala Phe
785 790 795 800
Val Val Leu Pro Pro Asp Gln Glu Gly Phe Ala Asp Leu Ala Ser Pro
805 810 815
Thr Glu Thr Tyr Asp Glu Leu Lys Lys Ala Leu Ala Asn Met Gly Ile
820 825 830
Tyr Ser Gln Met Ala Tyr Phe Asp Arg Phe Arg Asp Ala Lys Ile Phe
835 840 845
Tyr Thr Arg Asn Val Ala Leu Gly Leu Leu Ala Ala Ala Gly Gly Val
850 855 860
Ala Phe Thr Thr Glu His Ala Met Pro Gly Asp Ala Asp Met Phe Ile
865 870 875 880
Gly Ile Ala Val Ser Arg Ser Tyr Pro Glu Asp Gly Ala Ser Gly Gln
885 890 895
Ile Asn Ile Ala Ala Thr Ala Thr Ala Val Tyr Lys Asp Gly Thr Ile
900 905 910
Leu Gly His Ser Ser Thr Arg Pro Gln Leu Gly Glu Lys Leu Gln Ser
915 920 925
Thr Asp Val Arg Asp Ile Met Lys Asn Ala Ile Leu Gly Tyr Gln Gln
930 935 940
Val Thr Gly Glu Ser Pro Thr His Ile Val Ile His Arg Asp Gly Phe
945 950 955 960
Met Asn Glu Asp Leu Asp Pro Ala Thr Glu Phe Leu Asn Glu Gln Gly
965 970 975
Val Glu Tyr Asp Ile Val Glu Ile Arg Lys Gln Pro Gln Thr Arg Leu
980 985 990
Leu Ala Val Ser Asp Val Gln Tyr Asp Thr Pro Val Lys Ser Ile Ala
995 1000 1005
Ala Ile Asn Gln Asn Glu Pro Arg Ala Thr Val Ala Thr Phe Gly
1010 1015 1020
Ala Pro Glu Tyr Leu Ala Thr Arg Asp Gly Gly Gly Leu Pro Arg
1025 1030 1035
Pro Ile Gln Ile Glu Arg Val Ala Gly Glu Thr Asp Ile Glu Thr
1040 1045 1050
Leu Thr Arg Gln Val Tyr Leu Leu Ser Gln Ser His Ile Gln Val
1055 1060 1065
His Asn Ser Thr Ala Arg Leu Pro Ile Thr Thr Ala Tyr Ala Asp
1070 1075 1080
Gln Ala Ser Thr His Ala Thr Lys Gly Tyr Leu Val Gln Thr Gly
1085 1090 1095
Ala Phe Glu Ser Asn Val Gly Phe Leu Gly Gly Gly Gly Ser Gly
1100 1105 1110
Gly Gly Gly Ser Ser Ser Gln Leu Val Lys Ser Glu Leu Glu Glu
1115 1120 1125
Lys Lys Ser Glu Leu Arg His Lys Leu Lys Tyr Val Pro His Glu
1130 1135 1140
Tyr Ile Glu Leu Ile Glu Ile Ala Arg Asn Ser Thr Gln Asp Arg
1145 1150 1155
Ile Leu Glu Met Lys Val Met Glu Phe Phe Met Lys Val Tyr Gly
1160 1165 1170
Tyr Arg Gly Lys His Leu Gly Gly Ser Arg Lys Pro Asp Gly Ala
1175 1180 1185
Ile Tyr Thr Val Gly Ser Pro Ile Asp Tyr Gly Val Ile Val Asp
1190 1195 1200
Thr Lys Ala Tyr Ser Gly Gly Tyr Asn Leu Pro Ile Gly Gln Ala
1205 1210 1215
Asp Glu Met Gln Arg Tyr Val Glu Glu Asn Gln Thr Arg Asn Lys
1220 1225 1230
His Ile Asn Pro Asn Glu Trp Trp Lys Val Tyr Pro Ser Ser Val
1235 1240 1245
Thr Glu Phe Lys Phe Leu Phe Val Ser Gly His Phe Lys Gly Asn
1250 1255 1260
Tyr Lys Ala Gln Leu Thr Arg Leu Asn His Ile Thr Asn Cys Asn
1265 1270 1275
Gly Ala Val Leu Ser Val Glu Glu Leu Leu Ile Gly Gly Glu Met
1280 1285 1290
Ile Lys Ala Gly Thr Leu Thr Leu Glu Glu Val Arg Arg Lys Phe
1295 1300 1305
Asn Asn Gly Glu Ile Asn Phe
1310 1315
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:11
<211> 1002
<212> PRT
<213>Artificial sequence
<300>
<308> NLS
<309> 2016-11-11
<313> (1)..(17)
<300>
<308> RsAgo
<309> 2016-11-11
<313> (18)..(794)
<300>
<308> linker
<309> 2016-11-11
<313> (795)..(804)
<300>
<308> FOKI-C
<309> 2016-11-11
<313> (805)..(1002)
<400> SEQ ID NO:11
Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
1 5 10 15
Ala Met Ala Pro Val Gln Ala Ala Asp Glu Met Tyr Asp Ser Asn Pro
20 25 30
His Pro Asp Arg Arg Gln Leu Val Ser Asn Gly Phe Glu Val Asn Leu
35 40 45
Pro Asp Gln Val Glu Val Ile Val Arg Asp Leu Pro Asp Pro Ser Lys
50 55 60
Val Lys Glu Glu Arg Thr Arg Leu Met Gly Tyr Trp Phe Val His Trp
65 70 75 80
Phe Asp Gly Lys Leu Phe His Leu Arg Ile Lys Ala Gly Gly Pro Asn
85 90 95
Val Asp Gly Glu His Arg Ala Ile Arg Thr Ala Glu His Pro Trp Leu
100 105 110
Leu Arg Ala Arg Leu Asp Asp Ala Leu Glu Glu Ala Leu Pro Lys Tyr
115 120 125
Ala Ala Val Lys Lys Arg Pro Phe Thr Phe Leu Ala Gln Lys Asp Glu
130 135 140
Leu Ile Asp Ala Ala Ala Thr Ala Ala Gly Leu Ser His Arg Leu Leu
145 150 155 160
Asn Ser Phe Lys Val Ile Pro Arg Phe Ala Leu Ser Pro Lys Ile Tyr
165 170 175
Glu Pro Val Asp Gly Thr Thr Arg Val Gly Val Phe Val Thr Ile Gly
180 185 190
Met Arg Tyr Asp Ile Glu Ala Ser Leu Arg Asp Leu Leu Glu Ala Gly
195 200 205
Ile Asp Leu Arg Gly Met Tyr Val Val Arg Arg Lys Arg Gln Pro Gly
210 215 220
Glu Arg Gly Leu Leu Gly Arg Val Arg Ala Ile Ser Asp Asp Met Val
225 230 235 240
Gln Leu Phe Glu Glu Thr Asp Leu Ala Ser Val Asn Val Asn Asp Ala
245 250 255
Lys Leu Glu Gly Ser Lys Glu Asn Phe Thr Arg Cys Leu Ser Ala Leu
260 265 270
Leu Gly His Asn Tyr Lys Lys Leu Leu Asn Ala Leu Asp Asp Gln Glu
275 280 285
Ala Gly Tyr Arg Thr Gly Pro Arg Phe Asp Asp Ala Val Arg Arg Met
290 295 300
Gly Glu Phe Leu Ala Lys Lys Pro Ile Arg Leu Ala Asp Asn Ile Asn
305 310 315 320
Ala Gln Val Gly Asp Arg Ile Val Phe Ser Asn Glu Gly Gln Ala Arg
325 330 335
Asn Val Arg Leu Ala Pro Lys Val Glu Tyr Val Phe Asp Arg Thr Gly
340 345 350
Ala Lys Ser Ala Glu Tyr Ala Trp Arg Gly Leu Ser Gln Phe Gly Pro
355 360 365
Phe Asp Arg Pro Ser Phe Ala Asn Arg Ser Pro Arg Ile Leu Val Val
370 375 380
Tyr Pro Ser Ser Thr Gln Gly Lys Val Glu Asn Phe Leu Ser Ala Phe
385 390 395 400
Arg Asp Gly Met Gly Ser Asn Tyr Ser Gly Phe Ser Lys Gly Phe Val
405 410 415
Asp Leu Met Gly Leu Thr Lys Val Glu Phe Val Met Cys Pro Val Glu
420 425 430
Val Ser Ser Ala Asp Arg Asn Gly Ala His Thr Lys Tyr Asn Ser Ala
435 440 445
Ile Glu Asp Lys Leu Ala Gly Ala Gly Glu Val His Ala Gly Ile Val
450 455 460
Val Leu Phe Glu Asp His Ala Arg Leu Pro Asp Asp Arg Asn Pro Tyr
465 470 475 480
Ile His Thr Lys Ser Leu Leu Leu Thr Leu Gly Val Pro Thr Gln Gln
485 490 495
Val Arg Met Pro Thr Val Leu Leu Glu Pro Lys Ser Leu Gln Tyr Thr
500 505 510
Leu Gln Asn Phe Ser Ile Ala Thr Tyr Ala Lys Leu Asn Gly Thr Pro
515 520 525
Trp Thr Val Asn His Asp Lys Ala Ile Asn Asp Glu Leu Val Val Gly
530 535 540
Met Gly Leu Ala Glu Leu Ser Gly Ser Arg Thr Glu Lys Arg Gln Arg
545 550 555 560
Phe Val Gly Ile Thr Thr Val Phe Ala Gly Asp Gly Ser Tyr Leu Leu
565 570 575
Gly Asn Val Ser Lys Glu Cys Glu Tyr Glu Gly Tyr Ser Asp Ala Ile
580 585 590
Arg Glu Ser Met Thr Gly Ile Leu Arg Glu Leu Lys Lys Arg Asn Asn
595 600 605
Trp Arg Pro Gly Asp Thr Val Arg Val Val Phe His Ala His Arg Pro
610 615 620
Leu Lys Arg Val Asp Val Ala Ser Ile Val Phe Glu Cys Thr Arg Glu
625 630 635 640
Ile Gly Ser Asp Gln Asn Ile Gln Met Ala Phe Val Thr Val Ser His
645 650 655
Asp His Pro Phe Val Leu Ile Asp Arg Ser Glu Arg Gly Leu Glu Ala
660 665 670
Tyr Lys Gly Ser Thr Ala Arg Lys Gly Val Phe Ala Pro Pro Arg Gly
675 680 685
Ala Ile Ser Arg Val Gly Arg Leu Thr Arg Leu Leu Ala Val Asn Ser
690 695 700
Pro Gln Leu Ile Lys Arg Ala Asn Thr Pro Leu Pro Thr Pro Leu Leu
705 710 715 720
Val Ser Leu His Pro Asp Ser Thr Phe Lys Asp Val Asp Tyr Leu Ala
725 730 735
Glu Gln Ala Leu Lys Phe Thr Ser Leu Ser Trp Arg Ser Thr Leu Pro
740 745 750
Ala Ala Thr Pro Val Thr Ile Phe Tyr Ser Glu Arg Ile Ala Glu Leu
755 760 765
Leu Gly Arg Leu Lys Ser Ile Pro Asn Trp Ser Ser Ala Asn Leu Asn
770 775 780
Ile Lys Leu Lys Trp Ser Arg Trp Phe Leu Gly Gly Gly Gly Ser Gly
785 790 795 800
Gly Gly Gly Ser Ser Ser Gln Leu Val Lys Ser Glu Leu Glu Glu Lys
805 810 815
Lys Ser Glu Leu Arg His Lys Leu Lys Tyr Val Pro His Glu Tyr Ile
820 825 830
Glu Leu Ile Glu Ile Ala Arg Asn Ser Thr Gln Asp Arg Ile Leu Glu
835 840 845
Met Lys Val Met Glu Phe Phe Met Lys Val Tyr Gly Tyr Arg Gly Lys
850 855 860
His Leu Gly Gly Ser Arg Lys Pro Asp Gly Ala Ile Tyr Thr Val Gly
865 870 875 880
Ser Pro Ile Asp Tyr Gly Val Ile Val Asp Thr Lys Ala Tyr Ser Gly
885 890 895
Gly Tyr Asn Leu Pro Ile Gly Gln Ala Asp Glu Met Gln Arg Tyr Val
900 905 910
Glu Glu Asn Gln Thr Arg Asn Lys His Ile Asn Pro Asn Glu Trp Trp
915 920 925
Lys Val Tyr Pro Ser Ser Val Thr Glu Phe Lys Phe Leu Phe Val Ser
930 935 940
Gly His Phe Lys Gly Asn Tyr Lys Ala Gln Leu Thr Arg Leu Asn His
945 950 955 960
Ile Thr Asn Cys Asn Gly Ala Val Leu Ser Val Glu Glu Leu Leu Ile
965 970 975
Gly Gly Glu Met Ile Lys Ala Gly Thr Leu Thr Leu Glu Glu Val Arg
980 985 990
Arg Lys Phe Asn Asn Gly Glu Ile Asn Phe
995 1000
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:12
<211> 1112
<212> PRT
<213>Artificial sequence
<300>
<308> NLS
<309> 2016-11-11
<313> (1)..(17)
<300>
<308> dNgAgo
<309> 2016-11-11
<313> (18)..(904)
<300>
<308> linker
<309> 2016-11-11
<313> (905)..(914)
<300>
<308> FOKI-C
<309> 2016-11-11
<313> (915)..(1112)
<400> SEQ ID NO:12
Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
1 5 10 15
Ala Met Thr Val Ile Asp Leu Asp Ser Thr Thr Thr Ala Asp Glu Leu
20 25 30
Thr Ser Gly His Thr Tyr Asp Ile Ser Val Thr Leu Thr Gly Val Tyr
35 40 45
Asp Asn Thr Asp Glu Gln His Pro Arg Met Ser Leu Ala Phe Glu Gln
50 55 60
Asp Asn Gly Glu Arg Arg Tyr Ile Thr Leu Trp Lys Asn Thr Thr Pro
65 70 75 80
Lys Asp Val Phe Thr Tyr Asp Tyr Ala Thr Gly Ser Thr Tyr Ile Phe
85 90 95
Thr Asn Ile Asp Tyr Glu Val Lys Asp Gly Tyr Glu Asn Leu Thr Ala
100 105 110
Thr Tyr Gln Thr Thr Val Glu Asn Ala Thr Ala Gln Glu Val Gly Thr
115 120 125
Thr Asp Glu Asp Glu Thr Phe Ala Gly Gly Glu Pro Leu Asp His His
130 135 140
Leu Asp Asp Ala Leu Asn Glu Thr Pro Asp Asp Ala Glu Thr Glu Ser
145 150 155 160
Asp Ser Gly His Val Met Thr Ser Phe Ala Ser Arg Asp Gln Leu Pro
165 170 175
Glu Trp Thr Leu His Thr Tyr Thr Leu Thr Ala Thr Asp Gly Ala Lys
180 185 190
Thr Asp Thr Glu Tyr Ala Arg Arg Thr Leu Ala Tyr Thr Val Arg Gln
195 200 205
Glu Leu Tyr Thr Asp His Asp Ala Ala Pro Val Ala Thr Asp Gly Leu
210 215 220
Met Leu Leu Thr Pro Glu Pro Leu Gly Glu Thr Pro Leu Asp Leu Asp
225 230 235 240
Cys Gly Val Arg Val Glu Ala Asp Glu Thr Arg Thr Leu Asp Tyr Thr
245 250 255
Thr Ala Lys Asp Arg Leu Leu Ala Arg Glu Leu Val Glu Glu Gly Leu
260 265 270
Lys Arg Ser Leu Trp Asp Asp Tyr Leu Val Arg Gly Ile Asp Glu Val
275 280 285
Leu Ser Lys Glu Pro Val Leu Thr Cys Asp Glu Phe Asp Leu His Glu
290 295 300
Arg Tyr Asp Leu Ser Val Glu Val Gly His Ser Gly Arg Ala Tyr Leu
305 310 315 320
His Ile Asn Phe Arg His Arg Phe Val Pro Lys Leu Thr Leu Ala Asp
325 330 335
Ile Asp Asp Asp Asn Ile Tyr Pro Gly Leu Arg Val Lys Thr Thr Tyr
340 345 350
Arg Pro Arg Arg Gly His Ile Val Trp Gly Leu Arg Asp Glu Cys Ala
355 360 365
Thr Asp Ser Leu Asn Thr Leu Gly Asn Gln Ser Val Val Ala Tyr His
370 375 380
Arg Asn Asn Gln Thr Pro Ile Asn Thr Asp Leu Leu Asp Ala Ile Glu
385 390 395 400
Ala Ala Asp Arg Arg Val Val Glu Thr Arg Arg Gln Gly His Gly Asp
405 410 415
Asp Ala Val Ser Phe Pro Gln Glu Leu Leu Ala Val Glu Pro Asn Thr
420 425 430
His Gln Ile Lys Gln Phe Ala Ser Asp Gly Phe His Gln Gln Ala Arg
435 440 445
Ser Lys Thr Arg Leu Ser Ala Ser Arg Cys Ser Glu Lys Ala Gln Ala
450 455 460
Phe Ala Glu Arg Leu Asp Pro Val Arg Leu Asn Gly Ser Thr Val Glu
465 470 475 480
Phe Ser Ser Glu Phe Phe Thr Gly Asn Asn Glu Gln Gln Leu Arg Leu
485 490 495
Leu Tyr Glu Asn Gly Glu Ser Val Leu Thr Phe Arg Asp Gly Ala Arg
500 505 510
Gly Ala His Pro Asp Glu Thr Phe Ser Lys Gly Ile Val Asn Pro Pro
515 520 525
Glu Ser Phe Glu Val Ala Val Val Leu Pro Glu Gln Gln Ala Asp Thr
530 535 540
Cys Lys Ala Gln Trp Asp Thr Met Ala Asp Leu Leu Asn Gln Ala Gly
545 550 555 560
Ala Pro Pro Thr Arg Ser Glu Thr Val Gln Tyr Asp Ala Phe Ser Ser
565 570 575
Pro Glu Ser Ile Ser Leu Asn Val Ala Gly Ala Ile Asp Pro Ser Glu
580 585 590
Val Asp Ala Ala Phe Val Val Leu Pro Pro Asp Gln Glu Gly Phe Ala
595 600 605
Asp Leu Ala Ser Pro Thr Glu Thr Tyr Asp Glu Leu Lys Lys Ala Leu
610 615 620
Ala Asn Met Gly Ile Tyr Ser Gln Met Ala Tyr Phe Asp Arg Phe Arg
625 630 635 640
Asp Ala Lys Ile Phe Tyr Thr Arg Asn Val Ala Leu Gly Leu Leu Ala
645 650 655
Ala Ala Gly Gly Val Ala Phe Thr Thr Glu His Ala Met Pro Gly Asp
660 665 670
Ala Asp Met Phe Ile Gly Ile Ala Val Ser Arg Ser Tyr Pro Glu Asp
675 680 685
Gly Ala Ser Gly Gln Ile Asn Ile Ala Ala Thr Ala Thr Ala Val Tyr
690 695 700
Lys Asp Gly Thr Ile Leu Gly His Ser Ser Thr Arg Pro Gln Leu Gly
705 710 715 720
Glu Lys Leu Gln Ser Thr Asp Val Arg Asp Ile Met Lys Asn Ala Ile
725 730 735
Leu Gly Tyr Gln Gln Val Thr Gly Glu Ser Pro Thr His Ile Val Ile
740 745 750
His Arg Asp Gly Phe Met Asn Glu Asp Leu Asp Pro Ala Thr Glu Phe
755 760 765
Leu Asn Glu Gln Gly Val Glu Tyr Asp Ile Val Glu Ile Arg Lys Gln
770 775 780
Pro Gln Thr Arg Leu Leu Ala Val Ser Asp Val Gln Tyr Asp Thr Pro
785 790 795 800
Val Lys Ser Ile Ala Ala Ile Asn Gln Asn Glu Pro Arg Ala Thr Val
805 810 815
Ala Thr Phe Gly Ala Pro Glu Tyr Leu Ala Thr Arg Asp Gly Gly Gly
820 825 830
Leu Pro Arg Pro Ile Gln Ile Glu Arg Val Ala Gly Glu Thr Asp Ile
835 840 845
Glu Thr Leu Thr Arg Gln Val Tyr Leu Leu Ser Gln Ser His Ile Gln
850 855 860
Val His Asn Ser Thr Ala Arg Leu Pro Ile Thr Thr Ala Tyr Ala Asp
865 870 875 880
Gln Ala Ser Thr His Ala Thr Lys Gly Tyr Leu Val Gln Thr Gly Ala
885 890 895
Phe Glu Ser Asn Val Gly Phe Leu Gly Gly Gly Gly Ser Gly Gly Gly
900 905 910
Gly Ser Ser Ser Gln Leu Val Lys Ser Glu Leu Glu Glu Lys Lys Ser
915 920 925
Glu Leu Arg His Lys Leu Lys Tyr Val Pro His Glu Tyr Ile Glu Leu
930 935 940
Ile Glu Ile Ala Arg Asn Ser Thr Gln Asp Arg Ile Leu Glu Met Lys
945 950 955 960
Val Met Glu Phe Phe Met Lys Val Tyr Gly Tyr Arg Gly Lys His Leu
965 970 975
Gly Gly Ser Arg Lys Pro Asp Gly Ala Ile Tyr Thr Val Gly Ser Pro
980 985 990
Ile Asp Tyr Gly Val Ile Val Asp Thr Lys Ala Tyr Ser Gly Gly Tyr
995 1000 1005
Asn Leu Pro Ile Gly Gln Ala Asp Glu Met Gln Arg Tyr Val Glu
1010 1015 1020
Glu Asn Gln Thr Arg Asn Lys His Ile Asn Pro Asn Glu Trp Trp
1025 1030 1035
Lys Val Tyr Pro Ser Ser Val Thr Glu Phe Lys Phe Leu Phe Val
1040 1045 1050
Ser Gly His Phe Lys Gly Asn Tyr Lys Ala Gln Leu Thr Arg Leu
1055 1060 1065
Asn His Ile Thr Asn Cys Asn Gly Ala Val Leu Ser Val Glu Glu
1070 1075 1080
Leu Leu Ile Gly Gly Glu Met Ile Lys Ala Gly Thr Leu Thr Leu
1085 1090 1095
Glu Glu Val Arg Arg Lys Phe Asn Asn Gly Glu Ile Asn Phe
1100 1105 1110
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:13
<211> 2994
<212> DNA
<213>Artificial sequence
<400> SEQ ID NO:13
atggccccaa agaagaagcg gaaggtcggt atccacggag tcccagcagc ctcttctcaa 60
ttggttaagt ctgaattgga agaaaagaag tctgaattga gacacaagtt gaagtacgtt 120
ccacacgaat acatcgaatt gatcgaaatc gctagaaact ctactcaaga cagaatcttg 180
gaaatgaagg ttatggaatt tttcatgaag gtttacggtt acagaggtaa gcacttgggt 240
ggttctcgta agccagacgg tgctatctac actgttggtt ctccaatcga ctacggtgtt 300
atcgttgaca ctaaggctta ctctggtggt tacaacttgc caatcggtca agctgacgaa 360
atgcaaagat acgttgaaga aaaccaaact agaaacaagc acatcaaccc aaacgaatgg 420
tggaaggttt acccatcttc tgttactgaa tttaagttct tgttcgtttc tggtcacttc 480
aagggtaact acaaggctca attgactaga ttgaaccaca tcactaactg taacggtgct 540
gttttgtctg ttgaagaatt gttgatcggt ggtgaaatga tcaaggctgg tactttgact 600
ttggaagaag ttagaagaaa gttcaacaac ggtgaaatca acttcggtgg tggtggttct 660
atggctccag ttcaagctgc tgacgaaatg tacgactcta acccacaccc agacagaaga 720
caattggttt ctaacggttt cgaagttaac ttgccagacc aagttgaagt tatcgttaga 780
gacttgccag acccatctaa ggttaaggaa gaaagaacta gattgatggg ttactggttc 840
gttcactggt tcgacggtaa gttgttccac ttgagaatca aggctggtgg tccaaacgtt 900
gacggtgaac acagagctat cagaactgct gaacacccat ggttgttgag agctagattg 960
gacgacgctt tggaggaggc tctcccaaag tacgcggctg ttaagaagag accattcact 1020
ttcttggctc aaaaggacga attgatcgac gctgcagcta ctgcggctgg cttgtctcac 1080
agactcttga actctttcaa ggttatccca agattcgctt tgtctccaaa gatctacgaa 1140
ccagttgacg gtactactag agttggtgtt ttcgttacta tcggtatgag atacgacatc 1200
gaagcttctt tgagagactt gttggaagct ggtatcgact tgagaggtat gtacgttgtt 1260
agaagaaaga gacaaccagg tgaaagaggt ttgttgggta gagttagagc tatctctgac 1320
gacatggttc aattgttcga agaaactgac ttggcttctg ttaacgttaa cgacgctaag 1380
ttggaaggtt ctaaggaaaa cttcactaga tgtttgtctg ctttgttggg tcacaactac 1440
aagaagttgt tgaacgcttt ggacgaccaa gaagctggtt acagaactgg tccaagattc 1500
gacgacgctg ttagaagaat gggtgaattc ttggctaaga agccaatcag attggctgac 1560
aacatcaacg ctcaagttgg tgacagaatc gttttctcta acgaaggtca agctagaaac 1620
gttagattgg ctccaaaggt tgaatacgtt ttcgacagaa ctggtgctaa gtctgctgaa 1680
tacgcttgga gaggtttgtc tcaattcggt ccattcgaca gaccatcttt cgctaacaga 1740
tctccaagaa tactcgttgt gtacccaagc tctactcaag gtaaggttga aaacttcttg 1800
tctgctttca gagacggtat gggttctaac tactctggtt tctctaaggg tttcgttgac 1860
ttgatgggtt tgactaaggt tgaattcgtt atgtgtccag ttgaagtttc ttctgctgac 1920
agaaacggtg ctcacactaa gtacaactct gctatcgaag acaagttggc tggtgctggt 1980
gaagttcacg ctggtatcgt tgttttgttc gaagaccacg ctagattgcc agacgacaga 2040
aacccataca tccacactaa gtctttgttg ttgactttgg gtgttccaac tcaacaagtt 2100
agaatgccaa ctgttttgtt ggaaccaaag tctttgcaat acactttgca aaacttctct 2160
atcgctactt acgctaagtt gaacggtact ccatggactg ttaaccacga caaggctatc 2220
aacgacgaat tggttgttgg tatgggtttg gctgaattgt ctggttctag aactgaaaag 2280
agacaaagat tcgttggtat cactactgtt ttcgctggtg acggttctta cttgttgggt 2340
aacgtttcta aggaatgtga atacgaaggt tactctgacg ctatcagaga atctatgact 2400
ggtatcttga gagaattgaa gaagagaaac aactggagac caggtgacac tgttagagtt 2460
gttttccacg ctcacagacc attgaagaga gttgacgttg cttctatcgt tttcgaatgt 2520
actagagaaa tcggttctga ccaaaacatc caaatggctt tcgttactgt ttctcacgac 2580
cacccattcg ttttgatcga cagatctgaa agaggtttgg aagcttacaa gggttctact 2640
gctagaaagg gtgttttcgc tccaccaaga ggtgctatct ctagagttgg tagattgact 2700
agattgttgg ctgttaactc tccacaattg atcaagagag ctaacactcc attgccaact 2760
ccactcctcg ttagcttgca cccagactcg actttcaagg acgttgacta cctcgctgag 2820
caagctctca agtttacttc gttgtcttgg agatcgactt tgccagctgc tactccagtt 2880
actatcttct actctgaaag aatcgctgaa ttgttgggta gattgaagtc tatcccaaac 2940
tggtcttctg ctaacttgaa catcaagttg aagtggtcta gatggttctt gtaa 2994
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:14
<211> 2580
<212> DNA
<213>Artificial sequence
<400> SEQ ID NO:14
atggccccaa agaagaagcg gaaggtcggt atccacggag tcccagcagc ctcttctcaa 60
ttggttaagt ctgaattgga agaaaagaag tctgaattga gacacaagtt gaagtacgtt 120
ccacacgaat acatcgaatt gatcgaaatc gctagaaact ctactcaaga cagaatcttg 180
gaaatgaagg ttatggaatt tttcatgaag gtttacggtt acagaggtaa gcacttgggt 240
ggttctcgta agccagacgg tgctatctac actgttggtt ctccaatcga ctacggtgtt 300
atcgttgaca ctaaggctta ctctggtggt tacaacttgc caatcggtca agctgacgaa 360
atgcaaagat acgttgaaga aaaccaaact agaaacaagc acatcaaccc aaacgaatgg 420
tggaaggttt acccatcttc tgttactgaa tttaagttct tgttcgtttc tggtcacttc 480
aagggtaact acaaggctca attgactaga ttgaaccaca tcactaactg taacggtgct 540
gttttgtctg ttgaagaatt gttgatcggt ggtgaaatga tcaaggctgg tactttgact 600
ttggaagaag ttagaagaaa gttcaacaac ggtgaaatca acttcggtgg tggtggttct 660
atgtacttga acttgtacaa gatcgacatc ccaaagaaga tcaagagatt gtacttctac 720
aacccagaca tggaaccaaa gttgttcgct agaaacttgt ctcgtgttaa caacttcaag 780
ttccaagatt ctaacgactt ggtatggata gaaatcccag acatcgactt ccaaatcact 840
ccaaagaacg ttttccaata caaggttgaa aaggaagaaa tcatcaagga agaagaagac 900
aagaagttgt tcgttaagac tttgtacaag tacatcaaga agttgttctt ggacaacgac 960
ttctacttca agaagggtaa caacttcatc tctaactctg aagttttctc tttggactct 1020
aacgaaaacg ttaacgctca cttgacttac aagatcaaga tccacaacat ctctaacgaa 1080
tactacttgt ctatcttgcc aaagttcact ttcttgtcta aggaaccagc tttggaatct 1140
gctatcaagt ctggttactt gtacaacatc aagtctggta agtctttccc atacatctct 1200
ggtttggacg gtatcttgaa gatcgacatc ggtaacaacc aaatcgttga agttgcttac 1260
ccagaaaact acttgttcaa cttcactact agagacgctg aaaagtacgg tttctctaag 1320
gaagttcacg aaatctacaa gaacaaggtt ttcgaaggtt tcaagaagat cccaaagact 1380
ctcggcttct tgaacaagat aactaacttg aacgaaaact accaattgaa ggacggttac 1440
aagatcttca tcaacgttat ctacaagttc aagaacggtg aatctcgtta cgctaaggac 1500
gttttcaagt actctttcta caagaacgaa caaccattga aggctatctt cttcttctct 1560
tctaagaagc aattcttcga agttcaaaag tctttgaagg aattgttcca caacaagcac 1620
tctgttttct acagagctgc tgctgaattg ggtttctcta aggttgaatt cttgagagac 1680
tctaagacta agtcttctgc tttcttgtac aacccagaag aattcactgt taagaacact 1740
gaattcatca accaaatcga agacaacgtt atggctatcg ttttgttgga caagtacatc 1800
ggtaacatcg acccattggt tagaaacttc ccagacaact tgatcttgca accaatcttg 1860
aaggaaaagt tggaagacat caagccattc atcatcaagt cttacgttta caagatgggt 1920
aacttcatcc cagaatgtaa gccattcatc ttgaagaaga tggaagacaa ggaaaagaac 1980
ttgtacatcg gtatcgactt gtctcacgac acttacgcta gaaagactaa cttgtgtatc 2040
gctgctgttg acaacactgg tgacatcttg tacatcggta agcacaagaa cttggaattg 2100
aacgaaaaga tgaacttgga catcttggaa aaggaataca tcaaggcttt cgaaaagtac 2160
atcgaaaagt tcaacgtttc tccagagaac gtattcatcc tcagagacgg tagattcatc 2220
gaagacatcg aaatcatcaa gaacttcatc tcttacaacg acactaagta cactttggtt 2280
gaagttaaca agaacactaa catcaactct tacgacgact tgaaggaatg gatcatcaag 2340
ttggacgaaa acacttacat ctactaccca aagactttct tgaaccaaaa gggtgttgaa 2400
gttaagatct tggaaaacaa cactgactac actatcgaag aaatcatcga acaaatctac 2460
ttgttgacta gagttgctca ctctactcca tacactaact acaagttgcc atacccattg 2520
cacatcgcta acaaggttgc tttgactgac tacgaatgga agttgtacat cccatactaa 2580
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:15
<211> 2580
<212> DNA
<213>Artificial sequence
<400> SEQ ID NO:15
atggccccaa agaagaagcg gaaggtcggt atccacggag tcccagcagc ctcttctcaa 60
ttggttaagt ctgaattgga agaaaagaag tctgaattga gacacaagtt gaagtacgtt 120
ccacacgaat acatcgaatt gatcgaaatc gctagaaact ctactcaaga cagaatcttg 180
gaaatgaagg ttatggaatt tttcatgaag gtttacggtt acagaggtaa gcacttgggt 240
ggttctcgta agccagacgg tgctatctac actgttggtt ctccaatcga ctacggtgtt 300
atcgttgaca ctaaggctta ctctggtggt tacaacttgc caatcggtca agctgacgaa 360
atgcaaagat acgttgaaga aaaccaaact agaaacaagc acatcaaccc aaacgaatgg 420
tggaaggttt acccatcttc tgttactgaa tttaagttct tgttcgtttc tggtcacttc 480
aagggtaact acaaggctca attgactaga ttgaaccaca tcactaactg taacggtgct 540
gttttgtctg ttgaagaatt gttgatcggt ggtgaaatga tcaaggctgg tactttgact 600
ttggaagaag ttagaagaaa gttcaacaac ggtgaaatca acttcggtgg tggtggttct 660
atgtacttga acttgtacaa gatcgacatc ccaaagaaga tcaagagatt gtacttctac 720
aacccagaca tggaaccaaa gttgttcgct agaaacttgt ctcgtgttaa caacttcaag 780
ttccaagatt ctaacgactt ggtatggata gaaatcccag acatcgactt ccaaatcact 840
ccaaagaacg ttttccaata caaggttgaa aaggaagaaa tcatcaagga agaagaagac 900
aagaagttgt tcgttaagac tttgtacaag tacatcaaga agttgttctt ggacaacgac 960
ttctacttca agaagggtaa caacttcatc tctaactctg aagttttctc tttggactct 1020
aacgaaaacg ttaacgctca cttgacttac aagatcaaga tccacaacat ctctaacgaa 1080
tactacttgt ctatcttgcc aaagttcact ttcttgtcta aggaaccagc tttggaatct 1140
gctatcaagt ctggttactt gtacaacatc aagtctggta agtctttccc atacatctct 1200
ggtttggacg gtatcttgaa gatcgacatc ggtaacaacc aaatcgttga agttgcttac 1260
ccagaaaact acttgttcaa cttcactact agagacgctg aaaagtacgg tttctctaag 1320
gaagttcacg aaatctacaa gaacaaggtt ttcgaaggtt tcaagaagat cccaaagact 1380
ctcggcttct tgaacaagat aactaacttg aacgaaaact accaattgaa ggacggttac 1440
aagatcttca tcaacgttat ctacaagttc aagaacggtg aatctcgtta cgctaaggac 1500
gttttcaagt actctttcta caagaacgaa caaccattga aggctatctt cttcttctct 1560
tctaagaagc aattcttcga agttcaaaag tctttgaagg aattgttcca caacaagcac 1620
tctgttttct acagagctgc tgctgaattg ggtttctcta aggttgaatt cttgagagac 1680
tctaagacta agtcttctgc tttcttgtac aacccagaag aattcactgt taagaacact 1740
gaattcatca accaaatcga agacaacgtt atggctatcg ttttgttgga caagtacatc 1800
ggtaacatcg acccattggt tagaaacttc ccagacaact tgatcttgca accaatcttg 1860
aaggaaaagt tggaagacat caagccattc atcatcaagt cttacgttta caagatgggt 1920
aacttcatcc cagaatgtaa gccattcatc ttgaagaaga tggaagacaa ggaaaagaac 1980
ttgtacatcg gtatcgcttt gtctcacgac acttacgcta gaaagactaa cttgtgtatc 2040
gctgctgttg acaacactgg tgacatcttg tacatcggta agcacaagaa cttggaattg 2100
aacgaaaaga tgaacttgga catcttggaa aaggaataca tcaaggcttt cgaaaagtac 2160
atcgaaaagt tcaacgtttc tccagagaac gtattcatcc tcagagacgg tagattcatc 2220
gaagacatcg aaatcatcaa gaacttcatc tcttacaacg acactaagta cactttggtt 2280
gaagttaaca agaacactaa catcaactct tacgacgact tgaaggaatg gatcatcaag 2340
ttggacgaaa acacttacat ctactaccca aagactttct tgaaccaaaa gggtgttgaa 2400
gttaagatct tggaaaacaa cactgactac actatcgaag aaatcatcga acaaatctac 2460
ttgttgacta gagttgctca ctctactcca tacactaact acaagttgcc atacccattg 2520
cacatcgcta acaaggttgc tttgactgac tacgaatgga agttgtacat cccatactaa 2580
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:16
<211> 3324
<212> DNA
<213>Artificial sequence
<400> SEQ ID NO:16
atggccccaa agaagaagcg gaaggtcggt atccacggag tcccagcagc ctcttctcaa 60
ttggttaagt ctgaattgga agaaaagaag tctgaattga gacacaagtt gaagtacgtt 120
ccacacgaat acatcgaatt gatcgaaatc gctagaaact ctactcaaga cagaatcttg 180
gaaatgaagg ttatggaatt tttcatgaag gtttacggtt acagaggtaa gcacttgggt 240
ggttctcgta agccagacgg tgctatctac actgttggtt ctccaatcga ctacggtgtt 300
atcgttgaca ctaaggctta ctctggtggt tacaacttgc caatcggtca agctgacgaa 360
atgcaaagat acgttgaaga aaaccaaact agaaacaagc acatcaaccc aaacgaatgg 420
tggaaggttt acccatcttc tgttactgaa tttaagttct tgttcgtttc tggtcacttc 480
aagggtaact acaaggctca attgactaga ttgaaccaca tcactaactg taacggtgct 540
gttttgtctg ttgaagaatt gttgatcggt ggtgaaatga tcaaggctgg tactttgact 600
ttggaagaag ttagaagaaa gttcaacaac ggtgaaatca acttcggtgg tggtggttct 660
atgactgtta tcgacttgga ctctactact actgctgacg aattgacttc tggtcacact 720
tacgacatct ctgttacttt gactggtgtt tacgacaaca ctgacgaaca acacccaaga 780
atgtcgttgg cgttcgaaca agacaatggt gaaagaagat acatcacttt gtggaagaac 840
actacaccaa aggacgtgtt cacgtacgac tacgctactg gttctactta catcttcact 900
aacatcgact acgaagttaa ggacggttac gaaaacttga ctgctactta ccaaactact 960
gttgaaaacg ctactgctca agaagttggt actactgacg aagacgaaac tttcgctggt 1020
ggtgaaccat tggaccacca cttggacgac gctttgaacg aaactccaga cgacgctgaa 1080
actgaatctg actctggcca cgttatgact agcttcgctt ctagagacca attgccagaa 1140
tggactttgc acacttacac tttgactgct actgacggtg ctaagactga cactgaatac 1200
gctagaagaa ctttggctta cactgttaga caagaattgt acactgacca cgacgctgct 1260
cccgttgcta ctgacggctt gatgttgttg actccagaac cattgggtga aactccattg 1320
gacttggact gtggtgttag agttgaagct gacgaaacta gaactttgga ctacactact 1380
gctaaggaca gattgttggc tagagaattg gttgaagaag gtttgaagag atctttgtgg 1440
gacgactact tggttagagg tatcgacgaa gttttgtcta aggaaccagt tttgacttgt 1500
gacgaattcg acttgcacga aagatacgac ttgtctgttg aagttggtca ctctggtaga 1560
gcttacttgc acatcaactt cagacacaga ttcgttccaa agttgacttt ggctgacatc 1620
gacgacgaca acatctaccc aggtttgaga gttaagacta cttacagacc aagaagaggt 1680
cacatcgttt ggggtttgag agacgaatgt gctactgact ctttgaacac tttgggtaac 1740
caatctgttg ttgcttacca cagaaacaac caaactccaa tcaacactga cttgttggac 1800
gctatcgaag ctgctgacag aagagttgtt gaaactagaa gacaaggtca cggtgacgac 1860
gctgtttctt tcccacaaga attgttggct gttgaaccaa acactcacca aatcaagcaa 1920
ttcgcttctg acggtttcca ccaacaagct agatctaaga ctagattgtc tgcttctaga 1980
tgttctgaaa aggctcaagc tttcgctgaa agattggacc cagttagatt gaacggttct 2040
actgttgaat tctcttctga attcttcact ggtaacaacg aacaacaatt gagattgttg 2100
tacgaaaacg gtgaatctgt tttgactttc agagacggtg ctagaggtgc tcacccagac 2160
gaaactttct ctaagggtat cgttaaccca ccagaatctt tcgaagttgc ggttgtgctg 2220
ccagaacaac aagctgacac ttgtaaggct caatgggaca ctatggctga cttgttgaac 2280
caagctggtg ctccaccaac tagatctgaa actgttcaat acgacgcttt ctcttctcca 2340
gaatctatct ctttgaacgt tgctggtgct atcgacccat ctgaagttga cgctgctttc 2400
gttgttttgc caccagacca agaaggtttc gctgacttgg cttctccaac tgaaacttac 2460
gacgaattga agaaggcttt ggctaacatg ggtatctact ctcaaatggc ttacttcgac 2520
agattcagag acgctaagat cttctacact agaaacgttg ctttgggttt gttggctgct 2580
gctggtggtg ttgctttcac tactgaacac gctatgccag gtgacgctga catgttcatc 2640
ggcatagccg taagcagatc ttacccagaa gacggtgctt ctggtcaaat caacatcgct 2700
gctactgcta ctgctgttta caaggacggt actatcttgg gtcactcttc tactagacca 2760
caattgggtg aaaagttgca atctactgac gttagagaca tcatgaagaa cgctatcttg 2820
ggttaccaac aagttactgg tgaatctcca actcacatcg ttatccacag agacggtttc 2880
atgaacgaag acttggaccc agctactgaa ttcttgaacg aacaaggtgt tgaatacgac 2940
atcgttgaaa tcagaaagca accacaaact agattgttgg ctgtttctga cgttcaatac 3000
gacactccag ttaagtctat cgctgctatc aaccaaaacg aaccaagagc tacagttgct 3060
acattcggtg ctccagagta cttggctact agagacggtg gtggtttgcc aagaccaatc 3120
caaatcgaaa gagttgctgg tgaaactgac atcgaaactt tgactagaca agtttacttg 3180
ttgtctcaat ctcacatcca agttcacaac tctactgcta gattgccaat cactactgct 3240
tacgctgacc aagcttctac tcacgctact aagggttact tggttcaaac tggtgctttc 3300
gaatctaacg ttggtttctt gtaa 3324
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:17
<211> 3618
<212> DNA
<213>Artificial sequence
<400> SEQ ID NO:17
atggccccaa agaagaagcg gaaggtcggt atccacggag tcccagcagc ctcttctcaa 60
ttggttaagt ctgaattgga agaaaagaag tctgaattga gacacaagtt gaagtacgtt 120
ccacacgaat acatcgaatt gatcgaaatc gctagaaact ctactcaaga cagaatcttg 180
gaaatgaagg ttatggaatt tttcatgaag gtttacggtt acagaggtaa gcacttgggt 240
ggttctcgta agccagacgg tgctatctac actgttggtt ctccaatcga ctacggtgtt 300
atcgttgaca ctaaggctta ctctggtggt tacaacttgc caatcggtca agctgacgaa 360
atgcaaagat acgttgaaga aaaccaaact agaaacaagc acatcaaccc aaacgaatgg 420
tggaaggttt acccatcttc tgttactgaa tttaagttct tgttcgtttc tggtcacttc 480
aagggtaact acaaggctca attgactaga ttgaaccaca tcactaactg taacggtgct 540
gttttgtctg ttgaagaatt gttgatcggt ggtgaaatga tcaaggctgg tactttgact 600
ttggaagaag ttagaagaaa gttcaacaac ggtgaaatca acttcggtgg tggtggttct 660
atggctccag ttcaagctgc tgacgaaatg tacgactcta acccacaccc agacagaaga 720
caattggttt ctaacggttt cgaagttaac ttgccagacc aagttgaagt tatcgttaga 780
gacttgccag acccatctaa ggttaaggaa gaaagaacta gattgatggg ttactggttc 840
gttcactggt tcgacggtaa gttgttccac ttgagaatca aggctggtgg tccaaacgtt 900
gacggtgaac acagagctat cagaactgct gaacacccat ggttgttgag agctagattg 960
gacgacgctt tggaggaggc tctcccaaag tacgcggctg ttaagaagag accattcact 1020
ttcttggctc aaaaggacga attgatcgac gctgcagcta ctgcggctgg cttgtctcac 1080
agactcttga actctttcaa ggttatccca agattcgctt tgtctccaaa gatctacgaa 1140
ccagttgacg gtactactag agttggtgtt ttcgttacta tcggtatgag atacgacatc 1200
gaagcttctt tgagagactt gttggaagct ggtatcgact tgagaggtat gtacgttgtt 1260
agaagaaaga gacaaccagg tgaaagaggt ttgttgggta gagttagagc tatctctgac 1320
gacatggttc aattgttcga agaaactgac ttggcttctg ttaacgttaa cgacgctaag 1380
ttggaaggtt ctaaggaaaa cttcactaga tgtttgtctg ctttgttggg tcacaactac 1440
aagaagttgt tgaacgcttt ggacgaccaa gaagctggtt acagaactgg tccaagattc 1500
gacgacgctg ttagaagaat gggtgaattc ttggctaaga agccaatcag attggctgac 1560
aacatcaacg ctcaagttgg tgacagaatc gttttctcta acgaaggtca agctagaaac 1620
gttagattgg ctccaaaggt tgaatacgtt ttcgacagaa ctggtgctaa gtctgctgaa 1680
tacgcttgga gaggtttgtc tcaattcggt ccattcgaca gaccatcttt cgctaacaga 1740
tctccaagaa tactcgttgt gtacccaagc tctactcaag gtaaggttga aaacttcttg 1800
tctgctttca gagacggtat gggttctaac tactctggtt tctctaaggg tttcgttgac 1860
ttgatgggtt tgactaaggt tgaattcgtt atgtgtccag ttgaagtttc ttctgctgac 1920
agaaacggtg ctcacactaa gtacaactct gctatcgaag acaagttggc tggtgctggt 1980
gaagttcacg ctggtatcgt tgttttgttc gaagaccacg ctagattgcc agacgacaga 2040
aacccataca tccacactaa gtctttgttg ttgactttgg gtgttccaac tcaacaagtt 2100
agaatgccaa ctgttttgtt ggaaccaaag tctttgcaat acactttgca aaacttctct 2160
atcgctactt acgctaagtt gaacggtact ccatggactg ttaaccacga caaggctatc 2220
aacgacgaat tggttgttgg tatgggtttg gctgaattgt ctggttctag aactgaaaag 2280
agacaaagat tcgttggtat cactactgtt ttcgctggtg acggttctta cttgttgggt 2340
aacgtttcta aggaatgtga atacgaaggt tactctgacg ctatcagaga atctatgact 2400
ggtatcttga gagaattgaa gaagagaaac aactggagac caggtgacac tgttagagtt 2460
gttttccacg ctcacagacc attgaagaga gttgacgttg cttctatcgt tttcgaatgt 2520
actagagaaa tcggttctga ccaaaacatc caaatggctt tcgttactgt ttctcacgac 2580
cacccattcg ttttgatcga cagatctgaa agaggtttgg aagcttacaa gggttctact 2640
gctagaaagg gtgttttcgc tccaccaaga ggtgctatct ctagagttgg tagattgact 2700
agattgttgg ctgttaactc tccacaattg atcaagagag ctaacactcc attgccaact 2760
ccactcctcg ttagcttgca cccagactcg actttcaagg acgttgacta cctcgctgag 2820
caagctctca agtttacttc gttgtcttgg agatcgactt tgccagctgc tactccagtt 2880
actatcttct actctgaaag aatcgctgaa ttgttgggta gattgaagtc tatcccaaac 2940
tggtcttctg ctaacttgaa catcaagttg aagtggtcta gatggttctt gggaggtggg 3000
ggatctggtg gaggtgggtc atcctcccag ctggttaagt ccgagctgga ggagaagaag 3060
tccgagctgc gccacaagct gaagtacgtt ccacacgagt acatcgagct gatcgagatc 3120
gctcgcaact ccacccagga ccgcatcctg gagatgaagg ttatggagtt cttcatgaag 3180
gtttacggct accgcggcaa gcacctgggc ggctcccgca agccagacgg cgctatctac 3240
accgttggct ccccaatcga ctacggcgtt atcgttgaca ccaaggctta ctccggcggc 3300
tacaacctgc caatcggcca ggctgacgag atgcagcgct acgttgagga gaaccagacc 3360
cgcaacaagc acatcaaccc aaacgagtgg tggaaggttt acccatcctc cgttaccgag 3420
ttcaagttcc tgttcgtttc cggccacttc aagggcaact acaaggctca gctgacccgc 3480
ctgaaccaca tcaccaactg caacggcgct gttctgtccg ttgaggagct gctgatcggc 3540
ggcgagatga tcaaggctgg caccctgacc ctggaggagg ttcgccgcaa gttcaacaac 3600
ggcgagatca acttctaa 3618
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:18
<211> 3204
<212> DNA
<213>Artificial sequence
<400> SEQ ID NO:18
atggccccaa agaagaagcg gaaggtcggt atccacggag tcccagcagc ctcttctcaa 60
ttggttaagt ctgaattgga agaaaagaag tctgaattga gacacaagtt gaagtacgtt 120
ccacacgaat acatcgaatt gatcgaaatc gctagaaact ctactcaaga cagaatcttg 180
gaaatgaagg ttatggaatt tttcatgaag gtttacggtt acagaggtaa gcacttgggt 240
ggttctcgta agccagacgg tgctatctac actgttggtt ctccaatcga ctacggtgtt 300
atcgttgaca ctaaggctta ctctggtggt tacaacttgc caatcggtca agctgacgaa 360
atgcaaagat acgttgaaga aaaccaaact agaaacaagc acatcaaccc aaacgaatgg 420
tggaaggttt acccatcttc tgttactgaa tttaagttct tgttcgtttc tggtcacttc 480
aagggtaact acaaggctca attgactaga ttgaaccaca tcactaactg taacggtgct 540
gttttgtctg ttgaagaatt gttgatcggt ggtgaaatga tcaaggctgg tactttgact 600
ttggaagaag ttagaagaaa gttcaacaac ggtgaaatca acttcggtgg tggtggttct 660
atgtacttga acttgtacaa gatcgacatc ccaaagaaga tcaagagatt gtacttctac 720
aacccagaca tggaaccaaa gttgttcgct agaaacttgt ctcgtgttaa caacttcaag 780
ttccaagatt ctaacgactt ggtatggata gaaatcccag acatcgactt ccaaatcact 840
ccaaagaacg ttttccaata caaggttgaa aaggaagaaa tcatcaagga agaagaagac 900
aagaagttgt tcgttaagac tttgtacaag tacatcaaga agttgttctt ggacaacgac 960
ttctacttca agaagggtaa caacttcatc tctaactctg aagttttctc tttggactct 1020
aacgaaaacg ttaacgctca cttgacttac aagatcaaga tccacaacat ctctaacgaa 1080
tactacttgt ctatcttgcc aaagttcact ttcttgtcta aggaaccagc tttggaatct 1140
gctatcaagt ctggttactt gtacaacatc aagtctggta agtctttccc atacatctct 1200
ggtttggacg gtatcttgaa gatcgacatc ggtaacaacc aaatcgttga agttgcttac 1260
ccagaaaact acttgttcaa cttcactact agagacgctg aaaagtacgg tttctctaag 1320
gaagttcacg aaatctacaa gaacaaggtt ttcgaaggtt tcaagaagat cccaaagact 1380
ctcggcttct tgaacaagat aactaacttg aacgaaaact accaattgaa ggacggttac 1440
aagatcttca tcaacgttat ctacaagttc aagaacggtg aatctcgtta cgctaaggac 1500
gttttcaagt actctttcta caagaacgaa caaccattga aggctatctt cttcttctct 1560
tctaagaagc aattcttcga agttcaaaag tctttgaagg aattgttcca caacaagcac 1620
tctgttttct acagagctgc tgctgaattg ggtttctcta aggttgaatt cttgagagac 1680
tctaagacta agtcttctgc tttcttgtac aacccagaag aattcactgt taagaacact 1740
gaattcatca accaaatcga agacaacgtt atggctatcg ttttgttgga caagtacatc 1800
ggtaacatcg acccattggt tagaaacttc ccagacaact tgatcttgca accaatcttg 1860
aaggaaaagt tggaagacat caagccattc atcatcaagt cttacgttta caagatgggt 1920
aacttcatcc cagaatgtaa gccattcatc ttgaagaaga tggaagacaa ggaaaagaac 1980
ttgtacatcg gtatcgcttt gtctcacgac acttacgcta gaaagactaa cttgtgtatc 2040
gctgctgttg acaacactgg tgacatcttg tacatcggta agcacaagaa cttggaattg 2100
aacgaaaaga tgaacttgga catcttggaa aaggaataca tcaaggcttt cgaaaagtac 2160
atcgaaaagt tcaacgtttc tccagagaac gtattcatcc tcagagacgg tagattcatc 2220
gaagacatcg aaatcatcaa gaacttcatc tcttacaacg acactaagta cactttggtt 2280
gaagttaaca agaacactaa catcaactct tacgacgact tgaaggaatg gatcatcaag 2340
ttggacgaaa acacttacat ctactaccca aagactttct tgaaccaaaa gggtgttgaa 2400
gttaagatct tggaaaacaa cactgactac actatcgaag aaatcatcga acaaatctac 2460
ttgttgacta gagttgctca ctctactcca tacactaact acaagttgcc atacccattg 2520
cacatcgcta acaaggttgc tttgactgac tacgaatgga agttgtacat cccatacgga 2580
ggtgggggat ctggtggagg tgggtcatcc tcccagctgg ttaagtccga gctggaggag 2640
aagaagtccg agctgcgcca caagctgaag tacgttccac acgagtacat cgagctgatc 2700
gagatcgctc gcaactccac ccaggaccgc atcctggaga tgaaggttat ggagttcttc 2760
atgaaggttt acggctaccg cggcaagcac ctgggcggct cccgcaagcc agacggcgct 2820
atctacaccg ttggctcccc aatcgactac ggcgttatcg ttgacaccaa ggcttactcc 2880
ggcggctaca acctgccaat cggccaggct gacgagatgc agcgctacgt tgaggagaac 2940
cagacccgca acaagcacat caacccaaac gagtggtgga aggtttaccc atcctccgtt 3000
accgagttca agttcctgtt cgtttccggc cacttcaagg gcaactacaa ggctcagctg 3060
acccgcctga accacatcac caactgcaac ggcgctgttc tgtccgttga ggagctgctg 3120
atcggcggcg agatgatcaa ggctggcacc ctgaccctgg aggaggttcg ccgcaagttc 3180
aacaacggcg agatcaactt ctaa 3204
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:19
<211> 3948
<212> DNA
<213>Artificial sequence
<400> SEQ ID NO:19
atggccccaa agaagaagcg gaaggtcggt atccacggag tcccagcagc ctcttctcaa 60
ttggttaagt ctgaattgga agaaaagaag tctgaattga gacacaagtt gaagtacgtt 120
ccacacgaat acatcgaatt gatcgaaatc gctagaaact ctactcaaga cagaatcttg 180
gaaatgaagg ttatggaatt tttcatgaag gtttacggtt acagaggtaa gcacttgggt 240
ggttctcgta agccagacgg tgctatctac actgttggtt ctccaatcga ctacggtgtt 300
atcgttgaca ctaaggctta ctctggtggt tacaacttgc caatcggtca agctgacgaa 360
atgcaaagat acgttgaaga aaaccaaact agaaacaagc acatcaaccc aaacgaatgg 420
tggaaggttt acccatcttc tgttactgaa tttaagttct tgttcgtttc tggtcacttc 480
aagggtaact acaaggctca attgactaga ttgaaccaca tcactaactg taacggtgct 540
gttttgtctg ttgaagaatt gttgatcggt ggtgaaatga tcaaggctgg tactttgact 600
ttggaagaag ttagaagaaa gttcaacaac ggtgaaatca acttcggtgg tggtggttct 660
atgactgtta tcgacttgga ctctactact actgctgacg aattgacttc tggtcacact 720
tacgacatct ctgttacttt gactggtgtt tacgacaaca ctgacgaaca acacccaaga 780
atgtcgttgg cgttcgaaca agacaatggt gaaagaagat acatcacttt gtggaagaac 840
actacaccaa aggacgtgtt cacgtacgac tacgctactg gttctactta catcttcact 900
aacatcgact acgaagttaa ggacggttac gaaaacttga ctgctactta ccaaactact 960
gttgaaaacg ctactgctca agaagttggt actactgacg aagacgaaac tttcgctggt 1020
ggtgaaccat tggaccacca cttggacgac gctttgaacg aaactccaga cgacgctgaa 1080
actgaatctg actctggcca cgttatgact agcttcgctt ctagagacca attgccagaa 1140
tggactttgc acacttacac tttgactgct actgacggtg ctaagactga cactgaatac 1200
gctagaagaa ctttggctta cactgttaga caagaattgt acactgacca cgacgctgct 1260
cccgttgcta ctgacggctt gatgttgttg actccagaac cattgggtga aactccattg 1320
gacttggact gtggtgttag agttgaagct gacgaaacta gaactttgga ctacactact 1380
gctaaggaca gattgttggc tagagaattg gttgaagaag gtttgaagag atctttgtgg 1440
gacgactact tggttagagg tatcgacgaa gttttgtcta aggaaccagt tttgacttgt 1500
gacgaattcg acttgcacga aagatacgac ttgtctgttg aagttggtca ctctggtaga 1560
gcttacttgc acatcaactt cagacacaga ttcgttccaa agttgacttt ggctgacatc 1620
gacgacgaca acatctaccc aggtttgaga gttaagacta cttacagacc aagaagaggt 1680
cacatcgttt ggggtttgag agacgaatgt gctactgact ctttgaacac tttgggtaac 1740
caatctgttg ttgcttacca cagaaacaac caaactccaa tcaacactga cttgttggac 1800
gctatcgaag ctgctgacag aagagttgtt gaaactagaa gacaaggtca cggtgacgac 1860
gctgtttctt tcccacaaga attgttggct gttgaaccaa acactcacca aatcaagcaa 1920
ttcgcttctg acggtttcca ccaacaagct agatctaaga ctagattgtc tgcttctaga 1980
tgttctgaaa aggctcaagc tttcgctgaa agattggacc cagttagatt gaacggttct 2040
actgttgaat tctcttctga attcttcact ggtaacaacg aacaacaatt gagattgttg 2100
tacgaaaacg gtgaatctgt tttgactttc agagacggtg ctagaggtgc tcacccagac 2160
gaaactttct ctaagggtat cgttaaccca ccagaatctt tcgaagttgc ggttgtgctg 2220
ccagaacaac aagctgacac ttgtaaggct caatgggaca ctatggctga cttgttgaac 2280
caagctggtg ctccaccaac tagatctgaa actgttcaat acgacgcttt ctcttctcca 2340
gaatctatct ctttgaacgt tgctggtgct atcgacccat ctgaagttga cgctgctttc 2400
gttgttttgc caccagacca agaaggtttc gctgacttgg cttctccaac tgaaacttac 2460
gacgaattga agaaggcttt ggctaacatg ggtatctact ctcaaatggc ttacttcgac 2520
agattcagag acgctaagat cttctacact agaaacgttg ctttgggttt gttggctgct 2580
gctggtggtg ttgctttcac tactgaacac gctatgccag gtgacgctga catgttcatc 2640
ggcatagccg taagcagatc ttacccagaa gacggtgctt ctggtcaaat caacatcgct 2700
gctactgcta ctgctgttta caaggacggt actatcttgg gtcactcttc tactagacca 2760
caattgggtg aaaagttgca atctactgac gttagagaca tcatgaagaa cgctatcttg 2820
ggttaccaac aagttactgg tgaatctcca actcacatcg ttatccacag agacggtttc 2880
atgaacgaag acttggaccc agctactgaa ttcttgaacg aacaaggtgt tgaatacgac 2940
atcgttgaaa tcagaaagca accacaaact agattgttgg ctgtttctga cgttcaatac 3000
gacactccag ttaagtctat cgctgctatc aaccaaaacg aaccaagagc tacagttgct 3060
acattcggtg ctccagagta cttggctact agagacggtg gtggtttgcc aagaccaatc 3120
caaatcgaaa gagttgctgg tgaaactgac atcgaaactt tgactagaca agtttacttg 3180
ttgtctcaat ctcacatcca agttcacaac tctactgcta gattgccaat cactactgct 3240
tacgctgacc aagcttctac tcacgctact aagggttact tggttcaaac tggtgctttc 3300
gaatctaacg ttggtttctt gggaggtggg ggatctggtg gaggtgggtc atcctcccag 3360
ctggttaagt ccgagctgga ggagaagaag tccgagctgc gccacaagct gaagtacgtt 3420
ccacacgagt acatcgagct gatcgagatc gctcgcaact ccacccagga ccgcatcctg 3480
gagatgaagg ttatggagtt cttcatgaag gtttacggct accgcggcaa gcacctgggc 3540
ggctcccgca agccagacgg cgctatctac accgttggct ccccaatcga ctacggcgtt 3600
atcgttgaca ccaaggctta ctccggcggc tacaacctgc caatcggcca ggctgacgag 3660
atgcagcgct acgttgagga gaaccagacc cgcaacaagc acatcaaccc aaacgagtgg 3720
tggaaggttt acccatcctc cgttaccgag ttcaagttcc tgttcgtttc cggccacttc 3780
aagggcaact acaaggctca gctgacccgc ctgaaccaca tcaccaactg caacggcgct 3840
gttctgtccg ttgaggagct gctgatcggc ggcgagatga tcaaggctgg caccctgacc 3900
ctggaggagg ttcgccgcaa gttcaacaac ggcgagatca acttctaa 3948
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:20
<211> 3009
<212> DNA
<213>Artificial sequence
<400> SEQ ID NO:20
atggccccaa agaagaagcg gaaggtcggt atccacggag tcccagcagc catggctcca 60
gttcaagctg ctgacgaaat gtacgactct aacccacacc cagacagaag acaattggtt 120
tctaacggtt tcgaagttaa cttgccagac caagttgaag ttatcgttag agacttgcca 180
gacccatcta aggttaagga agaaagaact agattgatgg gttactggtt cgttcactgg 240
ttcgacggta agttgttcca cttgagaatc aaggctggtg gtccaaacgt tgacggtgaa 300
cacagagcta tcagaactgc tgaacaccca tggttgttga gagctagatt ggacgacgct 360
ttggaggagg ctctcccaaa gtacgcggct gttaagaaga gaccattcac tttcttggct 420
caaaaggacg aattgatcga cgctgcagct actgcggctg gcttgtctca cagactcttg 480
aactctttca aggttatccc aagattcgct ttgtctccaa agatctacga accagttgac 540
ggtactacta gagttggtgt tttcgttact atcggtatga gatacgacat cgaagcttct 600
ttgagagact tgttggaagc tggtatcgac ttgagaggta tgtacgttgt tagaagaaag 660
agacaaccag gtgaaagagg tttgttgggt agagttagag ctatctctga cgacatggtt 720
caattgttcg aagaaactga cttggcttct gttaacgtta acgacgctaa gttggaaggt 780
tctaaggaaa acttcactag atgtttgtct gctttgttgg gtcacaacta caagaagttg 840
ttgaacgctt tggacgacca agaagctggt tacagaactg gtccaagatt cgacgacgct 900
gttagaagaa tgggtgaatt cttggctaag aagccaatca gattggctga caacatcaac 960
gctcaagttg gtgacagaat cgttttctct aacgaaggtc aagctagaaa cgttagattg 1020
gctccaaagg ttgaatacgt tttcgacaga actggtgcta agtctgctga atacgcttgg 1080
agaggtttgt ctcaattcgg tccattcgac agaccatctt tcgctaacag atctccaaga 1140
atactcgttg tgtacccaag ctctactcaa ggtaaggttg aaaacttctt gtctgctttc 1200
agagacggta tgggttctaa ctactctggt ttctctaagg gtttcgttga cttgatgggt 1260
ttgactaagg ttgaattcgt tatgtgtcca gttgaagttt cttctgctga cagaaacggt 1320
gctcacacta agtacaactc tgctatcgaa gacaagttgg ctggtgctgg tgaagttcac 1380
gctggtatcg ttgttttgtt cgaagaccac gctagattgc cagacgacag aaacccatac 1440
atccacacta agtctttgtt gttgactttg ggtgttccaa ctcaacaagt tagaatgcca 1500
actgttttgt tggaaccaaa gtctttgcaa tacactttgc aaaacttctc tatcgctact 1560
tacgctaagt tgaacggtac tccatggact gttaaccacg acaaggctat caacgacgaa 1620
ttggttgttg gtatgggttt ggctgaattg tctggttcta gaactgaaaa gagacaaaga 1680
ttcgttggta tcactactgt tttcgctggt gacggttctt acttgttggg taacgtttct 1740
aaggaatgtg aatacgaagg ttactctgac gctatcagag aatctatgac tggtatcttg 1800
agagaattga agaagagaaa caactggaga ccaggtgaca ctgttagagt tgttttccac 1860
gctcacagac cattgaagag agttgacgtt gcttctatcg ttttcgaatg tactagagaa 1920
atcggttctg accaaaacat ccaaatggct ttcgttactg tttctcacga ccacccattc 1980
gttttgatcg acagatctga aagaggtttg gaagcttaca agggttctac tgctagaaag 2040
ggtgttttcg ctccaccaag aggtgctatc tctagagttg gtagattgac tagattgttg 2100
gctgttaact ctccacaatt gatcaagaga gctaacactc cattgccaac tccactcctc 2160
gttagcttgc acccagactc gactttcaag gacgttgact acctcgctga gcaagctctc 2220
aagtttactt cgttgtcttg gagatcgact ttgccagctg ctactccagt tactatcttc 2280
tactctgaaa gaatcgctga attgttgggt agattgaagt ctatcccaaa ctggtcttct 2340
gctaacttga acatcaagtt gaagtggtct agatggttct tgggaggtgg gggatctggt 2400
ggaggtgggt catcctccca gctggttaag tccgagctgg aggagaagaa gtccgagctg 2460
cgccacaagc tgaagtacgt tccacacgag tacatcgagc tgatcgagat cgctcgcaac 2520
tccacccagg accgcatcct ggagatgaag gttatggagt tcttcatgaa ggtttacggc 2580
taccgcggca agcacctggg cggctcccgc aagccagacg gcgctatcta caccgttggc 2640
tccccaatcg actacggcgt tatcgttgac accaaggctt actccggcgg ctacaacctg 2700
ccaatcggcc aggctgacga gatgcagcgc tacgttgagg agaaccagac ccgcaacaag 2760
cacatcaacc caaacgagtg gtggaaggtt tacccatcct ccgttaccga gttcaagttc 2820
ctgttcgttt ccggccactt caagggcaac tacaaggctc agctgacccg cctgaaccac 2880
atcaccaact gcaacggcgc tgttctgtcc gttgaggagc tgctgatcgg cggcgagatg 2940
atcaaggctg gcaccctgac cctggaggag gttcgccgca agttcaacaa cggcgagatc 3000
aacttctaa 3009
SEQUENCE LISTING
<110>Instrument is grand
<120>Chimeric protein pAgoE and construction method, application and chimeric protein pAgoE and construction method using guide, Using
<130>
<160> 21
<170> PatentIn version 3.3
<210> SEQ ID NO:21
<211> 3339
<212> DNA
<213>Artificial sequence
<400> SEQ ID NO:21
atggccccaa agaagaagcg gaaggtcggt atccacggag tcccagcagc catgactgtt 60
atcgacttgg actctactac tactgctgac gaattgactt ctggtcacac ttacgacatc 120
tctgttactt tgactggtgt ttacgacaac actgacgaac aacacccaag aatgtcgttg 180
gcgttcgaac aagacaatgg tgaaagaaga tacatcactt tgtggaagaa cactacacca 240
aaggacgtgt tcacgtacga ctacgctact ggttctactt acatcttcac taacatcgac 300
tacgaagtta aggacggtta cgaaaacttg actgctactt accaaactac tgttgaaaac 360
gctactgctc aagaagttgg tactactgac gaagacgaaa ctttcgctgg tggtgaacca 420
ttggaccacc acttggacga cgctttgaac gaaactccag acgacgctga aactgaatct 480
gactctggcc acgttatgac tagcttcgct tctagagacc aattgccaga atggactttg 540
cacacttaca ctttgactgc tactgacggt gctaagactg acactgaata cgctagaaga 600
actttggctt acactgttag acaagaattg tacactgacc acgacgctgc tcccgttgct 660
actgacggct tgatgttgtt gactccagaa ccattgggtg aaactccatt ggacttggac 720
tgtggtgtta gagttgaagc tgacgaaact agaactttgg actacactac tgctaaggac 780
agattgttgg ctagagaatt ggttgaagaa ggtttgaaga gatctttgtg ggacgactac 840
ttggttagag gtatcgacga agttttgtct aaggaaccag ttttgacttg tgacgaattc 900
gacttgcacg aaagatacga cttgtctgtt gaagttggtc actctggtag agcttacttg 960
cacatcaact tcagacacag attcgttcca aagttgactt tggctgacat cgacgacgac 1020
aacatctacc caggtttgag agttaagact acttacagac caagaagagg tcacatcgtt 1080
tggggtttga gagacgaatg tgctactgac tctttgaaca ctttgggtaa ccaatctgtt 1140
gttgcttacc acagaaacaa ccaaactcca atcaacactg acttgttgga cgctatcgaa 1200
gctgctgaca gaagagttgt tgaaactaga agacaaggtc acggtgacga cgctgtttct 1260
ttcccacaag aattgttggc tgttgaacca aacactcacc aaatcaagca attcgcttct 1320
gacggtttcc accaacaagc tagatctaag actagattgt ctgcttctag atgttctgaa 1380
aaggctcaag ctttcgctga aagattggac ccagttagat tgaacggttc tactgttgaa 1440
ttctcttctg aattcttcac tggtaacaac gaacaacaat tgagattgtt gtacgaaaac 1500
ggtgaatctg ttttgacttt cagagacggt gctagaggtg ctcacccaga cgaaactttc 1560
tctaagggta tcgttaaccc accagaatct ttcgaagttg cggttgtgct gccagaacaa 1620
caagctgaca cttgtaaggc tcaatgggac actatggctg acttgttgaa ccaagctggt 1680
gctccaccaa ctagatctga aactgttcaa tacgacgctt tctcttctcc agaatctatc 1740
tctttgaacg ttgctggtgc tatcgaccca tctgaagttg acgctgcttt cgttgttttg 1800
ccaccagacc aagaaggttt cgctgacttg gcttctccaa ctgaaactta cgacgaattg 1860
aagaaggctt tggctaacat gggtatctac tctcaaatgg cttacttcga cagattcaga 1920
gacgctaaga tcttctacac tagaaacgtt gctttgggtt tgttggctgc tgctggtggt 1980
gttgctttca ctactgaaca cgctatgcca ggtgacgctg acatgttcat cggcatagcc 2040
gtaagcagat cttacccaga agacggtgct tctggtcaaa tcaacatcgc tgctactgct 2100
actgctgttt acaaggacgg tactatcttg ggtcactctt ctactagacc acaattgggt 2160
gaaaagttgc aatctactga cgttagagac atcatgaaga acgctatctt gggttaccaa 2220
caagttactg gtgaatctcc aactcacatc gttatccaca gagacggttt catgaacgaa 2280
gacttggacc cagctactga attcttgaac gaacaaggtg ttgaatacga catcgttgaa 2340
atcagaaagc aaccacaaac tagattgttg gctgtttctg acgttcaata cgacactcca 2400
gttaagtcta tcgctgctat caaccaaaac gaaccaagag ctacagttgc tacattcggt 2460
gctccagagt acttggctac tagagacggt ggtggtttgc caagaccaat ccaaatcgaa 2520
agagttgctg gtgaaactga catcgaaact ttgactagac aagtttactt gttgtctcaa 2580
tctcacatcc aagttcacaa ctctactgct agattgccaa tcactactgc ttacgctgac 2640
caagcttcta ctcacgctac taagggttac ttggttcaaa ctggtgcttt cgaatctaac 2700
gttggtttct tgggaggtgg gggatctggt ggaggtgggt catcctccca gctggttaag 2760
tccgagctgg aggagaagaa gtccgagctg cgccacaagc tgaagtacgt tccacacgag 2820
tacatcgagc tgatcgagat cgctcgcaac tccacccagg accgcatcct ggagatgaag 2880
gttatggagt tcttcatgaa ggtttacggc taccgcggca agcacctggg cggctcccgc 2940
aagccagacg gcgctatcta caccgttggc tccccaatcg actacggcgt tatcgttgac 3000
accaaggctt actccggcgg ctacaacctg ccaatcggcc aggctgacga gatgcagcgc 3060
tacgttgagg agaaccagac ccgcaacaag cacatcaacc caaacgagtg gtggaaggtt 3120
tacccatcct ccgttaccga gttcaagttc ctgttcgttt ccggccactt caagggcaac 3180
tacaaggctc agctgacccg cctgaaccac atcaccaact gcaacggcgc tgttctgtcc 3240
gttgaggagc tgctgatcgg cggcgagatg atcaaggctg gcaccctgac cctggaggag 3300
gttcgccgca agttcaacaa cggcgagatc aacttctaa 3339

Claims (50)

1. a kind of chimeric protein pAgoE, it is characterised in that：Described chimeric protein pAgoE contains with genome targeting positioning The pAgo domains of function, and be connected with the pAgo domains, with genome cutting or modification activities effect knot Structure domain E.
2. chimeric protein pAgoE according to claim 1, it is characterised in that：The effector domain E is using with nucleic acid Enzyme sample DNA cleavage activities (Nuclease-like DNA cleavage activity), knot for genome targeting editor Structure domain N, to constitute the chimeric protein pAgoE of pAgoE-N types.
3. chimeric protein pAgoE according to claim 2, it is characterised in that：The effector domain N from nuclease, Transposase, site differential recombination enzyme.
4. chimeric protein pAgoE according to claim 3, it is characterised in that：The effector domain N is numbered from zymetology For the II S type restriction endonuclease of EC 3.1.21.4.
5. chimeric protein pAgoE according to claim 4, it is characterised in that：The effector domain N is adopted Planomicrobium okeanokoites, GenBank registration numbers be:The II S type restriction nuclease inscribes of AAA24934.1 The 383rd of enzyme FOK I is to the 579th aminoacid.
6. chimeric protein pAgoE according to claim 1, it is characterised in that：The effector domain E contains with gene Group or apparent group of modification activities (Modification activity), domain M for genome targeting modification.
7. chimeric protein pAgoE according to claim 6, it is characterised in that：The effector domain M is using with DNA The domain NM of nucleotide modification activity (Nucleotide Modification activity), can be used for genome targeting core Thuja acid is modified or genome targeting accelerated evolutionary.
8. chimeric protein pAgoE according to claim 7, it is characterised in that：The domain NM adopt zymetology numbering for The AID of the EC 3.5.4.5 or MAG1 that zymetology numbering is EC 3.2.2.21.
9. chimeric protein pAgoE according to claim 6, it is characterised in that：The domain M is adopted and repaiied with apparent group The domain EM of decorations active (Epigenome Modification activity), can be used for apparent group of editor.
10. chimeric protein pAgoE according to claim 9, it is characterised in that：The domain EM adopt zymetology numbering for The TET1 of the EC 1.14.11.n2 or DBMt3a/b that zymetology numbering is EC 2.1.1.37.
11. chimeric protein pAgoE according to any one of claim 1 to 10, it is characterised in that：The pAgo domains It is more than 30% using the amino acid sequence homology of the natural protokaryon Argonaute albumen of guide with any one.
12. chimeric protein pAgoE according to claim 11, it is characterised in that：The pAgo domains are tied using PIWI The pAgo of structure domain center phytase activity inactivation.
13. chimeric protein pAgoE according to claim 12, it is characterised in that：The pAgo domains adopt from Rhodobacter sphaeroides ATCC 17025, NCBI Serial No. ABP72561.1 RsAgo, is obtained with building The chimeric protein pAgoE of RsAgoE types.
14. chimeric protein pAgoE according to claim 11, it is characterised in that：The pAgo domains are tied using PIWI There is the natural pAgo of nuclease in structure domain.
15. chimeric protein pAgoE according to claim 14, it is characterised in that：The pAgo domains adopt from Marinitoga piezophila, NCBI Serial No. WP_014295921.1 MpAgo, to build MpAgoE types are obtained Chimeric protein pAgoE.
16. chimeric protein pAgoE according to claim 11, it is characterised in that：The pAgo domains are tied using PIWI There is artificial deactivation's mutant of the natural pAgo of nuclease in structure domain.
17. chimeric protein pAgoE according to claim 16, it is characterised in that：The pAgo domains are using MpAgo's The artificial mutant dMpAgo of PIWI domains nuclease inactivation, to build the chimeric protein for obtaining dMpAgoE types pAgoE。
18. chimeric protein pAgoE according to claim 17, it is characterised in that：The artificial mutant dMpAgo from The inactivation at least one of the following four site of MpAgo：D446、E482、D516、N624.
19. chimeric protein pAgoE according to claim 18, it is characterised in that：The artificial mutant dMpAgo contains Following four alanine substitutes at least one of mutational site：D446A、E482A、D516A、N624A.
20. chimeric protein pAgoE according to claim 16, it is characterised in that：The pAgo domains are using NgAgo's The artificial mutant dNgAgo of PIWI domain nuclease-deads, to build the chimeric protein pAgoE of the dNgAgoE types for obtaining.
21. according to the chimeric protein pAgoE described in claim 20, it is characterised in that：The artificial mutant dNgAgo from The inactivation at least one of the following four site of NgAgo：D663、D738、D863、S665.
22. chimeric protein pAgoE according to claim 21, it is characterised in that：The artificial mutant dNgAgo contains Following four alanine substitutes at least one of mutational site：D663A、D738A、D863A、S665A.
A kind of 23. construction methods of chimeric protein pAgoE, it is characterised in that：The method is will to position work(with genome targeting The pAgo domains of energy, and the effector domain E connections with genome cutting or modification activities.
The construction method of 24. chimeric protein pAgoE according to claim 23, it is characterised in that：The pAgo domains Artificial connection is adopted with the effector domain E.
The construction method of 25. chimeric protein pAgoE according to claim 24, it is characterised in that：The pAgo domains It is covalently bonded with the effector domain E.
The construction method of 26. chimeric protein pAgoE according to claim 25, it is characterised in that：The pAgo domains The connection between carbon teminal and nitrogen end is formed between the effector domain E.
The construction method of 27. chimeric protein pAgoE according to claim 26, it is characterised in that：The pAgo domains Nitrogen end be connected with the carbon teminal of effector domain E, to build the pAgoE of E-pAgo types；Or the carbon teminal of the pAgo domains with The nitrogen end connection of effector domain E, builds the pAgoE of pAgo-E types；Or the carbon teminal and nitrogen end of the pAgo domains respectively with The nitrogen end of effector domain E and carbon teminal connect, and build E1-pAgo-E2The pAgoE of type, wherein, E1With E2It is identical or different.
The construction method of 28. albumen pAgoE according to claim 24, it is characterised in that：The pAgoE is fabricated composition The chimeric protein (split-pAgoE) of body form, is connected between split in the way of non-covalent bond.
The construction method of 29. chimeric protein pAgoE according to claim 28, it is characterised in that：The chimeric protein Between the pAgo domains and the effector domain E of pAgoE, built using MxeGryA Intein, to be formed The chimeric protein pAgoE of split-pAgoE types.
A kind of 30. applications of chimeric protein pAgoE, it is characterised in that：The chimeric protein pAgoE uses guide, targeting editor Or modifying gene group.
A kind of 31. chimeric protein pAgoE of use guide, it is characterised in that：Containing as any one of claim 1 to 29 Chimeric protein pAgoE, and combined with the chimeric protein pAgoE, with assist pAgoE identification and with reference to genome ability Guide.
The chimeric protein pAgoE of 32. use guides according to claim 31, it is characterised in that：The guide is few core Thuja acid gNA.
The chimeric protein pAgoE of 33. use guides according to claim 32, it is characterised in that：The oligonucleotide gNA Arrange according to the principle complementary with target gene group site sequence is intended.
The chimeric protein pAgoE of 34. use guides according to claim 33, it is characterised in that：The oligonucleotide gNA Nucleotide sequence with intend target area genome nucleotide sequence homology be more than 40%.
The chimeric protein pAgoE of 35. use guides according to claim 31, it is characterised in that：RsAgoE types it is chimeric Albumen pAgoE, is gNA using the single-stranded gRNA of 5 ' end phosphorylations that length is 18 nucleotide.
The chimeric protein pAgoE of 36. use guides according to claim 31, it is characterised in that：MpAgoE types or The chimeric protein pAgoE of dMpAgoE types, is gNA using the single-stranded gRNA of 5 ' terminal hydroxy groupizations that length is 10 to 40 nucleotide.
The chimeric protein pAgoE of 37. use guides according to claim 31, it is characterised in that：DNgAgoE types it is chimeric Albumen pAgoE, is gNA using the single-stranded gDNA of 5 ' end phosphorylations that length is 24 nucleotide.
A kind of 38. construction methods of the chimeric protein pAgoE of use guide, it is characterised in that：The method is by chimeric protein PAgoE is combined with guide.
A kind of 39. applications of the chimeric protein pAgoE of use guide, it is characterised in that：It is applied to genome targeting editor or Genome targeting modification.
A kind of 40. application processes of the chimeric protein pAgoE of use guide, it is characterised in that：Guide is directly turned with expression in vivo The mode of record or transcribe out polymerized nucleoside acid precursors mode processed again and realize.
The application process of the chimeric protein pAgoE of 41. use guides according to claim 40, it is characterised in that：It is described Precursor polynucleotide shearing system, is the CSY4 of EC3.1.-.- or from NCBI Serial No. from zymetology numbering The RsAgo of ABP72561.1.
The application process of the chimeric protein pAgoE of the 42. use guides according to claim 39, it is characterised in that：It is chimeric At least one in albumen pAgoE, the prerequisite knowledge of guide oligonucleotide gNA, gNA, with implement it is intracellular it is normal expression or The mode or external preparation of abduction delivering is re-fed into intracellular mode, and the state for making pAgoE to combine guide comes across It is intracellular.
The application process of the chimeric protein pAgoE of 43. use guides according to claim 42, it is characterised in that：It is described Cell is live body eukaryotic cell.
The application process of the chimeric protein pAgoE of 44. use guides according to claim 43, it is characterised in that：It is described Live body eukaryotic cell is live body eukaryotic microbial cell, plant cell, zooblast.
The application process of the chimeric protein pAgoE of 45. use guides according to claim 44, it is characterised in that：Institute Cell is stated for living mammal cell.
The application process of the chimeric protein pAgoE of the 46. use guides according to any one of claim 40 to 45, it is special Levy and be：The method is carried out at normal temperatures.
47. a kind of chimeric protein with genome targeting editting function, it is characterised in that：Containing in such as claim 1 to 22 Chimeric protein pAgoE described in any one, the chimeric protein pAgoE contains the effector domain E with genome cutting.
48. chimeric proteins with genome targeting editting function according to claim 47, it is characterised in that：Also contain It is being combined with the chimeric protein pAgoE, with assist pAgoE identification and with reference to the guide of genome ability.
A kind of 49. applications of the chimeric protein with genome targeting editting function, it is characterised in that：PAgoE-N types it is described Chimeric protein pAgoE, at normal temperatures, in the active somatic cell including including eukaryotic cell, is carried out based on homologous recombination repair (HDR) genome targeting editor or the genome targeting editor based on non-homologous end joining (NHEJ).
The application process of 50. chimeric proteins with genome targeting editting function according to claim 49, its feature It is：Chimeric protein pAgoE, guide oligonucleotide gNA and homologous recombination fragment HR for making pAgoE-N types comes across cell It is interior, complete genome being based on homologous recombination repair (HDR), knocking in including the deletion of endogenous gene targeting or exogenous gene targeting Targeting editor.
CN201610996972.XA 2016-11-11 2016-11-11 Chimeric protein pAgoE, construction method and application thereof, chimeric protein pAgoE using guide, construction method and application thereof Active CN106589134B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610996972.XA CN106589134B (en) 2016-11-11 2016-11-11 Chimeric protein pAgoE, construction method and application thereof, chimeric protein pAgoE using guide, construction method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610996972.XA CN106589134B (en) 2016-11-11 2016-11-11 Chimeric protein pAgoE, construction method and application thereof, chimeric protein pAgoE using guide, construction method and application thereof

Publications (2)

Publication Number Publication Date
CN106589134A true CN106589134A (en) 2017-04-26
CN106589134B CN106589134B (en) 2021-04-20

Family

ID=58590103

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610996972.XA Active CN106589134B (en) 2016-11-11 2016-11-11 Chimeric protein pAgoE, construction method and application thereof, chimeric protein pAgoE using guide, construction method and application thereof

Country Status (1)

Country Link
CN (1) CN106589134B (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108796036A (en) * 2018-04-03 2018-11-13 上海交通大学 Nucleic acid detection method based on protokaryon Argonaute albumen and its application
CN108795968A (en) * 2017-05-03 2018-11-13 华东理工大学 A kind of genetic transforming method of hydrogenlike silicon ion superior strain
CN112481309A (en) * 2019-09-12 2021-03-12 石家庄埃佤基因科技有限公司 Application and composition of Ago protein and gene editing method
CN112538470A (en) * 2020-12-11 2021-03-23 湖北大学 Argonaute protein from prokaryote and application thereof
CN113373129A (en) * 2021-05-25 2021-09-10 湖北大学 Mbp _ Argonaute protein from prokaryote and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101679959A (en) * 2007-02-19 2010-03-24 赛莱克蒂斯公司 LAGLIDADG homing endonuclease variants having novel substrate specificity and use thereof
CN105483118A (en) * 2015-12-21 2016-04-13 浙江大学 Gene editing technique taking Argonaute nuclease as core

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101679959A (en) * 2007-02-19 2010-03-24 赛莱克蒂斯公司 LAGLIDADG homing endonuclease variants having novel substrate specificity and use thereof
CN105483118A (en) * 2015-12-21 2016-04-13 浙江大学 Gene editing technique taking Argonaute nuclease as core

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
仪宏等: "《重要进展：南京大学科学家发明最新基因编辑技术》", 《BIOART公众号》 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108795968A (en) * 2017-05-03 2018-11-13 华东理工大学 A kind of genetic transforming method of hydrogenlike silicon ion superior strain
CN108796036A (en) * 2018-04-03 2018-11-13 上海交通大学 Nucleic acid detection method based on protokaryon Argonaute albumen and its application
CN112481309A (en) * 2019-09-12 2021-03-12 石家庄埃佤基因科技有限公司 Application and composition of Ago protein and gene editing method
CN112538470A (en) * 2020-12-11 2021-03-23 湖北大学 Argonaute protein from prokaryote and application thereof
CN112538470B (en) * 2020-12-11 2023-03-28 湖北大学 Argonaute protein from prokaryote and application thereof
CN113373129A (en) * 2021-05-25 2021-09-10 湖北大学 Mbp _ Argonaute protein from prokaryote and application thereof
CN113373129B (en) * 2021-05-25 2022-07-26 湖北大学 Mbp _ Argonaute protein from prokaryote and application thereof

Also Published As

Publication number Publication date
CN106589134B (en) 2021-04-20

Similar Documents

Publication Publication Date Title
KR102021585B1 (en) A method for regulation of gene expression by expressing Cas9 protein from the two independent vector
JP7232531B2 (en) High fidelity CAS9 variants and their use
JP7223377B2 (en) Thermostable CAS9 nuclease
CN107922931B (en) Thermostable Cas9 nuclease
CN106589134A (en) Chimeric protein pAgoE, construction method and applications thereof, chimeric protein pAgoE using guide, and construction method and applications thereof
CN110527697B (en) RNA fixed-point editing technology based on CRISPR-Cas13a
CN111448313A (en) Compositions and methods for improving the effectiveness of Cas 9-based knock-in strategies
CA3223527A1 (en) Novel crispr enzymes and systems
KR20220142547A (en) Crispr enabled multiplexed genome engineering
WO2019185751A1 (en) Inhibitors of crispr-cas associated activity
Jiang et al. Highly efficient genome editing in Xanthomonas oryzae pv. oryzae through repurposing the endogenous type I‐C CRISPR‐Cas system
CN112481309B (en) Application of Ago protein, composition and gene editing method
CN107574178B (en) Fungal artificial chromosomes, compositions, methods and uses
CN112899252A (en) High-activity transposase and application thereof
CN110819620B (en) Method for carrying out gene mutation on rhodobacter sphaeroides
CN114686456B (en) Base editing system based on bimolecular deaminase complementation and application thereof
CN114163506B (en) Application of Pseudomonas stutzeri-derived PsPIWI-RE protein in mediating homologous recombination
CN108728477B (en) Efficient transposition mutation system and construction method
JP2024501892A (en) Novel nucleic acid-guided nuclease
EP1670932B1 (en) Libraries of recombinant chimeric proteins
US11203760B2 (en) Gene therapy DNA vector GDTT1.8NAS12 and the method for obtaining thereof
Chen et al. Multiple-copy-gene integration on chromosome of Escherichia coli for beta-galactosidase production
CN103849640B (en) A kind of oligonucleotide and the method for plasmid cotransformation for the point mutation of intestinal bacteria indispensable gene can be eliminated
EP1097990A2 (en) A mutant kanamycin nucleotidyltransferase and a method of screening thermophilic bacteria using the same
US20230242922A1 (en) Gene editing tools

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant