CN113355362B - Use of chemically modified CRISPR/Cpf1 complex - Google Patents

Abstract

The invention relates to the technical field of gene editing, in particular to application of a chemically modified CRISPR/Cpf1 complex. The invention discloses an application of a CRISPR/Cpf1 complex in gene editing of cells, wherein a chemically modified Cpf1 protein in the complex is coupled with crRNA and is marked as cCpf 1. The gene editing using the complex can improve the gene editing efficiency. When the antigen-binding fragment is applied to the preparation of immune cells, the preparation efficiency of CAR-T can be improved, and more importantly, the preparation efficiency of multi-site gene editing and universal CAR-T is improved.

Description

Use of chemically modified CRISPR/Cpf1 complex

Technical Field

The invention relates to the technical field of gene editing, in particular to application of a chemically modified CRISPR/Cpf1 complex.

Background

Tumors are a serious disease that afflicts human health. Due to the high complexity, diversity and variability of the biological characteristics of tumors, understanding the mechanisms underlying tumorigenesis and finding ways to treat tumors are a great challenge to scientists. In recent years, with the continuous and deep knowledge of the relationship between tumor and host, especially the anti-tumor immune response and tumor immune escape mechanism of the organism, the application of the intervention means based on immune cells, molecules and genes to tumor therapy becomes a great focus of attention of scientists and obtains exciting clinical test results. Immunotherapy of tumors has become a fourth class of anti-tumor therapies that have been demonstrated to have significant clinical therapeutic effects and advantages following surgery, radiation therapy, and chemotherapy. Research approaches (CAR-T) in which genetic engineering techniques have been adapted to enhance the specificity of T cells to enhance their killing of tumor cells have made significant progress. The therapy achieves the purpose of rapidly killing tumor cells by separating immune T cells in peripheral blood of a patient, culturing in vitro, then carrying out genetic engineering modification, namely carrying out specific genetic modification and in vitro amplification according to the tumor type suffered by the patient, and finally infusing back into the body of the patient.

Early clinical trials of CAR-T cell therapy in patients with advanced refractory leukemia and lymphoma have shown very encouraging results. One clinical trial, published by the university of pennsylvania researcher in the world journal of top medicine, new england journal of medicine, 10 months this year, showed that in 30 subjects with relapsed or refractory ALL who received CTL019 infusion (CAR-T therapy targeting CD19 antigen), 27 patients achieved complete remission 1 month after treatment, including even 15 patients who had received a bone marrow stem cell transplant. The non-recurrent survival rate at 6 months was 67% (20 people), and the overall survival rate was 78% (23 people). In addition 1 patient continued to have complete remission at 2 years follow-up. CAR-T therapy has also achieved a series of exciting advances in the treatment of solid tumors in recent years, showing good promise for immunotherapy.

Although CAR-T therapy currently has achieved an exciting set of clinical outcomes, it still carries many risks, such as over-killing, cytokine storm, inhibition of the solid tumor microenvironment, limited target selectivity, and the like. In addition, the current CAR-T preparation usually uses a virus system to integrate the exogenous CAR gene, and the integration has randomness, so that the integration position of the exogenous gene cannot be controlled, and the integration has the possible carcinogenic risk, and after the blue bird biotechnology company in the recent journal of science uses lentiviral vector to perform gene modification on blood stem cells, the modified blood stem cells are delivered to human bodies for the research of treating sickle cell diseases, and two people develop leukemia after receiving the treatment for five years and are considered to be the carcinogenic risk caused by gene random introduction. The fact that random integration caused by retrovirus has carcinogenicity is also proved in past clinical experiments, so that the development of site-directed controllable high-efficiency targeted gene integration T cells is one of the important directions for the development of future CAR-T therapy and is also a core problem mainly concerned in the field.

In recent years, gene editing technology has been developed rapidly, and is a new molecular biotechnology that artificially changes a specific gene site in a certain nucleotide sequence, inserts, deletes, replaces or modifies a specific target gene in a genome, and changes its expression trait. With the development of the technology, three generations of gene editing technologies are widely applied, namely zinc finger protein nucleases, TALEN and CRISPR technologies, wherein the CRISPR technology is developed vigorously in the last decade as a third generation gene editing technology since people find that CRISPR-Cas9 has RNA-mediated DNA endonuclease activity in 2012. Compared with the first two generations of gene editing technology, the CRISPR/Cas9 technology is easier to design and operate, has higher targeting efficiency and has unique development advantages. CRISPR-Cas systems can be divided into two classes based on the properties of the effector nucleases, one class of effector nucleases being multi-protein complexes and the second class of effector nucleases being single proteins. The two systems are divided into 6 types and 19 subtypes, and the different systems have different target substrates and cleavage mechanisms, so that the possibility is provided for the diversified application of the CRISPR-Cas system. One type of system is common in bacteria and archaea, accounting for about 90% of all established CRISPR-Cas loci, with the remaining about 10% of the two system being almost entirely present in bacteria. The second class of CRISPR-Cas systems comprises three types ii, v, and vi, with type ii nuclease Cas9 being the first effector nuclease for genome editing in mammalian cells, type v nuclease including DNA-targeting nucleases Cpf1 and Cas12b (previously referred to as Cpf1 and C2C1, respectively), and type vi nuclease including RNA-mediated RNA nucleases Cas13a and Cas13 b.

Among these, CRISPR/Cas9 is most widely used in mammalian cells, and is widely used in mammalian gene editing and immune cell preparation due to its high editing efficiency and wide genome recognition, CAR-T prepared by knocking out T cell TRAC gene and performing in situ fixed point integration into CAR gene using CRISPR/Cas9 has been in clinical stage at present, but CRISPR/Cas9 system has high off-target effect due to its own existence, and lacks evaluation of clinical long-term safety, and is still unknown for the existence of carcinogenic risk for a long time.

CRISPR/Cpf1 is the second CRISPR family enzyme found after CRISPR/Cas9 that can be applied to mammalian cell editing, because it has different preferences for genome recognition and its off-target efficiency is significantly lower than Cas9, Cpf1 becomes a powerful complement to Cas9 and a CRISPR family gene editing tool with more biomedical prospects. In general, CRISPR is used for gene editing of T cells in vitro, DNA or mRNA is introduced into the cells for editing, and then CAR-T cells are prepared by introducing exogenous donor DNA or delivering a donor through AAV, DNA delivery editing has a potential integration risk and persistent expression of the DNA may improve off-target efficiency, mRNA delivery editing methods also have an adverse effect that an expression peak is long and off-target is easily improved, compared with direct delivery of a ribonucleoprotein complex (RNP), protein and RNA are directly introduced into cells, can rapidly respond to cleavage and rapidly degrade the protein after editing is realized, the currently known most safe delivery method for gene editing is provided, and the off-target editing efficiency is significantly lower than other delivery methods, so that the method is widely applied to CAR-T cell preparation. The CRISPR-Cpf1 is reported based on an mRNA delivery system, the site-directed TRAC gene CAR-T can be prepared through systematic optimization, the multiple gene knockout CAR-T can be prepared, and the preparation by an RNP mode is a better choice but no related method is reported in documents at present. The reason for this is that the overall gene editing efficiency of Cpf1 is not ideal, the preparation efficiency of CAR-T cells using RNP complexes of Cpf1-crRNA is very low, which greatly limits the wide application of CAR-T cells in immune cells, and there is a strong need in the art to provide a method for efficiently preparing CAR-T cells by RNP delivery using improved Cpf 1.

Disclosure of Invention

In view of the above, the technical problem to be solved by the present invention is to provide the use of the chemically modified CRISPR/Cpf1 complex in immune cell gene editing.

The invention provides the use of a chemically modified CRISPR/Cpf1 complex in gene editing of a cell.

In the present invention, the cell is a stem cell, an embryonic cell, a somatic cell and/or an immune cell.

The cell of the invention is a human cell or an animal cell. The stem cells comprise hematopoietic stem cells, embryonic stem cells and mesenchymal stem cells. The animal cell is derived from model animals such as mouse, rat, guinea pig, hamster, rabbit, monkey, etc.

In the present example, the gene editing effect of mouse cells was verified by using mouse-derived embryonic cells NIH-3T3 as an example.

The verification of the gene editing effect of the human body cells comprises the verification of the human body cells and immune cells. In some embodiments, the somatic cells are 293T cells or K562 cells. The immune cells are Jurkat cells, T cells, NK cells or Macrophage cells and the like.

In the invention, the chemically modified CRISPR/Cpf1 complex consists of a Cpf1 family protein and crRNA; wherein the Cpf1 family protein is selected from AsCpf1, SpCas9, FnCpf1, CmCpf1, MbCpf1, PcCpf1 or LbCpf 1. At least one of the amino acid residues at positions 806, 834, 835, 860 and/or 1086 of said AsCpf1 protein is chemically modified.

The amino acid residue at least one of positions 3, 757, 759, 768, 785 and/or 786 of the LbCpf1 protein is chemically modified.

The chemically modified amino acid is pAcF, AcF, NAEK, p-AzF, o-AzbK, AzK, ACPK, PrpF, PrpK, CpOK, TetF, Tet1, Tet2 or Tet 3.

In the present invention, the crRNA targets an endogenous gene.

In some embodiments, the targeted endogenous gene comprises at least one of TRAC, β 2M, PD1, CTLA4, or mHPRT 1.

The invention also provides a gene editing method of a cell, which comprises the following steps: the chemically modified CRISPR/Cpf1 complex is transformed into a cell and cultured to obtain a gene-edited cell.

In the present invention, the method of transformation is electrical transformation or chemical transformation.

The gene editing of the invention is also combined with plasmid vector, lentivirus or adenovirus mediated gene transformation methods.

The invention also provides a cell prepared by the gene editing method.

The invention also provides application of the chemically modified CRISPR/Cpf1 complex in preparing a medicament for treating diseases.

The invention also provides the application of the cell prepared by the gene editing method in preparing a medicament for treating diseases.

The diseases include: immune system diseases or tumors. The treatment comprises: autologous cell therapy or allogeneic cell therapy.

The tumor is at least one of bladder cancer, blood cancer, bone cancer, brain cancer, breast cancer, central nervous system cancer, cervical cancer, colon cancer, endometrial cancer, esophageal cancer, gall bladder cancer, gastrointestinal cancer, genitourinary tract cancer, head cancer, kidney cancer, laryngeal cancer, liver cancer, lung cancer, muscle tissue cancer, neck cancer, oral or nasal mucosa cancer, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer, spleen cancer, small intestine cancer, large intestine cancer, stomach cancer, testicular cancer and/or thyroid cancer.

The invention relates to a medicament for treating diseases, which comprises a chemically modified CRISPR/Cpf1 complex and/or a cell prepared by the gene editing method.

The present invention also provides a method for treating a disease, which comprises administering the cell obtained by the gene editing method of the present invention. Or editing the autoimmune cells or allogeneic immune cells with the chemically modified CRISPR/Cpf1 complex and then administering to the patient.

The invention discloses an application of a CRISPR/Cpf1 complex in gene editing of cells, wherein a chemically modified Cpf1 protein in the complex is coupled with crRNA and is marked as cCpf 1. The gene editing using the complex can improve the gene editing efficiency. When the antigen-binding fragment is applied to the preparation of immune cells, the preparation efficiency of CAR-T can be improved, and more importantly, the preparation efficiency of multi-site gene editing and universal CAR-T is improved.

Drawings

FIG. 1 shows a synthetic route to unnatural amino acid AeF;

FIG. 2 shows protein purity and activity validation of M806 modified with unnatural amino acid AeF;

FIG. 3 shows in vitro conjugation and validation of activity of unnatural amino acid AeF modified M806;

FIG. 4 shows the gene editing efficiency evaluation of the cCpf1 system;

FIG. 5 illustrates the safety evaluation of the cpcf 1 system;

FIG. 6 shows that the cpcpf 1 system improves the efficiency of precision knock-in fragments to achieve precise gene repair;

FIG. 7 shows the use of cpcf 1 in combination with AAV for the generation of CAR-Jurkat cells;

FIG. 8 shows genome level evaluation of the site-directed introduction of the CAR gene by cCpf1 into the TRAC gene;

FIG. 9 shows the application of cCpf1 to the preparation of site-directed integration of CAR-T in T cells;

FIG. 10 shows an immunological evaluation of cCpf1 for the preparation of CAR-T cells;

FIG. 11 shows the application of cCpf1 to multi-site gene knockout and knock-in for the preparation of generic CAR-T;

FIG. 12 is a schematic diagram showing that cpcf 1 improves efficiency of CAR-T production in gene editing, site-directed precise repair.

Detailed Description

The invention provides the application of the chemically modified CRISPR/Cpf1 complex, and the technical personnel can appropriately modify the technological parameters for realizing the CRISPR/Cpf1 complex by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

In the invention, the chemically modified CRISPR/Cpf1 complex is prepared by performing site-specific mutation on a CRISPR family protein by using an unnatural amino acid and then coupling the CRISPR family protein with nucleic acid, and is also called as cCpf1 in the invention. Among them, CRISPR family proteins include, but are not limited to, Cas9 protein, Cpf1 protein, CasX protein, Cas phi protein, Cas12g protein, Cas13X protein, or their related inactive homologous proteins that do not have cleavage activity but retain binding activity (e.g., dCas9 protein, dCpf1 protein, or ddCpf1 protein, etc.). In the invention, the CRISPR family protein is SpCas9, and the mutation exists in one or more of the K3 position, D39 position, H41 position, H116 position, D576 position, E945 position, K1151 position and G1367 position of SEQ ID NO. 2. Alternatively, the CRISPR family protein is ascipf 1, also designated as AsCas12a, which is mutated at the following positions: one or more of positions M806, L834, S835, K860, K1086 of SEQ ID NO. 1; the CRISPR family protein is LbCpf1, also designated LbCas12a, which is mutated at the following sites: position 3, 757, 759, 768, 785 or 786 of SEQ ID NO. 3.

The unnatural amino acids have orthogonal chemical reactivity. The unnatural amino acid comprises an azide, alkynyl, aldehyde, keto, cyclopropene, or tetrazine group, and in some embodiments, is selected from the group consisting of:

in some embodiments, the unnatural amino acid is selected from the group consisting of: pAcF, AeF, PrpF, NAEK, or TetF. In the present invention, the CRISPR family protein is modified with unnatural amino acid AeF also denoted Cpf1 (M806). Namely the Cpf1 protein with the AeF modified and mutated amino acid 806.

In the present invention, the nucleic acid in the cpcpf 1 complex includes oligo DNA, donor DNA, crRNA and modified nucleic acids related thereto. In the present invention, the nucleic acid in the cpcf 1 complex is crRNA, which leads CRISPR family protein to the vicinity of the target region by base pairing with the target DNA and changes its conformation to form ribonucleoprotein complex (RNP) having DNA cleavage activity, and the activated Cas9 or Cpf1 can cleave the target DNA to form double-stranded nick (DSB). In the present invention, the crRNA targets a target gene. In the present invention, the crRNA may target any endogenous gene that needs to be knocked out and/or knocked out, in the case of constructing a gene-editing cell line or animal model. In some embodiments, the crRNA may target genes associated with immune or other functions when constructing cells for cell therapy. In some embodiments, the targeted endogenous gene comprises at least one of a T cell endogenous TCR α constant region (TRAC), T cell β 2 microglobulin (β 2M), T cell programmed death receptor 1(PD1), T cell cytotoxic T lymphocyte-associated protein 4(CTLA4), or mHPRT 1.

In the gene editing method provided by the invention, the improvement of the editing efficiency mainly depends on the CRISPR/Cpf1 complex. Therefore, the specific sequence of the crRNA is not limited in the present invention, and any crRNA sequence that meets the design rules in the art can achieve the desired effect.

The invention provides the use of a chemically modified CRISPR/Cpf1 complex in gene editing of a cell. The animal cell is derived from model animals such as mouse, rat, guinea pig, hamster, rabbit, monkey, etc. In the present example, the gene editing effect of mouse cells was verified by using mouse-derived embryonic cells NIH-3T3 as an example. The verification of the gene editing effect of the human body cells comprises the verification of the human body cells and immune cells. In some embodiments, the somatic cells are 293T cells or K562 cells. The immune cells are Jurkat cells, T cells, NK cells or Macrophage cells and the like.

The gene editing according to the present invention includes gene knock-out and/or knock-in. In the case of gene knock-out, the system of electrotransformation, which comprises only the complex of the invention, in which the crRNA is designed for the target gene. In gene knock-in, a fragment of the homology arm of the knock-in gene is provided in addition to the complex.

In embodiments of the invention, methods of gene editing are provided. In this method, a chemically modified CRISPR/Cpf1 complex is first prepared. The preparation method of the compound comprises the following steps: (1) expressing Cpf1 protein containing unnatural amino acid by using gene codon expansion technology; (2) the Cpf1 protein containing the modified crRNA at the 5' end and the unnatural amino acid was coupled by orthogonal reaction. The complex is then used to edit the cells.

In the gene editing method of the present invention, an adeno-associated virus vector-mediated gene editing means, a lentiviral vector-mediated gene editing means, and an adenoviral vector-mediated gene editing means are combined, or a plasmid vector or single-stranded/double-stranded DNA is used to introduce a target gene. Alternatively, RNA interference techniques may be combined to reduce or silence the expression of the gene of interest. For example, in embodiments of the invention, an adenoviral vector is used to integrate the CAR gene in a cell, and the immunosuppressive factor is knocked out in the cell. Immune cells for cell therapy were constructed. The method can be applied to T cells, NK cells, Macrophage cells and the like. In the examples of the present invention, T cells were used as the subjects.

The method provided by the invention can improve the gene editing efficiency, so that the obtained cells can be more effectively used for cell therapy. The cell therapy of the present invention includes the treatment of diseases of the immune system or tumors. The means of treatment include autologous cell therapy or allogeneic cell therapy. In the invention, K562 cells are edited so as to be used as a medicine for treating blood tumor diseases; editing hematopoietic stem cells as a drug for treating hematological neoplasms; the immune cells are edited to be used as a medicine for treating immune system diseases or tumors. For example, Jurkat cells are edited and used to treat tumors.

The gene editing method provided by the invention can also be used for constructing a cell line and/or an animal model. For example, a specific gene-edited mouse cell line was obtained by editing 3T3 cells.

The invention relates to a medicament for treating diseases, which comprises a chemically modified CRISPR/Cpf1 complex and/or a cell prepared by the gene editing method.

The medicine for treating diseases comprises cells prepared by the gene editing method and pharmaceutically acceptable auxiliary materials. For example, cell buffers, osmo-regulators. More specifically, the medicine may include cells and physiological saline. Albumin, hyaluronic acid, and the like may also be included.

The medicament for treating diseases comprises a chemically modified CRISPR/Cpf1 complex. The medicament also comprises reagents required in the electrotransformation process. Cell culture media and the like may also be included.

The present invention also provides a method for treating a disease, which comprises administering the cell obtained by the gene editing method of the present invention. Or editing the autoimmune cells or allogeneic immune cells with the chemically modified CRISPR/Cpf1 complex and then administering to the patient.

The present invention is directed to improving the gene editing efficiency of the Cpf1 system while broadening its efficiency of production in immune cell production such as CAR-T. The inventor considers that the affinity of Cpf1 and crRNA thereof is low, and dissociation of a complex can be caused in a cell under a low-concentration RNP form, and then the function of gene editing is lost, so the inventor realizes covalent coupling of two molecules by a strategy of non-natural amino acid site-directed coupling technology and bio-orthogonal reaction of Cpf1 and crRNA for gene editing based on a strategy of protein chemical modification, and improves the application of Cpf1 in the fields of gene editing and CAR-T by increasing the affinity to infinity. In detail, the inventor develops a mode of coupling CRISPR/Cpf1 family protein fixed points and nucleic acids through chemical covalent bonds, delivers the protein and the nucleic acids into T cells as a whole to exert the gene editing function of the T cells, and introduces a donor containing a homology arm and an insertion fragment through AAV virus to perform fixed point gene integration at a specific position of a T cell gene to efficiently obtain the fixed point integrated CAR-T cells. The inventor edits T cells by chemical coupling of Cpf1, realizes efficient preparation of CAR-T cells by using the currently safest RNP delivery mode, and solves the problem of low efficiency of site-specific integration CAR-T cell preparation in the prior art.

The test materials adopted by the invention are all common commercial products and can be purchased in the market. The reagents used in the examples include the following:

2 × Phanta Max Master Mix (Novozam), KOD one TM PCR Master Mix (TOYOBO), DpnI (New England Biolabs, NEB), spectinomycin (Inalco Pharmaceuticals), ampicillin (Inalco Pharmaceuticals), IPTG (Inalco Pharmaceuticals), DMEM medium (Macgene), RPMI-1640 medium (Macgene), X-VIVOTM15 medium (Lonza), 1 XTrysin-EDTA 0.25% (Macgene), 1XPBS (Macgene), Nickel medium (GE healthcare), c-Myc mouse monoclonal (Invitrogen), Ann-mouse IgG (H + L), F (ab')2Fragment (Alexa B)

647Conjugate) (Cell Signaling Technology), APC anti-human CD3(Biolegend), FITC anti-human β 2-microlobulin (Biolegend), PE anti-human CD279(Biolegend), PE/Cyanine7 anti-human CD152(Biolegend), RNA transcription kit (NEB), Cell genome extraction kit (Nozan), Total Bovine Serum (Gibco), Dynabeads^TM Untouched^TMHuman T Cells Kit (Invitrogen), Ficoll-Paque PLUS (GE Healthcare), XYbeads Human CD3/CD 28T Cell Activator (SAILY BIO), T7 Endonuclase I (Norzam), ELISA Kit (Invitrogen), LDH detection Kit (Promega)

Examples the apparatus used comprises the following:

PCR apparatus (Bio-Rad), electrophoresis apparatus (Tanon), solar gel imaging system (Tanon), ultrasonication apparatus (SONICS), autoclave (STIK), water purification apparatus (Millipore), nanodrop (Thermo), table centrifuge (Thermo), sub-ultracentrifuge (Beckman), AKTA protein purification system (GE healthcare), flow cytometer (Beckmann Cytoflex), cell incubator (Thermo), microplate reader (BioTek), magnetic stand (Invitrogen), cell electro-transport apparatus (Celetrix).

The invention is further illustrated by the following examples:

example 1: construction of Gene vector comprising site-directed mutagenesis AsCpf1

(1) Acquisition of helper plasmids

pUltra-MjPolyRS (available from Addgene, Inc.) (hereinafter referred to as helper plasmid) which expresses tRNA and tRNA synthetase for specifically recognizing and inserting unnatural amino acid AeF.

(2) Obtaining of plasmid of AsCpf1

The protein sequence in the pET22b-AsCpf1 plasmid is obtained from Addgene plasmid #102565 through PCR, then 5 'NdeI and 3' XhoI enzyme digestion are introduced into the tail end of the PCR primer, and the complete plasmid sequence is constructed through enzyme digestion and connection, so that the AsCpf1 protein can be expressed in Escherichia coli in a recombinant mode.

The primer sequences used are shown in table 1:

TABLE 1

Primer name	Primer sequence (5 '-3')
		Cpf1-2NLS-FW	gggaattgtgagcggataacaattcccc
SV40-RV	cccactttacgtttctttttaggactgccctttttcttttttgcctggccgg
		Cpf1-2NLS-RV	cagtggtggtggtggtggtgctcgagggatcccactttacgtttctttttaggactgc

(3) Obtaining of AsCpf1 mutant plasmid

According to the analysis result of the AsCpf1 protein crystal structure, the inventor selects M806 site as target amino acid of site-directed mutagenesis, replaces original amino acid residue with unnatural amino acid AeF containing azide group, and then can take the former amino acid residue as raw material to react with DBCO modified crRNA in vitro to prepare covalent modified Cpf1-crRNA coupling complex (cCpf1), so as to solve the problem of low affinity of Cpf1 and the crRNA thereof and further improve the editing efficiency of Cpf1 system in T cells.

The inventor designs a primer capable of mutating a corresponding codon for coding the amino acid into TAG aiming at M806 position of AsCpf1, wherein the specific primer is shown in the following table.

Table 2: list of mutant primers

Primer name	Primer sequence (5 '-3')
		M806TAG-FW	accggctgggagagaagtagctgaacaagaagctgaagg
M806TAG-RV	ccttcagcttcttgttcagctacttctctcccagccggt

Using pET22b-AsCpf1 plasmid as a template, performing 18-cycle PCR amplification by using the primers and KOD enzyme, performing DpnI digestion on the obtained PCR product, transforming the obtained product into DH5 alpha strain, recovering the strain, coating the recovered strain on a plate with corresponding resistance, and picking single clone for sequencing the next day to obtain pET22b-AsCpf1-M806TAG plasmid

(4) Construction of site-directed mutated AsCpf1-M806TAG expressing Strain

And (2) transferring the helper plasmid pUltra-MjPolyRS (spectinomycin resistance) obtained in the step (1) and the pET22b-AsCpf1-M806TAG mutant plasmid (ampicillin resistance) obtained in the step (3) into Escherichia coli Ecoli. BL21(DE3) together in a chemical transformation mode, screening out a positive strain which is simultaneously transformed by two plasmids through a double-resistance plate (spectinomycin and ampicillin), and naming the positive strain as an expression strain BL21-pET22b-AsCpf1-M806 TAG. Meanwhile, a wild-type expression strain BL21-pET22b-AsCpf1-WT (screened by ampicillin resistance) was constructed as a control.

Example 2: expression purification and in vitro activity validation of chemically modified Cpf1(AzCpf1)

1: amino acids were synthesized by the inventors

The synthetic route is shown in figure 1, and the synthetic procedures are performed according to the literature.

2: expression of chemically modified Cpf1(AzCpf1) protein

The expression strain BL21-pET22b-AsCpf1-M806TAG obtained in step (4) of example 1 was cultured overnight in 2YT medium (containing spectinomycin and ampicillin) in a constant temperature shaker at 37 ℃ and 220 rpm. The next day, inoculating to fresh 2YT culture medium (containing spectinomycin and ampicillin) according to a ratio of 1:100, culturing in a constant temperature shaking table at 37 ℃ and 220rpm, adding 1mM AeF amino acid for continuous culture when the culture reaches early logarithmic growth, adding 0.2mM IPTG (Isopropyl thiogalactoside, Isopropyl beta-D-1-thiogalactopyranoside) when the culture reaches an OD value of 0.6-1.0, and collecting thalli after induced expression in a constant temperature shaking table at 18-20 ℃ and 220rpm for 16-18 hours. The positive control used in this expression experiment was strain BL21-pET22b-AsCpf1-WT, and the expression conditions were the same as for the mutant strain.

3: purification of chemically modified Cpf1(AzCpf1) proteins

1) Resuspending the collected thallus in step 2 with buffer (50mM Tris, pH8.0, 1M KCl), and ultrasonicating for 15min

2) Carrying out high-speed centrifugation on the ultrasonication product obtained in the step 1), and taking soluble protein in supernatant for protein purification

3) Purifying the supernatant obtained in the step 2) by using a Ni affinity column, and eluting by using high-concentration imidazole.

4) Displacing the purified product in the step 3) into a buffer PBS, further purifying by size exclusion chromatography, and collecting the target protein component by using a Superdex 20010/300 GL Incrase (GE healthcare) molecular sieve.

Through the purification, the wild-type and mutant proteins of AsCpf1 with SDS-PAGE grade purity of more than 95% can be obtained, and the results are shown in A in FIG. 2.

4: in vitro activity validation of chemically modified Cpf1(AzCpf1) protein

In order to verify whether the AzCpf1 purified in step 3 has the function of cutting double-stranded DNA under the guidance of CrRNA, the inventors verified the in vitro activity of AzCpf1 protein.

1) Obtaining double-stranded DNA template by in vitro activity verification

EGFP gene is used as a cutting target gene, and an EGFP gene segment containing a cutting target sequence is amplified through PCR and is used as an in vitro activity verification template. The primers used were as follows:

table 3:

primer name	Primer sequence (5 '-3')
		IVD-EGFP-FW	catctgcaccaccggcaagc
IVD-EGFP-RV	gacggcgctattcagatcctcttctgag

2) In vitro Activity verification CrRNA acquisition

CrRNA targeting the EGFP gene was obtained by in vitro transcription. Firstly, designing a complementary primer of a T7 promoter + CrRNA sequence, obtaining an in vitro transcription template in a primer gradient annealing mode, further transcribing the CrRNA by using an in vitro transcription kit, and purifying the CrRNA by using an RNA purification kit (Zymo).

The EGFP targeting sequence was cgtcgccgtccagctcgaccagg, and the complementary primer sequences used were as follows:

table 4:

name of primer	Primer sequence (5 '-3')
		Cpf1-crRNA-FW	taatacgactcactataggaatttctactcttgtagatcgtcgccgtccagctcgaccagg
Cpf1-crRNA-RV	cctggtcgagctggacggcgacgatctacaagagtagaaattcctatagtgagtcgtatta

The template DNA sequence is as follows:

catctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaagaattccaccacactggactagtggatccgagctcggtaccaagctttctagaacaaaaactcatctcagaagaggatctgaatagcgccgtc

the gradient annealing procedure used is shown in table 5:

table 5: primer gradient annealing program

Temperature of	Time
		95℃	5min
95-85℃	-2℃/sec
		85-25℃	-0.1℃/sec
4℃	∞

3) Activity verification of AsCpf1 protein

Respectively diluting the wild-type protein and the mutant protein of AsCpf1 to 3 mu M, diluting CrRNA to 9 mu M, preparing a ribonucleoprotein complex according to the molar ratio of Cpf1 to CrRNA of 1:3, and preparing an in vitro cleavage system according to the table 3. The reaction system is then incubated at 37 ℃ for 1 hour and heat inactivated at 65 ℃ for 10min, and the reaction products are finally separated by electrophoresis on 1% agarose gel, and the result is shown in FIG. 2B, where AzCpf1 has cleavage activity consistent with WT Cpf1, which shows that the insertion of unnatural amino acids does not affect the recognition and cleavage activity of the protein on double-stranded DNA.

Table 6: in vitro cleavage reaction system

Example 3: covalent coupling and Activity evaluation of AzCpf1 with DBCO-modified RNA molecules

After introduction of AeF at the M806 site of ascipf 1, the azide group in AeF was covalently coupled to a DBCO-modified nucleic acid molecule by a copper-free click reaction, as demonstrated below by covalent coupling of AzCpf1 to a DBCO-modified RNA molecule and cleavage activity in vitro after coupling. In this validation, the EGFP target sequence was still cleaved as a double-stranded DNA template.

1: synthesis of DBCO-modified CrRNA

The WT-EGFP CrRNA and the DBCO-EGFP CrRNA of which the 5' -end is modified with a DBCO group are synthesized by Anhui general bio-corporation.

2: covalent coupling of AzCpf1 to DBCO-modified RNA molecules

Protein and CrRNA are mixed according to a molar ratio of 1:1.2, SDS-PAGE detection is carried out after 3-hour reaction at 4 ℃, and simultaneously, a ribonucleoprotein complex (RNP) after reaction is mixed and incubated with template double-stranded DNA in a buffer system according to the step 4 of the example 2 so as to verify the in vitro activity of the coupled complex. The results are shown in FIG. 3. According to the experimental result, the AzCpf1 and DBCO-CrRNA can realize almost complete covalent coupling at 4 ℃ within 3 hours, and the in vitro activity of the ribonucleoprotein complex after coupling is not influenced, so that the recognition and cleavage activity of the AsCpf1 protein on double-stranded DNA is not influenced by the insertion of unnatural amino acid AeF and the coupling of CrRNA. The Cpf1-CrRNA complex after point-mapping of CrRNA was designated as cCpf1(conjugated Cpf 1).

Example 4: in vivo gene editing efficiency evaluation of site-directed conjugation of cpcpf 1

The present inventors have selected four different cell lines and various target genes to assess the in vivo gene efficiency of site-directed conjugation of cpcpf 1.

1) The in vivo gene editing efficiency of 293T cells is evaluated by taking 293T-EGFP-Teton as a reporter cell line, and the specific process is as follows:

firstly, preparing a cCpf1 complex in vitro, preparing an RNP complex according to a Cpf1: CrRNA molar ratio of 1:1.2(60pmol:72pmol), incubating Cpf1 protein and CrRNA at room temperature for 5 minutes, placing at 4 ℃ for reaction for 3 hours to prepare cCpf1, performing cell electroporation after the reaction is finished, and preparing a wild-type WT Cpf1 complex as a control by the same method. Adherent 293T cells were aspirated off medium, washed once with PBS, digested with pancreatin, terminated with medium and counted in suspension. Take 1X 10⁶Suspending the cells with 20 μ L electrotransfer buffer (Celetrix, used after mixing solution A and solution B in equal proportion before use), mixing RNP and cells, slowly adding into 20 μ L electric shock cup, performing electric shock according to optimized parameters (420V, 30ms, 1pulse), rapidly adding cells into preheated DMEM culture medium after electric shock is finished, and culturing in incubator (37 deg.C, 5% CO)₂). After 24 hours, doxycycline hydrochloride solution was added to a final concentration of 10 μ g/ml. After 48 hours, the cells were digested and suspended, washed once with PBS and then subjected to flow analysis. The edited cells cannot generate EGFP fluorescence under the induction of DOX due to the cutting and the destruction of the EGFP gene, while the unedited cells can generate fluorescence, and the result of analyzing the flow type result is shown as A in FIG. 4, which shows that the cutting efficiency of the EGFP is improved from-20% to-70% by the conjugated cCpf1 compared with that of WT Cpf 1.

2) Evaluating the in vivo gene editing efficiency of K562 cells, and editing the gene locus of the targeted endogenous gene hHPRT1 by the following specific process:

firstly, preparing a cCpf1 complex in vitro, preparing an RNP complex according to a Cpf1: CrRNA molar ratio of 1:1.2(60pmol:72pmol), incubating Cpf1 protein and CrRNA at room temperature for 5 minutes, placing at 4 ℃ for reaction for 3 hours to prepare cCpf1, performing cell electroporation after the reaction is finished, and preparing a wild-type WT Cpf1 complex as a control by the same method. Counting K562 cells, 1.5X 10⁶The cells were suspended in 20. mu.L of an electrotransfer buffer (Celetrix, used after mixing solution A and solution B at equal ratio before use), and RNP was mixed with the cells and then gradually suspendedSlowly adding into a 20 μ L electric shock cup, performing electric shock according to optimized parameters (380V, 30ms, 1pulse), rapidly adding cells into preheated RPMI-1640 culture medium after electric shock is finished, and culturing in an incubator (37 deg.C, 5% CO)₂). Cells were harvested after 48 hours, and cell genome extraction was performed using a cell genome extraction kit (nuozin). Then, the extracted genome is used as a template, a locus fragment containing a target site is obtained by PCR amplification, and the gene editing efficiency is detected by a T7E1 mode. 200ng of the PCR product fragment was subjected to gradient annealing in T7E1 reaction buffer (Novozam), the procedure is shown in Table 2, T7E1 enzyme was added after the annealing was completed, the cleavage band was detected by agarose gel after incubation at 37 ℃ for 30 minutes, and the cleavage band was subjected to computational analysis by Tanon Gis. The results are shown in fig. 4, B, which shows that cpcf 1 can increase the genome cleavage efficiency from-10% to 44% compared to WT cpcf 1 after conjugation, and exhibits greater therapeutic potential for leukemia. Gene editing efficiency was 100 × (1-amount of cleaved band DNA/amount of total DNA in lane). The sequences of CrRNA used and primers used for genomic PCR are shown below:

TABLE 7

Name (R)	Sequence (5 '-3')
		hHPRT1 CrRNA	gguuaaagaugguuaaaugau
Geno-hHPRT1-FW	catggtacactcagcacggatgaaatg
		Geno-hHPRT1-RV	gctgttcaactatttcagccaacaagaagtg

3) The evaluation of the in vivo gene editing efficiency of the jurkat cell and the editing of the gene locus of the targeted endogenous gene hHPRT1 are the same as those of the K562 cell except that the specific process is different from the electrotransfer condition (the electrotransfer condition of the jurkat cell is 400V, 30ms and 1 pulse). The results of the evaluation of gene editing efficiency in vivo on jurkat cells are shown in fig. 4, C, and indicate that cpcf 1 showed twice the editing efficiency after conjugation compared to WT Cpf1, showing better potential for efficient T cell production.

4) The in vivo gene editing efficiency evaluation of NIH-3T3 cells, targeted endogenous gene mHPRT1 locus for editing, the specific process is as follows:

firstly, preparing a cCpf1 complex in vitro, preparing an RNP complex according to a Cpf1: CrRNA molar ratio of 1:1.2(60pmol:72pmol), incubating Cpf1 protein and CrRNA at room temperature for 5 minutes, placing at 4 ℃ for reaction for 3 hours to prepare cCpf1, performing cell electroporation after the reaction is finished, and preparing a wild-type WT Cpf1 complex as a control by the same method. Adherent NIH-3T3 cells were aspirated off the medium, washed once with PBS, digested with pancreatin, terminated with medium and counted in suspension. Take 1X 10⁶Suspending the cells with 20 μ L electrotransfer buffer (Celetrix, used after mixing solution A and solution B in equal proportion before use), mixing RNP and cells, slowly adding into 20 μ L electric shock cup, performing electric shock according to optimized parameters (400V, 30ms, 1pulse), rapidly adding cells into preheated DMEM culture medium after electric shock is finished, and culturing in incubator (37 deg.C, 5% CO)₂). Cells were harvested after 48 hours, and cell genome extraction was performed using a cell genome extraction kit (nuozin). The genome editing efficiency was detected and evaluated in accordance with step 2), and the editing efficiency was improved from-8% to-25% as shown in D in FIG. 4. The sequences of CrRNA used and primers used for genomic PCR are shown below:

TABLE 8

Name (R)	Sequence (5 '-3')
		Mouse HPRT1 CrRNA	ggauguuaagagucccuaucu
Geno-mHPRT1-FW	gttcaattcccagcaaccacatgttg
		Geno-mHPRT1-RV	gtatacacaaaatctcaccacaattcacacagag

Example 5: in vivo off-target efficiency assessment of site-directed conjugation of cpcf 1

The invention adopts the currently accepted strategy of Guide-seq and the strategy of PEM-seq reported in recent years to evaluate the safety of CRISPR/cCpf1 system gene editing. The Guide-seq is evaluated by drumhead medical treatment limited, the tracing of gene editing cutting sites is carried out by adding dsODN through homologous recombination, the enrichment of the cutting sites is realized by utilizing dsODN specific amplification, the recognition of the cutting sites is realized by utilizing a second-generation sequencing platform, and then the positions and the number of target sites and off-target sites are analyzed. Off-target sequencing results as shown in a in fig. 5, it can be seen that 1359 editing sites were detected in the target sequence and one off-target site was generated for wild-type Cpf1, whereas 2816 editing sites were detected in the target sequence and no off-target site was detected in the panel conjugated Cpf1, indicating that the cppf 1 system can improve gene editing efficiency without generating additional off-target effects.

To further detect possible chromosomal rearrangements or additional large fragment deletions by CRISPR/cpcpf 1, the inventors used PEM-Seq protocol to test the cleavage and amplify the sequence with specific primers as follows, followed by sequencing through a next-generation sequencing platform. Off-target sequencing results as shown in B in fig. 5, off-target at 1 site was detected using both wild-type Cpf1 and Cpf1, and no additional large deletion insertions or deletions were detected, indicating the safety and efficacy of the cppf 1 system.

Example 6: site-directed conjugation of AsCpf1 to crRNA evaluation of the level of homologous recombination in cells

In the embodiment, conserved gene HPRT genes in human cells are cut, 6 bp specific sequences containing 40bp homologous arms at the left and right are introduced at the cutting sites, the sequences are EcoR1 specific recognition sites, and if gene editing is successfully realized and accurate homologous recombination occurs, corresponding fragments can be specifically amplified through genomes, and then fragment enzyme digestion evaluation is carried out. The efficiency of EcoR1 cleavage can directly reflect the level of homologous recombination. Specifically, after incubating 40/60pmol AsCpf1 protein with the corresponding crRNA (1.2 fold equivalent) for 10min in vitro to form RNP, and reacting at 4 ℃ for 3 hr, 0.6 fold equivalent of single stranded donor DNA was added to form a complex for subsequent transfection. The transfection used was a CTX-1500A LE model electrotransfer apparatus, according to the instructions according to the buffer A and B equal proportion mixing configuration, for a single reaction using 20ul electrotransfer buffer heavy suspension 1x 10⁶And (3) carrying out cell separation, namely adding the pre-prepared coupling compound into the cell suspension for electrotransformation under the condition of 420V for 30ms, immediately sucking out the cells after electrotransformation, and placing the cells in a preheated DMEM culture medium for continuous culture for 48 h. At 48 hours after transfection, cells were collected, the genome of the cells was extracted using a genome extraction kit provided by noximedium, and after PCR amplification of the target region, the amplified product was purified using a Cycle pure purification kit and then quantified. The evaluation of homologous recombination efficiency is carried out by enzyme digestion, the specific operation is as follows, sample adding is carried out according to 200 ng/reaction of PCR product, the enzyme digestion system is 10ul, 1ul CutSmart solution, 200ng template and 1ul EcoRI-HF enzyme are added, the mixture is supplemented to 10ul by water, the product is identified by 1% agarose gel electrophoresis after 1h reaction at 37 ℃, and the band is quantitatively analyzed. The results are shown in FIG. 6, where the RNP cut was performed at 40pmol and 60pmolThe coupling group (cCpf1) can be seen to be capable of obviously improving the homologous recombination efficiency by 7-8 times under the condition of the cut concentration, and the method for site-specific coupling of crRNA on RNP, which is created by the inventor, is proved to be capable of really improving the homologous recombination repair efficiency in gene editing.

The nucleic acid sequences used in this example are shown in the following table:

TABLE 9

Example 7: site-directed conjugation of cCpf1 in combination with AAV production of CAR-Jurkat cells and evaluation of cellular levels thereof

The invention adopts a Jurkat cell electrotransfer mode to target a TRAC locus for editing, and then delivers anti-CD19 CAR through adeno-associated virus (serotype 6), thereby realizing the site-specific integration and knock-in of CAR gene at the TRAC locus. The specific process is as follows:

1: production and purification of adeno-associated virus

The sequence of the integration delivered CAR gene used in the invention is shown in SEQ ID NO. 4. Wherein, the lower case underline is the homologous arm of TRAC gene, which is convenient for site-directed integration; lower case bold SFFV promoter to start expression of CAR gene; the capital bold is Myc-tag, which facilitates the detection of the expression of the CAR gene; the lower case italics are the bGH polyA signals; the upper case part is the gene sequence of anti-CD19 CAR. The gene sequence is synthesized by Anhui general biology company, then 5 'MluI and 3' RsrII restriction enzyme cutting sites are introduced at the tail ends through PCR primers, and the plasmid pAAV-SFFV-CD19CAR is obtained by cutting enzyme and connecting into a pAAV-MCS vector for packaging adeno-associated virus. The viral packaging helper plasmids pAAV-RC6 and pAAV-helper were purchased from Fenghui Bio Inc. AAV-293 cell lines for viral packaging were purchased from Nanjing Helhong Rui Biotech, Inc. The primers used for the construction of the pAAV-SFFV-CD19CAR plasmid are as follows:

watch 10

Name (R)	Sequence (5 '-3')
		Mlu1-FW	ccatcactaggggttcctgcggccgcacgcgtgatgtaaggagctgctgtgacttgc
RsrII-RV	cactaggggttcctgcggccgctcggtccggtgggttaatgagtgactgcgtgag

The AAV-293 cells were co-transfected with pAAV-SFFV-CD19CAR, pAAV-RC6, pAAV-helper in a mass ratio of 1:1:1 using PEI, virus was collected 72 hours after transfection, virus purification and titer were performed by Vigene Biosciences and named AAV-CD 19-CAR.

2: preparation of CAR-jurkat cells

Firstly, preparing a cCpf1 complex in vitro, preparing an RNP complex according to the molar ratio of Cpf1 to CrRNA of 1:1.2, incubating Cpf1 protein and CrRNA at room temperature for 5 minutes, reacting at 4 ℃ for 3 hours to prepare cCpf1, performing cell electrotransfer after the reaction is finished, and preparing a wild-type WT Cpf1 complex by the same method as a control. Jurkat cells were counted, 1.5X 10⁶Suspending the cells with 20 μ L electrotransfer buffer (Celetrix, used after mixing solution A and solution B in equal proportion before use), mixing RNP and cells, slowly adding into 20 μ L electric shock cup, performing electric shock according to optimized parameters (400V, 30ms, 1pulse), rapidly adding cells into preheated RPMI-1640 culture medium after electric shock is finished, and culturing in incubator (37 deg.C, 5% CO)₂). 4 hours after electrotransfer AAV-CD19-CAR at MOI of 1 × 10⁶Jurkat cells were infected by addition to the medium. Cells were harvested 48 hours after electroporation, the genome extracted, and the knockout efficiency of the TRAC target site determined using the method described previously for T7E 1.

3: evaluation of production efficiency of CAR-jurkat cell

5 days after electroporation, the prepared CAR-jurkat cells were collected for flow assay to evaluate the efficiency of CAR-jurkat cell preparation. The specific process is as follows:

1) take 1X 10⁶Individual cells were collected into 1.5ml Ep tubes for detection;

2) the cell culture medium was removed by centrifugation, the cells were resuspended with 200 μ L PBS + 2% FBS after one PBS wash, and blocked at 4 ℃ for 1 hour to reduce non-specific binding;

3) after blocking, the cells were centrifuged, resuspended in 100. mu.L PBS + 1% FBS, diluted 1:100, c-Mycmouse monoclonal antibody (Invitrogen) was added and incubated at 4 ℃ for 1.5 hours to allow primary antibody to bind to myc tag incubation;

4) after the primary antibody incubation was completed, the cells were washed twice with PBS to remove residual antibody as much as possible, then the cells were resuspended in 100. mu.L PBS, and Anti-mouse IgG (H + L), F (ab')2Fragment (Alexa) were added at a dilution of 1:1000

647Conjugate) (Cell Signaling Technology), incubating at 4 ℃ for 30 minutes in the absence of light to allow the secondary antibody to bind to the primary antibody;

5) after the incubation of the secondary antibody is finished, washing the cells twice by PBS, removing residual secondary antibody as much as possible to reduce the fluorescence background, and then re-suspending the cells by 100 mu L PBS;

5) the detection was carried out using a six-laser Flow Cytometer (CytoFLEX LX Flow Cytometer) with a detection channel of R660-APC, and the results were analyzed using analysis software CytExpert.

The flow analysis results are shown in FIG. 7, and show that the cCpf1 shows the improved efficiency of CAR-jurkat cell production compared with the WT Cpf1 group, and has the production efficiency as high as 80% when the cell is electrically transferred to 60pmol RNP. The CrRNA sequence and genomic PCR primers targeting the TRAC gene used in the experiment are shown below:

TABLE 11

Name (R)	Sequence (5 '-3')
		Human TRAC CrRNA	gagtctctcagctggtacac
Geno-TRAC-FW	cgagcagctggtttctaagatgc
		Geno-TRAC-RV	ctggactgccagaacaaggc

Example 8: evaluation of efficiency of integration at site-directed Gene integration CAR-Jurkat Gene level

The invention adopts an In-Out PCR mode to carry Out semi-quantitative evaluation on the efficiency of CAR site-specific integration In the TRAC locus. The specific process is as follows:

1: In-Out PCR primer design

Aiming at the integration of the TRAC locus, three specific primers of TRAC-1st-FW, CART-PCR-FW and TRAC-2st-RV are designed, wherein the primer TRAC-1st-FW is combined with a homologous arm at the 5 'end of the TRAC locus, the primer CART-PCR-FW is combined with a CAR gene integrated in a fixed point way, and the primer TRAC-2st-RV is combined with a homologous arm at the 3' end of the TRAC locus. The PCR primer sequences used In the In-Out PCR are shown below:

TABLE 12

Name (R)	Sequence (5 '-3')
		TRAC-1st-FW	cccttgtccatcactggcat
CART-PCR-FW	ggagtacgacgtgctggataag
		TRAC-2st-RV	gcacacccctcatctgactt

2: evaluation of Gene level integration efficiency

Jurkat cells obtained 5 days after the electroporation in step 3 of example 7 were taken, the genome of the cells was extracted using a genome extraction kit (Novozan), and three primers were mixed in the same tube of PCR reaction solution using the genomic DNA as a template to perform PCR reaction. If site-directed integration does not occur, only a band with the length of 843bp is obtained by amplification of primers TRAC-1st-FW and TRAC-2 st-RV; if the two primers are partially integrated at fixed points, there are 843bp bands obtained by amplification with the primers TRAC-1st-FW and TRAC-2st-RV and 1278bp bands obtained by amplification with the primers CART-PCR-FW and TRAC-2st-RV, respectively. The PCR reaction system is shown in Table 13.

TABLE 13 In-Out PCR reaction System

Genome template	50ng
		Primer TRAC-1st-FW	1.5μL
Primer CART-PCR-FW	1.5μL
		Primer TRAC-2st-RV	1.5μL
KOD OneTM PCR Master Mix(TOYOBO)	25μL
		ddH2O	Up to 50μL

After the PCR reaction is finished, electrophoresis is carried out by using 1% agarose gel according to the condition of 150V for 20min, and then analysis and quantification are carried out on a PCR band by using gel quantification software Tanon Gis, and the result is shown in figure 8, which shows that the group of cCpf1 has higher gene level integration efficiency than the group of wild-type Cpf1, and at the time of 30pmol RNP (low dose), the coupling complex cCpf1 has gene level integration efficiency equivalent to that of the high dose group, and has better CAR-jurkat cell preparation potential.

Example 9: site-directed conjugation of cCpf1 in combination with AAV production of CAR-T cells and evaluation of cellular levels thereof

It has been verified in examples 7 and 8 that the cpcf 1 has high production efficiency in combination with AAV in the production of CAR-jurkat cells, and subsequently the production effect of this method in the production of CAR-T cells was verified, as follows:

1: isolated culture of PBMC cells

Mononuclear lymphocytes in peripheral blood were isolated using Ficoll-Paque PLUS (GE Healthcare) and the procedure was as described by first diluting the blood sample by mixing it with a balanced salt solution in a volume ratio of 1:1, priming the 15ml tube with 3ml of Ficoll-Paque PLUS and carefully adding the diluted blood sample to the upper layer. Gradient centrifugation at 400 Xg for 30min at 20 deg.C, followed by careful aspiration of plasma layer and transfer of mononuclear cell layer to a new centrifuge tube, washing twice with balanced salt solution, and resuspension in T cell separation buffer (PBS without calcium and magnesium ions + 0.1% BSA +2mM EDTA) for further processing

2: isolation of primary T cells

Using Dynabeads^TM Untouched^TMHuman T Cells Kit (Invitrogen) isolated primary T Cells from PBMC isolated in step 1 as follows:

1) taking 500 μ L PBMC (less than or equal to 5X 10)⁷Individual cells) were transferred to 15ml tubes;

2) adding 100 μ L of heat-inactivated fetal calf serum, and mixing to reduce nonspecific binding of antibody;

3) adding 100 mu L of allopody-mix, uniformly mixing, and incubating for 20min at 4 ℃;

4) adding 4ml of the T cell separation buffer solution in the step 1, uniformly mixing, and centrifuging at 350 Xg at 4 ℃ for 8 min;

5) resuspend the cells in 500. mu. L T cell isolation buffer, add 500. mu.L Dynabeads washed with T cell isolation buffer in advance, mix well and incubate at room temperature for 15 min;

6) adding 4ml of T cell separation buffer solution, uniformly mixing, placing the centrifugal tube on a magnetic frame, standing for 2 minutes, and transferring the supernatant into a new centrifugal tube to obtain the separated primary T cells.

3: stimulated culture of primary T cells

Primary T cells were cultured using XYbeads Human CD3/CD 28T Cell Activator (SAILY BIO) for stimulation. The primary T cells isolated in step 2 were counted, centrifuged to remove the T cell isolation buffer, and the cells were resuspended to a density of 8X 10 using T cell medium (X-VIVO + 10% heat inactivated FBS +30U/ml IL-2+5ng/ml IL-7+5ng/ml IL-15+ 1% ps)⁵Each cell/ml, was cultured in a six-well cell culture plate. According to the number of cells: the number of magnetic beads was 1:1, CD3/CD28 magnetic beads previously washed with T cell medium were added to the cells, and the cells were placed in a cell incubator (37 ℃ C., 5% CO)₂) Culturing in the medium.

4: preparation of CAR-T cells

Similar to the preparation of CAR-jurkat cells, the cCpf1 complex was first prepared in vitro, RNP complex was prepared according to a molar ratio of Cpf1: CrRNA of 1:1.2(30pmol:42pmol), and Cpf1 protein was incubated with CrRNA at room temperatureAfter incubation for 5 minutes, the cells were incubated at 4 ℃ for 3 hours to prepare cCpf1, which was used for cell electroporation as a control in the same manner as wild-type WT Cpf1 complex. Taking T cells on the third day after stimulation for electrotransfer, firstly resuspending the T cells in a 15ml centrifuge tube, removing the magnetic beads in the culture solution by using a magnetic frame, repeating the process once to ensure that the magnetic beads are completely removed, and completely washing the magnetic beads by using PBS and storing the washed magnetic beads at 4 ℃ for later use. Counting primary T cells, taking 1.5X 10⁶Suspending the cells with 20 μ L electrotransfer buffer (Celetrix, used after mixing solution A and solution B in equal proportion before use), mixing RNP and cells, slowly adding into 20 μ L electric shock cup, performing electric shock according to optimized parameters (420V, 20ms, 1pulse), rapidly adding cells into preheated T cell culture medium after electric shock is finished, and culturing in incubator (37 deg.C, 5% CO)₂). 4 hours after electrotransfer AAV-CD19-CAR at MOI of 1 × 10⁶The T cells were infected by addition to the medium. After 24 hours of electroporation, the rate of survival of T cells by electroporation and the cell density were recorded, and the CD3/CD28 magnetic beads previously kept ready were counted as cells: the number of magnetic beads was 1:1, and the cells were re-cultured in a re-stimulation manner. Cells were harvested 48 hours after electroporation, the genome extracted, and the knockout efficiency of the TRAC target site determined using the method described previously for T7E 1.

5: production evaluation of CAR-T cells

5 days after electroporation, the CAR-T cells prepared were collected for flow assay to evaluate the efficiency of CAR-T cell preparation. The specific process is as follows:

1) take 1X 10⁶Collecting the cells into a 1.5ml Ep tube, and completely removing magnetic beads in the culture solution by using a magnetic frame so as not to influence flow detection;

2) the cell culture medium was removed by centrifugation, the cells were resuspended with 200 μ L PBS + 2% FBS after one PBS wash, and blocked at 4 ℃ for 1 hour to reduce non-specific binding;

3) after the blocking, the cells were centrifuged, resuspended in 100. mu.L PBS + 1% FBS, diluted 1:100, c-Mycmouse monoclonal antibody (Invitrogen) was added, and incubated at 4 ℃ for 1.5 hours to allow primary antibody to bind to myc tag incubation;

4) after the primary antibody incubation was completed, the cells were washed twice with PBS to remove residual antibody as much as possible, then the cells were resuspended in 100. mu.L PBS, and Anti-mouse IgG (H + L), F (ab')2Fragment (Alexa) were added at a dilution of 1:1000

647Conjugate) (Cell Signaling Technology), incubating at 4 ℃ for 30 minutes in the absence of light to allow the secondary antibody to bind to the primary antibody;

5) after the incubation of the secondary antibody is finished, washing the cells twice by PBS, removing residual secondary antibody as much as possible to reduce the fluorescence background, and then re-suspending the cells by 100 mu L PBS;

5) the detection was carried out using a six-laser Flow Cytometer (CytoFLEX LX Flow Cytometer) with a detection channel of R660-APC, and the results were analyzed using analysis software CytExpert.

As shown in FIG. 9B, the cCpf1 group increased the efficiency of CAR-T cell production from 30% to 53% compared to the wild-type Cpf1 group, and the immunological function of the produced CAR-T cells was evaluated.

Example 10: site-directed conjugation of cpcpf 1 in combination with AAV for immunological evaluation of CAR-T cells

The CD19 positive NALM6 (adult B-type acute lymphoblastic leukemia cell strain) is used for detecting the targeting killing function and the secretion of killer cytokines of the prepared CAR-T cells. LDH-Glo Using an LDH detection kit^TMCytoxicity Assay (Promega) was used to detect the release of lactate dehydrogenase LDH in the culture medium after the death of NALM6 cells, and an ELISA detection kit (Invitrogen) was used to detect cytokine interferon gamma (IFN- γ) and tumor necrosis factor- α (TNF- α) secreted by CAR-T cells, as follows:

the prepared CAR-T cells were washed twice with RPMI-1640 cell culture medium (medium for NALM-6 cell culture) for use. The CAR-T cells and NALM-6 cells were counted separately and the two cells were co-incubated in 96-well plates at 1:10, i.e.1X 10 cells were added to each well⁴NALM-6 cells and 1X 10⁵Each CAR-T cell is controlled by a T cell which is not modified by CAR, and each incubation group is provided with three diplopore platesAnd (6) rows. After incubation in an incubator at 37 ℃ for 24-48 hours, the culture supernatant was centrifuged and assayed for LDH and ELISA.

1: LDH release assay

The culture supernatant was diluted 1:100 with LDH storage buffer (200mM Tris-HCl, pH7.3+ 10% glycerol + 1% BSA), and 50. mu.L of the diluted solution was added to a 96-well plate for detection. An LDH detection reagent is prepared by using 50 mu L of Enzyme mix and 0.25 mu L of detection substrate according to each reaction in a 96-well plate, the LDH detection reagent is added into a sample to be detected, chemiluminescence is detected by using a microplate reader after incubation for 60min at room temperature, and the integration time is 1 ms. Cell killing efficiency of 100 × (experimental group LDH release-medium background)/(control group LDH release-medium background), cytotoxicity assay results for CAR-T cells as shown in fig. 10A, CAR-T cells prepared from wild-type Cpf1 group had a cell killing efficiency of 24.5%, whereas CAR-T cells prepared from coupling complex cpcf 1 group developed by the present inventors had a cell killing efficiency of 42.5%.

2: cytokine IFN-gamma and TNF-alpha secretion detection

In this experiment, Human IFN gamma Uncoated ELISA kit (Invitrogen) and Human TNF alpha Uncoated ELISA kit (Invitrogen) were used to detect the IFN-. gamma.and TNF-. alpha.content in the culture medium supernatant after co-incubation, respectively, and the cytokine content in the culture medium was quantified according to a standard curve. As shown in FIGS. 10B and 10C, it can be seen that the IFN-. gamma.and TNF-. alpha.release in the cCpf1 group was increased 2-fold and 1.5-fold, respectively, compared to the WT Cpf1 group.

Example 11: cCpf 1-based evaluation of multi-site knockout CAR-T cells

The inventor utilizes a cpcf 1 system to knock out four sites of TRAC, beta 2M, PD1 and CTLA4 of T cells at the same time, and utilizes AAV delivery to realize site-directed integration of CAR genes at the TRAC site, so as to successfully prepare universal T cells capable of breaking immunosuppression and knocking in CAR genes at a site, and as a result, as shown in fig. 11, it can be seen that the cpcf 1 group shows higher editing efficiency in double site editing, triple site editing and quadruple site editing compared with wild type.

The specific evaluation process is as follows:

1: preparation of RNP complexes targeting different sites

RNP complexes targeting different sites are prepared by reaction respectively, the RNP complexes are prepared according to the molar ratio of Cpf1 to CrRNA of 1:1.2, Cpf1 protein and CrRNA are incubated for 5 minutes at room temperature and then placed at 4 ℃ for reaction for 3 hours to prepare cCpf1, and wild-type WT Cpf1 complexes are prepared by the same method as a control.

2: preparation of multiple Gene edited CAR-T cells

Similar to the preparation of CAR-T cells in step 4 of example 8, 1.5X 10 cells were taken⁶Suspending each cell with 20 μ L electrotransfer buffer solution (Celetrix, mixing solution A and solution B at equal ratio before use), mixing RNPs in different multiple gene editing combinations, mixing total RNPs and cells, slowly adding into 20 μ L electric shock cup, performing electric shock according to optimized parameters (420V, 20ms, 1pulse), rapidly adding cells into preheated T cell culture medium after electric shock is finished, and culturing in incubator (37 deg.C, 5% CO)₂). 4 hours after electrotransfer AAV-CD19-CAR at MOI of 1 × 10⁶The cells were infected by addition to the medium. After 24 hours of electroporation, the rate of survival of T cells by electroporation and the cell density were recorded, and the CD3/CD28 magnetic beads previously kept ready were counted as cells: the number of magnetic beads was 1:1, and the cells were re-cultured in a re-stimulation manner. Cells were harvested 48 hours after electroporation, the genome extracted, and the gene level knockout efficiency of the TRAC target site determined using the method described previously for T7E 1. The CrRNA sequences and genomic PCR primers used in the experiments targeting the β 2M, PD1, CTLA4 genes are shown below:

TABLE 14

Name(s)	Sequence (5 '-3')
		Human β2M CrRNA	ccgatattcctcaggtactc
Human PD1 CrRNA	gcacgaagctctccgatgtg
		Human CTLA4 CrRNA	cctggagatgcatactcacacac
IVD-β2M-FW	gaggaattatgagggaaagataccaagtcacgg
		IVD-β2M-RV	caaaggcctataccttcttgagatgttcgttcag
IVD-PD1-FW	cagcagagacttctcaatgacattccagc
		IVD-PD1-RV	ggacagagatgccggtcaccattc
IVD-CLTA4-FW	gctggaaaacagttgagagatggaggg
		IVD-CLTA4-RV	catgatggttagcactccagagcgag

3: evaluation of multiple Gene editing T cells

T cells after 5 days of electrotransformation in step 2 were characterized for efficiency of T cell multiplex gene editing by flow assay of β 2M, PD1, CTLA4 protein expression levels in the edited T cells. Firstly, 2 is multiplied by 10⁶The individual cells were collected in 1.5ml Ep tubes and placed in culture using a magnetic holderThe magnetic beads are removed completely to avoid affecting flow detection, and the cells are divided into two parts, one part is used for detecting gene knockout efficiency, and the other part is used for detecting fixed point knock-in efficiency of CAR. Detection of CAR site-directed integration efficiency was performed using myc tag staining as described in example 8, step 5, and is not described herein. The flow detection process of gene knockout efficiency is as follows:

1) the cell culture medium was removed by centrifugation, the cells were resuspended with 200 μ L PBS + 2% FBS after one PBS wash, and blocked at 4 ℃ for 1 hour to reduce non-specific binding;

2) after blocking, the cells were centrifuged and resuspended in 80. mu.L PBS + 1% FBS and 5. mu.L of APC anti-human CD3 (Biolegged), 5. mu.L of FITC anti-human β 2-microrogobulin (Biolegged), 5. mu.L of PE anti-human CD279 (Biolegged), 5. mu.L of PE/cysteine 7 anti-human CD152 (Biolegged), approximately 100. mu.L of staining volume containing 1X 10⁶Incubating the cells at 4 ℃ for 1 hour in the dark to allow the antibody to bind to the corresponding cell surface protein;

4) after the incubation is finished, washing the cells twice by PBS (phosphate buffer solution), removing residual antibodies as much as possible, and then resuspending the cells by 100 mu L of PBS;

5) detecting by using a six-laser Flow Cytometer (CytoFLEX LX Flow Cytometer), wherein detection channels are B525-FITC, Y585-PE, R660-APC and Y763-PC7, analyzing the total knockout efficiency of the T cells by using analysis software CytExpert, and if the four-site gene knockout efficiency is 100 multiplied by the cell number/total cell number of the APC-FITC-PE-PY7-, the knockout efficiencies of the rest sites are analogized.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that it is obvious to those skilled in the art that various modifications and improvements can be made without departing from the principle of the present invention, and these modifications and improvements should also be considered as the protection scope of the present invention.

Sequence listing

<110> Beijing university

<120> use of chemically modified CRISPR/Cpf1 complex

<130> MP21006798

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1342

<212> PRT

<213> AsCpf1(AsCpf1)

<400> 1

Met Thr Gln Phe Glu Gly Phe Thr Asn Leu Tyr Gln Val Ser Lys Thr

1 5 10 15

Leu Arg Phe Glu Leu Ile Pro Gln Gly Lys Thr Leu Lys His Ile Gln

20 25 30

Glu Gln Gly Phe Ile Glu Glu Asp Lys Ala Arg Asn Asp His Tyr Lys

35 40 45

Glu Leu Lys Pro Ile Ile Asp Arg Ile Tyr Lys Thr Tyr Ala Asp Gln

50 55 60

Cys Leu Gln Leu Val Gln Leu Asp Trp Glu Asn Leu Ser Ala Ala Ile

65 70 75 80

Asp Ser Tyr Arg Lys Glu Lys Thr Glu Glu Thr Arg Asn Ala Leu Ile

85 90 95

Glu Glu Gln Ala Thr Tyr Arg Asn Ala Ile His Asp Tyr Phe Ile Gly

100 105 110

Arg Thr Asp Asn Leu Thr Asp Ala Ile Asn Lys Arg His Ala Glu Ile

115 120 125

Tyr Lys Gly Leu Phe Lys Ala Glu Leu Phe Asn Gly Lys Val Leu Lys

130 135 140

Gln Leu Gly Thr Val Thr Thr Thr Glu His Glu Asn Ala Leu Leu Arg

145 150 155 160

Ser Phe Asp Lys Phe Thr Thr Tyr Phe Ser Gly Phe Tyr Glu Asn Arg

165 170 175

Lys Asn Val Phe Ser Ala Glu Asp Ile Ser Thr Ala Ile Pro His Arg

180 185 190

Ile Val Gln Asp Asn Phe Pro Lys Phe Lys Glu Asn Cys His Ile Phe

195 200 205

Thr Arg Leu Ile Thr Ala Val Pro Ser Leu Arg Glu His Phe Glu Asn

210 215 220

Val Lys Lys Ala Ile Gly Ile Phe Val Ser Thr Ser Ile Glu Glu Val

225 230 235 240

Phe Ser Phe Pro Phe Tyr Asn Gln Leu Leu Thr Gln Thr Gln Ile Asp

245 250 255

Leu Tyr Asn Gln Leu Leu Gly Gly Ile Ser Arg Glu Ala Gly Thr Glu

260 265 270

Lys Ile Lys Gly Leu Asn Glu Val Leu Asn Leu Ala Ile Gln Lys Asn

275 280 285

Asp Glu Thr Ala His Ile Ile Ala Ser Leu Pro His Arg Phe Ile Pro

290 295 300

Leu Phe Lys Gln Ile Leu Ser Asp Arg Asn Thr Leu Ser Phe Ile Leu

305 310 315 320

Glu Glu Phe Lys Ser Asp Glu Glu Val Ile Gln Ser Phe Cys Lys Tyr

325 330 335

Lys Thr Leu Leu Arg Asn Glu Asn Val Leu Glu Thr Ala Glu Ala Leu

340 345 350

Phe Asn Glu Leu Asn Ser Ile Asp Leu Thr His Ile Phe Ile Ser His

355 360 365

Lys Lys Leu Glu Thr Ile Ser Ser Ala Leu Cys Asp His Trp Asp Thr

370 375 380

Leu Arg Asn Ala Leu Tyr Glu Arg Arg Ile Ser Glu Leu Thr Gly Lys

385 390 395 400

Ile Thr Lys Ser Ala Lys Glu Lys Val Gln Arg Ser Leu Lys His Glu

405 410 415

Asp Ile Asn Leu Gln Glu Ile Ile Ser Ala Ala Gly Lys Glu Leu Ser

420 425 430

Glu Ala Phe Lys Gln Lys Thr Ser Glu Ile Leu Ser His Ala His Ala

435 440 445

Ala Leu Asp Gln Pro Leu Pro Thr Thr Leu Lys Lys Gln Glu Glu Lys

450 455 460

Glu Ile Leu Lys Ser Gln Leu Asp Ser Leu Leu Gly Leu Tyr His Leu

465 470 475 480

Leu Asp Trp Phe Ala Val Asp Glu Ser Asn Glu Val Asp Pro Glu Phe

485 490 495

Ser Ala Arg Leu Thr Gly Ile Lys Leu Glu Met Glu Pro Ser Leu Ser

500 505 510

Phe Tyr Asn Lys Ala Arg Asn Tyr Ala Thr Lys Lys Pro Tyr Ser Val

515 520 525

Glu Lys Phe Lys Leu Asn Phe Gln Met Pro Thr Leu Ala Ser Gly Trp

530 535 540

Asp Val Asn Lys Glu Lys Asn Asn Gly Ala Ile Leu Phe Val Lys Asn

545 550 555 560

Gly Leu Tyr Tyr Leu Gly Ile Met Pro Lys Gln Lys Gly Arg Tyr Lys

565 570 575

Ala Leu Ser Phe Glu Pro Thr Glu Lys Thr Ser Glu Gly Phe Asp Lys

580 585 590

Met Tyr Tyr Asp Tyr Phe Pro Asp Ala Ala Lys Met Ile Pro Lys Cys

595 600 605

Ser Thr Gln Leu Lys Ala Val Thr Ala His Phe Gln Thr His Thr Thr

610 615 620

Pro Ile Leu Leu Ser Asn Asn Phe Ile Glu Pro Leu Glu Ile Thr Lys

625 630 635 640

Glu Ile Tyr Asp Leu Asn Asn Pro Glu Lys Glu Pro Lys Lys Phe Gln

645 650 655

Thr Ala Tyr Ala Lys Lys Thr Gly Asp Gln Lys Gly Tyr Arg Glu Ala

660 665 670

Leu Cys Lys Trp Ile Asp Phe Thr Arg Asp Phe Leu Ser Lys Tyr Thr

675 680 685

Lys Thr Thr Ser Ile Asp Leu Ser Ser Leu Arg Pro Ser Ser Gln Tyr

690 695 700

Lys Asp Leu Gly Glu Tyr Tyr Ala Glu Leu Asn Pro Leu Leu Tyr His

705 710 715 720

Ile Ser Phe Gln Arg Ile Ala Glu Lys Glu Ile Met Asp Ala Val Glu

725 730 735

Thr Gly Lys Leu Tyr Leu Phe Gln Ile Tyr Asn Lys Asp Phe Ala Lys

740 745 750

Gly His His Gly Lys Pro Asn Leu His Thr Leu Tyr Trp Thr Gly Leu

755 760 765

Phe Ser Pro Glu Asn Leu Ala Lys Thr Ser Ile Lys Leu Asn Gly Gln

770 775 780

Ala Glu Leu Phe Tyr Arg Pro Lys Ser Arg Met Lys Arg Met Ala His

785 790 795 800

Arg Leu Gly Glu Lys Met Leu Asn Lys Lys Leu Lys Asp Gln Lys Thr

805 810 815

Pro Ile Pro Asp Thr Leu Tyr Gln Glu Leu Tyr Asp Tyr Val Asn His

820 825 830

Arg Leu Ser His Asp Leu Ser Asp Glu Ala Arg Ala Leu Leu Pro Asn

835 840 845

Val Ile Thr Lys Glu Val Ser His Glu Ile Ile Lys Asp Arg Arg Phe

850 855 860

Thr Ser Asp Lys Phe Phe Phe His Val Pro Ile Thr Leu Asn Tyr Gln

865 870 875 880

Ala Ala Asn Ser Pro Ser Lys Phe Asn Gln Arg Val Asn Ala Tyr Leu

885 890 895

Lys Glu His Pro Glu Thr Pro Ile Ile Gly Ile Asp Arg Gly Glu Arg

900 905 910

Asn Leu Ile Tyr Ile Thr Val Ile Asp Ser Thr Gly Lys Ile Leu Glu

915 920 925

Gln Arg Ser Leu Asn Thr Ile Gln Gln Phe Asp Tyr Gln Lys Lys Leu

930 935 940

Asp Asn Arg Glu Lys Glu Arg Val Ala Ala Arg Gln Ala Trp Ser Val

945 950 955 960

Val Gly Thr Ile Lys Asp Leu Lys Gln Gly Tyr Leu Ser Gln Val Ile

965 970 975

His Glu Ile Val Asp Leu Met Ile His Tyr Gln Ala Val Val Val Leu

980 985 990

Glu Asn Leu Asn Phe Gly Phe Lys Ser Lys Arg Thr Gly Ile Ala Glu

995 1000 1005

Lys Ala Val Tyr Gln Gln Phe Glu Lys Met Leu Ile Asp Lys Leu Asn

1010 1015 1020

Cys Leu Val Leu Lys Asp Tyr Pro Ala Glu Lys Val Gly Gly Val Leu

1025 1030 1035 1040

Asn Pro Tyr Gln Leu Thr Asp Gln Phe Thr Ser Phe Ala Lys Met Gly

1045 1050 1055

Thr Gln Ser Gly Phe Leu Phe Tyr Val Pro Ala Pro Tyr Thr Ser Lys

1060 1065 1070

Ile Asp Pro Leu Thr Gly Phe Val Asp Pro Phe Val Trp Lys Thr Ile

1075 1080 1085

Lys Asn His Glu Ser Arg Lys His Phe Leu Glu Gly Phe Asp Phe Leu

1090 1095 1100

His Tyr Asp Val Lys Thr Gly Asp Phe Ile Leu His Phe Lys Met Asn

1105 1110 1115 1120

Arg Asn Leu Ser Phe Gln Arg Gly Leu Pro Gly Phe Met Pro Ala Trp

1125 1130 1135

Asp Ile Val Phe Glu Lys Asn Glu Thr Gln Phe Asp Ala Lys Gly Thr

1140 1145 1150

Pro Phe Ile Ala Gly Lys Arg Ile Val Pro Val Ile Glu Asn His Arg

1155 1160 1165

Phe Thr Gly Arg Tyr Arg Asp Leu Tyr Pro Ala Asn Glu Leu Ile Ala

1170 1175 1180

Leu Leu Glu Glu Lys Gly Ile Val Phe Arg Asp Gly Ser Asn Ile Leu

1185 1190 1195 1200

Pro Lys Leu Leu Glu Asn Asp Asp Ser His Ala Ile Asp Thr Met Val

1205 1210 1215

Ala Leu Ile Arg Ser Val Leu Gln Met Arg Asn Ser Asn Ala Ala Thr

1220 1225 1230

Gly Glu Asp Tyr Ile Asn Ser Pro Val Arg Asp Leu Asn Gly Val Cys

1235 1240 1245

Phe Asp Ser Arg Phe Gln Asn Pro Glu Trp Pro Met Asp Ala Asp Ala

1250 1255 1260

Asn Gly Ala Tyr His Ile Ala Leu Lys Gly Gln Leu Leu Leu Asn His

1265 1270 1275 1280

Leu Lys Glu Ser Lys Asp Leu Lys Leu Gln Asn Gly Ile Ser Asn Gln

1285 1290 1295

Asp Trp Leu Ala Tyr Ile Gln Glu Leu Arg Asn Lys Arg Pro Ala Ala

1300 1305 1310

Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Gly Ser Pro Lys Lys

1315 1320 1325

Lys Arg Lys Val Gly Ser Leu Glu His His His His His His

1330 1335 1340

<210> 2

<211> 1394

<212> PRT

<213> SpCas9(SpCas9)

<400> 2

Met Gly Phe Met Pro Lys Lys Lys Arg Lys Val Met Asp Lys Lys Tyr

1 5 10 15

Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val Gly Trp Ala Val Ile

20 25 30

Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe Lys Val Leu Gly Asn

35 40 45

Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile Gly Ala Leu Leu Phe

50 55 60

Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys Arg Thr Ala Arg

65 70 75 80

Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys Tyr Leu Gln Glu Ile

85 90 95

Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser Phe Phe His Arg Leu

100 105 110

Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His Glu Arg His Pro

115 120 125

Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His Glu Lys Tyr Pro

130 135 140

Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser Thr Asp Lys Ala

145 150 155 160

Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met Ile Lys Phe Arg

165 170 175

Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp Asn Ser Asp Val

180 185 190

Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn Gln Leu Phe Glu

195 200 205

Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys Ala Ile Leu Ser

210 215 220

Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn Leu Ile Ala Gln Leu

225 230 235 240

Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu Ile Ala Leu Ser

245 250 255

Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp Leu Ala Glu Asp

260 265 270

Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp Asp Leu Asp Asn

275 280 285

Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu Phe Leu Ala Ala

290 295 300

Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile Leu Arg Val Asn

305 310 315 320

Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met Ile Lys Arg Tyr

325 330 335

Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala Leu Val Arg Gln

340 345 350

Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp Gln Ser Lys Asn

355 360 365

Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln Glu Glu Phe Tyr

370 375 380

Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly Thr Glu Glu Leu

385 390 395 400

Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys Gln Arg Thr Phe

405 410 415

Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly Glu Leu His Ala

420 425 430

Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu Lys Asp Asn Arg

435 440 445

Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro Tyr Tyr Val Gly

450 455 460

Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met Thr Arg Lys Ser

465 470 475 480

Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val Val Asp Lys Gly

485 490 495

Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn Phe Asp Lys Asn

500 505 510

Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu Leu Tyr Glu Tyr

515 520 525

Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr Val Thr Glu Gly

530 535 540

Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys Lys Ala Ile Val

545 550 555 560

Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val Lys Gln Leu Lys

565 570 575

Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser Val Glu Ile Ser

580 585 590

Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr Tyr His Asp Leu

595 600 605

Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn Glu Glu Asn Glu

610 615 620

Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu Phe Glu Asp Arg

625 630 635 640

Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His Leu Phe Asp Asp

645 650 655

Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr Gly Trp Gly Arg

660 665 670

Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys Gln Ser Gly Lys

675 680 685

Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala Asn Arg Asn Phe

690 695 700

Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys Glu Asp Ile Gln

705 710 715 720

Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His Glu His Ile Ala

725 730 735

Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile Leu Gln Thr Val

740 745 750

Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg His Lys Pro Glu

755 760 765

Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr Thr Gln Lys Gly

770 775 780

Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu Glu Gly Ile Lys

785 790 795 800

Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val Glu Asn Thr Gln

805 810 815

Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln Asn Gly Arg Asp

820 825 830

Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu Ser Asp Tyr Asp

835 840 845

Val Asp His Ile Val Pro Gln Ser Phe Leu Lys Asp Asp Ser Ile Asp

850 855 860

Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly Lys Ser Asp Asn

865 870 875 880

Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn Tyr Trp Arg Gln

885 890 895

Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe Asp Asn Leu Thr

900 905 910

Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp Lys Ala Gly Phe Ile

915 920 925

Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr Lys His Val Ala Gln

930 935 940

Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp Glu Asn Asp Lys Leu

945 950 955 960

Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser Lys Leu Val Ser Asp

965 970 975

Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu Ile Asn Asn Tyr

980 985 990

His His Ala His Asp Ala Tyr Leu Asn Ala Val Val Gly Thr Ala Leu

995 1000 1005

Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val Tyr Gly Asp Tyr

1010 1015 1020

Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser Glu Gln Glu Ile

1025 1030 1035 1040

Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn Ile Met Asn Phe

1045 1050 1055

Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile Arg Lys Arg Pro

1060 1065 1070

Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val Trp Asp Lys Gly

1075 1080 1085

Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met Pro Gln Val Asn

1090 1095 1100

Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser

1105 1110 1115 1120

Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp

1125 1130 1135

Trp Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr

1140 1145 1150

Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu

1155 1160 1165

Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser

1170 1175 1180

Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys Glu

1185 1190 1195 1200

Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu Phe Glu

1205 1210 1215

Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Gly Glu Leu Gln

1220 1225 1230

Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val Asn Phe Leu Tyr

1235 1240 1245

Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro Glu Asp Asn Glu

1250 1255 1260

Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr Leu Asp Glu Ile

1265 1270 1275 1280

Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile Leu Ala Asp Ala

1285 1290 1295

Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys His Arg Asp Lys Pro

1300 1305 1310

Ile Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe Thr Leu Thr Asn

1315 1320 1325

Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg

1330 1335 1340

Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His

1345 1350 1355 1360

Gln Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu

1365 1370 1375

Gly Gly Asp Pro Lys Lys Lys Arg Lys Val Leu Glu His His His His

1380 1385 1390

His His

<210> 3

<211> 1263

<212> PRT

<213> LbCpf1(LbCpf1)

<400> 3

Met Ser Lys Leu Glu Lys Phe Thr Asn Cys Tyr Ser Leu Ser Lys Thr

1 5 10 15

Leu Arg Phe Lys Ala Ile Pro Val Gly Lys Thr Gln Glu Asn Ile Asp

20 25 30

Asn Lys Arg Leu Leu Val Glu Asp Glu Lys Arg Ala Glu Asp Tyr Lys

35 40 45

Gly Val Lys Lys Leu Leu Asp Arg Tyr Tyr Leu Ser Phe Ile Asn Asp

50 55 60

Val Leu His Ser Ile Lys Leu Lys Asn Leu Asn Asn Tyr Ile Ser Leu

65 70 75 80

Phe Arg Lys Lys Thr Arg Thr Glu Lys Glu Asn Lys Glu Leu Glu Asn

85 90 95

Leu Glu Ile Asn Leu Arg Lys Glu Ile Ala Lys Ala Phe Lys Gly Asn

100 105 110

Glu Gly Tyr Lys Ser Leu Phe Lys Lys Asp Ile Ile Glu Thr Ile Leu

115 120 125

Pro Glu Phe Leu Asp Asp Lys Asp Glu Ile Ala Leu Val Asn Ser Phe

130 135 140

Asn Gly Phe Thr Thr Ala Phe Thr Gly Phe Phe Asp Asn Arg Glu Asn

145 150 155 160

Met Phe Ser Glu Glu Ala Lys Ser Thr Ser Ile Ala Phe Arg Cys Ile

165 170 175

Asn Glu Asn Leu Thr Arg Tyr Ile Ser Asn Met Asp Ile Phe Glu Lys

180 185 190

Val Asp Ala Ile Phe Asp Lys His Glu Val Gln Glu Ile Lys Glu Lys

195 200 205

Ile Leu Asn Ser Asp Tyr Asp Val Glu Asp Phe Phe Glu Gly Glu Phe

210 215 220

Phe Asn Phe Val Leu Thr Gln Glu Gly Ile Asp Val Tyr Asn Ala Ile

225 230 235 240

Ile Gly Gly Phe Val Thr Glu Ser Gly Glu Lys Ile Lys Gly Leu Asn

245 250 255

Glu Tyr Ile Asn Leu Tyr Asn Gln Lys Thr Lys Gln Lys Leu Pro Lys

260 265 270

Phe Lys Pro Leu Tyr Lys Gln Val Leu Ser Asp Arg Glu Ser Leu Ser

275 280 285

Phe Tyr Gly Glu Gly Tyr Thr Ser Asp Glu Glu Val Leu Glu Val Phe

290 295 300

Arg Asn Thr Leu Asn Lys Asn Ser Glu Ile Phe Ser Ser Ile Lys Lys

305 310 315 320

Leu Glu Lys Leu Phe Lys Asn Phe Asp Glu Tyr Ser Ser Ala Gly Ile

325 330 335

Phe Val Lys Asn Gly Pro Ala Ile Ser Thr Ile Ser Lys Asp Ile Phe

340 345 350

Gly Glu Trp Asn Val Ile Arg Asp Lys Trp Asn Ala Glu Tyr Asp Asp

355 360 365

Ile His Leu Lys Lys Lys Ala Val Val Thr Glu Lys Tyr Glu Asp Asp

370 375 380

Arg Arg Lys Ser Phe Lys Lys Ile Gly Ser Phe Ser Leu Glu Gln Leu

385 390 395 400

Gln Glu Tyr Ala Asp Ala Asp Leu Ser Val Val Glu Lys Leu Lys Glu

405 410 415

Ile Ile Ile Gln Lys Val Asp Glu Ile Tyr Lys Val Tyr Gly Ser Ser

420 425 430

Glu Lys Leu Phe Asp Ala Asp Phe Val Leu Glu Lys Ser Leu Lys Lys

435 440 445

Asn Asp Ala Val Val Ala Ile Met Lys Asp Leu Leu Asp Ser Val Lys

450 455 460

Ser Phe Glu Asn Tyr Ile Lys Ala Phe Phe Gly Glu Gly Lys Glu Thr

465 470 475 480

Asn Arg Asp Glu Ser Phe Tyr Gly Asp Phe Val Leu Ala Tyr Asp Ile

485 490 495

Leu Leu Lys Val Asp His Ile Tyr Asp Ala Ile Arg Asn Tyr Val Thr

500 505 510

Gln Lys Pro Tyr Ser Lys Asp Lys Phe Lys Leu Tyr Phe Gln Asn Pro

515 520 525

Gln Phe Met Gly Gly Trp Asp Lys Asp Lys Glu Thr Asp Tyr Arg Ala

530 535 540

Thr Ile Leu Arg Tyr Gly Ser Lys Tyr Tyr Leu Ala Ile Met Asp Lys

545 550 555 560

Lys Tyr Ala Lys Cys Leu Gln Lys Ile Asp Lys Asp Asp Val Asn Gly

565 570 575

Asn Tyr Glu Lys Ile Asn Tyr Lys Leu Leu Pro Gly Pro Asn Lys Met

580 585 590

Leu Pro Lys Val Phe Phe Ser Lys Lys Trp Met Ala Tyr Tyr Asn Pro

595 600 605

Ser Glu Asp Ile Gln Lys Ile Tyr Lys Asn Gly Thr Phe Lys Lys Gly

610 615 620

Asp Met Phe Asn Leu Asn Asp Cys His Lys Leu Ile Asp Phe Phe Lys

625 630 635 640

Asp Ser Ile Ser Arg Tyr Pro Lys Trp Ser Asn Ala Tyr Asp Phe Asn

645 650 655

Phe Ser Glu Thr Glu Lys Tyr Lys Asp Ile Ala Gly Phe Tyr Arg Glu

660 665 670

Val Glu Glu Gln Gly Tyr Lys Val Ser Phe Glu Ser Ala Ser Lys Lys

675 680 685

Glu Val Asp Lys Leu Val Glu Glu Gly Lys Leu Tyr Met Phe Gln Ile

690 695 700

Tyr Asn Lys Asp Phe Ser Asp Lys Ser His Gly Thr Pro Asn Leu His

705 710 715 720

Thr Met Tyr Phe Lys Leu Leu Phe Asp Glu Asn Asn His Gly Gln Ile

725 730 735

Arg Leu Ser Gly Gly Ala Glu Leu Phe Met Arg Arg Ala Ser Leu Lys

740 745 750

Lys Glu Glu Leu Val Val His Pro Ala Asn Ser Pro Ile Ala Asn Lys

755 760 765

Asn Pro Asp Asn Pro Lys Lys Thr Thr Thr Leu Ser Tyr Asp Val Tyr

770 775 780

Lys Asp Lys Arg Phe Ser Glu Asp Gln Tyr Glu Leu His Ile Pro Ile

785 790 795 800

Ala Ile Asn Lys Cys Pro Lys Asn Ile Phe Lys Ile Asn Thr Glu Val

805 810 815

Arg Val Leu Leu Lys His Asp Asp Asn Pro Tyr Val Ile Gly Ile Asp

820 825 830

Arg Gly Glu Arg Asn Leu Leu Tyr Ile Val Val Val Asp Gly Lys Gly

835 840 845

Asn Ile Val Glu Gln Tyr Ser Leu Asn Glu Ile Ile Asn Asn Phe Asn

850 855 860

Gly Ile Arg Ile Lys Thr Asp Tyr His Ser Leu Leu Asp Lys Lys Glu

865 870 875 880

Lys Glu Arg Phe Glu Ala Arg Gln Asn Trp Thr Ser Ile Glu Asn Ile

885 890 895

Lys Glu Leu Lys Ala Gly Tyr Ile Ser Gln Val Val His Lys Ile Cys

900 905 910

Glu Leu Val Glu Lys Tyr Asp Ala Val Ile Ala Leu Glu Asp Leu Asn

915 920 925

Ser Gly Phe Lys Asn Ser Arg Val Lys Val Glu Lys Gln Val Tyr Gln

930 935 940

Lys Phe Glu Lys Met Leu Ile Asp Lys Leu Asn Tyr Met Val Asp Lys

945 950 955 960

Lys Ser Asn Pro Cys Ala Thr Gly Gly Ala Leu Lys Gly Tyr Gln Ile

965 970 975

Thr Asn Lys Phe Glu Ser Phe Lys Ser Met Ser Thr Gln Asn Gly Phe

980 985 990

Ile Phe Tyr Ile Pro Ala Trp Leu Thr Ser Lys Ile Asp Pro Ser Thr

995 1000 1005

Gly Phe Val Asn Leu Leu Lys Thr Lys Tyr Thr Ser Ile Ala Asp Ser

1010 1015 1020

Lys Lys Phe Ile Ser Ser Phe Asp Arg Ile Met Tyr Val Pro Glu Glu

1025 1030 1035 1040

Asp Leu Phe Glu Phe Ala Leu Asp Tyr Lys Asn Phe Ser Arg Thr Asp

1045 1050 1055

Ala Asp Tyr Ile Lys Lys Trp Lys Leu Tyr Ser Tyr Gly Asn Arg Ile

1060 1065 1070

Arg Ile Phe Arg Asn Pro Lys Lys Asn Asn Val Phe Asp Trp Glu Glu

1075 1080 1085

Val Cys Leu Thr Ser Ala Tyr Lys Glu Leu Phe Asn Lys Tyr Gly Ile

1090 1095 1100

Asn Tyr Gln Gln Gly Asp Ile Arg Ala Leu Leu Cys Glu Gln Ser Asp

1105 1110 1115 1120

Lys Ala Phe Tyr Ser Ser Phe Met Ala Leu Met Ser Leu Met Leu Gln

1125 1130 1135

Met Arg Asn Ser Ile Thr Gly Arg Thr Asp Val Asp Phe Leu Ile Ser

1140 1145 1150

Pro Val Lys Asn Ser Asp Gly Ile Phe Tyr Asp Ser Arg Asn Tyr Glu

1155 1160 1165

Ala Gln Glu Asn Ala Ile Leu Pro Lys Asn Ala Asp Ala Asn Gly Ala

1170 1175 1180

Tyr Asn Ile Ala Arg Lys Val Leu Trp Ala Ile Gly Gln Phe Lys Lys

1185 1190 1195 1200

Ala Glu Asp Glu Lys Leu Asp Lys Val Lys Ile Ala Ile Ser Asn Lys

1205 1210 1215

Glu Trp Leu Glu Tyr Ala Gln Thr Ser Val Lys His Lys Arg Pro Ala

1220 1225 1230

Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Gly Ser Pro Lys

1235 1240 1245

Lys Lys Arg Lys Val Ser Ser Leu Glu His His His His His His

1250 1255 1260

<210> 4

<211> 3706

<212> DNA

<213> AAV Delivery donor (AAV Delivery donor)

<400> 4

gatgtaagga gctgctgtga cttgctcaag gccttatatc gagtaaacgg tagtgctggg 60

gcttagacgc aggtgttctg atttatagtt caaaacctct atcaatgaga gagcaatctc 120

ctggtaatgt gatagatttc ccaacttaat gccaacatac cataaacctc ccattctgct 180

aatgcccagc ctaagttggg gagaccactc cagattccaa gatgtacagt ttgctttgct 240

gggccttttt cccatgcctg cctttactct gccagagtta tattgctggg gttttgaaga 300

agatcctatt aaataaaaga ataagcagta ttattaagta gccctgcatt tcaggtttcc 360

ttgagtggca ggccaggcct ggccgtgaac gttcactgaa atcatggcct cttggccaag 420

attgatagct tgtgcctgtc cctgagtccc agtccatcac gagcagctgg tttctaagat 480

gctatttccc gtataaagca tgagaccgtg acttgccagc cccacagagc cccgcccttg 540

tccatcactg gcatctggac tccagcctgg gttggggcaa agagggaaat gagatcatgt 600

cctaaccctg atcctcttgt cccacagata tccagaaccc tgaccctgcc gtaacgccat 660

tttgcaaggc atggaaaaat accaaaccaa gaatagagaa gttcagatca agggcgggta 720

catgaaaata gctaacgttg ggccaaacag gatatctgcg gtgagcagtt tcggccccgg 780

cccggggcca agaacagatg gtcaccgcag tttcggcccc ggcccgaggc caagaacaga 840

tggtccccag atatggccca accctcagca gtttcttaag acccatcaga tgtttccagg 900

ctcccccaag gacctgaaat gaccctgcgc cttatttgaa ttaaccaatc agcctgcttc 960

tcgcttctgt tcgcgcgctt ctgcttcccg agctctataa aagagctcac aacccctcac 1020

tcggcgcgcc agtcctccga cagactgagt cgcccgggtt aattaagcca ccatggccct 1080

gcctgtgacc gcactgctgc tgcccctggc cctgctgctg cacgctgctc gacccgacat 1140

tcagatgact cagacaacaa gctccctgtc cgcctctctg ggcgacagag tgaccatcag 1200

ctgccgggcc tctcaggata tcagcaagta tctgaactgg taccagcaga agcctgacgg 1260

cacagtgaag ctgctgatct atcacacctc cagactgcac tctggagtgc caagcaggtt 1320

cagcggatcc ggatctggca cagactactc cctgaccatc tctaacctgg agcaggagga 1380

tatcgccaca tatttctgtc agcagggcaa tacactgcca tacacctttg gcggcggcac 1440

aaagctggag atcacccggg cagacgcagc accaaccgtg tctatctttc ccccttctag 1500

caacggcgga ggaggatccg gaggaggagg atctggcggc ggcggcagcg aggtgaagct 1560

gcaggagagc ggaccaggcc tggtggcacc cagccagtcc ctgtctgtga catgcaccgt 1620

gtccggcgtg tctctgcctg attacggcgt gtcttggatc aggcagccac caaggaaggg 1680

cctggagtgg ctgggcgtga tctggggcag cgagacaaca tactataata gcgccctgaa 1740

gtccagactg accatcatca aggacaacag caagtcccag gtgttcctga agatgaacag 1800

cctgcagaca gacgataccg ccatctacta ttgcgccaag cactactatt acggcggcag 1860

ctatgccatg gattactggg gccagggcac atccgtgacc gtgtcctcta tcgatgagca 1920

gaagctgatc agcgaggagg atctgaagcc aaccacaacc cctgcaccaa ggcctccaac 1980

accagcacct accatcgcct ctcagcctct gagcctgcgg cccgaggcct gtaggcccgc 2040

agcaggcggc gccgtgcaca cacgcggcct ggacttcgcc tgcgattttt gggtgctggt 2100

ggtggtggga ggcgtgctgg cctgttattc cctgctggtg accgtggcct tcatcatctt 2160

ttgggtgcgc agcaagcgga gccggctgct gcactctgac tacatgaaca tgacaccaag 2220

acggcccgga ccaacccgga agcactatca gccttacgcc ccacctaggg atttcgcagc 2280

atatcggtcc aagagaggca ggaagaagct gctgtacatc ttcaagcagc cctttatgcg 2340

ccctgtgcag acaacccagg aggaggacgg ctgcagctgt cggttcccag aggaggagga 2400

gggaggatgt gagctgcgcg tgaagttttc tcggagcgcc gatgcacctg catatcagca 2460

gggacagaat cagctgtaca acgagctgaa tctgggcagg cgcgaggagt acgacgtgct 2520

ggataagagg agaggccggg accccgagat gggaggcaag cctaggcgca agaacccaca 2580

ggagggcctg tataatgagc tgcagaagga caagatggcc gaggcctaca gcgagatcgg 2640

catgaaggga gagcggagaa ggggcaaggg acacgatggc ctgtatcagg gcctgtccac 2700

agccaccaag gacacctacg atgccctgca catgcaggcc ctgccaccaa ggtaagaatt 2760

ctgcagatat ccagcacagt ggcggccgct cgagtctaga gggcccgttt aaacccgctg 2820

atcagcctcg actgtgcctt ctagttgcca gccatctgtt gtttgcccct cccccgtgcc 2880

ttccttgacc ctggaaggtg ccactcccac tgtcctttcc taataaaatg aggaaattgc 2940

atcgcattgt ctgagtaggt gtcattctat tctggggggt ggggtggggc aggacagcaa 3000

gggggaggat tgggaagaca atagcaggca tgctggggat gcggtgggct ctatggtaaa 3060

tccagtgaca agtctgtctg cctattcacc gattttgatt ctcaaacaaa tgtgtcacaa 3120

agtaaggatt ctgatgtgta tatcacagac aaaactgtgc tagacatgag gtctatggac 3180

ttcaagagca acagtgctgt ggcctggagc aacaaatctg actttgcatg tgcaaacgcc 3240

ttcaacaaca gcattattcc agaagacacc ttcttcccca gcccaggtaa gggcagcttt 3300

ggtgccttcg caggctgttt ccttgcttca ggaatggcca ggttctgccc agagctctgg 3360

tcaatgatgt ctaaaactcc tctgattggt ggtctcggcc ttatccattg ccaccaaaac 3420

cctcttttta ctaagaaaca gtgagccttg ttctggcagt ccagagaatg acacgggaaa 3480

aaagcagatg aagagaaggt ggcaggagag ggcacgtggc ccagcctcag tctctccaac 3540

tgagttcctg cctgcctgcc tttgctcaga ctgtttgccc cttactgctc ttctaggcct 3600

cattctaagc cccttctcca agttgcctct ccttatttct ccctgtctgc caaaaaatct 3660

ttcccagctc actaagtcag tctcacgcag tcactcatta acccac 3706

Claims (10)

1. The chemically modified CRISPR/Cpf1 complex is prepared from Cpf1 family protein and DBCO modified crRNA; wherein the Cpf1 family protein is AsCpf1, the M806 site of the protein is AeF, and the amino acid sequence of the AsCpf1 protein is shown as SEQ ID NO. 1.

2. Use according to claim 1, wherein the cells are stem cells, embryonic cells, somatic cells and/or immune cells.

3. The use according to claim 2, wherein the cells are NIH-3T3 cells, 293T cells, K562 cells, Jurkat cells, T cells, NK cells or Macrophage cells.

4. A method of gene editing of a cell of non-therapeutic interest, comprising: transforming the chemically modified CRISPR/Cpf1 complex of claim 1 into a cell, and culturing to obtain a gene-edited cell; the chemically modified CRISPR/Cpf1 complex is prepared from a Cpf1 family protein and DBCO modified crRNA; wherein the Cpf1 family protein is AsCpf1, the M806 site of the protein is AeF, and the amino acid sequence of the AsCpf1 protein is shown as SEQ ID NO. 1.

5. The method of gene editing according to claim 4, wherein the transformation method is electrical transformation or chemical transformation.

6. The method of gene editing according to claim 4 or 5, wherein said gene editing is further combined with a plasmid vector, lentivirus or adenovirus-mediated gene transformation method.

7. Use of a chemically modified CRISPR/Cpf1 complex in the manufacture of a medicament for the treatment of a disease; the chemically modified CRISPR/Cpf1 complex is prepared from a Cpf1 family protein and DBCO modified crRNA; wherein the Cpf1 family protein is AsCpf1, the M806 site of the protein is AeF, and the amino acid sequence of the AsCpf1 protein is shown as SEQ ID NO. 1.

8. The use according to claim 7, wherein the disease comprises: immune system diseases or tumors.

9. The use of claim 7, wherein the treatment comprises: autologous cell therapy or allogeneic cell therapy.

10. A medicament for the treatment of a disease comprising a chemically modified CRISPR/Cpf1 complex;

the chemically modified CRISPR/Cpf1 complex is prepared from a Cpf1 family protein and DBCO modified crRNA; wherein the Cpf1 family protein is AsCpf1, the M806 site of the protein is AeF, and the amino acid sequence of the AsCpf1 protein is shown as SEQ ID NO. 1.

Images