CN107312092B - Preparation method and application of polyclonal antibody of epinephelus coioides CCR12 - Google Patents

Abstract

A preparation method and application of polyclonal antibody of epinephelus coioides CCR12 are provided. At present, 3 XCR 1-like chemokine receptors, namely XCR1, XCR1L and CCR12, are found in fish, wherein XCR1L and CCR12 are only found in fish genomes, but the function research is very little, so far, no report on the in-vitro expression of fish CCR12 exists, no human CCR12 polyclonal antibody of epinephelus coioides is prepared, and no report on the application of the CCR12 polyclonal antibody exists. In order to further reveal the migration or proliferation condition of the grouper CCR12 positive cells in parasite-infected tissues and identify the CCR12 positive cell types, the research expresses and purifies an N-terminal region and 3 extracellular region recombinant proteins of CCR12 through a prokaryotic system for the first time, and finally prepares a rabbit anti-CCR 12 recombinant protein polyclonal antibody for the first time, wherein the antibody can specifically recognize the grouper CCR12 protein and mark cells in blood, thereby laying a foundation for marking CCR12 positive cells and developing anti-parasite-infection researches of the grouper.

Description

Preparation method and application of polyclonal antibody of epinephelus coioides CCR12

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to a preparation method and application of a polyclonal antibody of epinephelus coioides CCR 12.

Background

Chemokines are a class of very small molecular weight cytokines that share a similar monomeric structure (Baggiolini, 1998; Jin et al, 2005). Depending on their structure and the ordering of the 4 conserved cysteines, chemokines can be classified as: CXC type, CC type, XC type, CX3C type, CX type, and the like 5 types (Murphy, et al, 2000; Nomiyama et al, 2008). Chemokines function by requiring binding to their corresponding receptors. XCL1 is a type XC chemokine produced by thymic medullary epithelial cells, or activated T cells, NK cells, and NKT cells in a homeostatic, pathogenic infection, or inflammatory response (Lei et al, 2012). XCR1 is the only receptor for XCL1, encoded by CD8 α⁺And CD11b^-CD103⁺DC cells were secreted (Alexandre et al, 2013). XCL1-XCR1 axis maintenance of homeostasis, regulatory T cell production, and DC thinningPlay an important role in cell-mediated cytotoxic reactions (Lei et al, 2012). In addition, the XCL1-XCR1 axis is also involved in infections and autoimmune diseases.

Currently, only XCL1, a member of the XC subfamily of chemokines, is identified in the murine genome, but two XCL1 and XCL2 are identified in the human genome (DeVries et al, 2006; Fox et al, 2015). XCL1 is a ubiquitous chemokine in mammals and birds, but XCL2 is only present in some species (Nomiyama et al, 2011). In fish, no XCL1 or XCL2 homologous proteins have been identified so far, but 3 XCR 1-like chemokine receptors, namely XCR1, XCR1L and CCR12 (griholt et al, 2015; Nomiyama et al, 2011), have been found. Of these, XCR1L and CCR12 are found only in the fish genome, but there are few studies on their function, and the absence of anti-XCR 1L or CCR12 antibodies limits the isolation and functional studies of their positive cells. Until now, there has been no report on the expression of fish CCR12 in vitro, let alone the study of CCR12 polyclonal antibodies.

We found that: after the cryptocaryon irritans are stimulated to infect, the expression level of CCR12 of the grouper in skin, gill and spleen is obviously increased, and CCR12 positive cells are supposed to be involved in the parasite infection resisting process of the grouper. In order to further reveal the migration or proliferation condition of the grouper CCR12 positive cells in parasite-infected tissues and identify the CCR12 positive cell types, the research firstly constructs a grouper CCR12 extracellular region expression vector, firstly expresses and purifies an N-terminal region of CCR12 and 3 extracellular region recombinant proteins through a prokaryotic system, and finally firstly prepares a rabbit anti-CCR 12 recombinant protein polyclonal antibody, wherein the antibody can specifically recognize the grouper CCR12 protein and mark cells in blood, thereby laying a foundation for marking CCR12 positive cells and developing the research on the anti-parasite infection of the grouper.

Disclosure of Invention

Until now, no human has prepared CCR12 polyclonal antibody of Epinephelus coioides, there is no report about the application of CCR12 polyclonal antibody, but the invention successfully expresses and purifies the CCR12 of Epinephelus coioides for the first time through the genetic engineering method, and prepares rabbit anti-CCR 12 recombinant protein polyclonal antibody for the first time, and has carried on some research to its preliminary application at the same time.

The invention aims to provide a preparation method and application of a polyclonal antibody of epinephelus coioides CCR12, and the preparation method comprises the following specific steps:

the clone and sequence analysis of rockfish CCR12 gene:

1. extraction of total RNA in spleen of grouper

(1) Quickly taking out the frozen spleen from liquid nitrogen, grinding the spleen by using the liquid nitrogen, adding 3ml of TRIzol Reagent after the spleen is fully ground, sucking the spleen into an EP (ethylene propylene) tube with the volume of 1ml to 1.5ml when the spleen is quickly melted, and placing the spleen on ice;

(2) adding 20% chloroform (0.2 ml chloroform in 1ml TRIzol Reagent) into each tube, shaking vigorously for 15s, and standing on ice for 3min to observe layering;

(3) centrifuging at 12000g for 15min at 4 deg.C, separating the liquid in the tube into three layers, sequentially from top to bottom, including water layer, protein layer, and organic layer, and collecting the supernatant to a new 1.5ml EP tube;

(4) add 0.5ml isopropanol to the tube, invert the EP tube gently, stand on ice for 10 min;

(5) centrifugation at 12000g for 10min at 4 ℃ and discarding the supernatant (without continuous inversion);

(6) adding 1ml of 75% ethanol (prepared by DEPC water) into each tube, and slightly blowing up the precipitate by using a gun head;

(7) centrifuging at 4 deg.C for 5min at 7500g, and removing supernatant;

(8) repeating the steps (6) and (7) once;

(9) dissolving RNA with 15 μ l RNase-free water;

(10) the integrity of RNA was checked by 2% agarose gel electrophoresis, the concentration of RNA was determined by a nucleic acid concentration meter, its purity was shown by A260/A280, and the remaining sample was left at-70 ℃ until use.

2. Synthesis of Single Strand cDNA

Genomic DNA contamination was removed and reverse transcribed to single-stranded cDNA. The components were added according to table 1 below, mixed gently and centrifuged briefly;

TABLE 1 formula for decontamination of genomic DNA

(1) Incubating the PCR instrument at 37 ℃ for 30min to remove genomic DNA contamination;

(2) adding 1 μ l of 50mM EDTA, incubating at 65 ℃ for 10min to inactivate DNase I;

(3) add 1. mu.l oligo (dT) per microgram of total RNA₂₀(10 pmol/mu l), after incubation for 5min at 65 ℃, immediately placing on ice to eliminate the secondary structure of RNA and improve the efficiency of reverse rotation rate;

(4) a reverse transcription reaction system was prepared according to the following Table 2, and the reaction procedure was as follows: 42 deg.C, 30min, 99 deg.C, 5min, 4 deg.C, 5 min. The product is at-20 ℃ for later use.

TABLE 2 formulation for reverse transcription into cDNA

3. Amplification of CCR12 sequence

According to grouper transcriptome information, contig encoding CCR12 was placed on NCBI to search for ORF region, sequence alignment was performed, primers (Table 3) were designed outside the ORF region, and the spleen cDNA obtained in the above step was used as template to amplify the ORF region of the target gene by PCR.

TABLE 3 Gene cloning primers

The formulation of the PCR amplification reaction solution is shown in Table 4 below. The PCR reaction conditions are as follows: at 98 deg.C for 1min, (98 deg.C, 10s, 55 deg.C, 15s, 72 deg.C, 1min) for 35 cycles, and finally at 72 deg.C for 10 min. The PCR product was detected by electrophoresis on a 1.5% agarose gel.

TABLE 4 PCR amplification System recipe

4. Gel recovery of target fragments

The recovery and purification of the PCR product of the target fragment are carried out according to the following steps:

(1) irradiating under an ultraviolet lamp, cutting off a target strip as soon as possible, and placing the cut strip in a new weighed 1.5ml EP tube;

(2) weigh the EP tube and calculate the mass and volume of the gel (the volume of the gel is calculated as 1 ml/g);

(3) adding Binding Buffer (XP2) according to the volume of 1 time of the gel volume, placing in a water bath kettle at 60 ℃ for incubation until the gel is completely dissolved, and gently mixing the gel dissolving solution at an interval of 2-3 min;

(4) mixing the components in the kit

The DNA Mini Column is matched and placed with 2ml Collection Tube;

(5) transferring the dissolved solution in the step (3) to Mini Column, and centrifuging for 1min at room temperature of 10000 g;

(6) removing the effluent and repeating (5) until all the gel-dissolved solution is centrifugally filtered through a filter membrane at the bottom of the Mini Column;

(7) adding 300 μ l Binding Buffer (XP2) into Mini Column, centrifuging at room temperature of 13000g for 1min, and removing effluent;

(8) adding 700 μ l of SPW Wash Buffer into Mini Column, centrifuging at room temperature of 13000g for 1min, and removing effluent;

(9) repeating the step (8) once;

(10) centrifuging at 13000g for 2min at room temperature to dehydrate the empty Mini Column filter membrane as much as possible;

(11) placing Mini Column in a new 1.5ml EP tube, adding 15-30 μ l of precipitation Buffer in the center of the filter membrane, standing at room temperature for 1min, centrifuging at room temperature 13000g for 1min to elute DNA;

(12) the above 1.5ml EP tube was stored at-20 ℃.

5. Cloning and transformation of fragments of interest

Sample loading was performed according to the system of table 5:

TABLE 5 blunt-ended Carrier ligation kit formulations

(1) Connecting at 25 deg.C for 30 min;

(2) the ligation product was added to 50. mu.l DH 5. alpha. competent (clonal) bacteria and ice-cooled for 30 min;

(3) performing water bath heat shock at 42 ℃ for 90s, and performing ice bath for 2 min;

(4) adding 1ml of fresh LB culture solution, and performing shaking culture at 37 ℃ and 200r/min for 90 min;

(5) centrifuging at 4000g for 5min, removing 800 μ l of supernatant, blowing and suspending the bacterial liquid again, taking 100 μ l of bacterial liquid, coating the bacterial liquid on an LB solid culture medium containing benzyl amine, and culturing overnight at 37 ℃;

(6) selecting a single clone as a template in 10 mul LB culture solution, and detecting the size of the inserted fragment through colony PCR;

(7) positive clones with consistent fragment size were inoculated into 5ml of LB liquid medium containing ampicillin, incubated overnight at 37 ℃ and 1ml aspirated for sequencing.

6. Sequence analysis

Signal peptides of the sequence and domains of the protein were predicted using the Smart program (http:// Smart. embl-heidelberg. de /), the transmembrane domains of the receptor were predicted using TMHMM Server v.2.0 (http:// www.cbs.dtu.dk/services/TMH-MM /), the alignment of the cloned gene and the corresponding amino acid sequences of the other species was performed using BioEdit and Clustal Omega (http:// www.ebi.ac.uk/Tools/msa/cluster-alo /), and the phylogenetic tree was performed using MEGA 5.04(Beta 2) software.

By the method, the ORF sequence of the epinephelus coioides CCR12 is cloned, the full length is 1074bp, 357 amino acid polypeptides are coded, and the theoretical isoelectric point and the molecular weight are respectively 8.87 and 41 Da. SMART sequence analysis showed: grouper CCR12 was composed of 1N-terminal region, 3 extracellular regions, 3 intracellular regions and 1C-terminal region, and the results can be seen in fig. 1: wherein the wavy lines represent the N-and C-terminal sequences, respectively, the thin underlines represent the transmembrane regions, respectively, and the thick underlines represent the extracellular and intracellular regions. Multiple sequence alignments show: grouper CCR12 resembled daniorio and oryziasilateles at 62% and 73%, respectively, and resembled other CCR12 and xenoprosticalis at 47% -48%. Evolution analysis shows that: grouper CCR12 is grouped together with other fish CCR12 (see FIG. 2), and is consistent with the results of sequence alignment.

(II) prokaryotic expression and purification of rockfish CCR 12:

1. construction of recombinant expression vector for CCR12

(1) Amplification of a fragment of interest

a. According to the analysis of SMART software, the grouper CCR12 is a seven-transmembrane protein and is composed of an N-terminal region, 3 extracellular regions, 3 intracellular regions and a C-terminal region; the present study expressed the N-terminal region and 3 extracellular regions of rockfish CCR 12;

b. CCR12NF/R, CCR12EL1F/R, CCR12EL2F/R and CCR12EL3F/R are used as primers, the previously synthesized cDNA is used as a template, and high fidelity enzyme PrimeSTAR is used^TMMix amplified the N-terminal region and 3 extracellular regions of CCR12, respectively;

c. and c, taking CCR12NF/EL1R as a primer, taking the CCR 12N-terminal region amplified in the step b and the 1 st extracellular region as a template, and connecting the N-terminal region and the 1 st extracellular region through recombinant PCR; meanwhile, the 2 nd and 3 rd extracellular regions are connected by recombination PCR by taking CCR12EL2F/EL3R as primers and the 2 nd and 3 rd extracellular regions of CCR12 amplified in the step b as templates;

d. finally, the N-terminal region and 3 extracellular regions of CCR12 are connected together by recombinant PCR by using CCR12NF/EL3R as primers and two fusion fragments successfully connected in the step c as templates, and the target fragment is recovered by gel. The primers used are detailed in Table 6, the restriction sites being indicated by the underlined sections.

TABLE 6 primer for CCR12 amplification

(2) Extraction of expression vectors

Recovering the strain transformed with pET32a expression vector, selecting monoclonal amplification culture, and extracting plasmid, and its concrete steps are as follows:

a. centrifuging at room temperature of 1000g for 1min to collect bacterial liquid;

b. adding 250 mu l of Solution I into the thallus sediment, and blowing and beating the resuspended thallus by a gun head;

c. adding 250 μ l of solutionII, and slightly inverting and mixing for several times until the bacterial suspension becomes clear;

d. adding 350 μ l of solutionIII, and slightly inverting and mixing for several times until white flocculent precipitate appears;

e. centrifuging at room temperature 1000g for 10 min;

f. carefully pipette off the supernatant as much as possible on a new Hibind DNA binding column;

g. centrifuging at room temperature of 10000g for 1min, and removing effluent;

h. adding 500 μ l Buffer HB into the column, centrifuging at room temperature 10000g for 1min, and removing the effluent;

i. adding 700 μ l of Wash Buffer into the column, centrifuging at room temperature of 10000g for 1min, and removing effluent;

j. repeating step i) once;

k. centrifuging at 13000g for 2min at room temperature to dehydrate the empty Mini Column filter membrane as much as possible;

l, placing the Hibind DNA binding column in a new 1.5ml EP tube, adding 15-30 μ l of precipitation Buffer in the center of the filter membrane, standing at room temperature for 1min, and centrifuging at 13000g at room temperature for 1min to elute DNA;

m. the above 1.5ml EP tube was stored at-20 ℃.

(3) Double enzyme digestion target fragment and expression vector

a. Adding the target fragments recovered from the glue in the step (1) and the expression vector extracted in the step (2) according to a system in a table 7;

b. mixing, centrifuging instantaneously, and enzyme cutting at 37 deg.C for 0.5 h;

c. recovering the target fragment and the expression vector after enzyme digestion by using glue;

TABLE 7 Quick Cut cleavage System

(4) Construction of recombinant expression vectors

a. Adding samples of the target fragments and the expression vectors recovered after double enzyme digestion in the step (3) according to a system in a table 8;

b.16 ℃ overnight;

c. transforming the ligation product into a competent cell of an expression bacterium BL 21;

d. positive clones were identified by colony PCR and sequenced.

TABLE 8 ligation System of recombinant expression vectors

The N-terminal region and 3 extracellular segments of the chemokine receptor CCR12 are spliced by using the designed primers through recombinant PCR, and are connected to a pET32a prokaryotic expression vector after glue recovery and double enzyme digestion. After BL21 transformation, 1 positive clone was picked and sequenced, and the sequence of this positive clone was completely correct. The results are shown in FIG. 3, where lane 1 is a clone of the ORF region of CCR12, 2, 3, 4, 5 are clones of the extracellular N-terminus of CCR12, EL1, EL2, EL3 segments, respectively, lane 6 is the extracellular N-terminus of CCR12 and EL1 recombinant PCR results, lane 7 is the EL2 and EL3 recombinant PCR results of CCR12, and lane 8 is the product recombinant PCR results of lanes 6 and 7.

2. Optimization and solubility analysis of CCR12 recombinant protein expression conditions

(1) Inducible expression of CCR12 recombinant proteins

a. Inoculating the recombinant protein expression strain with correct sequencing in the previous step into a new LB liquid culture solution containing Amp, and carrying out shaking culture at 37 ℃ and 200r/min for overnight;

b. inoculating overnight-cultured bacterial liquid into fresh LB culture solution according to the proportion of 1: 50, and performing shaking culture at 37 ℃ and 200r/min until OD600 is 0.6-0.8;

c. adding IPTG to the final concentration of 1mM, and performing shaking culture at 30 ℃ and 200r/min for 6 h;

d. taking 1ml of bacterial liquid, centrifuging at the room temperature of 4000r/min for 5min, and removing supernatant;

e. resuspending with 100 μ l double distilled water, mixing with 5 xSDS-PAGE Loading Buffer at a ratio of 1: 4, and boiling in water bath for 5 min;

f. carrying out SDS-PAGE gel electrophoresis on the samples to detect whether the recombinant protein CCR12 is expressed, and taking an induction group of an expression strain of pET32a as a control;

(2) optimization of recombinant protein expression conditions

Concentration of iptg: inducing the expression bacteria for 6h by IPTG with final concentration of 0.1mM, 0.3mM, 0.5mM, 0.7mM and 0.9mM respectively, collecting thalli, loading and running electrophoresis after treatment;

b. time of induction: under the condition of the optimal induction concentration, thalli are collected at 0h, 2h, 4h and 6h after induction, and the thalli are subjected to sample loading and electrophoresis after treatment.

The positive clone is expanded and cultured at 37 ℃ until the OD600 of the bacterial liquid reaches 0.6-0.8, 0mM, 0.1mM, 0.3mM, 0.5mM, 0.7mM and 0.9mM of IPTG are added to induce and express for 6h at 30 ℃, and the thalli are collected, and SDS-PAGE electrophoretic analysis shows that the optimal induction concentration of the recombinant protein CCR12 is 0.5 mM. The time of induction was optimized on this basis. As can be seen from FIG. 4, the expression level of the recombinant protein CCR12 had reached its maximum at the induction time of 4 h. Therefore, the conditions for inducing expression in large amounts were 30 ℃ and 0.5mM for 4 hours.

In FIG. 4, C is the relationship between the expression level of the recombinant protein and the IPTG induction concentration, and C is the relationship between the expression level of the protein and the change of the IPTG induction concentration with time. Lanes M represent protein Marker, lanes 1-6 in C represent the expression of recombinant protein induced at 30 ℃ for 6h with IPTG at 0mM, 0.1mM, 0.3mM, 0.5mM, 0.7mM and 0.9mM, respectively. Lanes 1-4 in c show the expression of recombinant protein at optimal IPTG induction concentrations for 0h, 2h, 4h and 6h, respectively, and the target protein bands are indicated by black arrows.

(3) Recombinant protein solubility assay

a. Inducing the expression of the recombinant protein by using the optimized conditions in the step (2), and centrifugally collecting thalli;

b. adding PBS according to the proportion of 50: 1 of the original bacterial liquid, resuspending the bacterial liquid, centrifuging the bacterial liquid for 3min at 4 ℃ and 10000g, and removing supernatant;

c. adding an equal amount of lysine buffer to resuspend the thallus, and carrying out ultrasonic disruption (the ultrasonic disruption condition is 200W, 5s of ultrasound, 8s of interval, 15min of ultrasound, and 3 cycles);

d. centrifuging at 4 deg.C and 8000g for 15min after the ultrasound treatment is finished, and collecting supernatant and precipitate respectively;

e. after processing, SDS-PAGE detects the solubility of the recombinant protein.

Final SDS-PAGE analysis indicated that CCR12 was present in soluble form in the supernatant, see fig. 5, where lane M represents protein Marker. 1. Lanes 2 and 3 show the whole cell suspension, supernatant and pellet, respectively.

3. Purification of CCR12 recombinant proteins

(1) The BL21 strain containing the recombinant expression vector is enlarged and cultured to 1000ml, and the strain is shake-cultured at 37 ℃ and 200r/min to OD₆₀₀0.6-0.8, adding IPTG to the optimal final concentration optimized in the step 2, and culturing at 30 ℃ for a proper time of 200 r/min;

(2) centrifuging at 4 deg.C for 1min at 1000g, and collecting all thallus;

(3)50ml of 0.01mM PBS for resuspending the thallus, centrifuging at 4 ℃ for 10min at 1000g, and removing the supernatant;

(4)50ml Lysis buffer heavy suspension thallus, ultrasonic crushing, 4 ℃, 1000g centrifugation for 10min and supernatant collection;

(5) washing the nickel column by a Wash buffer and an Elution buffer containing imidazole with different concentrations in sequence, collecting effluent liquid, and detecting the Elution effect by SDS-PAGE;

(6) and dialyzing the purified protein solution in PBS overnight, concentrating by using an ultrafiltration centrifugal tube, and storing the concentrated solution at the temperature of-80 ℃.

After the final recombinant protein is purified by a nickel column, a relatively pure single target band is obtained, see fig. 5, wherein a lane M represents a protein Marker, a lane 4 is a purified sample obtained by affinity chromatography, and the target protein band is marked by a black arrow.

(III) preparation and application of polyclonal antibody of epinephelus coioides CCR 12:

1. preparation of CCR12 polyclonal antibody:

(1) two male New Zealand rabbits purchased from the Experimental animals center of Guangdong province were acclimatized in a sterile animal room for 2 weeks;

(2) taking about 2mg of recombinant protein, adding PBS to 2ml, adding 2ml Freund's complete adjuvant, and repeatedly pushing and pulling a conjugated syringe to emulsify the recombinant protein;

(3) sucking the recombinant protein emulsified with Freund's complete adjuvant by using a sterile syringe, and carrying out subcutaneous injection on the New Zealand male rabbits at multiple sites (the injection sites need to be sterilized by 75% alcohol cotton at first), wherein the injection dose is 1 ml/mouse;

(4) after two weeks, performing boosting immunization, emulsifying and uniformly mixing half of recombinant protein of the initial immunization with equivalent Freund incomplete adjuvant, and performing subcutaneous injection on the New Zealand male rabbits for 3 times, wherein the interval time of each time is 2 weeks;

(5) after 7 days of the last booster immunization, carotid blood sampling is carried out on the immunized New Zealand male rabbits, the rabbits are stood for 2 hours at room temperature, kept overnight at 4 ℃, centrifuged at 4000r/min for 30min, then supernatant serum is carefully sucked, treated at 56 ℃ for 30min to inactivate complement, purified by a protein A column, and stored at-20 ℃ after subpackaging (blood sampling before first immunization is taken as negative control).

2. And (3) measuring the titer of the multiple antibodies by ELISA:

(1) diluting the purified protein antigen to 20 mug/ml by using a coating solution, adding 100 mug/ml into each hole of a 96-hole enzyme label plate, and coating at 4 ℃ overnight;

(2) patting the liquid in the holes, adding 200 μ l of washing solution, shaking and washing for 3 times, each time for 3min, discarding, and patting to dry;

(3) adding 200 mul of sealing liquid into each hole, and sealing for 1h at room temperature;

(4) discarding the blocking solution in the hole, patting to dry, adding 200 μ l of washing solution, washing for 3 times with shaking for 3min each time, discarding, patting to dry;

(5) carrying out continuous gradient dilution on the polyclonal antibody and PBS according to the ratio of 1: 10, adding 100 mu l of the polyclonal antibody into each hole, setting 3 parallel wells, taking the PBS as a negative control group, and incubating for 2h at 37 ℃;

(6) discarding the primary antibody in the hole, patting to dry, adding 200 μ l of washing solution, washing for 3 times with shaking for 3min each time, discarding, patting to dry;

(7) adding 100 mul of diluted secondary antibody into each hole, keeping out of the light, and incubating for 2h at 37 ℃;

(8) discarding the secondary antibody in the hole, patting dry, adding 200 μ l of washing solution, shaking and washing for 3 times, each time for 3min, discarding, patting dry;

(9) preparing fresh substrate solution, adding 100 μ l of fresh substrate solution into each well, keeping out of the sun, and incubating at 37 ℃ for 20 min;

(10) adding 50 mul of stop solution into each hole, and detecting the absorbance value of each hole at the wavelength of 450nm by using a microplate reader, wherein the standard is that P/N is more than or equal to 2.1 or P is more than or equal to N + 3D.

Finally, ELISA detection shows that the titer of the polyclonal antibody is 1: 100000, and the titer is high, so that the requirements of subsequent immunohistochemical experiments can be met.

3. Western blotting detection of the specificity of the polyclonal antibody:

a: in order to detect whether the prepared polyclonal antibody can identify natural protein, total protein and membrane protein of the Epinephelus coioides head and kidney are respectively extracted to carry out western blotting experiment. The method comprises the following specific steps of anesthetizing the grouper by using eugenol, quickly placing head and kidney tissues of the grouper into a new 1.5ml EP tube, and storing the head and kidney tissues in liquid nitrogen for subsequent total protein and membrane protein extraction.

(1) Extraction of total tissue protein:

a) fully grinding the tissues in a liquid nitrogen environment until the tissues become uniform pulp;

b) adding tissue lysate into the fully ground tissue, and carrying out ice bath for 30min (adding PMSF to a final concentration of 1mM before lysate experiment);

c) carrying out ultrasonic crushing on the cracked sample by using an ultrasonic crusher (the program is ultrasonic crushing 5, the interval is 10s, and 2 times);

d) centrifuging at 14000r/min for 15min at 4 deg.C, carefully sucking the supernatant, and storing at-80 deg.C.

(2) Tissue membrane protein extraction

a) Adding 10mM Tris-HCl to the sample to cover the sample;

b) adding equal volume of precooled Triton X-114 extraction buffer (the buffer needs to be mixed uniformly before use), and adding PMSF protease inhibitor until the final concentration is 1 mM;

c) shaking the sample with vortex oscillator for 1min, ice-bathing for 5min, and repeating for 10 times;

d) centrifuging at 4 ℃ at 12000r/min for 15min, and carefully sucking the supernatant;

e) adding sucrose buffer solution with the same volume into the supernatant, and carrying out water bath at 30 ℃ for 5min until cloudiness is generated;

f) centrifuging at 12000r/min at room temperature for 3min to demix, and storing oil layer on ice;

g) adding 9 times volume of precooled acetone into the oil layer, and incubating on ice for 1h and overnight at-20 ℃;

h) removing acetone, dissolving the precipitated protein with Tris-HCl, and storing at-80 deg.C.

B: specific detection of polyclonal antibodies:

(1) after SDS-PAGE electrophoresis of the antigen protein, cutting the gel into a proper size according to a sample application lane and soaking the gel in a membrane transfer buffer solution;

(2) cutting the PVDF membrane into a size matched with the gel, and soaking in a membrane conversion buffer solution;

(3) fixing the gel and PVDF membrane in the order of blackboard (negative electrode), foam pad, filter paper, gel, PVDF membrane, filter paper, foam pad, white board (positive electrode) (note to exclude air bubbles);

(4) putting the device into a transfer printing groove, adding a film transfer buffer solution, and carrying out film transfer for 23min at 100V;

(5) after the film transfer is finished, taking down the PVDF film, adding 10% skimmed milk powder, and sealing at room temperature for 1 h;

(6) adding the appropriate primary antibody (i.e., the prepared CCR12 polyclonal antibody), and incubating overnight at 4 ℃;

(7) discarding the primary antibody, washing with PBST for 3 times, each time for 5 min;

(8) adding a secondary antibody diluted by 10% skimmed milk powder, and incubating at room temperature for 1 h;

(9) discarding the secondary antibody, washing with PBST for 3 times, each time for 5 min;

(10) the display photograph was taken by chemiluminescence.

The specificity of the polyclonal antibody of CCR12 was examined by western blotting, and the result is shown in FIG. 6, and the polyclonal antibody specifically recognizes the recombinant protein and also recognizes the natural protein (about 41 kDa). Wherein, lane M shows Marker, lanes 1, 2 and 3 show SDS-PAGE results of the recombinant protein purified sample of chemokine receptor CCR12, the head kidney tissue holoprotein and the head kidney membrane protein, respectively, lanes a, b and c show the results of western blotting using the prepared polyclonal antibody for the samples of lanes 1, 2 and 3, respectively, and arrows mark the natural protein and the recombinant protein recognized by the polyclonal antibody, respectively.

4. Preliminary application of polyclonal antibody (immunohistochemistry of Epinephelus coioides peripheral blood cells):

(1) anaesthetizing Epinephelus coioides with appropriate dose of eugenol (50mg/ml), and collecting blood from tail vein with syringe treated with heparin sodium;

(2) taking a clean glass slide, and dropwise adding a drop of anticoagulation blood;

(3) using another clean glass slide, making one end contact with the blood drop on the glass slide, making the two glass slides form an angle of 45 degrees, slightly moving to make the blood drop in a straight line, and moving from one end of the glass slide to the other end to form a uniform thin layer;

(4) after drying the blood smear in the air, immediately fixing the blood smear with 4% paraformaldehyde at room temperature for 15 min;

(5) washing with PBS for 3 times, each for 3 min;

(6) treating with 0.5% Triton X-100 for 20 min;

(7) washing with PBS for 3 times, each for 3 min;

(8) with 3% H₂O₂Sealing at room temperature for 15 min;

(9) washing with PBS for 3 times, each for 3 min;

(10) putting the slide into a citric acid buffer solution, performing antigen restoration in a microwave oven for 15min, and cooling at room temperature;

(11) washing with PBS for 3 times, each for 3 min;

(12) sealing with normal goat serum at room temperature for 30 min;

(13) spin-drying goat serum on the slide, dripping primary antibody (namely the prepared CCR12 polyclonal antibody), placing in a wet box, and incubating overnight at 4 ℃;

(14) taking out the wet box, and rewarming at 37 ℃ for 40 min;

(15) washing with PBS for 3 times, each for 3 min;

(16) adding secondary antibody dropwise, and incubating at 37 deg.C for 40 min;

(17) washing with PBS for 3 times, each for 3 min;

(18) coloring DAB for 1min, and washing with distilled water for 5 min;

(19) counterstaining with hematoxylin at 37 deg.C for 15min, and washing with tap water for 5 min;

(20) acidifying with 1% hydrochloric acid for 5s, and washing with tap water for 5 min;

(21) dehydrating 75%, 80%, 90%, 95%, 100% ethanol for 3 min;

(22) 1/2100% ethanol and 1/2100% xylene for 3 min;

(23) xylene I, II was clear for 5 min;

(24) the gel was mounted on a neutral resin and observed by photographing under a microscope after being overnight at 37 ℃.

The prepared polyclonal antibody of the chemokine receptor CCR12 can mark positive cells of blood smears through immunohistochemistry, and the result is shown in FIG. 7, wherein the CCR12 positive cells have the diameter of about 9 μm and have different karyotypes including kidney shapes and round shapes. A, B shows different karyotypes of CCR12 positive cells, A is kidney shaped and B is round.

Drawings

FIG. 1 is a nucleotide and protein sequence of rockfish CCR 12.

FIG. 2 is a graph of the evolutionary tree analysis of CCR12 in Epinephelus.

FIG. 3 is a diagram showing the construction results of a recombinant expression vector for CCR 12.

FIG. 4 is a schematic diagram of optimization of the expression conditions of recombinant CCR12 protein.

FIG. 5 is a graph of the results of solubility analysis and purification of CCR12 recombinant protein.

FIG. 6 shows the result of specific detection of the polyclonal antibody to CCR 12.

FIG. 7 is the immunohistochemical results for blood smear CCR12 positive cells.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. The examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

A preparation method and application of a polyclonal antibody of epinephelus coioides CCR12 comprise the following steps:

the clone and sequence analysis of rockfish CCR12 gene:

1. extraction of total RNA in spleen of grouper

(1) Quickly taking out the frozen spleen from liquid nitrogen, grinding the spleen by using the liquid nitrogen, adding 3ml of TRIzol Reagent after the spleen is fully ground, sucking the spleen into an EP (ethylene propylene) tube with the volume of 1ml to 1.5ml when the spleen is quickly melted, and placing the spleen on ice;

(2) adding 20% chloroform (0.2 ml chloroform in 1ml TRIzol Reagent) into each tube, shaking vigorously for 15s, and standing on ice for 3min to observe layering;

(3) centrifuging at 12000g for 15min at 4 deg.C, separating the liquid in the tube into three layers, sequentially from top to bottom, including water layer, protein layer, and organic layer, and collecting the supernatant to a new 1.5ml EP tube;

(4) add 0.5ml isopropanol to the tube, invert the EP tube gently, stand on ice for 10 min;

(5) centrifugation at 12000g for 10min at 4 ℃ and discarding the supernatant (without continuous inversion);

(6) adding 1ml of 75% ethanol (prepared by DEPC water) into each tube, and slightly blowing up the precipitate by using a gun head;

(7) centrifuging at 4 deg.C for 5min at 7500g, and removing supernatant;

(8) repeating the steps (6) and (7) once;

(9) dissolving RNA with 15 μ l RNase-free water;

(10) the integrity of RNA was checked by 2% agarose gel electrophoresis, the concentration of RNA was determined by a nucleic acid concentration meter, its purity was shown by A260/A280, and the remaining sample was left at-70 ℃ until use.

2. Synthesis of Single Strand cDNA

Genomic DNA contamination was removed and reverse transcribed to single-stranded cDNA. The components were added according to table 1 below, mixed gently and centrifuged briefly;

TABLE 1 formula for decontamination of genomic DNA

(1) Incubating the PCR instrument at 37 ℃ for 30min to remove genomic DNA contamination;

(2) adding 1 μ l of 50mM EDTA, incubating at 65 ℃ for 10min to inactivate DNase I;

(3) add 1. mu.l oligo (dT) per microgram of total RNA₂₀(10 pmol/mu l), after incubation for 5min at 65 ℃, immediately placing on ice to eliminate the secondary structure of RNA and improve the efficiency of reverse rotation rate;

(4) a reverse transcription reaction system was prepared according to the following Table 2, and the reaction procedure was as follows: 42 deg.C, 30min, 99 deg.C, 5min, 4 deg.C, 5 min. The product is at-20 ℃ for later use.

TABLE 2 formulation for reverse transcription into cDNA

3. Amplification of CCR12 sequence

According to the grouper transcriptome information, each contig is put on NCBI to search ORF region, and sequence comparison is carried out, primers (table 3) are designed outside the ORF region, and the tissue cDNA obtained in the above step is used as a template to amplify the ORF region of the target gene by PCR.

TABLE 3 Gene cloning primers

The formulation of the PCR amplification reaction solution is shown in Table 4 below. The PCR reaction conditions are as follows: at 98 deg.C for 1min, (98 deg.C, 10s, 55 deg.C, 15s, 72 deg.C, 1min) for 35 cycles, and finally at 72 deg.C for 10 min. The PCR product was detected by electrophoresis on a 1.5% agarose gel.

TABLE 4 PCR amplification System recipe

4. Gel recovery of target fragments

The recovery and purification of the PCR product of the target fragment are carried out according to the following steps:

(1) irradiating under an ultraviolet lamp, cutting off a target strip as soon as possible, and placing the cut strip in a new weighed 1.5ml EP tube;

(2) weigh the EP tube and calculate the mass and volume of the gel (the volume of the gel is calculated as 1 ml/g);

(3) adding Binding Buffer (XP2) according to the volume of 1 time of the gel volume, placing in a water bath kettle at 60 ℃ for incubation until the gel is completely dissolved, and gently mixing the gel dissolving solution at an interval of 2-3 min;

(4) mixing the components in the kit

The DNA Mini Column is matched and placed with 2ml Collection Tube;

(5) transferring the dissolved solution in the step (3) to Mini Column, and centrifuging for 1min at room temperature of 10000 g;

(6) removing the effluent and repeating (5) until all the gel-dissolved solution is centrifugally filtered through a filter membrane at the bottom of the Mini Column;

(7) adding 300 μ l Binding Buffer (XP2) into Mini Column, centrifuging at room temperature of 13000g for 1min, and removing effluent;

(8) adding 700 μ l of SPW Wash Buffer into Mini Column, centrifuging at room temperature of 13000g for 1min, and removing effluent;

(9) repeating the step (8) once;

(10) centrifuging at 13000g for 2min at room temperature to dehydrate the empty Mini Column filter membrane as much as possible;

(11) placing Mini Column in a new 1.5ml EP tube, adding 15-30 μ l of precipitation Buffer in the center of the filter membrane, standing at room temperature for 1min, centrifuging at room temperature 13000g for 1min to elute DNA;

(12) the above 1.5ml EP tube was stored at-20 ℃.

5. Cloning and transformation of fragments of interest

The operation was performed as in table 5:

TABLE 5 blunt-ended Carrier ligation kit formulations

(1) Connecting at 25 deg.C for 30 min;

(2) the ligation product was added to 50. mu.l DH 5. alpha. competent (clonal) bacteria and ice-cooled for 30 min;

(3) performing water bath heat shock at 42 ℃ for 90s, and performing ice bath for 2 min;

(4) adding 1ml of fresh LB culture solution, and performing shaking culture at 37 ℃ and 200r/min for 90 min;

(5) centrifuging at 4000g for 5min, removing 800 μ l of supernatant, blowing and suspending the bacterial liquid again, taking 100 μ l of bacterial liquid, coating the bacterial liquid on an LB solid culture medium containing benzyl amine, and culturing overnight at 37 ℃;

(6) selecting a single clone as a template in 10 mul LB culture solution, and detecting the size of the inserted fragment through colony PCR;

(7) positive clones with consistent fragment size were inoculated into 5ml of LB liquid medium containing ampicillin, incubated overnight at 37 ℃ and 1ml aspirated for sequencing.

6. Sequence analysis

Signal peptides of the sequence and domains of the proteins were predicted using the Smart program (http:// Smart. embl-heidelberg. de /), transmembrane domains of the receptors were predicted using TMHMM Server v.2.0 (http:// www.cbs.dtu.dk/services/TMH-MM /), alignment of the cloned corresponding amino acid sequences of the respective genes and other species was performed using BioEdit and Clustal Omega (http:// www.ebi.ac.uk/Tools/msa/cluster-alo /), and phylogenetic trees were performed using MEGA 5.04(Beta 2) software.

By the method, the ORF sequence of the epinephelus coioides CCR12 is cloned, the full length is 1074bp, 357 amino acid polypeptides are coded, and the theoretical isoelectric point and the molecular weight are respectively 8.87 and 41 Da. SMART sequence analysis showed: grouper CCR12 was composed of 1N-terminal region, 3 extracellular regions, 3 intracellular regions and 1C-terminal region, and the results can be seen in fig. 1: wherein the wavy lines represent the N-and C-terminal sequences, respectively, the thin underlines represent the transmembrane regions, respectively, and the thick underlines represent the extracellular and intracellular regions. Multiple sequence alignments show: grouper CCR12 resembled daniorio and oryziasilateles at 62% and 73%, respectively, and resembled other CCR12 and xenoprosticalis at 47% -48%. Evolution analysis shows that: grouper CCR12 is grouped together with other fish CCR12 (see FIG. 2), and is consistent with the results of sequence alignment.

(II) prokaryotic expression and purification of rockfish CCR 12:

1. construction of recombinant expression vector for CCR12

(1) Amplification of a fragment of interest

a. According to the analysis of SMART software, the grouper CCR12 is a seven-transmembrane protein and is composed of an N-terminal region, 3 extracellular regions, 3 intracellular regions and a C-terminal region; the present study expressed the N-terminal region and 3 extracellular regions of rockfish CCR 12;

b. CCR12NF/R, CCR12EL1F/R, CCR12EL2F/R and CCR12EL3F/R are used as primers, the previously synthesized cDNA is used as a template, and high fidelity enzyme PrimeSTAR is used^TMMix amplified the N-terminal region and 3 extracellular regions of CCR12, respectively;

c. and c, taking CCR12NF/EL1R as a primer, taking the CCR 12N-terminal region amplified in the step b and the 1 st extracellular region as a template, and connecting the N-terminal region and the 1 st extracellular region through recombinant PCR; meanwhile, the 2 nd and 3 rd extracellular regions are connected by recombination PCR by taking CCR12EL2F/EL3R as primers and the 2 nd and 3 rd extracellular regions of CCR12 amplified in the step b as templates;

d. finally, the N-terminal region and 3 extracellular regions of CCR12 are connected together by recombinant PCR by using CCR12NF/EL3R as primers and two fusion fragments successfully connected in the step c as templates, and the target fragment is recovered by gel. The primers used are detailed in Table 6, the restriction sites being indicated by the underlined sections.

TABLE 6 primer for CCR12 amplification

(2) Extraction of expression vectors

Recovering the strain transformed with pET32a expression vector, selecting monoclonal amplification culture, and extracting plasmid, and its concrete steps are as follows:

m, centrifugally collecting bacterial liquid at room temperature of 1000g for 1 min;

n, adding 250 mu l of Solution I into the thallus precipitate, and blowing and beating the resuspended thallus by a gun head;

o. add 250 μ l SolutionII, mix by gently inverting several times until the bacterial suspension becomes clear;

p, adding 350 mu l of solutionIII, and slightly reversing and mixing the mixture for several times until white flocculent precipitate appears;

q, centrifuging for 10min at room temperature of 1000 g;

carefully pipette off the supernatant as much as possible onto a new Hibind DNA binding column;

s. centrifuging at room temperature 10000g for 1min, and removing effluent;

t, adding 500 μ l Buffer HB into the column, centrifuging at room temperature 10000g for 1min, and removing the effluent;

u. adding 700 mul Wash Buffer into the column, centrifuging for 1min at room temperature of 10000g, and removing effluent;

v. repeating step i) once;

w, centrifuging at room temperature of 13000g for 2min to dehydrate the empty Mini Column filter membrane as much as possible;

x, placing the Hibind DNA binding column in a new 1.5ml EP tube, adding 15-30 μ l of precipitation Buffer in the center of the filter membrane, standing at room temperature for 1min, and centrifuging at 13000g at room temperature for 1min to elute DNA;

m. the above 1.5ml EP tube was stored at-20 ℃.

(3) Double enzyme digestion target fragment and expression vector

a. Adding the target fragments recovered from the glue in the step (1) and the expression vector extracted in the step (2) according to a system in a table 7;

b. mixing, centrifuging instantaneously, and enzyme cutting at 37 deg.C for 0.5 h;

c. recovering the target fragment and the expression vector after enzyme digestion by using glue;

TABLE 7 Quick Cut cleavage System

(4) Construction of recombinant expression vectors

a. Adding samples of the target fragments and the expression vectors recovered after double enzyme digestion in the step (3) according to a system in a table 8;

b.16 ℃ overnight;

c. transforming the ligation product into a competent cell of an expression bacterium BL 21;

d. positive clones were identified by colony PCR and sequenced.

TABLE 8 ligation System of recombinant expression vectors

The N-terminal region and 3 extracellular segments of the chemokine receptor CCR12 are spliced by using the designed primers through recombinant PCR, and are connected to a pET32a prokaryotic expression vector after glue recovery and double enzyme digestion. After BL21 transformation, 1 positive clone was picked and sequenced, and the sequence of this positive clone was completely correct. The results are shown in FIG. 3, where lane 1 is a clone of the ORF region of CCR12, 2, 3, 4, 5 are clones of the extracellular N-terminus of CCR12, EL1, EL2, EL3 segments, respectively, lane 6 is the extracellular N-terminus of CCR12 and EL1 recombinant PCR results, lane 7 is the EL2 and EL3 recombinant PCR results of CCR12, and lane 8 is the product recombinant PCR results of lanes 6 and 7.

2. Optimization and solubility analysis of CCR12 recombinant protein expression conditions

(1) Inducible expression of CCR12 recombinant proteins

a. Inoculating the recombinant protein expression strain with correct sequencing in the previous step into a new LB liquid culture solution containing Amp, and carrying out shaking culture at 37 ℃ and 200r/min for overnight;

b. inoculating overnight-cultured bacterial liquid into fresh LB culture solution according to the proportion of 1: 50, and performing shaking culture at 37 ℃ and 200r/min until OD600 is 0.6-0.8;

c. adding IPTG to the final concentration of 1mM, and performing shaking culture at 30 ℃ and 200r/min for 6 h;

d. taking 1ml of bacterial liquid, centrifuging at the room temperature of 4000r/min for 5min, and removing supernatant;

e. resuspending with 100 μ l double distilled water, mixing with 5 xSDS-PAGE Loading Buffer at a ratio of 1: 4, and boiling in water bath for 5 min;

f. carrying out SDS-PAGE gel electrophoresis on the samples to detect whether the recombinant protein CCR12 is expressed, and taking an induction group of an expression strain of pET32a as a control;

(2) optimization of recombinant protein expression conditions

Concentration of iptg: inducing the expression bacteria for 6h by IPTG with final concentration of 0.1mM, 0.3mM, 0.5mM, 0.7mM and 0.9mM respectively, collecting thalli, loading and running electrophoresis after treatment;

b. time of induction: under the condition of the optimal induction concentration, thalli are collected at 0h, 2h, 4h and 6h after induction, and the thalli are subjected to sample loading and electrophoresis after treatment.

The positive clone is expanded and cultured at 37 ℃ until the OD600 of the bacterial liquid reaches 0.6-0.8, 0mM, 0.1mM, 0.3mM, 0.5mM, 0.7mM and 0.9mM of IPTG are added to induce and express for 6h at 30 ℃, and the thalli are collected, and SDS-PAGE electrophoretic analysis shows that the optimal induction concentration of the recombinant protein CCR12 is 0.5 mM. The time of induction was optimized on this basis. As can be seen from FIG. 4, the expression level of the recombinant protein CCR12 had reached its maximum at the induction time of 4 h. Therefore, the conditions for inducing expression in large amounts were 30 ℃ and 0.5mM for 4 hours.

In FIG. 4, C is the relationship between the expression level of the recombinant protein and the IPTG induction concentration, and C is the relationship between the expression level of the protein and the change of the IPTG induction concentration with time. Lanes M represent protein Marker, lanes 1-6 in C represent the expression of recombinant protein induced at 30 ℃ for 6h with IPTG at 0mM, 0.1mM, 0.3mM, 0.5mM, 0.7mM and 0.9mM, respectively. Lanes 1-4 in c show the expression of recombinant protein at optimal IPTG induction concentrations for 0h, 2h, 4h and 6h, respectively, and the target protein bands are indicated by black arrows.

(3) Recombinant protein solubility assay

a. Inducing the expression of the recombinant protein by using the optimized conditions in the step (2), and centrifugally collecting thalli;

b. adding PBS according to the proportion of 50: 1 of the original bacterial liquid, resuspending the bacterial liquid, centrifuging the bacterial liquid for 3min at 4 ℃ and 10000g, and removing supernatant;

c. adding an equal amount of lysine buffer to resuspend the thallus, and carrying out ultrasonic disruption (the ultrasonic disruption condition is 200W, 5s of ultrasound, 8s of interval, 15min of ultrasound, and 3 cycles);

d. centrifuging at 4 deg.C and 8000g for 15min after the ultrasound treatment is finished, and collecting supernatant and precipitate respectively;

e. after processing, SDS-PAGE detects the solubility of the recombinant protein.

Final SDS-PAGE analysis indicated that CCR12 was present in soluble form in the supernatant, see fig. 5, where lane M represents protein Marker. 1. Lanes 2 and 3 show the whole cell suspension, supernatant and pellet, respectively.

3. Purification of CCR12 recombinant proteins

(1) The BL21 strain containing the recombinant expression vector is enlarged and cultured to 1000ml, and the strain is shake-cultured at 37 ℃ and 200r/min to OD₆₀₀0.6-0.8, adding IPTG to the optimal final concentration optimized in the step 2, and culturing at 30 ℃ for a proper time of 200 r/min;

(2) centrifuging at 4 deg.C for 1min at 1000g, and collecting all thallus;

(3)50ml of 0.01mM PBS for resuspending the thallus, centrifuging at 4 ℃ for 10min at 1000g, and removing the supernatant;

(4)50ml Lysis buffer heavy suspension thallus, ultrasonic crushing, 4 ℃, 1000g centrifugation for 10min and supernatant collection;

(5) washing the nickel column by a Wash buffer and an Elution buffer containing imidazole with different concentrations in sequence, collecting effluent liquid, and detecting the Elution effect by SDS-PAGE;

(6) and dialyzing the purified protein solution in PBS overnight, concentrating by using an ultrafiltration centrifugal tube, and storing the concentrated solution at the temperature of-80 ℃.

After the final recombinant protein is purified by a nickel column, a relatively pure single target band is obtained, see fig. 5, wherein a lane M represents a protein Marker, a lane 4 is a purified sample obtained by affinity chromatography, and the target protein band is marked by a black arrow.

(III) preparation and application of polyclonal antibody of epinephelus coioides CCR 12:

1. preparation of CCR12 polyclonal antibody:

(1) two male New Zealand rabbits purchased from the Experimental animals center of Guangdong province were acclimatized in a sterile animal room for 2 weeks;

(2) taking about 2mg of recombinant protein, adding PBS to 2ml, adding 2ml Freund's complete adjuvant, and repeatedly pushing and pulling a conjugated syringe to emulsify the recombinant protein;

(3) sucking the recombinant protein emulsified with Freund's complete adjuvant by using a sterile syringe, and carrying out subcutaneous injection on the New Zealand male rabbits at multiple sites (the injection sites need to be sterilized by 75% alcohol cotton at first), wherein the injection dose is 1 ml/mouse;

(4) after two weeks, performing boosting immunization, emulsifying and uniformly mixing half of recombinant protein of the initial immunization with equivalent Freund incomplete adjuvant, and performing subcutaneous injection on the New Zealand male rabbits for 3 times, wherein the interval time of each time is 2 weeks;

(5) after 7 days of the last booster immunization, carotid blood sampling is carried out on the immunized New Zealand male rabbits, the rabbits are stood for 2 hours at room temperature, kept overnight at 4 ℃, centrifuged at 4000r/min for 30min, then supernatant serum is carefully sucked, treated at 56 ℃ for 30min to inactivate complement, purified by a proteinA column, and stored at-20 ℃ after subpackaging (blood sampling before first immunization is taken as negative control).

2. And (3) measuring the titer of the multiple antibodies by ELISA:

(1) diluting the purified protein antigen to 20 mug/ml by using a coating solution, adding 100 mug/ml into each hole of a 96-hole enzyme label plate, and coating at 4 ℃ overnight;

(2) patting the liquid in the holes, adding 200 μ l of washing solution, shaking and washing for 3 times, each time for 3min, discarding, and patting to dry;

(3) adding 200 mul of sealing liquid into each hole, and sealing for 1h at room temperature;

(4) discarding the blocking solution in the hole, patting to dry, adding 200 μ l of washing solution, washing for 3 times with shaking for 3min each time, discarding, patting to dry;

(5) carrying out continuous gradient dilution on the polyclonal antibody and PBS according to the ratio of 1: 10, adding 100 mu l of the polyclonal antibody into each hole, setting 3 parallel wells, taking the PBS as a negative control group, and incubating for 2h at 37 ℃;

(6) discarding the primary antibody in the hole, patting to dry, adding 200 μ l of washing solution, washing for 3 times with shaking for 3min each time, discarding, patting to dry;

(7) adding 100 mul of diluted secondary antibody into each hole, keeping out of the light, and incubating for 2h at 37 ℃;

(8) discarding the secondary antibody in the hole, patting dry, adding 200 μ l of washing solution, shaking and washing for 3 times, each time for 3min, discarding, patting dry;

(9) preparing fresh substrate solution, adding 100 μ l of fresh substrate solution into each well, keeping out of the sun, and incubating at 37 ℃ for 20 min;

(10) adding 50 mul of stop solution into each hole, and detecting the absorbance value of each hole at the wavelength of 450nm by using a microplate reader, wherein the standard is that P/N is more than or equal to 2.1 or P is more than or equal to N + 3D.

Finally, through ELISA detection, the titer of the polyclonal antibody is 1: 128000, and the titer is higher, so that the requirement of a subsequent immunohistochemical experiment can be met.

3. Western blotting detection of the specificity of the polyclonal antibody:

a: in order to detect whether the prepared polyclonal antibody can identify natural protein, total protein and membrane protein of the Epinephelus coioides head and kidney are respectively extracted to carry out western blotting experiment. The method comprises the following specific steps of anesthetizing the grouper by using eugenol, quickly placing head and kidney tissues of the grouper into a new 1.5ml EP tube, and storing the head and kidney tissues in liquid nitrogen for subsequent total protein and membrane protein extraction.

(3) Extraction of total tissue protein:

e) fully grinding the tissues in a liquid nitrogen environment until the tissues become uniform pulp;

f) adding tissue lysate into the fully ground tissue, and carrying out ice bath for 30min (adding PMSF to a final concentration of 1mM before lysate experiment);

g) carrying out ultrasonic crushing on the cracked sample by using an ultrasonic crusher (the program is ultrasonic crushing 5, the interval is 10s, and 2 times);

h) centrifuging at 14000r/min for 15min at 4 deg.C, carefully sucking the supernatant, and storing at-80 deg.C.

(4) Tissue membrane protein extraction

i) Adding 10mM Tris-HCl to the sample to cover the sample;

j) adding equal volume of precooled Triton X-114 extraction buffer (the buffer needs to be mixed uniformly before use), and adding PMSF protease inhibitor until the final concentration is 1 mM;

k) shaking the sample with vortex oscillator for 1min, ice-bathing for 5min, and repeating for 10 times;

l) centrifuging at 4 ℃ at 12000r/min for 15min, and carefully sucking the supernatant;

m) adding the sucrose buffer solution with the same volume into the supernatant, and carrying out water bath at 30 ℃ for 5min until cloudiness is generated;

n) centrifuging the mixed solution at room temperature of 12000r/min for 3min to stratify, and storing an oil layer on ice;

o) adding 9 times volume of precooled acetone into the oil layer, and incubating for 1h on ice at-20 ℃ overnight;

p) removing acetone, dissolving the precipitated protein with Tris-HCl, and storing at-80 ℃.

B: specific detection of polyclonal antibodies:

(11) after SDS-PAGE electrophoresis of the antigen protein, cutting the gel into a proper size according to a sample application lane and soaking the gel in a membrane transfer buffer solution;

(12) cutting the PVDF membrane into a size matched with the gel, and soaking in a membrane conversion buffer solution;

(13) fixing the gel and PVDF membrane in the order of blackboard (negative electrode), foam pad, filter paper, gel, PVDF membrane, filter paper, foam pad, white board (positive electrode) (note to exclude air bubbles);

(14) putting the device into a transfer printing groove, adding a film transfer buffer solution, and carrying out film transfer for 23min at 100V;

(15) after the film transfer is finished, taking down the PVDF film, adding 10% skimmed milk powder, and sealing at room temperature for 1 h;

(16) adding the appropriate primary antibody (i.e., the prepared CCR12 polyclonal antibody), and incubating overnight at 4 ℃;

(17) discarding the primary antibody, washing with PBST for 3 times, each time for 5 min;

(18) adding a secondary antibody diluted by 10% skimmed milk powder, and incubating at room temperature for 1 h;

(19) discarding the secondary antibody, washing with PBST for 3 times, each time for 5 min;

(20) the display photograph was taken by chemiluminescence.

The specificity of the polyclonal antibody of CCR12 was examined by western blotting, and the result is shown in FIG. 6, and the polyclonal antibody specifically recognizes the recombinant protein and also recognizes the natural protein (about 41 kDa). Wherein, lane M shows Marker, lanes 1, 2 and 3 show SDS-PAGE results of the recombinant protein purified sample of chemokine receptor CCR12, the head kidney tissue holoprotein and the head kidney membrane protein, respectively, lanes a, b and c show the results of western blotting using the prepared polyclonal antibody for the samples of lanes 1, 2 and 3, respectively, and arrows mark the natural protein and the recombinant protein recognized by the polyclonal antibody, respectively.

4. Preliminary application of polyclonal antibody (immunohistochemistry of Epinephelus coioides peripheral blood cells):

(25) anaesthetizing Epinephelus coioides with appropriate dose of eugenol (50mg/ml), and collecting blood from tail vein with syringe treated with heparin sodium;

(26) taking a clean glass slide, and dropwise adding a drop of anticoagulation blood;

(27) using another clean glass slide, making one end contact with the blood drop on the glass slide, making the two glass slides form an angle of 45 degrees, slightly moving to make the blood drop in a straight line, and moving from one end of the glass slide to the other end to form a uniform thin layer;

(28) after drying the blood smear in the air, immediately fixing the blood smear with 4% paraformaldehyde at room temperature for 15 min;

(29) washing with PBS for 3 times, each for 3 min;

(30) treating with 0.5% Triton X-100 for 20 min;

(31) washing with PBS for 3 times, each for 3 min;

(32) with 3% H₂O₂Sealing at room temperature for 15 min;

(33) washing with PBS for 3 times, each for 3 min;

(34) putting the slide into a citric acid buffer solution, performing antigen restoration in a microwave oven for 15min, and cooling at room temperature;

(35) washing with PBS for 3 times, each for 3 min;

(36) sealing with normal goat serum at room temperature for 30 min;

(37) spin-drying goat serum on the slide, dripping primary antibody (namely the prepared CCR12 polyclonal antibody), placing in a wet box, and incubating overnight at 4 ℃;

(38) taking out the wet box, and rewarming at 37 ℃ for 40 min;

(39) washing with PBS for 3 times, each for 3 min;

(40) adding secondary antibody dropwise, and incubating at 37 deg.C for 40 min;

(41) washing with PBS for 3 times, each for 3 min;

(42) coloring DAB for 1min, and washing with distilled water for 5 min;

(43) counterstaining with hematoxylin at 37 deg.C for 15min, and washing with tap water for 5 min;

(44) acidifying with 1% hydrochloric acid for 5s, and washing with tap water for 5 min;

(45) dehydrating 75%, 80%, 90%, 95%, 100% ethanol for 3 min;

(46) 1/2100% ethanol and 1/2100% xylene for 3 min;

(47) xylene I, II was clear for 5 min;

(48) the gel was mounted on a neutral resin and observed by photographing under a microscope after being overnight at 37 ℃.

The prepared polyclonal antibody of the chemokine receptor CCR12 can mark positive cells of blood smears through immunohistochemistry, and the result is shown in FIG. 7, wherein the CCR12 positive cells have the diameter of about 9 μm and have different karyotypes including kidney shapes and round shapes. A, B shows different karyotypes of CCR12 positive cells, A is kidney shaped and B is round.

Claims (3)

1. A preparation method of a polyclonal antibody of the epinephelus coioides CCR12 is characterized by comprising the following steps:

prokaryotic expression and purification of rockfish CCR 12:

I. construction of recombinant expression vector for CCR12

(1) Amplifying a target fragment;

a. according to the analysis of SMART software, the epinephelus coioides CCR12 is a seven-transmembrane protein and is composed of an N-terminal region, 3 extracellular regions, 3 intracellular regions and a C-terminal region; selecting an N-terminal region and 3 extracellular regions of the epinephelus coioides CCR12 for amplification;

b. using CCR12N forward primer/reverse primer, CCR12 extracellular region 1 forward primer/reverse primer, CCR12 extracellular region 2 forward primer/reverse primer and CCR12 extracellular region 3 forward primer/reverse primer as primers, using Epinephelus rockcod cDNA as a template, using high fidelity enzyme PrimeSTAR^TMMix amplified the N-terminal region and 3 extracellular regions of CCR12, respectively;

c. then using a CCR12N terminal forward primer/extracellular region 1 reverse primer as a primer, using the CCR 12N-terminal region amplified in the step b and the 1 st extracellular region as templates, and connecting the N-terminal region and the 1 st extracellular region through recombinant PCR; meanwhile, the 2 nd and 3 rd extracellular regions are connected by recombination PCR by taking a CCR12 extracellular region 2 forward primer/extracellular region 3 reverse primer as a primer and the 2 nd and 3 rd extracellular regions of CCR12 amplified in the step b as templates;

d. finally, taking a CCR12N terminal forward primer/extracellular region 3 reverse primer as a primer, taking two fusion fragments successfully connected in the step c as templates, connecting an N-terminal region and 3 extracellular regions of CCR12 together through recombinant PCR, and recovering a target fragment by glue;

wherein the sequence of the forward primer at the end of the primer CCR12N is CGGGATCCATGAGCGACGAATTTCTGCT, the sequence of the primer CCR12N terminal reverse primer is AGAACCACCGCCGCCAAATTTCGCACCAAAGTGG, and the amplified fragment is 41 bp; the sequence of a forward primer of the CCR12 extracellular region 1 is GGCGGCGGTGGTTCTCATCTGTCTGAATGG, the sequence of a reverse primer of the CCR12 extracellular region 1 is AGAACCACCGCCGCCGTAGGCACTGCTGAC, and the amplified fragment is 87 bp; the sequence of a forward primer of the CCR12 extracellular region 2 is GGCGGCGGTGGTTCTAAAAATGTGGGTAGCA, the sequence of a reverse primer of the CCR12 extracellular region 2 is GCTGCCACCGCCACCGAATTGCTGGTAATA, and the amplified fragment is 135 bp; the sequence of the forward primer of the extracellular region 3 of the primer CCR12 is GGTGGCGGTGGCAGCGCTATTCAGATCTC, and the sequence of the reverse primer of the extracellular region 3 of the primer CCR12 is CCGCTCGAGTCACGCATAGTCCAAGCTCT, the amplified fragment is 96 bp; underlined portions in the primer sequences indicate restriction sites;

(2) extracting an expression vector; (3) double enzyme digestion of target fragment and expression vector; (4) constructing a recombinant expression vector: identifying positive clones by a colony PCR method, and sequencing;

II. Optimization of expression conditions for CCR12 recombinant proteins

(1) Inducible expression of CCR12 recombinant protein;

(2) optimizing the expression condition of the CCR12 recombinant protein;

optimizing the IPTG concentration; b. optimizing the induction time;

III, purifying CCR12 recombinant protein;

(II) preparing a polyclonal antibody of the epinephelus coioides CCR 12:

I. preparation of CCR12 polyclonal antibody:

(1) two male New Zealand rabbits were adapted to be raised in a sterile animal room for 2 weeks;

(2) adding PBS (phosphate buffer solution) into about 2mg of CCR12 recombinant protein to 2ml, adding 2ml of Freund's complete adjuvant, and repeatedly pushing and pulling a conjugate syringe to emulsify the CCR12 recombinant protein;

(3) sucking the CCR12 recombinant protein emulsified with Freund's complete adjuvant by using a sterile syringe, sterilizing a plurality of injection sites of New Zealand male rabbits by using 75% alcohol cotton, and then performing subcutaneous injection, wherein the injection dose is 1 ml/mouse;

(4) after two weeks, performing boosting immunization, emulsifying and uniformly mixing half of CCR12 recombinant protein of the initial immunization with an equivalent amount of Freund incomplete adjuvant, and performing subcutaneous injection on New Zealand male rabbits for 3 times, wherein the interval time of each time is 2 weeks;

(5) after 7 days of the last boosting immunization, carotid blood sampling is carried out on the immune New Zealand male rabbits, the immune New Zealand male rabbits are stood for 2 hours at room temperature, are kept overnight at 4 ℃, are centrifuged at 4000r/min for 30min at 4 ℃, then upper serum is carefully sucked, are treated at 56 ℃ for 30min to inactivate complement, are purified by a protein A column, and are stored at the temperature of minus 20 ℃ after being subpackaged;

II. Measuring the titer of the multiple antibodies by ELISA;

III, detecting the specificity of the polyclonal antibody by Western blotting:

(1) extracting total protein and membrane protein of Epinephelus coioides head and kidney;

(2) specific detection of polyclonal antibodies:

a. after SDS-PAGE electrophoresis of the antigen protein, cutting the gel into a proper size according to a sample application lane and soaking the gel in a membrane transfer buffer solution;

b. cutting the PVDF membrane into a size matched with the gel, and soaking in a membrane conversion buffer solution;

c. fixing the gel and the PVDF film according to the sequence of the blackboard, namely a negative electrode, a foam pad, filter paper, the gel, the PVDF film, the filter paper, the foam pad and the whiteboard, namely a positive electrode, and paying attention to the removal of bubbles;

d. putting the device into a transfer printing groove, adding a film transfer buffer solution, and carrying out film transfer for 23min at 100V;

e. after the film transfer is finished, taking down the PVDF film, adding 10% skimmed milk powder, and sealing at room temperature for 1 h;

f. adding the CCR12 polyclonal antibody prepared in the step (II) I, and incubating overnight at 4 ℃;

g. discarding the CCR12 polyclonal antibody, washing with PBST for 3 times, each time for 5 min;

h. adding a secondary antibody diluted by 10% skimmed milk powder, and incubating at room temperature for 1 h;

i. discard secondary antibody, wash 3 times with PBST;

j. the display photograph was taken by chemiluminescence.

2. The method of making polyclonal antibodies to Epinephelus coioides CCR12 of claim 1, wherein said ELISA assay for polyclonal antibody titers comprises the steps of:

(1) diluting the CCR12 recombinant protein purified in the step (I) III to 20 mu g/ml by using a coating solution, adding 100 mu l of the CCR12 recombinant protein into each well of a 96-well enzyme label plate, and coating at 4 ℃ overnight;

(2) patting the liquid in the holes, adding 200 μ l of washing solution, shaking and washing for 3 times, each time for 3min, discarding, and patting to dry;

(3) adding 200 mul of sealing liquid into each hole, and sealing for 1h at room temperature;

(4) discarding the blocking solution in the hole, patting to dry, adding 200 μ l of washing solution, washing for 3 times with shaking for 3min each time, discarding, patting to dry;

(5) carrying out continuous gradient dilution on the CCR12 polyclonal antibody prepared in the step (II) and PBS according to the ratio of 1: 10, adding 100 mu l of the antibody into each hole, setting 3 parallel antibodies, taking the PBS as a negative control group, and incubating for 2h at 37 ℃;

(6) discarding the CCR12 polyclonal antibody in the hole, patting dry, adding 200 mul of washing solution, shaking and washing for 3 times, 3min each time, discarding, patting dry;

(7) adding 100 mul of diluted secondary antibody into each hole, keeping out of the light, and incubating for 2h at 37 ℃;

(8) discarding the secondary antibody in the hole, patting dry, adding 200 μ l of washing solution, shaking and washing for 3 times, each time for 3min, discarding, patting dry;

(9) preparing fresh substrate solution, adding 100 μ l of fresh substrate solution into each well, keeping out of the sun, and incubating at 37 ℃ for 20 min;

(10) adding 50 mul of stop solution into each hole, and detecting the absorbance value of each hole at the wavelength of 450nm by using a microplate reader, wherein the standard is that P/N is more than or equal to 2.1 or P is more than or equal to N + 3D.

3. Preliminary use of the epinephelus coioides CCR12 polyclonal antibody prepared according to claim 1 or 2, characterized in that: the application is realized by immunohistochemistry of peripheral blood cells of the epinephelus coioides, and specifically comprises the following steps:

(1) anaesthetizing Epinephelus coioides with appropriate dose of 50mg/ml eugenol, and collecting blood from tail vein with syringe treated with heparin sodium;

(2) taking a clean glass slide, and dropwise adding a drop of anticoagulation blood;

(3) using another clean glass slide, making one end contact with the blood drop on the glass slide, making the two glass slides form an angle of 45 degrees, slightly moving to make the blood drop in a straight line, and moving from one end of the glass slide to the other end to form a uniform thin layer;

(4) after drying the blood smear in the air, immediately fixing the blood smear with 4% paraformaldehyde at room temperature for 15 min;

(5) washing with PBS for 3 times, each for 3 min;

(6) treating with 0.5% Triton X-100 for 20 min;

(7) washing with PBS for 3 times, each for 3 min;

(8) with 3% H₂O₂Sealing at room temperature for 15 min;

(9) washing with PBS for 3 times, each for 3 min;

(10) putting the slide into a citric acid buffer solution, performing antigen restoration in a microwave oven for 15min, and cooling at room temperature;

(11) washing with PBS for 3 times, each for 3 min;

(12) sealing with normal goat serum at room temperature for 30 min;

(13) spin-drying goat serum on the slide, dripping the CCR12 polyclonal antibody prepared in the step (II) I, placing the goat serum in a wet box, and incubating overnight at 4 ℃;

(14) taking out the wet box, and rewarming at 37 ℃ for 40 min;

(15) washing with PBS for 3 times, each for 3 min;

(16) adding secondary antibody dropwise, and incubating at 37 deg.C for 40 min;

(17) washing with PBS for 3 times, each for 3 min;

(18) coloring DAB for 1min, and washing with distilled water for 5 min;

(19) counterstaining with hematoxylin at 37 deg.C for 15min, and washing with tap water for 5 min;

(20) acidifying with 1% hydrochloric acid for 5s, and washing with tap water for 5 min;

(21) dehydrating 75%, 80%, 90%, 95%, 100% ethanol for 3 min;

(22) 1/2100% ethanol and 1/2100% xylene for 3 min;

(23) xylene I, II was clear for 5 min;

(24) the gel was mounted on a neutral resin and observed by photographing under a microscope after being overnight at 37 ℃.

Images