CN108220298B

CN108220298B - Anti-mullerian hormone AMH gene of epinephelus lanceolatus, encoding protein and application thereof

Info

Publication number: CN108220298B
Application number: CN201810076706.4A
Authority: CN
Inventors: 张勇; 韩玉龙; 赵密; 彭诚; 杨宇晴; 李水生; 刘云; 张海发; 林浩然
Original assignee: Sun Yat Sen University
Current assignee: Sun Yat Sen University
Priority date: 2018-01-26
Filing date: 2018-01-26
Publication date: 2021-11-30
Anticipated expiration: 2038-01-26
Also published as: CN108220298A

Abstract

The invention discloses an anti-mullerian hormone AMH gene of epinephelus lanceolatus, and the nucleotide sequence of the gene is shown as SEQ ID NO: 1 is shown. Also discloses a protein coded by the gene, a preparation method for producing anti-mullerian hormone AMH recombinant protein by using the anti-mullerian hormone AMH gene as a target gene, and a polyclonal antibody prepared by immunizing animals by using the anti-mullerian hormone AMH recombinant protein of the epinephelus lanceolatus obtained by the method as an antigen. The invention further discloses application of the anti-mullerian hormone AMH recombinant plasmid of the epinephelus lanceolatus in preparing an inducer in the sex transformation process of the epinephelus lanceolatus and application of the polyclonal antibody in preparing a detection agent for the epinephelus lanceolatus at different development stages.

Description

Anti-mullerian hormone AMH gene of epinephelus lanceolatus, encoding protein and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to an anti-mullerian hormone AMH gene of epinephelus lanceolatus, a coding protein and application thereof.

Background

anti-Mullerian hormone (AMH), also known as Mullerian Inhibition (MIS), is named because it can cause Mullerian degeneration during male embryonic development and prevent the development of female reproductive organs. The AMH gene was originally cloned from cattle. In mammals, embryonic stage testis development is initiated by the SRY gene on the Y chromosome, and with the help of other transcription factors (SF-1, Wt1 and GATA-4), the expression of AMH by the supporting cells in the male testis is stimulated to cause the degradation of the Mullerian duct, and the individual develops in the male direction. AMH can also inhibit cAMP and FSH to indirectly influence the embryo testis to express Cyp19a1, and Cyp19a1 can encode P450 aromatase to catalyze the conversion of androgen into estrogen.

The molecular genetic regulation mechanism of gonad differentiation in fish is complicated and the research is started later compared to mammals, so far it has not been studied thoroughly. Since the Mullerian duct is not found in teleost fish, the function of AMH and its receptors in teleost fish is not yet clear.

The epinephelus lanceolatus is popular because of delicious taste and rich nutrition, and is edible fish with high economic value. The epinephelus lanceolatus is a typical hermaphrodite fish, the epinephelus lanceolatus is converted into a male after undergoing a female process in a reproductive process, the reproductive cycle is long, the period of obtaining the male is generally more than 6 years, and male parent fish is very scarce during artificial propagation. And the chance of catching wild male parent fish in natural sea areas is much more vast due to environmental damage and over-fishing. Therefore, how to obtain the functional male parent fish becomes the key to the smooth operation of the artificial breeding of the epinephelus lanceolatus.

Disclosure of Invention

The invention aims to provide an anti-mullerian hormone AMH gene of epinephelus lanceolatus, a protein for coding the gene and a preparation method of the anti-mullerian hormone AMH gene.

Another object of the present invention is to provide a method for producing an anti-mullerian hormone AMH recombinant protein using the anti-mullerian hormone AMH gene as a target gene, and an anti-mullerian hormone AMH recombinant protein and a polyclonal antibody produced by the method.

The invention further aims to solve the technical problem of providing the application of the anti-mullerian hormone AMH recombinant plasmid of the epinephelus lanceolatus in preparing an inducer in the sex transformation process of the epinephelus lanceolatus and the application of the polyclonal antibody in preparing a detection agent for the epinephelus lanceolatus in different development periods.

In order to solve the problems, the nucleotide sequence of the anti-mullerian hormone AMH gene of the epinephelus lanceolatus provided by the invention is shown as SEQ ID NO: 1 is shown.

The open reading frame of the anti-mullerian hormone AMH gene of the epinephelus lanceolatus is obtained by a method of amplifying a gene fragment by using a primer and amplifying the full length of RACE.

The amino acid sequence of the anti-mullerian hormone AMH protein of the epinephelus lanceolatus is shown as SEQ ID NO: 2, it codes for 518 amino acids and has a molecular weight of 72.5 kilodaltons.

This sequence contains a 66 amino acid signal peptide sequence at the N-terminus and 9 conserved cysteines in biologically active regions near the C-terminus of its amino acid sequence, consistent with other AMH sequences identified.

The preparation method of the anti-mullerian hormone AMH gene of the epinephelus lanceolatus comprises the following steps:

(1) extracting total RNA from the existing epinephelus lanceolatus;

(2) taking the total RNA extracted in the step (1) as a template, taking RNA Oligo dT as a primer, and carrying out reverse transcription to synthesize cDNA, wherein the nucleotide sequence of the primer is shown as SEQ ID NO. 3;

(3) using cDNA as a template, and using SEQ ID NO: 4. SEQ ID NO:5 is an upstream primer and a downstream primer, and the anti-mullerian hormone AMH gene of the epinephelus lanceolatus is obtained by PCR amplification.

The invention also provides an expression vector containing the anti-mullerian hormone AMH gene.

Among the above expression vectors, the expression vector is preferably an E.coli expression vector pET32 a-AMH.

The invention also provides a recombinant strain, namely the Escherichia coli recombinant strain pET32a-AMH-Rosetta formed by transferring the Escherichia coli expression vector pET32a-AMH into an Escherichia coli Rosetta strain.

The anti-mullerian hormone AMH protein of the epinephelus lanceolatus is obtained by expressing a recombinant expression vector pET32a-AMH in an intracellular inclusion body form in an escherichia coli Rosetta strain.

Further, the invention provides an expression method of the anti-mullerian hormone AMH recombinant protein of the epinephelus lanceolatus, which comprises the following steps:

(1) constructing a recombinant expression vector pET32 a-AMH;

(2) the recombinant expression vector pET32a-AMH is used for transforming an escherichia coli Rosetta strain;

(3) culturing expression engineering bacteria;

(4) coating the anti-mullerian hormone AMH recombinant plasmid;

(5) purification and renaturation treatment of anti-mullerian hormone AMH protein.

Wherein the construction of the recombinant expression vector pET32a-AMH in the step (1) comprises the following steps:

(a) synthesizing a pair of primers, wherein an upstream primer is shown as SEQ ID NO. 6, a downstream primer is shown as SEQ ID NO. 7, the upstream primer is shown as SEQ ID NO. 6 with an EcoRI cutting site, the downstream primer is shown as SEQ ID NO. 7 with an XhoI cutting site,

(b) amplifying a DNA sequence of an AMH gene expression mature peptide by using a plasmid containing an AMH encoding gene of anti-mullerian hormone of the epinephelus lanceolatus as a template and primers SEQ ID NO. 6 and SEQ ID NO. 7;

(c) cloning the PCR amplification product to prokaryotic expression vector pET32a to obtain recombinant expression vector pET32 a-AMH.

The invention designs a pair of upstream primers SEQ ID NO 6 containing EcoRI enzyme cutting sites and downstream primers SEQ ID NO 7 containing XhoI enzyme cutting sites, clones the mature peptide coding sequence of the anti-mullerian hormone AMH of the epinephelus lanceolatus to a prokaryotic expression vector pET-32a, constructs a recombinant expression vector pET-32a-AMH, the recombinant vector contains 6 XHis affinity tag sites, T7 is taken as a promoter, the C end of the obtained target protein has a 6 XHis structure, and the purification is conveniently carried out by utilizing nickel column affinity chromatography. Through exploration and optimization of conditions such as culture temperature, induction dose and the like, the expression quantity of the recombinant protein AMH is high, but most of the recombinant protein AMH is in an inclusion body state.

The cultivation of the expression engineering bacteria in the step (3) preferably comprises the following steps: inoculating the single colony to 5mL LB culture medium containing 100mg/L ampicillin resistance, performing shaking overnight culture (about 12h) at 37 ℃ and 200rpm, inoculating the overnight culture to the LB culture medium containing 100mg/L ampicillin at a ratio of 1:100, performing culture at 37 ℃ and 200rpm until OD600 reaches 0.6 (about 3h), adding IPTG (isopropyl thiogalactoside) with the final concentration of 0.8mmol/L, performing induction culture at 37 ℃ and 200rpm for 6h to obtain the maximum recombinant protein expression, centrifuging at 10000rpm for 15min, and collecting thalli.

The purification and renaturation treatment of the anti-mullerian hormone AMH protein in the step (5) comprises the following steps:

(A) washing the collected thallus with bufffer B, then re-suspending with an appropriate amount of bufffer B, shaking and cracking the thallus on ice for 1h, and obtaining a cracking supernatant through high-speed centrifugation;

(B) purifying the collected lysate by nickel column affinity chromatography, eluting with urea eluent, and collecting protein elution peak;

(C) precooling the collected protein eluent, putting the protein eluent into a treated dialysis bag, fastening bag openings at two sides, transferring the bag openings to dialysate, dialyzing at 4 ℃ overnight, replacing the dialysate every 8 hours, and freeze-drying the protein in vacuum after the dialysis is finished.

The invention also provides the anti-mullerian hormone AMH recombinant protein of the epinephelus lanceolatus obtained by the expression method and an antibody prepared from the recombinant protein.

The invention further provides application of the epinephelus lanceolatus anti-mullerian hormone AMH recombinant plasmid obtained by the expression method in preparation of an inducer in the sex transformation process of the epinephelus lanceolatus.

The recombinant expression AMH plasmid is coated and then fed, and the result shows that the epinephelus lanceolatus ovary degenerates and develops towards the spermary direction after being fed for a plurality of weeks, so that a novel induction mode is provided for the subsequent artificial induction of the epinephelus lanceolatus sex reversal, and the action time of the sex reversal can be enhanced and accelerated.

Therefore, the invention constructs AMH protein recombinant expression plasmid by using the anti-mullerian hormone AMH gene of the epinephelus lanceolatus and the coding protein thereof, and can induce the sex transformation of female epinephelus lanceolatus into male.

Furthermore, a specific antibody prepared by the epinephelus lanceolatus anti-mullerian hormone AMH recombinant protein can also be used as an auxiliary detection agent for the male of the epinephelus lanceolatus.

A polyclonal antibody is prepared by immunizing animal with recombinant protein of Epinephelus lanceolatus anti-Mullerian hormone AMH obtained by the above expression method as antigen.

Further, the invention obtains the purified recombinant protein AMH, and prepares the recombinant protein rabbit polyclonal antibody, and the immunization steps are as follows:

1) 1mg of different immunogens was taken from the reagent and dissolved in PBS buffer, mixed thoroughly with equal volume of Freund's complete adjuvant and emulsified;

2) 4 male New Zealand white rabbits with the age of 1-3 weeks are selected, and blood is collected for 0.5mL before immunization to be used as a sample control. Mixing complete Freund's adjuvant (1:1) for the first immunization, adding 0.5mL of antigen solution into 0.5mL of Freund's complete adjuvant, and sucking the emulsion by using a 2mL syringe to remove air bubbles in the syringe;

3) the immunization dose for each rabbit was 1.5mL injected subcutaneously, and after the first immunization, boosted with Incomplete Freund's Adjuvant (IFA) at weeks 2 and 8, with no change in immunization dose. Blood was taken 2 weeks after the last immunization;

4) measuring the titer, namely taking blood from the ear vein of the rabbit, centrifugally separating plasma, and measuring the titer of antiserum by ELISA;

5) arterial blood is taken, the temperature is 37 ℃ for 1h, then serum is collected at 3500rpm, the serum is collected, subpackaged and stored at-80 ℃, Western blot detection is carried out on the last serum, and immunohistochemical experiment verification is carried out after the detection.

The polyclonal antibody prepared by the invention can be applied to the preparation of the detection agent for the epinephelus lanceolatus in different development periods.

The polyclonal antibody can be further used as an immunohistochemical detection method for understanding different development stages of epinephelus lanceolatus.

Compared with the prior art, the invention has the following advantages: the invention prepares recombinant protein expression plasmid by cloning anti-mullerian hormone AMH gene of the epinephelus lanceolatus, packages the recombinant protein expression plasmid and feeds the epinephelus lanceolatus to successfully induce the epinephelus lanceolatus to be male; and the polyclonal antibody of the recombinant AMH protein is prepared by utilizing the principle that the animal can immunize a foreign antigen to generate the antibody, and male judgment is carried out by detecting the expression of the AMH protein.

Drawings

FIG. 1 shows the results of electrophoresis of PCR amplification products of mature peptide coding sequences of anti-Mullerian hormone AMH of Epinephelus sadicus in example 2, wherein M is DNA Marker, and 1 is target fragment of AMH nucleotide with cleavage site;

FIG. 2 is a schematic diagram showing the construction of a recombinant expression plasmid for the gene AMH in example 2;

FIG. 3 is a SDS-PAGE (A/B) and Western blot (C) analysis of the expression and purification of recombinant protein of anti-Mullerian hormone AMH from Epinephelus sadicus in example 2, wherein M is a protein molecular weight standard, 1: negative control, 2: total bacterial protein after non-induction, 3-6: IPTG induced final concentrations are respectively 0.2, 0.4, 0.6 and 0.8 of total bacterial protein after induction; in panel B, M is a protein molecular weight standard, 1: negative control, 2: induced inclusion body protein, 3-5: bufferB (pH8.0)/bufferC C (Ph6.3)/bufferE E (pH 4.5); in panel C, M is a protein molecular weight standard, 1: purifying the protein;

FIG. 4 is the sampling conditions of different periods in gonads after feeding the AMH recombinant coated plasmid of Epinephelus saddleyani in example 2, wherein A-C are gonad slices sampled at different periods in a control group, and D-F are gonad slices sampled at different periods in a feeding group;

FIG. 5 is the expression of AMH of Epinephelus sadicus at different stages of gonadal development in example 4, and (A) is a graph showing the results of slicing at different fold changes in distribution of AMH in females: A-C is female second-stage gonad, D-F is female third-stage gonad; (B) the graph shows the results of slicing at different multiples for the distribution change of AMH in facultative: A-C is the sexual prophase gonad, D-F is the sexual metaphase gonad, G-I is the anaphase gonad; (C) the graph shows the results of slicing at different fold for the distribution change of AMH in males: A-C are male gonads.

Detailed Description

Example 1 cloning of anti-Mullerian hormone AMH in Epinephelus lanceolatus

1. Extraction of total RNA of gonad of epinephelus lanceolatus

Taking healthy Epinephelus lanceolatus whole fish, performing ice bath anesthesia for about 2min, killing fish, sampling, separating gonad tissue, and performing Trizol testExtracting with solvent to obtain total RNA of gonad of Epinephelus lanceolatus, and OD thereof_260/280＝1.90。

Synthesis of first Strand of cDNA

Taking 1 μ g of Epinephelus lanceolatus gonad total RNA sample, performing DNase treatment to remove genomic DNA pollution, mixing with RNA Oligo dT (sequence shown as SEQ ID NO:3, specifically tttttttttttttttttt), performing reverse transcription, and storing the obtained product at-20 deg.C for use.

3. Cloning of complete sequence of epinephelus lanceolatus AMH gene cDNA

According to the information in the grouper saddleheaded transcriptome database, designing specific primers at two ends of an AMH open reading frame splicing sequence, wherein an upstream primer sequence is shown as SEQ ID NO:4 (specifically atgctgtttgtggacatcttc), a downstream primer sequence is shown as SEQ ID NO:5 (specifically taacggcatccacactccttcgcc), performing PCR amplification by taking the first strand cDNA synthesized in the step 2 as a template, the size of an amplified fragment is 1726bp, performing electrophoretic separation on a DNA fragment, cutting gel to recover a target product, connecting the purified target product to a pGEM-T vector, transforming DH5 alpha escherichia coli, selecting positive clone sequencing, and BLAST homology analysis shows that the target product is the cDNA sequence fragment of the AMH gene.

The nucleotide sequence of the obtained anti-mullerian hormone AMH gene of the epinephelus lanceolatus is shown as SEQ ID NO: 1 is shown.

The method specifically comprises the following steps:

atgctgtttgtggacatcttctcctgtggagcgctgatgctctgctgcgcccggctctgtgcagccctgcaggtctcacatggaaagcagctgatggacaaccccgcagtgacagagcacacccctccatcagcctccacagtctcccatcacgcccctcacagtgcgccgtgctttgtggatgacatatttgcagcactacgtgaaggtgttgggagccacggtgaactcacaaaccgcagtttggctcagtttgggatctgcactgaatctgacagctcttcagtcttattacagctggctaaggacacaaacaaaaaccagggaaatggattggaggttcatccaggtggaggaatcagaggtgtcaaagatgagacgggaactctcgtgttgacctttgacctctcactgtcccctttgctgaaggtgaaccctgtgctgctgttggcgtttgaaagtccgctcacaggacgaaacctggatatcactttcacgagtcagtcgctgcatccaagcacacagtctgtgtgcatctcaggagaaacgcagtacatattgctgacaggaaaagcaacacaaggcaacgttcagcagacttggacaatttctgttgagacaaaaacccctgacatgaaccaaatcctaaaagacatcctcattggtggaaaaccaggaagtaacaccagcgtcactcctcttctgcttttctctgtggaaagaggatctgatacaagacatacacacgcctcttcacacacctccttcttctgtgagctgaagcgtttcctgcgtgacgtcctgcctcaggaccactctgcgtcctctcccctccagctggactccctgcagtccctgcctcctctcacgctagacttatcctccagcgagaccctgctggcaggactgatcaactcctcctcccccaccatcttctccttcaccggctgttgctccatgtttcagacgcacgatggagagctggccttgtctcctgcgctgctggaggaggtcaagcgcaggttggagcagactgtggtgcaggtaatggaggtaataatggaggaggaggtcggtcacagagctgcagagagcctgggaaggctcagagatctcagtgcatttccgaagacggaaccagcagcaggagggagccagtaccgtgcgttcctcctgctgaaggccctacagacggtagccggtgcatatgaggtgcagagaggactgcgggcgaccagagctggacccaacaacccagcgagaggcaacctatgtgggctgaggagcctcactgtgtcccttgaaaagcgtgttgtgggaccaaacactgccaacatcaacaactgccatggctcctgtgctttccccatggtcaacaccaacaaccacgccgtcctgctcagcttccacatcgagagtgagaatgcagacgagcagggcgccgtgctgtgtgcctgtggcctatcacgccctggaggtggtagacttgaacgaacatgggacgtacttgtccattacaccagatatggtggcgaaggagtgtggatgccgttataa 1557

the corresponding amino acid sequences are as follows:

MLFVDIFSCGALMLCCARLCAALQVSHGKQLMDNPAVTEHTPPSASTVSHHAPHSAPCFVDDIFAALREGVGSHGELTNRSLAQFGICTESDSSSVLLQLAKDTNKNQGNGLEVHPGGGIRGVKDETGTLVLTFDLSLSPLLKVNPVLLLAFESPLTGRNLDITFTSQSLHPSTQSVCISGETQYILLTGKATQGNVQQTWTISVETKTPDMNQILKDILIGGKPGSNTSVTPLLLFSVERGSDTRHTHASSHTSFFCELKRFLRDVLPQDHSASSPLQLDSLQSLPPLTLDLSSSETLLAGLINSSSPTIFSFTGCCSMFQTHDGELALSPALLEEVKRRLEQTVVQVMEVIMEEEVGHRAAESLGRLRDLSAFPKTEPAAGGSQYRAFLLLKALQTVAGAYEVQRGLRATRAGPNNPARGNLCGLRSLTVSLEKRVVGPNTANINNCHGSCAFPMVNTNNHAVLLSFHIESENADEQGAVLCACGLSRPGGGRLERTWDVLVHYTRYGGEGVWMPL-519

example 2 expression of anti-Mullerian hormone AMH recombinant protein from Epinephelus lanceolatus and plasmid coating

1. Construction of recombinant expression plasmids

A pGEM-T plasmid containing an AMH coding gene is taken as a template, and a pair of upstream primers containing an EcoRI cutting site, namely SEQ ID NO: 6(ccggaattcctgcaggtctcacatggaaagc) and the downstream primer containing the XhoI cleavage site SEQ ID NO: 7(ccgctcgagtaacggcatccacactccttcgcc), obtaining a single band with the product size of about 1497bp by PCR amplification, and the electrophoresis result is shown in figure 1.

The mature peptide coding sequence of the anti-mullerian hormone AMH of the epinephelus lanceolatus is cloned to a prokaryotic expression vector pET32a to obtain a recombinant expression vector pET32a-AMH (the construction process is shown in figure 2). The sequence of the exogenous gene in the expression vector is determined to be correct through sequencing.

2. Prokaryotic expression of anti-mullerian hormone AMH gene of epinephelus lanceolatus

Transforming the expression plasmid constructed in the step 1 into an escherichia coli Rosetta strain, cracking the genetically engineered bacteria by buffer B after IPTG induction expression to obtain supernatant, and performing SDS-PAGE electrophoretic analysis to show that the engineered bacteria have obvious specific expression product bands after IPTG induction and are similar to the molecular weight of the His-tag-containing AMH recombinant protein estimated by software (figure 3, A)).

FIG. 3 is a SDS-PAGE (A/B) and Western blot (C) analysis of the expression and purification of recombinant protein of Epinephelus lanceolatus anti-Mullerian hormone AMH, wherein M is a protein molecular weight standard, 1: negative control, 2: total bacterial protein after non-induction, 3-6: IPTG induced final concentrations are respectively 0.2, 0.4, 0.6 and 0.8 of total bacterial protein after induction; in panel B, M is a protein molecular weight standard, 1: negative control, 2: induced inclusion body protein, 3-5: bufferB (pH8.0)/bufferC C (Ph6.3)/bufferE E (pH 4.5); in panel C, M is a protein molecular weight standard, 1: purifying the protein;

the optimal culture conditions of the genetic engineering bacteria obtained by optimizing conditions such as induction temperature, induction dosage and the like are as follows: inoculating single colony to 5mL LB liquid culture medium containing ampicillin and chloramphenicol, culturing at 37 deg.C and 200rpm under shaking overnight; according to the following steps: inoculating 100 volume ratio into 100ml TB liquid culture medium containing ampicillin and chloramphenicol preheated at 37 deg.C, culturing at 37 deg.C and 200rpm until OD600 reaches 0.6; IPTG is added to the final concentration of 0.8mM, and the AMH protein expression engineering bacteria are induced for 6h at the temperature of 37 ℃, so that the maximum recombinant protein expression quantity can be obtained.

3. Prokaryotic expression and plasmid coating of anti-mullerian hormone recombinant gene of epinephelus lanceolatus

And (3) carrying out mass amplification culture on the recombinant plasmid, then recovering the over-expression plasmid, carrying out feeding experiments after the novel liposome is used for coating the recombinant expression AMH plasmid, and detecting the development condition of the gonad after different feeding time (as shown in figure 4).

FIG. 4 shows the sampling conditions of the epinephelus lanceolatus in different stages of the gonads after AMH recombinant coated plasmids are fed, A-C are the gonad slices sampled in different stages of the control group, D-F are the gonad slices sampled in different stages of the feeding group, and the ovary-like gonads of the epinephelus lanceolatus gradually degenerate and develop towards the male spermary direction along with the increase of feeding time in the feeding group.

As can be seen from fig. 4, it was found that the ovarian-like gonads of the epinephelus lanceolatus gradually degenerated and progressed toward the male testis with the increase of the feeding time in the feeding group, but the gonads of the control group still normally developed, and the anti-mullerian hormone AMH recombinant plasmid could be applied as a novel inducer during sex transition of the epinephelus lanceolatus.

4. Purification and renaturation treatment of anti-mullerian hormone AMH recombinant protein of epinephelus lanceolatus

Resuspending total thalli of the AMH protein expression engineering bacteria by buffer B, shaking the thalli by a shaking table, centrifuging at high speed to obtain cracked supernatant, purifying by nickel column affinity chromatography, eluting urea eluent, and collecting protein; SDS-PAGE was performed to analyze the expression and purification of the recombinant protein. The protein coded by the anti-mullerian hormone AMH gene of the epinephelus lanceolatus can be adsorbed by an immobilized nickel affinity chromatographic column, and when the nickel affinity chromatographic column is washed by elution buffer solution containing different urea concentrations, the target protein can be washed off, and the anti-mullerian hormone AMH recombinant protein of the epinephelus lanceolatus is obtained after dialysis (as shown in a B picture in a figure 3).

Example 3 preparation of anti-Mullerian hormone AMH antibody to Epinephelus lanceolatus

The recombinant protein AMH obtained in the example 2 after purification is used for preparing the rabbit polyclonal antibody, and the immunization steps are as follows:

1) from the recovered recombinant protein, 1mg was dissolved in PBS buffer, and thoroughly mixed and emulsified with an equal volume of Freund's complete adjuvant.

2) 4 male New Zealand white rabbits with the age of 1-3 weeks are selected, and blood is collected for 0.5mL before immunization to be used as a sample control. Complete Freund's adjuvant (1:1) was first mixed in, 0.5mL of Freund's complete adjuvant was added to 0.5mL of antigen solution, and the emulsion was aspirated with a 2mL syringe to remove air bubbles in the syringe.

3) The immunization dose per rabbit was 1.5mL injected subcutaneously. Following the first immunization, boosts were performed with Incomplete Freund's Adjuvant (IFA) at weeks 2 and 8, with no change in the immunization dose. Blood was taken 2 weeks after the last immunization.

4) And (3) measuring the titer, namely taking blood from the ear vein of the rabbit, centrifugally separating the blood plasma, and measuring the titer of the antiserum by ELISA.

5) Arterial blood was collected at 37 ℃ for 1h, then serum was collected at 3500rpm, collected, aliquoted and stored at-80 ℃. And carrying out Western blot detection on the last serum.

Example 4 anti-mullerian hormone, AMH, antibody immunohistochemical validation of Epinephelus lanceolatus

(1) Dehydrating the paraffin sections: xylene for 10 min; gradient alcohol: 100%, 2min 95%, 2min 80%, 2min 70%, 2 min; washing with distilled water for 5min for 2 times;

(2) hydrogen peroxide blocks endogenous enzymes: 3% H2O2, protected from light at room temperature for 10 min; washing with distilled water for 5min for 2 times;

(3) antigen retrieval: repairing the citric acid buffer solution in a water bath kettle at 95 ℃ for 10min, and naturally cooling at room temperature;

(4) primary antibody incubation: adding primary antibody with proper concentration dropwise, incubating at 37 deg.C for 1h, washing with TBS for 3 times, each time for 1 min;

(5) and (3) secondary antibody incubation: adding 100ul anti-rabbit/mouse HRP labeled polymer dropwise, incubating at 37 deg.C for 30min, washing with TBS for 3 times, each time for 1 min;

(6) DAB color development: adding 100ul of color developing agent dropwise, incubating at room temperature for 5-10min, and washing with distilled water;

(7) hematoxylin counterstaining and dehydration: counterstaining with hematoxylin for 2 min; dehydrating alcohol at each stage (70% -100%), and each stage for 5 min; placing xylene for 10min, and sealing;

(8) and (6) microscopic examination.

The results are shown in FIG. 5, in which FIG. 5 shows the expression of AMH of Epinephelus lanceolatus at different stages of gonadal development, and (A) shows the section results of the distribution change of AMH in female at different times: A-C is female second-stage gonad, D-F is female third-stage gonad; (B) the graph shows the results of slicing at different multiples for the distribution change of AMH in facultative: A-C is the sexual prophase gonad, D-F is the sexual metaphase gonad, G-I is the anaphase gonad; (C) the graph shows the results of slicing at different fold for the distribution change of AMH in males: A-C are male gonads.

As can be seen from FIG. 5, the AMH polyclonal antibody can be used as an immunohistochemical detection method for understanding different development stages of Epinephelus lanceolatus, so that the polyclonal antibody can be applied to preparation of a detection agent for the Epinephelus lanceolatus at different development stages.

Finally, it is also noted that the above-mentioned lists merely illustrate a few specific embodiments of the invention. It is obvious that the invention is not limited to the above embodiments, but that many variations are possible. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.

Sequence listing

<110> Zhongshan university

<120> Epinephelus lanceolatus anti-mullerian hormone AMH gene, encoding protein and application thereof

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1554

<212> DNA

<213> anti-Mullerian hormone (anti-Mullerian hormone)

<400> 1

atgctgtttg tggacatctt ctcctgtgga gcgctgatgc tctgctgcgc ccggctctgt 60

gcagccctgc aggtctcaca tggaaagcag ctgatggaca accccgcagt gacagagcac 120

acccctccat cagcctccac agtctcccat cacgcccctc acagtgcgcc gtgctttgtg 180

gatgacatat ttgcagcact acgtgaaggt gttgggagcc acggtgaact cacaaaccgc 240

agtttggctc agtttgggat ctgcactgaa tctgacagct cttcagtctt attacagctg 300

gctaaggaca caaacaaaaa ccagggaaat ggattggagg ttcatccagg tggaggaatc 360

agaggtgtca aagatgagac gggaactctc gtgttgacct ttgacctctc actgtcccct 420

ttgctgaagg tgaaccctgt gctgctgttg gcgtttgaaa gtccgctcac aggacgaaac 480

ctggatatca ctttcacgag tcagtcgctg catccaagca cacagtctgt gtgcatctca 540

ggagaaacgc agtacatatt gctgacagga aaagcaacac aaggcaacgt tcagcagact 600

tggacaattt ctgttgagac aaaaacccct gacatgaacc aaatcctaaa agacatcctc 660

attggtggaa aaccaggaag taacaccagc gtcactcctc ttctgctttt ctctgtggaa 720

agaggatctg atacaagaca tacacacgcc tcttcacaca cctccttctt ctgtgagctg 780

aagcgtttcc tgcgtgacgt cctgcctcag gaccactctg cgtcctctcc cctccagctg 840

gactccctgc agtccctgcc tcctctcacg ctagacttat cctccagcga gaccctgctg 900

gcaggactga tcaactcctc ctcccccacc atcttctcct tcaccggctg ttgctccatg 960

tttcagacgc acgatggaga gctggccttg tctcctgcgc tgctggagga ggtcaagcgc 1020

aggttggagc agactgtggt gcaggtaatg gaggtaataa tggaggagga ggtcggtcac 1080

agagctgcag agagcctggg aaggctcaga gatctcagtg catttccgaa gacggaacca 1140

gcagcaggag ggagccagta ccgtgcgttc ctcctgctga aggccctaca gacggtagcc 1200

ggtgcatatg aggtgcagag aggactgcgg gcgaccagag ctggacccaa caacccagcg 1260

agaggcaacc tatgtgggct gaggagcctc actgtgtccc ttgaaaagcg tgttgtggga 1320

ccaaacactg ccaacatcaa caactgccat ggctcctgtg ctttccccat ggtcaacacc 1380

aacaaccacg ccgtcctgct cagcttccac atcgagagtg agaatgcaga cgagcagggc 1440

gccgtgctgt gtgcctgtgg cctatcacgc cctggaggtg gtagacttga acgaacatgg 1500

gacgtacttg tccattacac cagatatggt ggcgaaggag tgtggatgcc gtta 1554

<210> 2

<211> 518

<212> PRT

<213> anti-Mullerian hormone (anti-Mullerian hormone)

<400> 2

Met Leu Phe Val Asp Ile Phe Ser Cys Gly Ala Leu Met Leu Cys Cys

1 5 10 15

Ala Arg Leu Cys Ala Ala Leu Gln Val Ser His Gly Lys Gln Leu Met

20 25 30

Asp Asn Pro Ala Val Thr Glu His Thr Pro Pro Ser Ala Ser Thr Val

35 40 45

Ser His His Ala Pro His Ser Ala Pro Cys Phe Val Asp Asp Ile Phe

50 55 60

Ala Ala Leu Arg Glu Gly Val Gly Ser His Gly Glu Leu Thr Asn Arg

65 70 75 80

Ser Leu Ala Gln Phe Gly Ile Cys Thr Glu Ser Asp Ser Ser Ser Val

85 90 95

Leu Leu Gln Leu Ala Lys Asp Thr Asn Lys Asn Gln Gly Asn Gly Leu

100 105 110

Glu Val His Pro Gly Gly Gly Ile Arg Gly Val Lys Asp Glu Thr Gly

115 120 125

Thr Leu Val Leu Thr Phe Asp Leu Ser Leu Ser Pro Leu Leu Lys Val

130 135 140

Asn Pro Val Leu Leu Leu Ala Phe Glu Ser Pro Leu Thr Gly Arg Asn

145 150 155 160

Leu Asp Ile Thr Phe Thr Ser Gln Ser Leu His Pro Ser Thr Gln Ser

165 170 175

Val Cys Ile Ser Gly Glu Thr Gln Tyr Ile Leu Leu Thr Gly Lys Ala

180 185 190

Thr Gln Gly Asn Val Gln Gln Thr Trp Thr Ile Ser Val Glu Thr Lys

195 200 205

Thr Pro Asp Met Asn Gln Ile Leu Lys Asp Ile Leu Ile Gly Gly Lys

210 215 220

Pro Gly Ser Asn Thr Ser Val Thr Pro Leu Leu Leu Phe Ser Val Glu

225 230 235 240

Arg Gly Ser Asp Thr Arg His Thr His Ala Ser Ser His Thr Ser Phe

245 250 255

Phe Cys Glu Leu Lys Arg Phe Leu Arg Asp Val Leu Pro Gln Asp His

260 265 270

Ser Ala Ser Ser Pro Leu Gln Leu Asp Ser Leu Gln Ser Leu Pro Pro

275 280 285

Leu Thr Leu Asp Leu Ser Ser Ser Glu Thr Leu Leu Ala Gly Leu Ile

290 295 300

Asn Ser Ser Ser Pro Thr Ile Phe Ser Phe Thr Gly Cys Cys Ser Met

305 310 315 320

Phe Gln Thr His Asp Gly Glu Leu Ala Leu Ser Pro Ala Leu Leu Glu

325 330 335

Glu Val Lys Arg Arg Leu Glu Gln Thr Val Val Gln Val Met Glu Val

340 345 350

Ile Met Glu Glu Glu Val Gly His Arg Ala Ala Glu Ser Leu Gly Arg

355 360 365

Leu Arg Asp Leu Ser Ala Phe Pro Lys Thr Glu Pro Ala Ala Gly Gly

370 375 380

Ser Gln Tyr Arg Ala Phe Leu Leu Leu Lys Ala Leu Gln Thr Val Ala

385 390 395 400

Gly Ala Tyr Glu Val Gln Arg Gly Leu Arg Ala Thr Arg Ala Gly Pro

405 410 415

Asn Asn Pro Ala Arg Gly Asn Leu Cys Gly Leu Arg Ser Leu Thr Val

420 425 430

Ser Leu Glu Lys Arg Val Val Gly Pro Asn Thr Ala Asn Ile Asn Asn

435 440 445

Cys His Gly Ser Cys Ala Phe Pro Met Val Asn Thr Asn Asn His Ala

450 455 460

Val Leu Leu Ser Phe His Ile Glu Ser Glu Asn Ala Asp Glu Gln Gly

465 470 475 480

Ala Val Leu Cys Ala Cys Gly Leu Ser Arg Pro Gly Gly Gly Arg Leu

485 490 495

Glu Arg Thr Trp Asp Val Leu Val His Tyr Thr Arg Tyr Gly Gly Glu

500 505 510

Gly Val Trp Met Pro Leu

515

<210> 3

<211> 18

<212> DNA

<213> Oligo thymine primer (Oligo dT)

<400> 3

tttttttttt tttttttt 18

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgctgtttg tggacatctt c 21

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

taacggcatc cacactcctt cgcc 24

<210> 6

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccggaattcc tgcaggtctc acatggaaag c 31

<210> 7

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ccgctcgagt aacggcatcc acactccttc gcc 33

Claims

1. A preparation method of anti-mullerian hormone AMH mature peptide gene of epinephelus lanceolatus is characterized by comprising the following steps:

(1) extracting total RNA from the existing epinephelus lanceolatus;

(2) reverse transcription is carried out to synthesize cDNA by taking the total RNA extracted in the step (1) as a template and taking RNA Oligo dT with the nucleotide sequence shown as SEQ ID NO. 3 as a primer;

(3) using cDNA as a template, and using SEQ ID NO: 4. SEQ ID NO:5 is an upstream primer and a downstream primer, and the anti-mullerian hormone AMH gene of the epinephelus lanceolatus is obtained by PCR amplification, and the nucleotide sequence of the gene is shown as SEQ ID NO: 1 is shown in the specification;

a pair of upstream primers SEQ ID NO: 6(ccggaattcctgcaggtctcacatggaaagc) and the downstream primer containing the XhoI cleavage site SEQ ID NO: 7(ccgctcgagtaacggcatccacactccttcgcc), and amplifying to obtain the mature peptide gene of anti-mullerian hormone AMH of the epinephelus lanceolatus.

2. An anti-mullerian hormone, AMH, mature peptide gene of epinephelus lanceolatus prepared by the method of claim 1.

3. An expression vector characterized by: contains the anti-mullerian hormone AMH mature peptide gene as claimed in claim 2.

4. The expression vector of claim 3, wherein: the expression vector is an Escherichia coli expression vector pET32 a-AMH.

5. A recombinant strain characterized by: an Escherichia coli recombinant strain pET32a-AMH-Rosetta formed by transferring the Escherichia coli expression vector pET32a-AMH described in claim 4 into an Escherichia coli Rosetta strain.

6. An expression method of anti-mullerian hormone AMH recombinant protein of epinephelus lanceolatus is characterized by comprising the following steps:

(1) culturing the recombinant strain of claim 5;

(2) purification and renaturation treatment of anti-mullerian hormone AMH recombinant protein.

7. Use of an expression vector according to claim 3 in the preparation of an inducer for sex conversion in female Epinephelus lanceolatus to induce sex conversion in male Epinephelus lanceolatus.

8. A polyclonal antibody prepared by immunizing an animal with the recombinant protein of Epinephelus lanceolatus anti-Mullerian hormone AMH obtained by the expression method according to claim 6 as an antigen.

9. Use of a polyclonal antibody according to claim 8 for the preparation of a detection agent for grouper saddletree at different developmental stages.