CN115058430A - Scylla paramamosain 5-HT2 receptor gene and application thereof - Google Patents
Scylla paramamosain 5-HT2 receptor gene and application thereof Download PDFInfo
- Publication number
- CN115058430A CN115058430A CN202210658740.9A CN202210658740A CN115058430A CN 115058430 A CN115058430 A CN 115058430A CN 202210658740 A CN202210658740 A CN 202210658740A CN 115058430 A CN115058430 A CN 115058430A
- Authority
- CN
- China
- Prior art keywords
- htr2
- scylla paramamosain
- seq
- sequence
- race
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70571—Receptors; Cell surface antigens; Cell surface determinants for neuromediators, e.g. serotonin receptor, dopamine receptor
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43509—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from crustaceans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/06—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies from serum
- C07K16/065—Purification, fragmentation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/286—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against neuromediator receptors, e.g. serotonin receptor, dopamine receptor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Wood Science & Technology (AREA)
- Neurology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Insects & Arthropods (AREA)
- Cell Biology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention relates to a Scylla paramamosain 5-HT2 receptor gene and application, wherein the gene sequence of the Scylla paramamosain 5-HT2 receptor gene is shown as SEQ NO.1, the invention provides a cloning method for cloning Scylla paramamosain 5-HTR2 gene, primers are designed according to the EST sequence of 5-HTR2, 5-HTR 23 'and 5' RACE are obtained by transcription, and the full-length sequence of Scylla paramamosain 5-HTR2 gene is obtained after splicing with the EST sequence, the invention also provides a method for preparing Scylla paramamosain 5-HTR2 gene polyclonal antibody, compared with the prior art, the invention has the following advantages: the Scylla paramamosain 5-HTR2 gene can be widely involved in the behavioral mechanism of Scylla paramamosain, the research on the 5-HTR2 receptor gene and the preparation of the antibody thereof can lay a theoretical basis for the research on the behavior and physiological mechanism of crabs and the function of a 5-HT receptor, and can also provide a new direction for the refined culture of crabs.
Description
Technical Field
The invention relates to the field of molecular biology, in particular to a scylla paramamosain 5-HT2 receptor gene and application thereof.
Background
In crustaceans of the order decapod, all body organ systems are under the combined regulation of the nervous system and the endocrine system. The neuroendocrine system controls various physiological processes of the body such as molting, growth and sexual maturity, and the synthesis and release of neurohormones are regulated by biogenic amine. 5-hydroxytryptamine (5-HT) is an inhibitory neurotransmitter, widely distributed in central nervous tissue and peripheral nervous tissue of crustacean, and can indirectly regulate and control various physiological effects and behaviors by influencing synthesis and release of neurohormones in neuroendocrine system. The 5-hydroxytryptamine receptor (5-HTR) is a transmembrane protein combined with 5-hydroxytryptamine on cell membranes. It has been found that 5-HT and its receptors play an extremely important role in the physiological processes of animals. 5-HT must be bound with corresponding receptors to play a role, and under the mediation of the corresponding receptors, the 5-HT participates in various behaviors such as regulation and control of attack, feeding, cognition, social level, emotion regulation and the like.
Scylla paramamosain belongs to Crustacea, Decapode, Brachypoda, Saracaceae and Syclada DeHann, has the characteristics of large individual, quick growth, strong adaptability, delicious meat taste, rich nutrition and the like, becomes a worldwide economic breeding variety, and has higher economic benefit and social benefit. The green mud crabs are strongly fighter in nature, the fighting action causes the mutual killing phenomenon in the species to be extremely serious, and the fighting causes the appearance of amputated crabs, thereby influencing the survival, growth and quality of the crabs and increasing the breeding cost. With the continuous improvement of the intelligent level of cultivation, the research on the physiology and behavior of scylla paramamosain under the cultivation condition is increasingly emphasized. Under the induction of a stress source, the scylla paramamosain can generate adaptive physiological change to stimulate the release and conversion of 5-HT and participate in a series of behavioral manifestations such as regulation of animal stress, endocrine and emotional response by mediating corresponding receptors. At present, the research on the function and the receptor of the Scylla paramamosain 5-HT has not been reported, so that further research on the behavior mechanism of the Scylla paramamosain in which the 5-HT2 participates is necessary.
Disclosure of Invention
The invention aims to solve the technical problem of providing a 5-HT2 receptor gene of Scylla paramamosain aiming at the current situation of the prior art.
The invention aims to solve another technical problem of providing an application of a scylla paramamosain 5-HT2 receptor gene aiming at the current state of the prior art.
The technical scheme adopted by the invention for solving the first technical problem is as follows: the method is characterized in that: the scylla paramamosain 5-HT2 receptor gene is Sp5-HTR2, and the nucleotide sequence of Sp5-HTR2 is shown in SEQ NO. 1.
AAGAGGCTAACCCCCCTCATGCCCACCCTAGGGGACCTCACTTTGCCCCCTCAGCCTCCCACGAACGCTAGGGACCTTGATGTGTCCCTTCATCCCTTAACCCCCCTGAACCTCACAACACTTCTCGCCACCCCACAAAATGTTACGCTTGGGAACTTAACATGGGAGGAGGAGGGGGAGGAGGGCACGGGAGGAGGAGGCACCGGTTCGCCCCCTGCCAACTGGTGGGGACTGGTGGCGCTACTGGTGGTGCTGTTGACGCTGTTTGGAAATATACTGCTGATTCTGGCCATCTCGTGGGATCGTCGTCTTCAGAATATGACAAACTACTTCCTGCTCTCTCTCGCTGTGACGGACCTCATGGTTGCCTCGCTGGTGATGCCGCTGTCCATCGTAGTCCTCGTCCTTGGCCACTTCCCGTTTTCTTCCGAGCTGTGCCTGTTATGGATCTCCCTGGACGTTCTCTTCTGCACCGCCTCCATCATGCACCTGTGTACCCTCTCCGTGGACCGCTTCCTCTCCCTCAGGTACCCCATCAAGTTCGGGCGCCAGAAGACGAGGCGGCGCGTGGTGCTGAAGATTGTGCTGGTGTGGTGCTTGTCGCTGGCCGCCTCGCTGCCGCTGTCCCTCATGTACGCCACGGCGCCGCACACCACCATCGTGGACGGCGTGTGTCAGATCCCAGTGTCACTCTTCCAGATCATCGGCTCCGTCATCTGCTTCTACATTCCGCTGGTCATCATGCTGGTGACTTACGCCCTCACGGTGCGCCTACTGTCCCAGAAGCAGAGTGAGCTGCATCCCTCTGTGCTGGAGCCCTCCTCAGCCTCCGCCTCCCCCTCGCCCCGCTCCCTGCGCTGGAAGAAGCTGTTGTGCAAGACCACCTCCACGCTCAGCACCAGCACGGCGGTGTCCCTCACGGACGGCGAGGTGAGCGAGGCCGCGTGTCGGCCCGAGCCCTGCGGCTCCCACACCACCAAACTGCGGCGCCTAGGCAGCAGCAGCAGCCCGCAGCGGCGCCCGCCCCTGGTGCGCTATCCAAGCCACTACCACCACCACCAACGCGCCGCGCTGGTGCGGGCTGACGGCTGCGGCATGCGGGGCTACTCCACGCGGGAGCTGCGGGAGTCCGAGGAGCAGTCCTTCCCTCAGCTCACCGCCTCGGCGCCCGCCTACGAGATGAGCGTGCTGCCCCCCGCCGCCCGCTCTGCCCCCTCCTCCACCGCCACCTCACCCCTCCACCGCCGCCACCATCACCGCCAGGCGGACGCCCCGGACGACGATGACGACTCCAGCGCCGCCCCTAGCTGCGAGCAAAACGGCGACCCCCGGGGGGGCGTGCGGGAGCGGTGCGGCGAGGAATGCGGGAGCGGCATGGGCGGGGCGGGCAGCGGGCAGGTGGCGGTGCCCTGCAGCTGCGCCCCGCGGTTCTTCCTGGAGGACATGAAGGCGCAGGACAGCCAATGCGACGAGTGCACCGTGCCGCAGCCAGAGGTGGCCGTCCACTACACGCCCCCCACGCCGCGCCGCAGCCGCGACATCACGCAGCCCCAGGAGAGAAGGAGCTGGTGCTGCTGCTGCTGCCTCGCTGCCTTCACTCGCCTCACCCGCCGCCACCACGCCCGCGAGGCGGGCGCCCCACTGTCGTCGCCGTGGCACGAGGGGTCCCCGAGAGCCCCTAAGGACATGGTCACCCGCGCCGCCCTCAGGTCCGGCGGGCAGGTGACCACACTCCTGCAGAAGGGATGTGCCGCTGATTCCGGTTCGTCGCCTCGCGGGCTGTGGCGGCAACAGTCCTGCTCTGCCTCCATCAAGTTCGTGTCTTCGAAGAGGCACGGCAGGACCCTCAGGATGGAGCAGAAGGCGACGAAGGTCCTGGGCGTCGTTTTCTTCACGTTCGTCCTGCTGTGGGCTCCGTTTTTCATCGCCAACGTGCTTATTTCCTGCGGCGCCCACATTGGGGAGGAGATGATCAACTTGGTCACTTGGCTGGGGTACGCCTCCTCCATGGTCAACCCTTTCTTCTACACCTTCTTCAATAAGACCTTCAGACAGACGTTCCTGAAGATCATTAAGTGTGAAATTAAGACGACCAGAAAGTATCATCTGTGAGGTTGTGAGTTCACGAGTCCAGTTACCAGTTATAAGCCATTTCTTCTCTCCCTTACTTTGTTAATCCTGCATCTCTCAACAAAAAAAAAAAAAAA
Further, the amino acid sequence of the scylla paramamosain 5-HT2 receptor gene is as follows:
MetProThrLeuGlyAspLeuThrLeuProProGlnProProThrAsnAlaArgAspLeuAspValSerLeuHisProLeuThrProLeuAsnLeuThrThrLeuLeuAlaThrProGlnAsnValThrLeuGlyAsnLeuThrTrpGluGluGluGlyGluGluGlyThrGlyGlyGlyGlyThrGlySerProProAlaAsnTrpTrpGlyLeuValAlaLeuLeuValValLeuLeuThrLeuPheGlyAsnIleLeuLeuIleLeuAlaIleSerTrpAspArgArgLeuGlnAsnMetThrAsnTyrPheLeuLeuSerLeuAlaValThrAspLeuMetValAlaSerLeuValMetProLeuSerIleValValLeuValLeuGlyHisPheProPheSerSerGluLeuCysLeuLeuTrpIleSerLeuAspValLeuPheCysThrAlaSerIleMetHisLeuCysThrLeuSerValAspArgPheLeuSerLeuArgTyrProIleLysPheGlyArgGlnLysThrArgArgArgValValLeuLysIleValLeuValTrpCysLeuSerLeuAlaAlaSerLeuProLeuSerLeuMetTyrAlaThrAlaProHisThrThrIleValAspGlyValCysGlnIleProValSerLeuPheGlnIleIleGlySerValIleCysPheTyrIleProLeuValIleMetLeuValThrTyrAlaLeuThrValArgLeuLeuSerGlnLysGlnSerGluLeuHisProSerValLeuGluProSerSerAlaSerAlaSerProSerProArgSerLeuArgTrpLysLysLeuLeuCysLysThrThrSerThrLeuSerThrSerThrAlaValSerLeuThrAspGlyGluValSerGluAlaAlaCysArgProGluProCysGlySerHisThrThrLysLeuArgArgLeuGlySerSerSerSerProGlnArgArgProProLeuValArgTyrProSerHisTyrHisHisHisGlnArgAlaAlaLeuValArgAlaAspGlyCysGlyMetArgGlyTyrSerThrArgGluLeuArgGluSerGluGluGlnSerPheProGlnLeuThrAlaSerAlaProAlaTyrGluMetSerValLeuProProAlaAlaArgSerAlaProSerSerThrAlaThrSerProLeuHisArgArgHisHisHisArgGlnAlaAspAlaProAspAspAspAspAspSerSerAlaAlaProSerCysGluGlnAsnGlyAspProArgGlyGlyValArgGluArgCysGlyGluGluCysGlySerGlyMetGlyGlyAlaGlySerGlyGlnValAlaValProCysSerCysAlaProArgPhePheLeuGluAspMetLysAlaGlnAspSerGlnCysAspGluCysThrValProGlnProGluValAlaValHisTyrThrProProThrProArgArgSerArgAspIleThrGlnProGlnGluArgArgSerTrpCysCysCysCysCysLeuAlaAlaPheThrArgLeuThrArgArgHisHisAlaArgGluAlaGlyAlaProLeuSerSerProTrpHisGluGlySerProArgAlaProLysAspMetValThrArgAlaAlaLeuArgSerGlyGlyGlnValThrThrLeuLeuGlnLysGlyCysAlaAlaAspSerGlySerSerProArgGlyLeuTrpArgGlnGlnSerCysSerAlaSerIleLysPheValSerSerLysArgHisGlyArgThrLeuArgMetGluGlnLysAlaThrLysValLeuGlyValValPhePheThrPheValLeuLeuTrpAlaProPhePheIleAlaAsnValLeuIleSerCysGlyAlaHisIleGlyGluGluMetIleAsnLeuValThrTrpLeuGlyTyrAlaSerSerMetValAsnProPhePheTyrThrPhePheAsnLysThrPheArgGlnThrPheLeuLysIleIleLysCysGluIleLysThrThrArgLysTyrHisLeu。
the invention also provides a method for cloning the scylla paramamosain 5-HT2 receptor gene, which is characterized by comprising the following steps: the method comprises the following steps:
(1) designing a specific primer according to the sequence information of the transcriptome, obtaining an Expression Sequence Tag (EST) of 5-HTR2 by PCR amplification by taking Scylla paramamosain cDNA as a template, connecting the obtained EST fragment with a vector, cloning and sequencing;
(2) respectively designing a 5-HTR 23 'RACE upstream primer and a 5' RACE downstream primer according to an Expression Sequence Tag (EST) of 5-HTR2, taking a RACE cDNA first chain as a template, utilizing cDNA terminal Rapid Amplification (RACE) to obtain 3 'terminal fragments and 5' terminal fragments RACE, respectively connecting the obtained 3 'terminal fragments and 5' terminal fragments with a vector, cloning and sequencing;
(3) splicing the sequenced 3 'and 5' terminal fragments with the EST sequence of 5-HTR2 to obtain the cDNA full-length sequence of the 5-HTR2 receptor.
On the basis of the scheme, the nucleotide sequences of the upstream primer and the downstream primer of the 5-HTR2 EST sequence are shown as SEQ ID NO. 3 and SEQ ID NO. 4:
3 is 5-HTR 2-EST-F: GGACTGGTGGCGCTACTG, respectively;
SEQ ID NO. 4 is 5-HTR2- -EST-R: CCCCAGCCAAGTGACCAAGTT are provided.
Based on the scheme, the nucleotide sequence of the 3' RACE upstream primer of the 5-HTR2 is shown as SEQ ID NO: 5 and SEQ ID NO: 6, showing:
SEQ ID NO: 5 is 5-HTR 2-3' Race-outer: GGGCAGGTGACCACACTCCTGCAGAAG, respectively;
SEQ ID NO: 6 is 5-HTR 2-3' Race-inner: CAGTCCTGCTCTGCCTCCATCAAGTTCGT is added. The nucleotide sequence of the 5' RACE downstream primer of the 5-HTR2 is shown as SEQ ID NO: 7 and SEQ ID NO: 8, showing:
based on the scheme, the nucleotide sequence of the 5' RACE downstream primer of the 5-HTR2 is shown as SEQ ID NO: 7 and SEQ ID NO: 8, showing:
SEQ ID NO: 7 is 5-HTR 2-5' Race-outer: CCGTCACAGCGAGAGAGAGCAGGAAGTA; SEQ ID NO: 8 is 5-HTR 2-5' Race-inner: AAGACGACGATCCCACGAGATGGCCAGA are provided.
On the basis of the scheme, the nucleotide sequence of the specific primer of the 5-HTR2 gene is shown as SEQ ID NO: 9 and SEQ ID NO: 10, and:
SEQ ID NO: 9 is 5-HTR 2-F: GACGTTCCTGAAGATCATTAAGTGTG, respectively;
SEQ ID NO: 10 is 5-HTR 2-R: CTGGACTCGTGAACTCACAAC are provided.
The invention also provides a preparation method of the Scylla paramamosain 5-HTR2 polyclonal antibody, which is characterized by comprising the following steps: the method comprises the following steps:
(1) screening 5-HTR2 antigen polypeptide sequence and synthesizing;
(2) coupling the polypeptide obtained in the step (1) with KLH to prepare an antigen immune rabbit, and obtaining immune serum;
(3) separating and purifying the serum obtained in the step (2) to obtain a purified antibody, and measuring the titer and the concentration, namely the Scylla paramamosain 5-HTR2 polyclonal antibody.
Further, the sequence of the antigen polypeptide used in step (1) is TLPPQPPTNARDLDC, and the polypeptide synthesized in the antigen: KLH was 1mg: 680. mu.g.
In order to solve the second technical problem, the invention also provides the application of the Scylla paramamosain 5-HTR2 gene.
Compared with the prior art, the invention has the following advantages: the application clones the Scylla paramamosain 5-HTR2 gene for the first time, successfully prepares a 5-HTR2 polyclonal antibody according to the sequence characteristics of the Scylla paramamosain 5-HTR2 gene, performs related expression analysis, analyzes the expression difference of the 5-HTR2 gene in different tissues of the Scylla paramamosain injected with 5-HT2 at different time, and performs protein immunoblotting (Western Blot, WB) analysis and verification by using the prepared 5-HTR2 polyclonal antibody, shows that the 5-HT2 participates in the behavior mechanism of the Scylla paramamosain, is helpful for disclosing the behavior and physiological adaptation strategy of the Scylla paramamosain, and has good application prospect in the development of new drugs such as anti-anxiety and the like and the fine culture management of the Scylla paramamosain.
Drawings
FIG. 1 is a diagram of the full-length cDNA and deduced amino acid sequence of Scylla paramamosain Sp5-HTR2 of the present invention, wherein the capital letters indicate the 5 'and 3' noncoding region sequences, the lowercase letters indicate the ORF coding sequences, and the nucleotide and amino acid sequences are numbered; the start codon (ATG) is shown in bold and single underlined, the stop codon (TGA) is shown in bold and with an asterisk; the 7 conserved transmembrane helical regions were marked with a gray background (68-94 aa, 101-129aa, 137-170aa, 180-206aa, 224-260aa, 605-641aa, 645-673aa, respectively), and the highly conserved amino acid residue sequence "NPXXY" is indicated by a block marker (666-670 aa);
FIG. 2 is a phylogenetic tree of amino acid sequences of Scylla paramamosain Sp5-HTR2 and other species 5-HTR2 according to the present invention;
FIG. 3 is a diagram showing the alignment result of amino acid sequences of Scylla paramamosain Sp5-HTR 2; through multiple sequence alignment, the Scylla paramamosain Sp5-HTR2 has a conserved functional motif 'NPXXY', 7 putative transmembrane helical regions and 7 conserved transmembrane helical regions marked by shading as the amino acid sequence of 5-HTR2 of other species;
FIG. 4 is a three-dimensional structure diagram of the proteins of Scylla paramamosain Sp5-HTR2 and human 5-HTR2 of the present invention; wherein (A) is a three-dimensional structure diagram of Sp5-HTR 2N end; (B, E) three-dimensional structure diagram of homo sapiens 5-HTR 2; (C) a three-dimensional map of the Sp5-HTR 2N-terminus overlapping homo sapiens 5-HTR 2; (D) sp5-HTR 2C end three-dimensional structure diagram; (F) a three-dimensional structure diagram of overlapping an Sp5-HTR 2N end with homo sapiens IKB alpha;
FIG. 5 shows the level of 5-HTR2 protein in different tissues of Scylla paramamosain of the present invention by Western blot analysis (shown in the figure, lane 1 is muscle, lane 2 is gill, lane 3 is ganglion, lane 4 is hepatopancreas);
FIG. 6 shows the expression results of 5-HTR2 in different tissues of Scylla paramamosain of the present invention (. P < 0.05);
FIG. 7 is a graph showing the results of real-time quantitative PCR analysis of the change in the expression of 5-HTR2 in the muscle of Scylla paramamosain after injection of 5-HT2 in accordance with the present invention (P < 0.05);
FIG. 8 is a graph showing the results of the real-time quantitative PCR analysis of the expression change of 5-HTR2 in Scylla paramamosain after the injection of 5-HT2 in accordance with the present invention (. about.P < 0.05);
FIG. 9 is a graph of the results of real-time quantitative PCR analysis of the change in expression of 5-HTR2 in Scylla paramamosain thoracic ganglia after injection of 5-HT2 in accordance with the present invention (P < 0.05);
FIG. 10 is a graph showing the results of the real-time quantitative PCR analysis of the 5-HTR2 expression changes in Scylla paramamosain brain ganglia after injection of 5-HT2 in accordance with the present invention (. P < 0.05);
FIG. 11 shows the expression level of 5-HTR2 protein in Scylla paramamosain brain ganglia after 5-HT2 injection by Western blot analysis (1-7 are 0h, 0.5h, 1h, 2h, 4h, 12h and 24h injection, respectively) in the present invention.
Detailed Description
The invention is further illustrated by the following figures, sequence listing and examples.
Example 1
The invention relates to a Scylla paramamosain 5-HTR2 cDNA sequence cloning method
1. The specific operation is as follows:
(1) extracting total RNA of Scylla paramamosain: sampling scylla paramamosain larva, storing in-80 deg.C refrigerator, and using
The reagents extract total RNA, determine RNA concentration and purity using a spectrophotometer, and check its integrity using agarose gel electrophoresis. Performing reverse transcription by using M-MLV reverse transcriptase and Oligo dT primer to obtain a first chain of scylla paramamosain cDNA;
(2) obtaining an Expressed Sequence Tag (EST) of Scylla paramamosain 5-HTR 2: designing specific primers from transcriptome sequencing data of Scylla paramamosain, and performing PCR amplification to obtain 5-HTR2 cDNA core fragment. The PCR reaction system is 50 μ L: 2.0. mu.L of cDNA template, 1.0. mu.L of each of the upstream and downstream primers,
PCR SuperMix45μL，ddH 2 o1.0. mu.L. The PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 2 min; denaturation at 94 ℃ for 30sec, annealing at 62 ℃ for 30sec, extension at 68 ℃ for 2min, 38 cycles. After the PCR is finished, analyzing by adopting 1.5% agarose gel electrophoresis, after cutting and recovering gel, connecting a pGM-T vector, transforming a high-efficiency chemically competent cell DH5 alpha, selecting positive clone bacteria, sending the positive clone bacteria to a company for sequencing, and verifying whether the fragment is correct or not by using a primer for bacterial liquid PCR and sequencing;
(3)3 'RACE and 5' RACE synthesis: based on the Expressed Sequence Tag (EST) of the obtained 5-HTR2, 3 'RACE upstream Primer and 5' RACE downstream Primer were designed using Primer Premier 6.0 software. By using GeneRacer TM The Kit was used for 3 'RACE and 5' RACE synthesis. A first round of PCR was performed using 5-HTR2-3 '(5') RACE-outer and 3(5 ') GeneRacer outer primer using RACE cDNA first strand as template according to the manufacturer's instructions in 25. mu.L. The PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 2 min; 94 ℃ 30sec, 72 ℃ 30sec, 5 cycles; 94 ℃ 30sec, 70 ℃ 30sec, 5 cycles; 94 ℃ 30sec, 66 ℃ 30sec, 25 cycles. Then, using the first round PCR product as a template, 5-HTR2-3 '(5')Race-inner and 3 (5') GeneRacer inner primer for the second round of PCR reaction under the following conditions: pre-denaturation at 94 ℃ for 2 min; 30sec at 94 ℃ and 30sec at 66 ℃ for 30 cycles. After the PCR is finished, 1.5% agarose gel electrophoresis is adopted for analysis, after gel cutting and recovery, the PCR is connected with a pGM-T vector, a high-efficiency chemically competent cell DH5 alpha is transformed, positive clone bacteria are selected and sent to a company for sequencing, and primers are used for PCR verification of bacterial liquid to determine whether the fragment is correct and for sequencing.
(4) The full-length cDNA sequence of the Scylla paramamosain 5-HTR2 is as follows: after removal of the Vector sequence, 5-HTR 23 'and 5' RACE obtained by sequencing were spliced to the EST sequence using Vector NTI Suite 7 software to obtain the full-length cDNA sequence of 5-HTR2, and specific primers were designed for the 5 'and 3' noncoding regions for validation and sequencing.
(5) The primer sequences are shown below:
the results show that: the complete cDNA sequence representing 5-HTR2 was obtained by overlapping the EST sequence and the amplified fragment, and the full length of the cDNA sequence consisted of 1473bp, with an Open Reading Frame (ORF) of 2094 bp. The 5 'non-coding Region (UTR) was 18bp and the 3' non-coding Region was 95 bp. The ORF encodes 697 amino acids, and the predicted protein molecular weight is 76.61kDa with a theoretical isoelectric point of 8.70 (shown in FIG. 1). The deduced amino acids from Sp5-HTR2 showed similarity to 5-HTR from other crustacean species, with 93% sequence similarity to Portunus trituberculatus 5-HTR (see FIG. 2). The tree topology is based on the CRD domain from Sp5-HTR2 and CRD domains from other invertebrates and reveals the relationship of Sp5-HTR2 to other invertebrates 5-HTR (as shown in FIG. 2).
2. Sequence analysis
The sequences obtained by sequencing were subjected to BLAST alignment analysis (http:// www.ncbi.nlm.nih.gov/BLAST). Analysis of full-Length sequence ORFs Using the Online ORF Finder Web site (https://www.ncbi.nlm.nih.gov/ orffinder/). (ii) amino acid sequence deduced from cDNA sequence by ExPASy website: (http:// www.expasy.org/tools/)Provide forThe analysis tool of (2) performs primary sequence analysis of protein, such as physicochemical properties, hydrophilicity and hydrophobicity and the like. Signal peptide analysis Using SignalP5.0 program (http://www.cbs.dtu.dk/services/SignaIP/)Domain analysis using SMART website: (http://smart.embl-heidelberg.de/)Homology analysis is carried out by using Cluster X multi-sequence alignment software, and a phylogenetic tree is constructed by using an adjacency method (NJ) in a Mega software package. The three-dimensional structure adopts SWISS-MODEL software to carry out homologous modeling.
The results show that: the predicted molecular weight of the mature peptide is 76.61kDa and the peptide contains 697 amino acid residues. The 5-HTR2 protein has a conserved 5-HTR domain with 7 conserved transmembrane helical regions when analyzed by SMART software (see FIG. 1). Analysis by SignalP software showed no signal peptide in the sequence. The phylogenetic tree shows that scylla paramamosain Sp5-HTR2 is evolutionarily closer to Portunus trituberculatus (portuguetus trituberculatus) and is clustered into one branch with other crustaceans 5-HTR2, while mammals, amphibians and teleosts 5-HTR2 are clustered into one branch each (see fig. 2). The results of homology analysis show that the amino acid sequence consistency of Scylla paramamosain 5-HTR2 and other species 5-HTR2 is between 21% and 96%, and is higher in crustaceans, and is between 68% and 96% (see figure 3). The resulting Sp5-HTR2 three-dimensional structure was predicted to be composed of 5 alpha helices and 0 beta sheets in the N-terminal part and 3 alpha helices and 0 beta sheets in the C-terminal part, and to be highly similar to the three-dimensional structure of homo sapiens 5-HTR2 (see fig. 4), to predict that Sp5-HTR2 of scylla paramamosain is highly similar to the three-dimensional structure of homo sapiens 5-HTR 2.
Example 2Sp5-HTR2 polyclonal antibody preparation method
The method comprises the following specific steps:
(1) analyzing and designing specific epitope of scylla paramamosain 5-HTR2 protein: performing antigen epitope analysis on the Scylla paramamosain 5-HTR2 amino acid sequence by using biological information software, evaluating transmembrane segment, polypeptide activity, hydrophilicity, antigenicity and other indexes, finally determining the peptide segment of the Scylla paramamosain 5-HTR2 protein antigen epitope at the 8 th to 21 th amino acid of the amino acid sequence, and determining that the synthetic polypeptide amino acid sequence is TLPPQPPTNARDLDC;
(2)5-HTR2 polypeptide antigen synthesis coupled to KLH: the method is characterized in that a polypeptide automatic synthesizer is adopted to synthesize and purify Scylla paramamosain 5-HTR2 polypeptide, and mass spectrometry and high performance liquid chromatography are adopted to carry out purity identification, wherein the purity is required to be more than 85%. 10mg/mL KLH was dissolved in 5mM EDTA aqueous solution to prepare 40mg/mL Sulfo-SMCC solution, which was added dropwise to KLH and left at room temperature for 1h, and 2L of 1 XPBS was dialyzed 2 times at 4 ℃ to preserve the solution. The polypeptides were dissolved in DMSO, according to the polypeptide: KLH was immediately added at a ratio of 1 mg/680. mu.g, and the mixture was reacted at 4 ℃ overnight or at room temperature for 2 hours, dialyzed against 4L of 1 XPBS, and the dialyzed KLH-peptide conjugate was stored at-20 ℃;
(3) rabbit immunization: taking the KLH-peptide obtained in the step (2) as an antigen to immunize a New Zealand white rabbit, and mixing the antigen with an adjuvant 1: 1, mixing, wherein the concentration of the primary immune antigen is 1mg/ml, adopting complete adjuvant, 0.5 ml/rabbit, halving the antigen amount of the secondary immune-quaternary immune, and adopting incomplete adjuvant. Multiple subcutaneous injections are adopted, secondary immunization is carried out 14 days after the first immunization, and the interval time between the secondary immunization and the fourth immunization is 7 days. And respectively taking blood from the ear artery after the three-immunization and the four-immunization to detect the titer and the specificity of the antibody by ELISA. Collecting whole blood by taking blood from heart after immunization;
(4) antibody purification: 10m of serum to be purified is taken into a 50mL centrifuge tube and is filtered by a microporous filter membrane with the pore diameter of 0.45 mu m and the diameter of 25 mm. Purifying the filtered serum by a protein purifier at a sample loading flow rate of 40mL/h, eluting with glycine solution (pH2.7,0.2M), concentrating the purified antibody by an ultrafiltration concentration tube, and detecting the titer of the polyclonal antibody by indirect ELISA;
(5) western blotting identification: collecting muscle, ganglion, hepatopancreas and gill tissues of the healthy Scylla paramamosain, extracting total protein by adopting a total protein extraction kit, and then quantifying the total protein by adopting a BCA quantification kit; performing SDS-PAGE power analysis by adopting total protein loading of 60 mu g per hole, then performing protein membrane transfer, soaking in methanol of a PVDF membrane for 20sec, and then transferring to Tris-Glycine transfer buffer (containing 5% methanol) for balancing for at least 5 min; the SDS-PAGE gel was equilibrated in Tris-Glycine transfer buffer for at least 30 min; under cooling conditions, the product can be fully wet-rotated at constant pressure of 100vAnd (5) film 2 h. After the membrane transfer was complete, the membrane was blocked in T-TBS (containing 5% BSA) at room temperature for 1h, and then rinsed 3 times in T-TBS 5min each time. The 5-HTR2 polyclonal antibody prepared was used to raise the antibody at a rate of 1: 100 dilutions were dissolved in T-TBS (3% BSA) and incubated overnight at 4 ℃; then, the plate was rinsed 4 times with T-TBS for 5 min. Mixing the raw materials in a ratio of 1: 10000 GAPDH was used as an internal control, goat anti-rabbit IgG (H + L) (1:5000) was added and incubated at room temperature for 1H, followed by 5min and 5 rinses in T-TBS. By using
West Dura Extended Duration Substrate, according to the instruction, prepare about 1ml ECL working solution, incubate the transfer film for 1min at room temperature, then remove the surplus ECL reagent, the plastic wrap is sealed, put X-ray film in the magazine and expose for 5-10min, develop and fix, the result is analyzed with ImageJ software.
The results show that: the results of rabbit polyclonal antibodies measured using ELISA were positive and reproducible; the ELISA result can be known according to a calculation formula that OD positive/OD negative is more than or equal to 2.1, and the titer of the prepared polyclonal antibody is as high as 1: 1024000. the positive serum or the purified antibody of the immune rabbit is used as a primary antibody to detect the expression of the 5-HTR2 protein, and clear and single 5-HTR2 protein expression bands can be obtained, so that the prepared antibody has resistance and good specificity (the specific result is shown in figure 5).
Example 35 real-time quantitative PCR analysis of the HTR2 Gene in different tissues of Scylla paramamosain
Muscle, ganglion, hepatopancreas and gill tissues were collected from healthy scylla paramamosain. A total of 9 crabs were sampled, each tissue being bio-replicated with 3 bio-replicates x3 crabs. Tissues were stored at-80 ℃ for total RNA extraction and then reverse transcribed to give cDNA. The distribution of 5-HTR2 receptors in each tissue of Scylla paramamosain was determined using a quantitative RT-PCR assay with a CFX384 multiplex real-time fluorescent quantitative PCR instrument (Bio-Rad, USA). Three experimental replicates and three biological replicates were performed. Amplifying an 80bp fragment of 5-HTR2 using primers 5-HTR2-F and 5-HTR 2-R; and Scylla paramamosain GAPDH (Genebank access: JX268543.1) was used as an internal reference. The RT-PCR reaction system is 20 mu L: SDW 8. mu.L, Power
Green Master Mix 10. mu.L, positive and negative primers (10uM) each 0.5. mu.L, cDNA 1.0. mu.L. The reaction conditions are 95 ℃ and 1 min; fluorescence was collected at 95 deg.C, 15sec, 63 deg.C, 25sec, 40 cycles, and melting point profile 55to 95 deg.C. Use 2 -ΔΔCt The method calculates relative expression level of 5-HTR2, and adopts one-way analysis of variance, P<0.05 is statistically significant.
The primer sequences are as follows:
the results show that: RT-PCR analysis showed that the 5-HTR2 receptor was expressed in the muscle, ganglia, hepatopancreas and gills of Scylla paramamosain with the highest expression in ganglia (P <0.05) followed by gills with the lowest expression in hepatopancreas (see FIG. 6). In normal crab WB, the expression level of 5HT2 receptor was detected in muscle, gill and ganglia, and showed no significant expression in the hepatopancreas (see fig. 5).
Example 4 real-time quantitative PCR and Western blotting analysis of the Effect of injection of 5-HT2 on expression of 5-HTR2 protein
The Scylla paramamosain is from wild Scylla paramamosain in sea area near Chinese elephant mountain, the Scylla paramamosain with regular specification and good activity is selected and temporarily cultured in a crab apartment for 10 days, and a single Scylla paramamosain is cultured in a separate box body. To investigate the effect of 5-HT2 on the expression of 5-HTR2 protein, different doses of 5-HT2 were injected per Scylla paramamosain, at an injection rate of 5. mu.g/g. A blank control group (CK group) and a normal saline injection group (NS group) were also provided. Each dose included three replicates. Collecting 3 crabs in each group 0, 0.5, 1, 2, 4, 12 and 24 hours after injection, collecting muscle, thoracic ganglion, brain ganglion and gill tissues, freezing in liquid nitrogen, and performing RNA extraction and WB. A total of 189 scylla paramamosains were collected and divided into three groups: 5-HT2 group, CK group and NS group. Thus, there were 63 crabs per group, with three biological replicates. All experiments were replicated at least three times independently and the data are expressed as mean ± Standard Deviation (SD). Statistical analysis of RNA expression data was performed using one-way anova, and p <0.05 was considered to be statistically significant.
The results show that: RT-PCR analysis shows that after the injection of 5-HT2, the 5-HTR2 receptors in muscles, gills, thoracic ganglia and brain ganglia basically show a tendency of firstly decreasing and then increasing on the whole (figures 7-10), which is probably because the injection of Scylla paramamosain can generate adaptive physiological change under the induction of a stress source, stimulate the expression of 5-HTR2, and further participate in a series of behavioral manifestations such as regulation of stress, endocrine and emotional response of animals. Meanwhile, the expression level was significantly increased (P <0.05) in the brain ganglion and the thoracic ganglion at 2h and 1h after injection, respectively (fig. 9 and 10), and the expression level was higher and the expression time was earlier than those of muscle and gill tissues, which indicates that 5-HTR2 is widely present in the nervous system and WB analysis results in the brain ganglion are substantially consistent with those of PCR (fig. 11).
Sequence listing
<110> Ningbo university
NINGBO INSTITUTE OF OCEANOGRAPHY
<120> Scylla paramamosain 5-HT2 receptor gene and application thereof
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2207
<212> DNA
<213> Scylla Paramosain)
<400> 1
Claims (10)
1. The scylla paramamosain 5-HT2 receptor gene is characterized in that: the scylla paramamosain 5-HT2 receptor gene is Sp5-HTR2, and the nucleotide sequence of Sp5-HTR2 is shown in SEQ NO. 1.
2. The scylla paramamosain 5-HT2 receptor gene of claim 1, wherein: the amino acid sequence of the scylla paramamosain 5-HT2 receptor gene is as follows:
MetProThrLeuGlyAspLeuThrLeuProProGlnProProThrAsnAlaArgAspLeuAspValSerLeuHisProLeuThrProLeuAsnLeuThrThrLeuLeuAlaThrProGlnAsnValThrLeuGlyAsnLeuThrTrpGluGluGluGlyGluGluGlyThrGlyGlyGlyGlyThrGlySerProProAlaAsnTrpTrpGlyLeuValAlaLeuLeuValValLeuLeuThrLeuPheGlyAsnIleLeuLeuIleLeuAlaIleSerTrpAspArgArgLeuGlnAsnMetThrAsnTyrPheLeuLeuSerLeuAlaValThrAspLeuMetValAlaSerLeuValMetProLeuSerIleValValLeuValLeuGlyHisPheProPheSerSerGluLeuCysLeuLeuTrpIleSerLeuAspValLeuPheCysThrAlaSerIleMetHisLeuCysThrLeuSerValAspArgPheLeuSerLeuArgTyrProIleLysPheGlyArgGlnLysThrArgArgArgValValLeuLysIleValLeuValTrpCysLeuSerLeuAlaAlaSerLeuProLeuSerLeuMetTyrAlaThrAlaProHisThrThrIleValAspGlyValCysGlnIleProValSerLeuPheGlnIleIleGlySerValIleCysPheTyrIleProLeuValIleMetLeuValThrTyrAlaLeuThrValArgLeuLeuSerGlnLysGlnSerGluLeuHisProSerValLeuGluProSerSerAlaSerAlaSerProSerProArgSerLeuArgTrpLysLysLeuLeuCysLysThrThrSerThrLeuSerThrSerThrAlaValSerLeuThrAspGlyGluValSerGluAlaAlaCysArgProGluProCysGlySerHisThrThrLysLeuArgArgLeuGlySerSerSerSerProGlnArgArgProProLeuValArgTyrProSerHisTyrHisHisHisGlnArgAlaAlaLeuValArgAlaAspGlyCysGlyMetArgGlyTyrSerThrArgGluLeuArgGluSerGluGluGlnSerPheProGlnLeuThrAlaSerAlaProAlaTyrGluMetSerValLeuProProAlaAlaArgSerAlaProSerSerThrAlaThrSerProLeuHisArgArgHisHisHisArgGlnAlaAspAlaProAspAspAspAspAspSerSerAlaAlaProSerCysGluGlnAsnGlyAspProArgGlyGlyValArgGluArgCysGlyGluGluCysGlySerGlyMetGlyGlyAlaGlySerGlyGlnValAlaValProCysSerCysAlaProArgPhePheLeuGluAspMetLysAlaGlnAspSerGlnCysAspGluCysThrValProGlnProGluValAlaValHisTyrThrProProThrProArgArgSerArgAspIleThrGlnProGlnGluArgArgSerTrpCysCysCysCysCysLeuAlaAlaPheThrArgLeuThrArgArgHisHisAlaArgGluAlaGlyAlaProLeuSerSerProTrpHisGluGlySerProArgAlaProLysAspMetValThrArgAlaAlaLeuArgSerGlyGlyGlnValThrThrLeuLeuGlnLysGlyCysAlaAlaAspSerGlySerSerProArgGlyLeuTrpArgGlnGlnSerCysSerAlaSerIleLysPheValSerSerLysArgHisGlyArgThrLeuArgMetGluGlnLysAlaThrLysValLeuGlyValValPhePheThrPheValLeuLeuTrpAlaProPhePheIleAlaAsnValLeuIleSerCysGlyAlaHisIleGlyGluGluMetIleAsnLeuValThrTrpLeuGlyTyrAlaSerSerMetValAsnProPhePheTyrThrPhePheAsnLysThrPheArgGlnThrPheLeuLysIleIleLysCysGluIleLysThrThrArgLysTyrHisLeu。
3. a method of cloning the scylla paramamosain 5-HTR2 gene of claim 1, wherein: the method comprises the following steps:
(1) designing a specific primer according to the sequence information of the transcriptome, obtaining an Expression Sequence Tag (EST) of 5-HTR2 by PCR amplification by taking Scylla paramamosain cDNA as a template, connecting the obtained EST fragment with a vector, cloning and sequencing;
(2) respectively designing a 5-HTR 23 'RACE upstream primer and a 5' RACE downstream primer according to an Expression Sequence Tag (EST) of 5-HTR2, taking a RACE cDNA first chain as a template, utilizing cDNA terminal Rapid Amplification (RACE) to obtain 3 'terminal fragments and 5' terminal fragments RACE, respectively connecting the obtained 3 'terminal fragments and 5' terminal fragments with a vector, cloning and sequencing;
(3) splicing the sequenced 3 'and 5' terminal fragments with the EST sequence of 5-HTR2 to obtain the cDNA full-length sequence of the 5-HTR2 receptor.
4. The method of cloning scylla paramamosain 5-HTR2 gene according to claim 3, wherein: the nucleotide sequences of the upstream primer and the downstream primer of the 5-HTR2 EST sequence are shown as SEQ ID NO. 3 and SEQ ID NO. 4:
3 is 5-HTR 2-EST-F: GGACTGGTGGCGCTACTG, respectively;
SEQ ID NO. 4 is 5-HTR2- -EST-R: CCCCAGCCAAGTGACCAAGTT is added.
5. The method of cloning Scylla paramamosain 5-HTR2 gene according to claim 4, wherein: the nucleotide sequence of the 3' RACE upstream primer of the 5-HTR2 is shown as SEQ ID NO: 5 and SEQ ID NO: 6, showing:
SEQ ID NO: 5 is 5-HTR 2-3' Race-outer: GGGCAGGTGACCACACTCCTGCAGAAG, respectively;
SEQ ID NO: 6 is 5-HTR 2-3' Race-inner: CAGTCCTGCTCTGCCTCCATCAAGTTCGT are provided.
6. The method of cloning Scylla paramamosain 5-HTR2 gene according to claim 5, wherein: the nucleotide sequence of the 5' RACE downstream primer of the 5-HTR2 is shown as SEQ ID NO: 7 and SEQ ID NO: 8, showing: the amino acid sequence of SEQ ID NO: 7 is 5-HTR 2-5' Race-outer: CCGTCACAGCGAGAGAGAGCAGGAAGTA, respectively; SEQ ID NO: 8 is 5-HTR 2-5' Race-inner: AAGACGACGATCCCACGAGATGGCCAGA are provided.
7. The method of cloning Scylla paramamosain 5-HTR2 gene according to claim 6, wherein: the nucleotide sequence of the specific primer of the 5-HTR2 gene is shown as SEQ ID NO: 9 and SEQ ID NO: 10, and:
the amino acid sequence of SEQ ID NO: 9 is 5-HTR 2-F: GACGTTCCTGAAGATCATTAAGTGTG, respectively;
SEQ ID NO: 10 is 5-HTR 2-R: CTGGACTCGTGAACTCACAAC are provided.
8. A method for preparing the scylla paramamosain 5-HTR2 polyclonal antibody of claim 1, wherein the method comprises the following steps: the method comprises the following steps:
(1) screening 5-HTR2 antigen polypeptide sequence and synthesizing;
(2) coupling the polypeptide obtained in the step (1) with KLH to prepare an antigen immune rabbit to obtain immune serum;
(3) separating and purifying the serum obtained in the step (2) to obtain a purified antibody, and measuring the titer and the concentration, namely the Scylla paramamosain 5-HTR2 polyclonal antibody.
9. The method for preparing scylla paramamosain 5-HTR2 polyclonal antibody according to claim 8, wherein: the sequence of the antigen polypeptide used in the step (1) is TLPPQPPTNARDLDC, and the polypeptide synthesized in the antigen: KLH was 1mg: 680. mu.g.
10. Use of the scylla paramamosain 5-HTR2 gene according to claim 1 or 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210658740.9A CN115058430B (en) | 2022-06-12 | 2022-06-12 | Scylla paramamosain 5-HT2 receptor gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210658740.9A CN115058430B (en) | 2022-06-12 | 2022-06-12 | Scylla paramamosain 5-HT2 receptor gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115058430A true CN115058430A (en) | 2022-09-16 |
| CN115058430B CN115058430B (en) | 2023-06-09 |
Family
ID=83200600
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210658740.9A Active CN115058430B (en) | 2022-06-12 | 2022-06-12 | Scylla paramamosain 5-HT2 receptor gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115058430B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116769839A (en) * | 2023-05-25 | 2023-09-19 | 汕头大学 | RNA interference method for researching Abd-A gene regulation scylla paramamosain larva abdominal limb development |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102477429A (en) * | 2011-11-25 | 2012-05-30 | 浙江海洋学院 | Scylla paramamosain ETFB gene and clone, detection method and application thereof |
| CN103045608A (en) * | 2012-12-17 | 2013-04-17 | 中国水产科学研究院东海水产研究所 | Scylla paramamosain macrophage migration inhibition factor gene MIF and application thereof |
| CN103667320A (en) * | 2013-11-04 | 2014-03-26 | 内蒙古科技大学 | Scylla paramamosain peroxy gene Sp-PX, amino acid sequence encoded by using scylla paramamosain peroxy gene Sp-PX and clone method |
| CN103789317A (en) * | 2014-01-08 | 2014-05-14 | 广西壮族自治区海洋研究所 | Scylla paramamosain antibacterial peptide hyastatin gene clone, encoding protein recombination and application |
| CN105274134A (en) * | 2015-11-25 | 2016-01-27 | 厦门大学 | Preparation method and application of scylla paramamosain antimicrobial peptide SCY2 |
-
2022
- 2022-06-12 CN CN202210658740.9A patent/CN115058430B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102477429A (en) * | 2011-11-25 | 2012-05-30 | 浙江海洋学院 | Scylla paramamosain ETFB gene and clone, detection method and application thereof |
| CN103045608A (en) * | 2012-12-17 | 2013-04-17 | 中国水产科学研究院东海水产研究所 | Scylla paramamosain macrophage migration inhibition factor gene MIF and application thereof |
| CN103667320A (en) * | 2013-11-04 | 2014-03-26 | 内蒙古科技大学 | Scylla paramamosain peroxy gene Sp-PX, amino acid sequence encoded by using scylla paramamosain peroxy gene Sp-PX and clone method |
| CN103789317A (en) * | 2014-01-08 | 2014-05-14 | 广西壮族自治区海洋研究所 | Scylla paramamosain antibacterial peptide hyastatin gene clone, encoding protein recombination and application |
| CN105274134A (en) * | 2015-11-25 | 2016-01-27 | 厦门大学 | Preparation method and application of scylla paramamosain antimicrobial peptide SCY2 |
Non-Patent Citations (1)
| Title |
|---|
| XINLIAN HUANG: "Identification and Characterization of 5-HT Receptor 1 from Scylla paramamosain: The Essential Roles of 5-HT and Its Receptor Gene during Aggressive Behavior in Crab Species", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116769839A (en) * | 2023-05-25 | 2023-09-19 | 汕头大学 | RNA interference method for researching Abd-A gene regulation scylla paramamosain larva abdominal limb development |
| CN116769839B (en) * | 2023-05-25 | 2024-05-17 | 汕头大学 | RNA interference method for researching Abd-A gene regulation scylla paramamosain larva abdominal limb development |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115058430B (en) | 2023-06-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Györgyey et al. | Alfalfa heat shock genes are differentially expressed during somatic embryogenesis | |
| US6943241B2 (en) | Full-length cDNA | |
| EP2133423B1 (en) | Germ cell marker using fish vasa gene | |
| CN108642069B (en) | Portunus trituberculatus COMT gene and application thereof | |
| CN106478822B (en) | A kind of preparation method of swamp eel aldehyde ketone reductase polyclonal antibody | |
| Du et al. | Identification and functional characterization of grass carp IL-17A/F1: An evaluation of the immunoregulatory role of teleost IL-17A/F1 | |
| CN106086229A (en) | Molecular marker that chicken growth traits is relevant and discrimination method thereof and application | |
| EP1059354A2 (en) | Sequence-determined DNA fragments and corresponding polypeptides encoded thereby | |
| CN111763256A (en) | Cloning of chicken CR2 gene, expression and purification of protein and preparation of polyclonal antibody thereof | |
| CN115058430A (en) | Scylla paramamosain 5-HT2 receptor gene and application thereof | |
| CN107937406B (en) | Novel Crustin gene of portunus trituberculatus and application of recombinant protein thereof | |
| CN110684776B (en) | Penaeus monodon Na+/K+/2Cl-Cotransporter NKCC gene and application thereof | |
| US8173790B2 (en) | Insect desiccation resistance genes and uses thereof | |
| Godl et al. | Pherophorins: a family of extracellular matrix glycoproteins from Volvox structurally related to the sex-inducing pheromone | |
| CN101525617B (en) | Eriocheir sinensis Crustin-1 gene and in-vitro recombination expression | |
| WO1995017205A1 (en) | Recombinant human thymopoietin proteins and uses therefor | |
| CN108220298B (en) | Anti-mullerian hormone AMH gene of epinephelus lanceolatus, encoding protein and application thereof | |
| US5470966A (en) | Neural α-catenin | |
| CN103739696B (en) | Cynoglossus semilaevis female specificity CSW3 protein as well as gene and application thereof | |
| CN106591353B (en) | A kind of CcARF18 gene cloning and analysis method is regulated and controled to grafting survival | |
| CN113087788A (en) | Preparation method of polyclonal antibody for specifically recognizing endogenous autophagy-related protein 8 of wheat | |
| CN108178797B (en) | Polyclonal antiserum for resisting bombyx mori BmSRC, preparation method and application | |
| CN111494616A (en) | New coronavirus immune enhanced gene vaccine and preparation method thereof | |
| CN112940113B (en) | Vibrio alginolyticus transcription factor LeuO polyclonal antibody, and preparation method and application thereof | |
| CN111041012B (en) | Litopenaeus vannamei endoplasmic reticulum Ca-ATP enzyme LvSERCA gene and encoding protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |