CN103667320A - Scylla paramamosain peroxy gene Sp-PX, amino acid sequence encoded by using scylla paramamosain peroxy gene Sp-PX and clone method - Google Patents
Scylla paramamosain peroxy gene Sp-PX, amino acid sequence encoded by using scylla paramamosain peroxy gene Sp-PX and clone method Download PDFInfo
- Publication number
- CN103667320A CN103667320A CN201310534686.8A CN201310534686A CN103667320A CN 103667320 A CN103667320 A CN 103667320A CN 201310534686 A CN201310534686 A CN 201310534686A CN 103667320 A CN103667320 A CN 103667320A
- Authority
- CN
- China
- Prior art keywords
- scylla paramamosain
- gene
- peroxide
- peroxy
- paramamosain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a scylla paramamosain peroxy gene Sp-PX, an amino acid sequence encoded by using the scylla paramamosain peroxy gene Sp-PX and a clone method. The overall length of a cDNA sequence of the gene is obtained by primer design, PCR (Polymerase Chain Reaction) amplification reaction and company sequence measurement, the nucleotide sequence of the scylla paramamosain peroxy gene Sp-PX has 2331bp, and the amino acid sequence encoded by using the scylla paramamosain peroxy gene Sp-PX has 776 amino acid residues. A research on the scylla paramamosain peroxy gene Sp-PX has important significance for further perfecting the theoretical basis of innate immune systems of invertebrates and can also provide theoretical foundation for finding immunization strategy of reinforcing the antibacterial ability and anti-virus capability of the scylla paramamosain.
Description
Technical field
The aminoacid sequence and the cloning process that the present invention relates to a kind of Scylla paramamosain peroxide plain gene Sp-PX, its coding, belong to technical field of molecular biology.
Background technology
Invertebrates is the animal of the lower grade of a class evolutionary degree, is just not have vertebra with vertebrate remarkable difference.In fact, just because of the appearance of vertebra, caused immune renewal in organic evolution history, the congenital immunity of being inherited by original dependence heredity, has been evolved into the posteriori acquired immunity that can enrich constantly.The appearance of acquired immunity mode, makes biology have during evolution immune form widely, from the immunization ways of Passive Defence type, changes into the immunization ways for active acquisition type simultaneously.For invertebrates, innate immune system is unique immune defense form of the cause of disease such as their defense against bacterial, virus, parasite invasion just, wherein, cellular immunization is a kind of important immunization route, relate to formation, encapsulation and the cytophagy of tubercle, in addition, also relate to process of cell signal transduction.Humoral immunization is also the important immunization ways of a class, mainly comprises formation and the melanism effect of antibacterial peptide.At present, find that there is molecule in performance physiological function, can expedite the emergence of the generation of humoral immunization and cellular immunization simultaneously, this molecule is called as peroxide element molecule.
Peroxide plain gene is the more conservative gene of a class evolution, and the product of expression is peroxide element molecule.Peroxide element molecule is the immune molecule that a class has complex function, the function with cell adhesion function and peroxidase, attribute from molecule, it is a kind of enzyme molecule with biological chemistry catalysis, having participated in corresponding signal pathway, is also a kind of immune effector molecule that can bring into play cytoadherence effect.This peroxide fibroin matter molecule plays an important role in removing bacterium and parasitic infection processs.At present, in the crustacean of decapods, successively find the homologue of this peroxide element molecule, comprised tigar prawn, all shrimps such as prawn, Chinese prawn, freshwater crayfish of receiving.In the homologue of these peroxide element molecules, all there are two structural domains, one is peroxydase structure domain, another is the whole protein structure domain that connects, therefore, the effect that this quasi-molecule has the effect of peroxidase and cell is sticked together.Meanwhile, these two kinds of effects have all participated in the signal transmission of pro-phenoloxidase activation system and the hydrolysis cascade reaction of proteolytic enzyme.The peroxidase activity of peroxide element molecule has finally caused the generation of the melanism effect of pro-phenoloxidase activation system mediation, and cytoadherence effect has caused the adhesive attraction between immunocyte.
Scylla paramamosain belongs to Crustachia, Decapoda, mud crab belongs to, and is a kind of aquatic animal of outbalance, and in China, southeastern coast cultivation scale is comparatively extensive.Between in the past 20 years, the breeding process of Scylla paramamosain is being perplexed by white spot virus and vibrios and some other bacterium, and bacterium has brought larger financial loss to virus for infecting to relevant cultivation industry of Scylla paramamosain.Yet Scylla paramamosain can come defense against bacterial and viral invasion by vaccinate unlike high vertebrates, the generation scale of crab disease is alleviated in the measure antibacterial, anti-virus ability that can only can strengthen by finding Scylla paramamosain self.Because, peroxide plain gene has related to cellular immunization and humoral immunization simultaneously, therefore, the peroxide plain gene of research Scylla paramamosain has outside important meaning for the basic theory of further improving the innate immune system of invertebrates, and the immunization strategy that can also strengthen for finding Scylla paramamosain antibacterial ability and anti-virus ability provides theoretical foundation.
Summary of the invention
The nucleotide sequence that the object of the present invention is to provide a kind of Scylla paramamosain peroxide plain gene Sp-PX, its nucleotides sequence is classified SEQ ID NO.1 as, has 2331bp.
Another object of the present invention is to provide a kind of aminoacid sequence of Scylla paramamosain peroxide plain gene Sp-PX coding, and its aminoacid sequence is SEQ ID NO.2, has 776 amino-acid residues.
Meanwhile, the present invention also provides the cloning process of this Scylla paramamosain peroxide plain gene Sp-PX.
Scylla paramamosain peroxide plain gene Sp-PX provided by the present invention derives from Scylla paramamosain (Scylla paramamosain), called after Sp-PX gene, and its nucleotides sequence is classified SEQ ID NO.1 as, has 2331bp.
The protein source of above-mentioned peroxide plain gene Sp-PX coding is in Scylla paramamosain (Scylla paramamosain), called after Sp-PX protein, and its aminoacid sequence is SEQ ID NO.2, has 776 amino-acid residues.
The cloning process of above-mentioned Scylla paramamosain peroxide plain gene Sp-PX, comprises the steps:
(1) select Scylla paramamosain as experiment material, utilize animal total RNA extraction reagent box to extract each total tissue RNA, obtain total RNA sample of each tissue of Scylla paramamosain;
(2) using each total tissue RNA sample of Scylla paramamosain that step (1) obtains as template, utilize single stage method RT-PCR amplification kit to carry out the reverse transcription of cDNA synthetic, obtain the cDNA sample of each tissue of Scylla paramamosain;
(3) front and back primer Sp-PX-F and the Sp-PX-R of design amplification Scylla paramamosain peroxide plain gene Sp-PX coding region:
Sp-PX-F：5′-TACTCA
GAATTCATGAAGGGGCTACTGTTCC-3′
Sp-PX-R：5′-TACTCA
CTCGAGCTAGTACTTCTTTGGTCCCCAA-3′
Using the cDNA sample of each tissue of Scylla paramamosain in step (2) as template, carry out pcr amplification reaction, the program of reaction is: 95 ℃ of denaturation 3min, 95 ℃ of sex change 30s, 60 ℃ of annealing 90s, 72 ℃ are extended 60s, circulation 35 circles, rear extension 5min, obtains PCR reaction product;
(4) PCR reaction product step (3) being obtained reclaims and purifying, carrying out afterwards the double digestion of EcoR I endonuclease and Xho I endonuclease processes, and be connected with the intestinal bacteria pET-28a plasmid vector of processing with Xho I endonuclease double digestion through EcoR I endonuclease, after transforming bacillus coli DH 5 alpha clone strain competent cell, carry out bacterium colony PCR screening, the sequencing that positive colony that screening is obtained send order-checking company to carry out goal gene, obtains Scylla paramamosain peroxide plain gene Sp-PX gene order.
(5) gene order step (4) being obtained, utilizes the online software of molecular biology Expasy (http://au.expasy.org) to carry out the translation of aminoacid sequence, obtains the aminoacid sequence of corresponding protein.
Advantage of the present invention:
The present invention relates to aminoacid sequence and the cloning process of a kind of Scylla paramamosain peroxide plain gene Sp-PX, its coding.This gene overexpression in Scylla paramamosain body can improve the expression amount of peroxide element molecule in Scylla paramamosain innate immune system, thereby can improve antibacterium and the antiviral ability of Scylla paramamosain.
Embodiment
Below in conjunction with specific embodiment, the present invention is done to further detailed description
The clone of peroxide plain gene Sp-PX in embodiment 1 Scylla paramamosain hepatic tissue
(1) select Scylla paramamosain hepatic tissue as experiment material, the Total RNA Extractor(Trizol that utilizes Shanghai Sheng Gong biotechnology company limited to provide) the quick extraction agent box of the total RNA of animal carries out the extraction of total RNA, obtains total RNA sample of Scylla paramamosain hepatic tissue;
(2) using total RNA sample of the Scylla paramamosain hepatic tissue that step (1) obtains as template, the single stage method RT-PCR amplification kit that utilizes Shanghai Sheng Gong biotechnology company limited to provide carries out the reverse transcription of cDNA and synthesizes, and obtains the cDNA sample of Scylla paramamosain hepatic tissue;
(3) front and back primer Sp-PX-F and the Sp-PX-R of design amplification Scylla paramamosain peroxide plain gene Sp-PX coding region:
Sp-PX-F：5′-TACTCA
GAATTCATGAAGGGGCTACTGTTCC-3′
Sp-PX-R：5′-TACTCA
CTCGAGCTAGTACTTCTTTGGTCCCCAA-3′
Using the cDNA sample of the Scylla paramamosain hepatic tissue in step (2) as template, carry out pcr amplification reaction, the program of reaction is: 95 ℃ of denaturation 3min, 95 ℃ of sex change 30s, 60 ℃ of annealing 90s, 72 ℃ are extended 60s, circulation 35 circles, rear extension 5min, obtains PCR reaction product;
(4) PCR reaction product step (3) being obtained reclaims, purifying, carry out afterwards EcoR I and Xho I endonuclease double digestion, and be connected with the pET-28a carrier of processing with Xho I endonuclease double digestion through EcoR I, after transforming bacillus coli DH 5 alpha clone strain competent cell, before and after utilizing, primer Pc-DDC-F and Pc-DDC-R carry out bacterium colony PCR screening, positive colony that screening is obtained is served Hai Shenggong biotechnology company limited and is carried out sequencing, obtains Scylla paramamosain hepatic tissue peroxide plain gene Sp-PX gene order.
(5) gene order step (4) being obtained, utilizes the online software of molecular biology Expasy (http://au.expasy.org) to carry out the translation of aminoacid sequence, obtains the aminoacid sequence of corresponding protein.
The embodiment 2 Scylla paramamosain cheeks are organized the clone of peroxide plain gene Sp-PX
(1) select Scylla paramamosain cheek setup action experiment material, the Total RNA Extractor(Trizol that utilizes Shanghai Sheng Gong biotechnology company limited to provide) the quick extraction agent box of the total RNA of animal carries out the extraction of total RNA, obtains total RNA sample of Scylla paramamosain cheek tissue;
(2) using total RNA sample of the Scylla paramamosain cheek tissue that step (1) obtains as template, the single stage method RT-PCR amplification kit that utilizes Shanghai Sheng Gong biotechnology company limited to provide carries out the reverse transcription of cDNA and synthesizes, and obtains the cDNA sample of Scylla paramamosain cheek tissue;
(3) front and back primer Sp-PX-F and the Sp-PX-R of design amplification Scylla paramamosain peroxide plain gene Sp-PX coding region:
Sp-PX-F：5′-TACTCA
GAATTCATGAAGGGGCTACTGTTCC-3′
Sp-PX-R：5′-TACTCA
CTCGAGCTAGTACTTCTTTGGTCCCCAA-3′
Using the cDNA sample of the Scylla paramamosain cheek tissue in step (2) as template, carry out pcr amplification reaction, the program of reaction is: 95 ℃ of denaturation 3min, 95 ℃ of sex change 30s, 60 ℃ of annealing 90s, 72 ℃ are extended 60s, circulation 35 circles, rear extension 5min, obtains PCR reaction product;
(4) PCR reaction product step (3) being obtained reclaims, purifying, carry out afterwards EcoR I and Xho I endonuclease double digestion, and be connected with the pET-28a carrier of processing with Xho I endonuclease double digestion through EcoR I, after transforming bacillus coli DH 5 alpha clone strain competent cell, before and after utilizing, primer Pc-DDC-F and Pc-DDC-R carry out bacterium colony PCR screening, positive colony that screening is obtained is served Hai Shenggong biotechnology company limited and is carried out sequencing, obtains the Scylla paramamosain cheek and organizes peroxide plain gene Sp-PX gene order.
(5) gene order step (4) being obtained, utilizes the online software of molecular biology Expasy (http://au.expasy.org) to carry out the translation of aminoacid sequence, obtains the aminoacid sequence of corresponding protein.
Embodiment 3 Scylla paramamosain optic stalks are organized the clone of peroxide plain gene Sp-PX
(1) select the optic stalk setup action experiment material of Scylla paramamosain, the Total RNA Extractor(Trizol that utilizes Shanghai Sheng Gong biotechnology company limited to provide) the quick extraction agent box of the total RNA of animal carries out the extraction of total RNA, obtains total RNA sample of Scylla paramamosain optic stalk tissue;
(2) using total RNA sample of the Scylla paramamosain optic stalk tissue that step (1) obtains as template, the single stage method RT-PCR amplification kit that utilizes Shanghai Sheng Gong biotechnology company limited to provide carries out the reverse transcription of cDNA and synthesizes, and obtains the cDNA sample of Scylla paramamosain optic stalk tissue;
(3) front and back primer Sp-PX-F and the Sp-PX-R of design amplification Scylla paramamosain peroxide plain gene Sp-PX coding region:
Sp-PX-F：5′-TACTCA
GAATTCATGAAGGGGCTACTGTTCC-3′
Sp-PX-R：5′-TACTCA
CTCGAGCTAGTACTTCTTTGGTCCCCAA-3′
Using the cDNA sample of the Scylla paramamosain optic stalk tissue in step (2) as template, carry out pcr amplification reaction, the program of reaction is: 95 ℃ of denaturation 3min, 95 ℃ of sex change 30s, 60 ℃ of annealing 90s, 72 ℃ are extended 60s, circulation 35 circles, rear extension 5min, obtains PCR reaction product;
(4) PCR reaction product step (3) being obtained reclaims, purifying, carry out afterwards EcoR I and Xho I endonuclease double digestion, and be connected with the pET-28a carrier of processing with Xho I endonuclease double digestion through EcoR I, after transforming bacillus coli DH 5 alpha clone strain competent cell, before and after utilizing, primer Pc-DDC-F and Pc-DDC-R carry out bacterium colony PCR screening, positive colony that screening is obtained is served Hai Shenggong biotechnology company limited and is carried out sequencing, obtains Scylla paramamosain optic stalk and organizes peroxide plain gene Sp-PX gene order.
(5) gene order step (4) being obtained, utilizes the online software of molecular biology Expasy (http://au.expasy.org) to carry out the translation of aminoacid sequence, obtains the aminoacid sequence of corresponding protein.
Sequence table
SEQ ID NO.1
University Of Science and Technology of the Inner Mongol
Aminoacid sequence and the cloning process of a kind of Scylla paramamosain peroxide plain gene Sp-PX, its coding
2013-10-22
2
1
2331
cDNA
Scylla paramamosain
Scylla paramamosain peroxide plain gene
(1)…(2331)
ATGAAGGGGCTACTGTTCCTGGCGGTGTTGGTGGTGACGGCAGTGCTGGTGGCCGGCCAGTTTGTTTTCC 70
CAGGTGCGTCGACTGGAGACCAGGGTGCGTGTGACTGCCAACCGGCCACTGTTTGTGCCATTGATTTCGA 140
TGTGATCCGGAATGGCTGCCAGCTTGGCGACGGCAGCCAGGGCGTCTGCTGCCCCTCAGAAAGCGCTGCC 210
CCAAGCAGTGCGGATGCCCCCGCCATACGGGGCAGCATGCTCAACGTGAACACCAGGAATGCCTTTGCCG 280
AGTCGCGACCCGCGGTGGCAGAAAGCCAGCTGGAGGTGGCGGTGAGAGCCGGTGTGGCTGCAGTGGACAG 350
CTTGGCGGCCTTAGAGCAGACACTTGTTCAGAGCAACAACTTCCTGCAAAGAGGCACCCCGGCATCCAAT 420
CACGTGCATCAGTCCAGGATCAGACAGAGTGCCCGTGACATGGACAAGCGTGCCTGGACCATCGTGATGG 490
CCTCCTCCAGCGTGATGCAGAGCGAGGGCTTCACTAGATCACAGGGCGGCTTGGGACTGCGAAACGTGCG 560
CGTGTCTGAAACCTCCCTTAGGGACCAGTGTCCACCTAAAGTGACGTGCGGAGACCCCAGTAGGAGATAC 630
CGCACCGCCGACGGCTCTTGCAATCACTTACAGAACCCAGAATCCGGCAAGAGCAACACACCCGCTCAGA 700
GGATTCTCCCTCCCACCTACAACGACGGACTGTCTGCCTTCCGCATAAATGGCGTGGACGGGTCTCCTCT 770
GCCCAATGTAAGAAAAATCAGCAGCTCAATAATGGTTGACATCAATGAGCCGGACCCAGCCTTCACGCTG 840
TCCGTGATGCAGTGGCCGCAGTTCATGGACCACGACTTTGCACACATCCCGTTCCCTTCCCTTGAAAATG 910
GCCAGGGTATTGACTGCTGCCCCAAGGACTCGAACGCGCAGCTTCACCCTCGCTGCCAGCCCATCGACAT 980
CTCCGGAGACCCATTCTTTTCCAAATTCCAAACTAAATGCATGAACTTCGTGAGGAGTATGCTTGCCGTG 1050
GGTCCTGGAGAGGCCTGCACCTTCGGGTTTGCTGAGCAGCTGAACCAGCTGACCCACTGGATTGACGGTT 1120
CCAATGTATACGGCTGGGACGACGAGGAACAGCGTGCGGTGAGAAGCTTCCAAGGCGGTCTGCTGAGGAC 1190
TTCCCGTGGCAACCTGCTGCCCATCAACCCCAGCCAGGGAGGAGAGTGTGAGGCGGAGCTGCGAGGCGCT 1260
GAATGCTTCCTTGCTGGCGAGTCCCGCGTGAACGAGCAACCAGGCCTCACCACCATCCACATCATCTGGA 1330
TGCGGGAACACAACCGCCTCGCCTCGGAGCTGCAGCGACTCAACCCTCAGTGGTCTGACGAGGAGGTGTT 1400
CCAGGAGGCGCGCCGCATTGTGATCGGCGAGATGCAGCACATCACCTTCAACGAGTGGCTCCCCATCATC 1470
ATTGGTCCGAGATTTGTGCGAGCGTTCCGAATCGGGGTCCGGCGTGATGGTTTCAGTAACGACTATAACC 1540
CAACCATCAATCCCAACATGAACAACGGATTCTCCACCGCCGCTTTCCGCTTCGGCCACTCTCTGGTGCA 1610
AGGAACAATCAATCTGATCGGGCAGGACGGGTCGTTCAGTTCGGTACTGCTCAGGAACAACTTCAATTCG 1680
CCCCACCTCATCCAAAACGAGGGCCGCTTGAATGACTTGGTACGCACCCTGGTTCAGTTCCCCGCGCAGA 1750
GCTTCGACAACTTCGTTACCCAGGATCTGTCCAACCATCTCTTCCAGACTCCAGAATTTAGCTTCGGCAT 1820
GGATCTGATGAGCCTCAACATCCACCGGGGGCGTGACCACGCCATCGCCACTTACAACTCCATGAGGCAG 1890
GCGTGTGGGCTGCGTCGTGCTACTACTTTCGAAGACTTGAGGGACCAGATCATTCCTCCGCTCATCAACA 1960
GGCTGAAAGCTCTGTACAAGAGTGTGGACGACATCGACTTCTTCGCCGGCGGCATGTCCGAGACGCCGCT 2030
GCAGGGTAGTTTGCTGGGCTGGACCTTCACCTGCGTCGTGGGTGACCAGTACGCGCGCCTCAAGAAGGGA 2100
GACCGATTCTTCTACGACCTTGGAGGACAGACCGGCTCGTTCAGGCTGGATCAATTGAATCAGATTCGCC 2170
GAACGTCCTGGGCTCGAATCCTGTGCGACAACTCGGATCTGACAGCCATCCAGCCTCTTGCCTTCCAACT 2240
GCCCACCCGTGAACTAAACCGCCCACGTTCCTGCAAGAGCTTCAGCATTCCCAGAGTGGATCTGAGAGCT 2310
TGGGGACCAAAGAAGTACTAG 2331
SEQ ID NO.2
2
776
PRT
Scylla paramamosain peroxide element
(1)…(776)
Claims (3)
1. a Scylla paramamosain peroxide plain gene Sp-PX, is characterized in that, its nucleotides sequence is classified SEQ ID NO.1 as.
2. a kind of Scylla paramamosain peroxide plain gene Sp-PX according to claim 1, is characterized in that, the aminoacid sequence corresponding to protein of Scylla paramamosain peroxide plain gene Sp-PX coding is SEQ ID NO.2.
3. a cloning process of Scylla paramamosain peroxide plain gene Sp-PX claimed in claim 1, is characterized in that, comprises the following steps:
(1) select Scylla paramamosain as experiment material, utilize animal total RNA extraction reagent box to extract each total tissue RNA, obtain total RNA sample of each tissue of Scylla paramamosain;
(2) using each total tissue RNA sample of Scylla paramamosain that step (1) obtains as template, utilize single stage method RT-PCR amplification kit to carry out the reverse transcription of cDNA synthetic, obtain the cDNA sample of each tissue of Scylla paramamosain;
(3) front and back primer Sp-PX-F and the Sp-PX-R of design amplification Scylla paramamosain peroxide plain gene Sp-PX coding region:
Sp-PX-F：5′-TACTCA
GAATTCATGAAGGGGCTACTGTTCC-3′
Sp-PX-R：5′-TACTCA
CTCGAGCTAGTACTTCTTTGGTCCCCAA-3′
Using the cDNA sample of each tissue of Scylla paramamosain in step (2) as template, carry out pcr amplification reaction, the program of reaction is: 95 ℃ of denaturation 3min, 95 ℃ of sex change 30s, 60 ℃ of annealing 90s, 72 ℃ are extended 60s, circulation 35 circles, rear extension 5min, obtains PCR reaction product;
(4) PCR reaction product step (3) being obtained reclaims and purifying, carrying out afterwards the double digestion of EcoR I endonuclease and Xho I endonuclease processes, and be connected with the intestinal bacteria pET-28a plasmid vector of processing with Xho I endonuclease double digestion through EcoR I endonuclease, after transforming bacillus coli DH 5 alpha clone strain competent cell, carry out bacterium colony PCR screening, the sequencing that positive colony that screening is obtained send order-checking company to carry out goal gene, obtains Scylla paramamosain peroxide plain gene Sp-PX gene order.
(5) gene order step (4) being obtained, utilizes the online software of molecular biology Expasy (http://au.expasy.org) to carry out the translation of aminoacid sequence, obtains the aminoacid sequence of corresponding protein.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310534686.8A CN103667320A (en) | 2013-11-04 | 2013-11-04 | Scylla paramamosain peroxy gene Sp-PX, amino acid sequence encoded by using scylla paramamosain peroxy gene Sp-PX and clone method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310534686.8A CN103667320A (en) | 2013-11-04 | 2013-11-04 | Scylla paramamosain peroxy gene Sp-PX, amino acid sequence encoded by using scylla paramamosain peroxy gene Sp-PX and clone method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103667320A true CN103667320A (en) | 2014-03-26 |
Family
ID=50306091
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310534686.8A Pending CN103667320A (en) | 2013-11-04 | 2013-11-04 | Scylla paramamosain peroxy gene Sp-PX, amino acid sequence encoded by using scylla paramamosain peroxy gene Sp-PX and clone method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103667320A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115058430A (en) * | 2022-06-12 | 2022-09-16 | 宁波大学 | Scylla paramamosain 5-HT2 receptor gene and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102167736A (en) * | 2011-05-17 | 2011-08-31 | 厦门大学 | Green mud crab antibacterial peptide Sphistin and application thereof |
| CN102477429A (en) * | 2011-11-25 | 2012-05-30 | 浙江海洋学院 | Scylla paramamosain ETFB gene and clone, detection method and application thereof |
| CN103074345A (en) * | 2013-01-06 | 2013-05-01 | 中国水产科学研究院东海水产研究所 | Scylla paramamosain sulfur and oxygen deoxidation protein-2 gene order and application thereof |
| CN103255116A (en) * | 2013-05-24 | 2013-08-21 | 集美大学 | Scylla paramamosain double-stranded specific deoxyribonuclease as well as preparation method and application thereof |
-
2013
- 2013-11-04 CN CN201310534686.8A patent/CN103667320A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102167736A (en) * | 2011-05-17 | 2011-08-31 | 厦门大学 | Green mud crab antibacterial peptide Sphistin and application thereof |
| CN102477429A (en) * | 2011-11-25 | 2012-05-30 | 浙江海洋学院 | Scylla paramamosain ETFB gene and clone, detection method and application thereof |
| CN103074345A (en) * | 2013-01-06 | 2013-05-01 | 中国水产科学研究院东海水产研究所 | Scylla paramamosain sulfur and oxygen deoxidation protein-2 gene order and application thereof |
| CN103255116A (en) * | 2013-05-24 | 2013-08-21 | 集美大学 | Scylla paramamosain double-stranded specific deoxyribonuclease as well as preparation method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| DU ZQ ET AL: "DU ZQ ET AL", 《MOL BIOL REP》 * |
| NCBI: "Eriocheir sinensis peroxinectin mRNA,complete cds,ACCESSION NO：GU002547.1", 《NCBI》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115058430A (en) * | 2022-06-12 | 2022-09-16 | 宁波大学 | Scylla paramamosain 5-HT2 receptor gene and application thereof |
| CN115058430B (en) * | 2022-06-12 | 2023-06-09 | 宁波大学 | Scylla paramamosain 5-HT2 receptor gene and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhao et al. | Profiling of differentially expressed genes in hepatopancreas of white spot syndrome virus-resistant shrimp (Litopenaeus vannamei) by suppression subtractive hybridisation | |
| Zhao et al. | Molecular cloning of an invertebrate goose-type lysozyme gene from Chlamys farreri, and lytic activity of the recombinant protein | |
| Arockiaraj et al. | Crustin, a WAP domain containing antimicrobial peptide from freshwater prawn Macrobrachium rosenbergii: immune characterization | |
| Li et al. | Molecular characterization and expression analysis of five chitinases associated with molting in the Chinese mitten crab, Eriocheir sinensis | |
| Lin et al. | Identification and phylogenetic analysis on lipopolysaccharide and β-1, 3-glucan binding protein (LGBP) of kuruma shrimp Marsupenaeus japonicus | |
| Beale et al. | Anti-lipopolysaccharide factors in the American lobster Homarus americanus: Molecular characterization and transcriptional response to Vibrio fluvialis challenge | |
| Qian et al. | cDNA cloning and expression analysis of myostatin/GDF11 in shrimp, Litopenaeus vannamei | |
| Tang et al. | Characterization, genomic organization, and expression profiles of MyD88, a key adaptor molecule in the TLR signaling pathways in miiuy croaker (Miichthys miiuy) | |
| Pan et al. | Molecular cloning and characterization of a novel c-type lysozyme gene in swimming crab Portunus trituberculatus | |
| Zhang et al. | Molecular characterization and expression analysis of lipopolysaccharide and β-1, 3-glucan-binding protein (LGBP) from pearl oyster Pinctada fucata | |
| Dong et al. | Involvement of peroxinectin in the defence of red swamp crayfish Procambarus clarkii against pathogenic Aeromonas hydrophila | |
| Wang et al. | Comparative analysis of peptidoglycan recognition proteins in endoparasitoid wasp Microplitis mediator | |
| Vaseeharan et al. | Molecular cloning, sequence analysis and expression of Fein-Penaeidin from the haemocytes of Indian white shrimp Fenneropenaeus indicus | |
| Wu et al. | Expression patterns of alpha-2 macroglobulin reveal potential immune functions in brood pouch of the lined seahorse Hippocampus erectus | |
| Shanthi et al. | cDNA cloning, characterization and expression analysis of a novel antimicrobial peptide gene penaeidin-3 (Fi-Pen3) from the haemocytes of Indian white shrimp Fenneropenaeus indicus | |
| Hsu et al. | Molecular cloning and characterisation of peroxinectin, a cell adhesion molecule, from the giant freshwater prawn Macrobrachium rosenbergii | |
| CN101525617B (en) | Eriocheir sinensis Crustin-1 gene and in-vitro recombination expression | |
| Labbe et al. | An ancient immunity gene duplication in Daphnia magna: RNA expression and sequence analysis of two nitric oxide synthase genes | |
| Li et al. | Three clip domain serine proteases (cSPs) and one clip domain serine protease homologue (cSPH) identified from haemocytes and eyestalk cDNA libraries of swimming crab Portunus trituberculatus | |
| CN103667320A (en) | Scylla paramamosain peroxy gene Sp-PX, amino acid sequence encoded by using scylla paramamosain peroxy gene Sp-PX and clone method | |
| CN108558994B (en) | Portunus trituberculatus C1q receptor PtgC1qR gene and encoding protein and application thereof | |
| CN103667324A (en) | Dopa decarboxylase gene Pc-DDC of freshwater crayfish, coded amino acid sequence and clone method thereof | |
| Shi et al. | Comprehensive expression analysis of the beta integrin from Penaeus monodon indicating its participation in innate immunity and ammonia nitrogen stress response | |
| Liu et al. | Gene expression profiling during early response to injury and microbial challenges in the silkworm, Bombyx mori | |
| Huang et al. | Iodothyronine deiodinase gene analysis of the Pacific oyster Crassostrea gigas reveals possible conservation of thyroid hormone feedback regulation mechanism in mollusks |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140326 |