CN107418955B - Gene cloning and prokaryotic expression and purification method of epinephelus coioides CCR12 - Google Patents

Abstract

The research firstly constructs a recombinant expression vector of an N-terminal region and 3 extracellular regions of the epinephelus coioides CCR12, expresses a recombinant protein of CCR12 through a prokaryotic system and lays a foundation for the in vitro research of the epinephelus coioides CCR12 in the future.

Description

Gene cloning and prokaryotic expression and purification method of epinephelus coioides CCR12

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to gene cloning, prokaryotic expression and purification of epinephelus coioides CCR 12.

Background

Chemokines are a class of very small molecular weight cytokines that have similar monomeric structures (Baggiolini, 1998; Jin et al, 2005). depending on their structure and the order of 4 conserved cysteines, chemokines can be classified into 5 classes, CXC, CC, XC, CX3C, CX, etc. (Murphy, et al, 2000; Nomiyama et al, 2008). when they function, they need to bind to their corresponding receptors.xc L1 is a type XC chemokine that is produced by thymic medullary epithelial cells, or activated T, NK, and NKT cells (L ei et al, 2012). XCR1 is XC L1 alone (XC L)A receptor of CD8 α⁺And CD11b^-CD103⁺DC cell secretion (alexandrie et al, 2013). XC L1-XCR 1 axis plays an important role in maintaining homeostasis, regulatory T cell production, and DC cell-mediated cytotoxic responses (L ei et al, 2012). furthermore, XC L1-XCR 1 axis is also involved in infection and autoimmune diseases.

Currently, only XC L, a member of the XC subfamily of chemokines, is identified in the murine genome, but two of XC L and XC L (DeVries et al, 2006; Fox et al, 2015) are identified in the human genome, XC L is a ubiquitous chemokine in mammals and birds, but XC L2 is only present in some species (Nomiyama et al, 2011) in fish, no XC L or XC L homologous proteins have been identified so far, but 3 XCR 1-like chemokine receptors, namely XCR1, XCR 1L and CCR12(grimhol et al, 2015; Nomiyama et al, 2011) have been found only in fish genomes, but few functional studies have been made on them, and the cutoff of antibodies against XCR 1L or CCR12 has also limited the isolation of their positive cells and there have been no report on the in vitro expression of any of CCR 12.

We found that: after the cryptocaryon irritans are stimulated to infect, the expression level of CCR12 of the grouper in skin, gill and spleen is obviously increased, and CCR12 positive cells are supposed to be involved in the parasite infection resisting process of the grouper. In order to further reveal the migration or proliferation condition of the grouper CCR12 positive cells in parasite-infected tissues and identify the CCR12 positive cell types, the research firstly constructs a recombinant expression vector of an N-terminal region and 3 extracellular regions of the grouper CCR12, and firstly expresses a recombinant protein of CCR12 through a prokaryotic system, thereby laying a foundation for the in-vitro research of the grouper CCR12 in the future.

Disclosure of Invention

Until now, no in vitro expression of the epinephelus coioides CCR12 exists, and the present invention successfully expresses and purifies the epinephelus coioides CCR12 for the first time through a gene engineering method.

The invention aims to provide a method for cloning and prokaryotic expression and purification of a gene of CCR12 of epinephelus coioides, which comprises the following specific steps:

the clone and sequence analysis of rockfish CCR12 gene:

1. extraction of total RNA in spleen of grouper

(1) Quickly taking out the frozen spleen from liquid nitrogen, grinding by using the liquid nitrogen, adding 3ml of TRIzol reagent after the spleen is fully ground, sucking the spleen into an EP (ethylene propylene) tube with the volume of 1ml to 1.5ml when the spleen is quickly melted, and placing the spleen on ice;

(2) adding 20% chloroform (0.2 ml chloroform in 1ml TRIzol Reagent) into each tube, shaking vigorously for 15s, and standing on ice for 3min to observe layering;

(3) centrifuging at 12000g for 15min at 4 deg.C, separating the liquid in the tube into three layers, sequentially from top to bottom, including water layer, protein layer, and organic layer, and collecting the supernatant to a new 1.5ml EP tube;

(4) add 0.5ml isopropanol to the tube, invert the EP tube gently, stand on ice for 10 min;

(5) centrifugation at 12000g for 10min at 4 ℃ and discarding the supernatant (without continuous inversion);

(6) adding 1ml of 75% ethanol (prepared by DEPC water) into each tube, and slightly blowing up the precipitate by using a gun head;

(7) centrifuging at 4 deg.C for 5min at 7500g, and removing supernatant;

(8) repeating the steps (6) and (7) once;

(9) dissolving RNA with 15 μ l RNase-free water;

(10) the integrity of RNA was checked by 2% agarose gel electrophoresis, the concentration of RNA was determined by a nucleic acid concentration meter, its purity was shown by A260/A280, and the remaining sample was left at-70 ℃ until use.

2. Synthesis of Single Strand cDNA

Genomic DNA contamination was removed and reverse transcribed to single-stranded cDNA. The components were added according to table 1 below, mixed gently and centrifuged briefly;

TABLE 1 formula for decontamination of genomic DNA

(1) Incubating the PCR instrument at 37 ℃ for 30min to remove genomic DNA contamination;

(2) adding 1 μ l of 50mM EDTA, incubating at 65 ℃ for 10min to inactivate DNase I;

(3) add 1. mu.l oligo (dT) per microgram of total RNA₂₀(10 pmol/mu l), after incubation for 5min at 65 ℃, immediately placing on ice to eliminate the secondary structure of RNA and improve the efficiency of reverse rotation rate;

(4) a reverse transcription reaction system was prepared according to the following Table 2, and the reaction procedure was as follows: 42 deg.C, 30min, 99 deg.C, 5min, 4 deg.C, 5 min. The product is at-20 ℃ for later use.

TABLE 2 formulation for reverse transcription into cDNA

3. Amplification of CCR12 sequence

According to grouper transcriptome information, contig encoding CCR12 was placed on NCBI to search for ORF region, sequence alignment was performed, primers (Table 3) were designed outside the ORF region, and the spleen cDNA obtained in the above step was used as template to amplify the ORF region of the target gene by PCR.

TABLE 3 Gene cloning primers

The formulation of the PCR amplification reaction solution is shown in Table 4 below. The PCR reaction conditions are as follows: at 98 deg.C for 1min, (98 deg.C, 10s, 55 deg.C, 15s, 72 deg.C, 1min) for 35 cycles, and finally at 72 deg.C for 10 min. The PCR product was detected by electrophoresis on a 1.5% agarose gel.

TABLE 4 PCR amplification System recipe

4. Gel recovery of target fragments

The recovery and purification of the PCR product of the target fragment are carried out according to the following steps:

(1) irradiating under an ultraviolet lamp, cutting off a target strip as soon as possible, and placing the cut strip in a new weighed 1.5ml EP tube;

(2) weigh the EP tube and calculate the mass and volume of the gel (the volume of the gel is calculated as 1 ml/g);

(3) adding Binding Buffer (XP2) according to the volume of 1 time of the gel volume, placing in a water bath kettle at 60 ℃ for incubation until the gel is completely dissolved, and gently mixing the gel dissolving solution at an interval of 2-3 min;

(4) mixing the components in the kit

The DNA Mini Column is matched and placed with 2ml Collection Tube;

(5) transferring the dissolved solution in the step (3) to Mini Column, and centrifuging for 1min at room temperature of 10000 g;

(6) removing the effluent and repeating (5) until all the gel-dissolved solution is centrifugally filtered through a filter membrane at the bottom of the Mini Column;

(7) adding 300 μ l Binding Buffer (XP2) into Mini Column, centrifuging at room temperature of 13000g for 1min, and removing effluent;

(8) adding 700 μ l of SPW Wash Buffer into Mini Column, centrifuging at room temperature of 13000g for 1min, and removing effluent;

(9) repeating the step (8) once;

(10) centrifuging at 13000g for 2min at room temperature to dehydrate the empty Mini Column filter membrane as much as possible;

(11) placing Mini Column in a new 1.5ml EP tube, adding 15-30 μ l of precipitation Buffer in the center of the filter membrane, standing at room temperature for 1min, centrifuging at room temperature 13000g for 1min to elute DNA;

(12) the above 1.5ml EP tube was stored at-20 ℃.

5. Cloning and transformation of fragments of interest

Sample loading was performed according to the system of table 5:

TABLE 5 blunt-ended Carrier ligation kit formulations

(1) Connecting at 25 deg.C for 30 min;

(2) the ligation product was added to 50. mu.l DH5 α competent (clonogenic bacteria) and ice-cooled for 30 min;

(3) performing water bath heat shock at 42 ℃ for 90s, and performing ice bath for 2 min;

(4) adding 1ml of fresh L B culture solution, and performing shaking culture at 37 deg.C and 200r/min for 90 min;

(5) centrifuging at 4000g for 5min, removing 800 μ l of supernatant, blowing and suspending the bacterial liquid again, spreading 100 μ l of bacterial liquid on L B solid culture medium containing benzyl, and culturing at 37 deg.C overnight;

(6) picking a single clone in 10 ul of L B culture solution as a template, and detecting the size of the inserted fragment by colony PCR;

(7) positive clones with the same fragment size were inoculated into 5ml of L B broth containing ampicillin, incubated overnight at 37 ℃ and 1ml aspirated for sequencing.

6. Sequence analysis

Signal peptides of the sequence and domains of the protein were predicted using the Smart program (http:// Smart. embl-heidelberg. de /), transmembrane domains of the receptor were predicted using TMHMM Server v.2.0 (http:// www.cbs.dtu.dk/services/TMH-MM /), alignment of the cloned gene with the corresponding amino acid sequences of other species was performed using BioEdit and Clustal Omega (http:// www.ebi.ac.uk/Tools/msa/cluster-alo /), phylogenetic tree was performed using MEGA5.04(Beta2) software.

By the method, the ORF sequence of the epinephelus coioides CCR12 is cloned, the full length is 1074bp, 357 amino acid polypeptides are coded, and the theoretical isoelectric point and the molecular weight are respectively 8.87 and 41 Da. SMART sequence analysis showed: grouper CCR12 was composed of 1N-terminal region, 3 extracellular regions, 3 intracellular regions and 1C-terminal region, and the results can be seen in fig. 1: wherein the wavy lines represent the N-and C-terminal sequences, respectively, the thin underlines represent the transmembrane regions, respectively, and the thick underlines represent the extracellular and intracellular regions. Multiple sequence alignments show: grouper CCR12 resembled daniorio and oryziasilateles at 62% and 73%, respectively, and resembled other CCR12 and xenoprosticalis at 47% -48%. Evolution analysis shows that: grouper CCR12 is grouped together with other fish CCR12 (see FIG. 2), and is consistent with the results of sequence alignment.

(II) prokaryotic expression and purification of rockfish CCR 12:

1. construction of recombinant expression vector for CCR12

(1) Amplification of a fragment of interest

a. According to the analysis of SMART software, the grouper CCR12 is a seven-transmembrane protein and is composed of an N-terminal region, 3 extracellular regions, 3 intracellular regions and a C-terminal region; the present study expressed the N-terminal region and 3 extracellular regions of rockfish CCR 12;

b. CCR12NF/R, CCR12E L1F/R, CCR12E L2F/R and CCR12E L3F/R are used as primers, the previously synthesized cDNA is used as a template, and high fidelity enzyme PrimeSTAR is used^TMMix amplified the N-terminal region and 3 extracellular regions of CCR12, respectively;

c. connecting the N-terminal region and the 1 st extracellular region by recombinant PCR by using CCR12NF/E L1R as primers and the CCR 12N-terminal region and the 1 st extracellular region amplified in the step b as templates, and connecting the 2 nd and 3 rd extracellular regions by recombinant PCR by using CCR12E L2F/E L3R as primers and the 2 nd and 3 rd extracellular regions of CCR12 amplified in the step b as templates;

d. finally, the N-terminal region and 3 extracellular regions of CCR12 are connected together by recombinant PCR by using CCR12NF/E L3R as a primer and two fusion fragments successfully connected in the step c as a template, and the target fragment is recovered by gel.

TABLE 6 primer for CCR12 amplification

(2) Extraction of expression vectors

Recovering the strain transformed with pET32a expression vector, selecting monoclonal amplification culture, and extracting plasmid, and its concrete steps are as follows:

a. centrifuging at room temperature of 1000g for 1min to collect bacterial liquid;

b. adding 250 mu l of Solution I into the thallus sediment, and blowing and beating the resuspended thallus by a gun head;

c. adding 250 μ l of solutionII, and slightly inverting and mixing for several times until the bacterial suspension becomes clear;

d. adding 350 μ l of solutionIII, and slightly inverting and mixing for several times until white flocculent precipitate appears;

e. centrifuging at room temperature 1000g for 10 min;

f. carefully pipette off the supernatant as much as possible on a new Hibind DNA binding column;

g. centrifuging at room temperature of 10000g for 1min, and removing effluent;

h. adding 500 μ l Buffer HB into the column, centrifuging at room temperature 10000g for 1min, and removing the effluent;

i. adding 700 μ l of Wash Buffer into the column, centrifuging at room temperature of 10000g for 1min, and removing effluent;

j. repeating step i) once;

k. centrifuging at 13000g for 2min at room temperature to dehydrate the empty Mini Column filter membrane as much as possible;

l, placing the Hibind DNA binding column in a new 1.5ml EP tube, adding 15-30 μ l of ElutionBuffer in the center of the filter membrane, standing at room temperature for 1min, and centrifuging at 13000g at room temperature for 1min to elute DNA;

m. the above 1.5ml EP tube was stored at-20 ℃.

(3) Double enzyme digestion target fragment and expression vector

a. Adding the target fragments recovered from the glue in the step (1) and the expression vector extracted in the step (2) according to a system in a table 7;

b. mixing, centrifuging instantaneously, and enzyme cutting at 37 deg.C for 0.5 h;

c. recovering the target fragment and the expression vector after enzyme digestion by using glue;

TABLE 7 Quick Cut cleavage System

(4) Construction of recombinant expression vectors

a. Adding samples of the target fragments and the expression vectors recovered after double enzyme digestion in the step (3) according to a system in a table 8;

b.16 ℃ overnight;

c. transforming the ligation product into competent cells of the expressing strain B L21;

d. positive clones were identified by colony PCR and sequenced.

TABLE 8 ligation System of recombinant expression vectors

The N-terminal region and 3 extracellular segments of a chemokine receptor CCR12 are spliced by using designed primers through recombinant PCR, and are connected to a pET32a prokaryotic expression vector after glue recovery and double enzyme digestion, 1 positive clone is picked for sequencing after B L21 is transformed, the sequence of the positive clone is completely correct, the result is shown in a figure 3, wherein a lane 1 is the clone of an ORF region of CCR12, 2, 3, 4 and 5 are respectively the extracellular N-terminal of CCR12, E L1, E L2 and E L3 segments, a lane 6 is the extracellular N-terminal of CCR12 and the recombinant PCR result of E L1, a lane 7 is the recombinant PCR result of E L2 and E L3 of CCR12, and a lane 8 is the recombinant PCR result of products of lanes 6 and 7.

2. Optimization and solubility analysis of CCR12 recombinant protein expression conditions

(1) Inducible expression of CCR12 recombinant proteins

a. Inoculating the recombinant protein expression strain with correct sequencing in the previous step into a new Amp L B-containing liquid culture solution, and carrying out shaking culture at 37 ℃ at 200r/min for overnight;

b. inoculating overnight-cultured bacterial liquid into fresh L B culture solution at a ratio of 1: 50, and performing shaking culture at 37 deg.C and 200r/min until OD600 is 0.6-0.8;

c. adding IPTG to the final concentration of 1mM, and performing shaking culture at 30 ℃ and 200r/min for 6 h;

d. taking 1ml of bacterial liquid, centrifuging at the room temperature of 4000r/min for 5min, and removing supernatant;

e. resuspending with 100 μ l double distilled water, mixing with 5 × SDS-PAGE L loading Buffer at a ratio of 1: 4, and boiling in water bath for 5 min;

f. carrying out SDS-PAGE gel electrophoresis on the samples to detect whether the recombinant protein CCR12 is expressed, and taking an induction group of an expression strain of pET32a as a control;

(2) optimization of recombinant protein expression conditions

Concentration of iptg: inducing the expression bacteria for 6h by IPTG with final concentration of 0.1mM, 0.3mM, 0.5mM, 0.7mM and 0.9mM respectively, collecting thalli, loading and running electrophoresis after treatment;

b. time of induction: under the condition of the optimal induction concentration, thalli are collected at 0h, 2h, 4h and 6h after induction, and the thalli are subjected to sample loading and electrophoresis after treatment.

The positive clone is expanded and cultured at 37 ℃ until the OD600 of the bacterial liquid reaches 0.6-0.8, 0mM, 0.1mM, 0.3mM, 0.5mM, 0.7mM and 0.9mM of IPTG are added to induce and express for 6h at 30 ℃, and the thalli are collected, and SDS-PAGE electrophoretic analysis shows that the optimal induction concentration of the recombinant protein CCR12 is 0.5 mM. The time of induction was optimized on this basis. As can be seen from FIG. 4, the expression level of the recombinant protein CCR12 had reached its maximum at the induction time of 4 h. Therefore, the conditions for inducing expression in large amounts were 30 ℃ and 0.5mM for 4 hours.

In FIG. 4, C is the relationship between the expression level of the recombinant protein and the IPTG induction concentration, and C is the relationship between the expression level of the protein and the change of the IPTG induction concentration with time. Lanes M represent protein Marker, lanes 1-6 in C represent the expression of recombinant protein induced at 30 ℃ for 6h with IPTG at 0mM, 0.1mM, 0.3mM, 0.5mM, 0.7mM and 0.9mM, respectively. Lanes 1-4 in c show the expression of recombinant protein at optimal IPTG induction concentrations for 0h, 2h, 4h and 6h, respectively, and the target protein bands are indicated by black arrows.

(3) Recombinant protein solubility assay

a. Inducing the expression of the recombinant protein by using the optimized conditions in the step (2), and centrifugally collecting thalli;

b. adding PBS according to the proportion of 50: 1 of the original bacterial liquid, resuspending the bacterial liquid, centrifuging the bacterial liquid for 3min at 4 ℃ and 10000g, and removing supernatant;

c. adding equal amount of L ysis buffer to resuspend the thallus, and carrying out ultrasonication (ultrasonication conditions are 200W, 5s of ultrasonication, 8s of interval, 15min of ultrasonication, and 3 cycles);

d. centrifuging at 4 deg.C and 8000g for 15min after the ultrasound treatment is finished, and collecting supernatant and precipitate respectively;

e. after processing, SDS-PAGE detects the solubility of the recombinant protein.

Final SDS-PAGE analysis indicated that CCR12 was present in soluble form in the supernatant, see fig. 5, where lane M represents protein Marker. 1. Lanes 2 and 3 show the whole cell suspension, supernatant and pellet, respectively.

3. Purification of CCR12 recombinant proteins

(1) The B L21 strain containing recombinant expression vector is expanded to 1000ml, and is shake-cultured at 37 deg.C and 200r/min to OD₆₀₀0.6-0.8, adding IPTG to the optimal final concentration optimized in the step 2, and culturing at 30 ℃ for a proper time of 200 r/min;

(2) centrifuging at 4 deg.C for 1min at 1000g, and collecting all thallus;

(3)50ml of 0.01mM PBS for resuspending the thallus, centrifuging at 4 ℃ for 10min at 1000g, and removing the supernatant;

(4)50ml of L ysis buffer is used for resuspending the thalli, carrying out ultrasonic disruption, and centrifuging at the temperature of 4 ℃ for 10min at 1000g to collect supernatant;

(5) washing the nickel column by a Wash buffer and an Elution buffer containing imidazole with different concentrations in sequence, collecting effluent liquid, and detecting the Elution effect by SDS-PAGE;

(6) and dialyzing the purified protein solution in PBS overnight, concentrating by using an ultrafiltration centrifugal tube, and storing the concentrated solution at the temperature of-80 ℃.

After the final recombinant protein is purified by a nickel column, a relatively pure single target band is obtained, see fig. 5, wherein a lane M represents a protein Marker, a lane 4 is a purified sample obtained by affinity chromatography, and the target protein band is marked by a black arrow.

Drawings

FIG. 1 is a nucleotide and protein sequence of rockfish CCR 12.

FIG. 2 is a graph of the evolutionary tree analysis of CCR12 in Epinephelus.

FIG. 3 is a diagram showing the construction results of a recombinant expression vector for CCR 12.

FIG. 4 is a schematic diagram of optimization of the expression conditions of recombinant CCR12 protein.

FIG. 5 is a graph of the results of solubility analysis and purification of CCR12 recombinant protein.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. The examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

A method for cloning and prokaryotic expression and purification of a gene CCR12 of epinephelus coioides comprises the following steps:

the clone and sequence analysis of rockfish CCR12 gene:

1. extraction of total RNA in spleen of grouper

(1) Quickly taking out the frozen spleen from liquid nitrogen, grinding by using the liquid nitrogen, adding 3ml of TRIzol reagent after the spleen is fully ground, sucking the spleen into an EP (ethylene propylene) tube with the volume of 1ml to 1.5ml when the spleen is quickly melted, and placing the spleen on ice;

(2) adding 20% chloroform (0.2 ml chloroform in 1ml TRIzol reagent) into each tube, shaking vigorously for 15s, and standing on ice for 3min to observe layering;

(3) centrifuging at 12000g for 15min at 4 deg.C, separating the liquid in the tube into three layers, sequentially from top to bottom, including water layer, protein layer, and organic layer, and collecting the supernatant to a new 1.5ml EP tube;

(4) add 0.5ml isopropanol to the tube, invert the EP tube gently, stand on ice for 10 min;

(5) centrifugation at 12000g for 10min at 4 ℃ and discarding the supernatant (without continuous inversion);

(6) adding 1ml of 75% ethanol (prepared by DEPC water) into each tube, and slightly blowing up the precipitate by using a gun head;

(7) centrifuging at 4 deg.C for 5min at 7500g, and removing supernatant;

(8) repeating the steps (6) and (7) once;

(9) dissolving RNA with 15 μ l RNase-free water;

(10) the integrity of RNA was checked by 2% agarose gel electrophoresis, the concentration of RNA was determined by a nucleic acid concentration meter, its purity was shown by A260/A280, and the remaining sample was left at-70 ℃ until use.

2. Synthesis of Single Strand cDNA

Genomic DNA contamination was removed and reverse transcribed to single-stranded cDNA. The components were added according to table 1 below, mixed gently and centrifuged briefly;

TABLE 1 formula for decontamination of genomic DNA

(1) Incubating the PCR instrument at 37 ℃ for 30min to remove genomic DNA contamination;

(2) adding 1 μ l of 50mM EDTA, incubating at 65 ℃ for 10min to inactivate DNase I;

(3) add 1. mu.l oligo (dT) per microgram of total RNA₂₀(10 pmol/mu l), after incubation for 5min at 65 ℃, immediately placing on ice to eliminate the secondary structure of RNA and improve the efficiency of reverse rotation rate;

(4) a reverse transcription reaction system was prepared according to the following Table 2, and the reaction procedure was as follows: 42 deg.C, 30min, 99 deg.C, 5min, 4 deg.C, 5 min. The product is at-20 ℃ for later use.

TABLE 2 formulation for reverse transcription into cDNA

3. Amplification of CCR12 sequence

According to the grouper transcriptome information, each contig is put on NCBI to search ORF region, and sequence comparison is carried out, primers (table 3) are designed outside the ORF region, and the tissue cDNA obtained in the above step is used as a template to amplify the ORF region of the target gene by PCR.

TABLE 3 Gene cloning primers

The formulation of the PCR amplification reaction solution is shown in Table 4 below. The PCR reaction conditions are as follows: at 98 deg.C for 1min, (98 deg.C, 10s, 55 deg.C, 15s, 72 deg.C, 1min) for 35 cycles, and finally at 72 deg.C for 10 min. The PCR product was detected by electrophoresis on a 1.5% agarose gel.

TABLE 4 PCR amplification System recipe

4. Gel recovery of target fragments

The recovery and purification of the PCR product of the target fragment are carried out according to the following steps:

(1) irradiating under an ultraviolet lamp, cutting off a target strip as soon as possible, and placing the cut strip in a new weighed 1.5ml EP tube;

(2) weigh the EP tube and calculate the mass and volume of the gel (the volume of the gel is calculated as 1 ml/g);

(3) adding Binding Buffer (XP2) according to the volume of 1 time of the gel volume, placing in a water bath kettle at 60 ℃ for incubation until the gel is completely dissolved, and gently mixing the gel dissolving solution at an interval of 2-3 min;

(4) mixing the components in the kit

The DNA Mini Column is matched and placed with 2ml Collection Tube;

(5) transferring the dissolved solution in the step (3) to Mini Column, and centrifuging for 1min at room temperature of 10000 g;

(6) removing the effluent and repeating (5) until all the gel-dissolved solution is centrifugally filtered through a filter membrane at the bottom of the Mini Column;

(7) adding 300 μ l Binding Buffer (XP2) into Mini Column, centrifuging at room temperature of 13000g for 1min, and removing effluent;

(8) adding 700 μ l of SPW Wash Buffer into Mini Column, centrifuging at room temperature of 13000g for 1min, and removing effluent;

(9) repeating the step (8) once;

(10) centrifuging at 13000g for 2min at room temperature to dehydrate the empty Mini Column filter membrane as much as possible;

(11) placing Mini Column in a new 1.5ml EP tube, adding 15-30 μ l of precipitation Buffer in the center of the filter membrane, standing at room temperature for 1min, centrifuging at room temperature 13000g for 1min to elute DNA;

(12) the above 1.5ml EP tube was stored at-20 ℃.

5. Cloning and transformation of fragments of interest

The operation was performed as in table 5:

TABLE 5 blunt-ended Carrier ligation kit formulations

(1) Connecting at 25 deg.C for 30 min;

(2) the ligation product was added to 50. mu.l DH5 α competent (clonogenic bacteria) and ice-cooled for 30 min;

(3) performing water bath heat shock at 42 ℃ for 90s, and performing ice bath for 2 min;

(4) adding 1ml of fresh L B culture solution, and performing shaking culture at 37 deg.C and 200r/min for 90 min;

(5) centrifuging at 4000g for 5min, removing 800 μ l of supernatant, blowing and suspending the bacterial liquid again, spreading 100 μ l of bacterial liquid on L B solid culture medium containing benzyl, and culturing at 37 deg.C overnight;

(6) picking a single clone in 10 ul of L B culture solution as a template, and detecting the size of the inserted fragment by colony PCR;

(7) positive clones with the same fragment size were inoculated into 5ml of L B broth containing ampicillin, incubated overnight at 37 ℃ and 1ml aspirated for sequencing.

6. Sequence analysis

Signal peptides of the sequence and domains of the proteins were predicted using the Smart program (http:// Smart. embl-heidelberg. de /), transmembrane domains of the receptors were predicted using TMHMM Server v.2.0 (http:// www.cbs.dtu.dk/services/TMH-MM /), alignment of the cloned corresponding amino acid sequences of the respective genes and other species was performed using BioEdit and Clustal Omega (http:// www.ebi.ac.uk/Tools/msa/cluster-alo /), phylogenetic tree was performed using MEGA5.04(Beta2) software.

By the method, the ORF sequence of the epinephelus coioides CCR12 is cloned, the full length is 1074bp, 357 amino acid polypeptides are coded, and the theoretical isoelectric point and the molecular weight are respectively 8.87 and 41 Da. SMART sequence analysis showed: grouper CCR12 was composed of 1N-terminal region, 3 extracellular regions, 3 intracellular regions and 1C-terminal region, and the results can be seen in fig. 1: wherein the wavy lines represent the N-and C-terminal sequences, respectively, the thin underlines represent the transmembrane regions, respectively, and the thick underlines represent the extracellular and intracellular regions. Multiple sequence alignments show: grouper CCR12 resembled daniorio and oryziasilateles at 62% and 73%, respectively, and resembled other CCR12 and xenoprosticalis at 47% -48%. Evolution analysis shows that: grouper CCR12 is grouped together with other fish CCR12 (see FIG. 2), and is consistent with the results of sequence alignment.

(II) prokaryotic expression and purification of rockfish CCR 12:

1. construction of recombinant expression vector for CCR12

(1) Amplification of a fragment of interest

a. According to the analysis of SMART software, the grouper CCR12 is a seven-transmembrane protein and is composed of an N-terminal region, 3 extracellular regions, 3 intracellular regions and a C-terminal region; the present study expressed the N-terminal region and 3 extracellular regions of rockfish CCR 12;

b. CCR12NF/R, CCR12E L1F/R, CCR12E L2F/R and CCR12E L3F/R are used as primers, the previously synthesized cDNA is used as a template, and high fidelity enzyme PrimeSTAR is used^TMMix amplified the N-terminal region and 3 extracellular regions of CCR12, respectively;

c. connecting the N-terminal region and the 1 st extracellular region by recombinant PCR by using CCR12NF/E L1R as primers and the CCR 12N-terminal region and the 1 st extracellular region amplified in the step b as templates, and connecting the 2 nd and 3 rd extracellular regions by recombinant PCR by using CCR12E L2F/E L3R as primers and the 2 nd and 3 rd extracellular regions of CCR12 amplified in the step b as templates;

d. finally, the N-terminal region and 3 extracellular regions of CCR12 are connected together by recombinant PCR by using CCR12NF/E L3R as a primer and two fusion fragments successfully connected in the step c as a template, and the target fragment is recovered by gel.

TABLE 6 primer for CCR12 amplification

(2) Extraction of expression vectors

Recovering the strain transformed with pET32a expression vector, selecting monoclonal amplification culture, and extracting plasmid, and its concrete steps are as follows:

m, centrifugally collecting bacterial liquid at room temperature of 1000g for 1 min;

n, adding 250 mu l of Solution I into the thallus precipitate, and blowing and beating the resuspended thallus by a gun head;

o. add 250 μ l SolutionII, mix by gently inverting several times until the bacterial suspension becomes clear;

p, adding 350 mu l of solutionIII, and slightly reversing and mixing the mixture for several times until white flocculent precipitate appears;

q, centrifuging for 10min at room temperature of 1000 g;

carefully pipette off the supernatant as much as possible onto a new Hibind DNA binding column;

s. centrifuging at room temperature 10000g for 1min, and removing effluent;

t, adding 500 μ l Buffer HB into the column, centrifuging at room temperature 10000g for 1min, and removing the effluent;

u. adding 700 mul Wash Buffer into the column, centrifuging for 1min at room temperature of 10000g, and removing effluent;

v. repeating step i) once;

w, centrifuging at room temperature of 13000g for 2min to dehydrate the empty Mini Column filter membrane as much as possible;

x, placing the Hibind DNA binding column in a new 1.5ml EP tube, adding 15-30 μ l of ElutionBuffer in the center of the filter membrane, standing at room temperature for 1min, and centrifuging at 13000g at room temperature for 1min to elute DNA;

m. the above 1.5ml EP tube was stored at-20 ℃.

(3) Double enzyme digestion target fragment and expression vector

a. Adding the target fragments recovered from the glue in the step (1) and the expression vector extracted in the step (2) according to a system in a table 7;

b. mixing, centrifuging instantaneously, and enzyme cutting at 37 deg.C for 0.5 h;

c. recovering the target fragment and the expression vector after enzyme digestion by using glue;

TABLE 7 Quick Cut cleavage System

(4) Construction of recombinant expression vectors

a. Adding samples of the target fragments and the expression vectors recovered after double enzyme digestion in the step (3) according to a system in a table 8;

b.16 ℃ overnight;

c. transforming the ligation product into competent cells of the expressing strain B L21;

d. positive clones were identified by colony PCR and sequenced.

TABLE 8 ligation System of recombinant expression vectors

The N-terminal region and 3 extracellular segments of a chemokine receptor CCR12 are spliced by using designed primers through recombinant PCR, and are connected to a pET32a prokaryotic expression vector after glue recovery and double enzyme digestion, 1 positive clone is picked for sequencing after B L21 is transformed, the sequence of the positive clone is completely correct, the result is shown in a figure 3, wherein a lane 1 is the clone of an ORF region of CCR12, 2, 3, 4 and 5 are respectively the extracellular N-terminal of CCR12, E L1, E L2 and E L3 segments, a lane 6 is the extracellular N-terminal of CCR12 and the recombinant PCR result of E L1, a lane 7 is the recombinant PCR result of E L2 and E L3 of CCR12, and a lane 8 is the recombinant PCR result of products of lanes 6 and 7.

2. Optimization and solubility analysis of CCR12 recombinant protein expression conditions

(1) Inducible expression of CCR12 recombinant proteins

a. Inoculating the recombinant protein expression strain with correct sequencing in the previous step into a new Amp L B-containing liquid culture solution, and carrying out shaking culture at 37 ℃ at 200r/min for overnight;

b. inoculating overnight-cultured bacterial liquid into fresh L B culture solution at a ratio of 1: 50, and performing shaking culture at 37 deg.C and 200r/min until OD600 is 0.6-0.8;

c. adding IPTG to the final concentration of 1mM, and performing shaking culture at 30 ℃ and 200r/min for 6 h;

d. taking 1ml of bacterial liquid, centrifuging at the room temperature of 4000r/min for 5min, and removing supernatant;

e. resuspending with 100 μ l double distilled water, mixing with 5 × SDS-PAGE L loading Buffer at a ratio of 1: 4, and boiling in water bath for 5 min;

f. carrying out SDS-PAGE gel electrophoresis on the samples to detect whether the recombinant protein CCR12 is expressed, and taking an induction group of an expression strain of pET32a as a control;

(2) optimization of recombinant protein expression conditions

Concentration of iptg: inducing the expression bacteria for 6h by IPTG with final concentration of 0.1mM, 0.3mM, 0.5mM, 0.7mM and 0.9mM respectively, collecting thalli, loading and running electrophoresis after treatment;

b. time of induction: under the condition of the optimal induction concentration, thalli are collected at 0h, 2h, 4h and 6h after induction, and the thalli are subjected to sample loading and electrophoresis after treatment.

The positive clone is expanded and cultured at 37 ℃ until the OD600 of the bacterial liquid reaches 0.6-0.8, 0mM, 0.1mM, 0.3mM, 0.5mM, 0.7mM and 0.9mM of IPTG are added to induce and express for 6h at 30 ℃, and the thalli are collected, and SDS-PAGE electrophoretic analysis shows that the optimal induction concentration of the recombinant protein CCR12 is 0.5 mM. The time of induction was optimized on this basis. As can be seen from FIG. 4, the expression level of the recombinant protein CCR12 had reached its maximum at the induction time of 4 h. Therefore, the conditions for inducing expression in large amounts were 30 ℃ and 0.5mM for 4 hours.

In FIG. 4, C is the relationship between the expression level of the recombinant protein and the IPTG induction concentration, and C is the relationship between the expression level of the protein and the change of the IPTG induction concentration with time. Lanes M represent protein Marker, lanes 1-6 in C represent the expression of recombinant protein induced at 30 ℃ for 6h with IPTG at 0mM, 0.1mM, 0.3mM, 0.5mM, 0.7mM and 0.9mM, respectively. Lanes 1-4 in c show the expression of recombinant protein at optimal IPTG induction concentrations for 0h, 2h, 4h and 6h, respectively, and the target protein bands are indicated by black arrows.

(3) Recombinant protein solubility assay

a. Inducing the expression of the recombinant protein by using the optimized conditions in the step (2), and centrifugally collecting thalli;

b. adding PBS according to the proportion of 50: 1 of the original bacterial liquid, resuspending the bacterial liquid, centrifuging the bacterial liquid for 3min at 4 ℃ and 10000g, and removing supernatant;

c. adding equal amount of L ysis buffer to resuspend the thallus, and carrying out ultrasonication (ultrasonication conditions are 200W, 5s of ultrasonication, 8s of interval, 15min of ultrasonication, and 3 cycles);

d. centrifuging at 4 deg.C and 8000g for 15min after the ultrasound treatment is finished, and collecting supernatant and precipitate respectively;

e. after processing, SDS-PAGE detects the solubility of the recombinant protein.

Final SDS-PAGE analysis indicated that CCR12 was present in soluble form in the supernatant, see fig. 5, where lane M represents protein Marker. 1. Lanes 2 and 3 show the whole cell suspension, supernatant and pellet, respectively.

3. Purification of CCR12 recombinant proteins

(1) The B L21 strain containing recombinant expression vector is expanded to 1000ml, and is shake-cultured at 37 deg.C and 200r/min to OD₆₀₀0.6-0.8, adding IPTG to the optimal final concentration optimized in the step 2, and culturing at 30 ℃ for a proper time of 200 r/min;

(2) centrifuging at 4 deg.C for 1min at 1000g, and collecting all thallus;

(3)50ml of 0.01mM PBS for resuspending the thallus, centrifuging at 4 ℃ for 10min at 1000g, and removing the supernatant;

(4)50ml of L ysis buffer is used for resuspending the thalli, carrying out ultrasonic disruption, and centrifuging at the temperature of 4 ℃ for 10min at 1000g to collect supernatant;

(5) washing the nickel column by a Wash buffer and an Elution buffer containing imidazole with different concentrations in sequence, collecting effluent liquid, and detecting the Elution effect by SDS-PAGE;

(6) and dialyzing the purified protein solution in PBS overnight, concentrating by using an ultrafiltration centrifugal tube, and storing the concentrated solution at the temperature of-80 ℃.

After the final recombinant protein is purified by a nickel column, a relatively pure single target band is obtained, see fig. 5, wherein a lane M represents a protein Marker, a lane 4 is a purified sample obtained by affinity chromatography, and the target protein band is marked by a black arrow.

Claims (4)

1. A method for cloning and prokaryotic expression and purification of a gene CCR12 of epinephelus coioides is characterized by comprising the following steps:

the clone and sequence analysis of rockfish CCR12 gene:

(1) extracting total RNA of grouper tissues; (2) synthesizing single-chain cDNA;

(3) amplification of the CCR12 sequence;

putting contig for coding grouper CCR12 on NCBI to search ORF region, carrying out sequence comparison, designing primer outside the ORF region, and carrying out PCR amplification on the ORF region of the target gene by using cDNA as a template; wherein the primer CCR12F is GCTGCACTGGTCAAAC, CACTTAAACATTCATACGC as primer CCR12R, 1219bp as amplified fragment; the formula of the PCR amplification reaction solution is as follows: single strand cDNA 1. mu.l, CCR12F 1. mu.l, CCR12R 1. mu.l, PrimeSTAR^TMMix 12.5μl、H₂O9.5 μ l; the PCR reaction conditions are as follows: at 98 deg.C for 1min, for 35 cycles, wherein 98 deg.C, 10s, 55 deg.C, 15s, 72 deg.C, 1min, and finally final extension at 72 deg.C for 10min, and detecting PCR product by 1.5% agarose gel electrophoresis;

(4) recovering the glue of the target fragment;

(5) cloning and transforming a target fragment; (6) analyzing the sequence;

prokaryotic expression and purification of rockfish CCR12

I. Construction of recombinant expression vector for CCR12

(1) Amplification of a fragment of interest

a. According to the analysis of SMART software, the epinephelus coioides CCR12 is a seven-transmembrane protein and is composed of an N-terminal region, 3 extracellular regions, 3 intracellular regions and a C-terminal region; selecting an N-terminal region and 3 extracellular regions of the epinephelus coioides CCR12 for amplification;

b. taking a CCR 12N-terminal forward primer/reverse primer, a CCR12 extracellular region 1 forward primer/reverse primer, a CCR12 extracellular region 2 forward primer/reverse primer and a CCR12 extracellular region 3 forward primer/reverse primer as primers, taking the cDNA synthesized in the step (I) (2) as a template, and using a high fidelity enzyme PrimeSTAR^TMMix amplified the N-terminal region and 3 extracellular regions of CCR12, respectively;

c. then using a CCR 12N-terminal forward primer/extracellular region 1 reverse primer as a primer, using the CCR 12N-terminal region amplified in the step b and the 1 st extracellular region as templates, and connecting the N-terminal region and the 1 st extracellular region through recombinant PCR; meanwhile, the 2 nd and 3 rd extracellular regions are connected by recombination PCR by taking a CCR12 extracellular region 2 forward primer/extracellular region 3 reverse primer as a primer and the 2 nd and 3 rd extracellular regions of CCR12 amplified in the step b as templates;

d. finally, taking a CCR 12N-terminal forward primer/extracellular region 3 reverse primer as a primer, taking two fusion fragments successfully connected in the step c as templates, connecting an N-terminal region and 3 extracellular regions of CCR12 together through recombinant PCR, and recovering a target fragment by glue;

wherein, CCR12N terminalThe sequence of the forward primer is CGGGATCCATGAGCGACGAATTTCTGCT, CCR12 the sequence of the N-terminal reverse primer is AGAACCACCGCCGCCAAATTTCGCACCAAAGTGG, the amplified fragment is 41 bp; the sequence of the forward primer of the CCR12 extracellular region 1 is GGCGGCGGTGGTTCTCATCTGTCTGAATGG, CCR12, the sequence of the reverse primer of the extracellular region 1 is AGAACCACCGCCGCCGTAGGCACTGCTGAC, and the amplified fragment is 87 bp; the sequence of the forward primer of the CCR12 extracellular region 2 is GGCGGCGGTGGTTCTAAAAATGTGGGTAGCA, CCR12, the sequence of the reverse primer of the extracellular region 2 is GCTGCCACCGCCACCGAATTGCTGGTAATA, and the amplified fragment is 135 bp; the sequence of the CCR12 extracellular region 3 forward primer is GGTGGCGGTGGCAGCGCTATTCAGATCTC, CCR12 extracellular region 3 reverse primer is CCGCTCGAGTCACGCATAGTCCAAGCTCT, the amplified fragment is 96 bp; underlined portions in the primer sequences indicate restriction sites;

(2) extracting an expression vector; (3) double enzyme digestion of target fragment and expression vector; (4) constructing a recombinant expression vector: identifying positive clones by a colony PCR method, and sequencing;

II. Optimization and solubility analysis of CCR12 recombinant protein expression conditions

(1) Inducible expression of CCR12 recombinant protein;

a. inoculating the recombinant protein expression strain with correct sequencing in the step I (4) into a new liquid culture solution containing Amp L B, and carrying out shaking culture at 37 ℃ at 200r/min for overnight;

b. inoculating overnight-cultured bacterial liquid into fresh L B culture solution at a ratio of 1: 50, and performing shaking culture at 37 deg.C and 200r/min until OD600 is 0.6-0.8;

c. adding IPTG to the final concentration of 1mM, and performing shaking culture at 30 ℃ and 200r/min for 6 h;

d. taking 1ml of bacterial liquid, centrifuging at the room temperature of 4000r/min for 5min, and removing supernatant;

e. resuspending with 100 μ l double distilled water, mixing with 5 × SDS-PAGE L loading Buffer at a ratio of 1: 4, and boiling in water bath for 5 min;

f. performing SDS-PAGE gel electrophoresis on the sample obtained in the step II (1) e, detecting whether the recombinant protein CCR12 is expressed, and taking an induction group of an expression strain of pET32a as a control;

(2) optimizing recombinant protein expression conditions;

concentration of iptg: carrying out amplification culture on the positive clone at 37 ℃ until the OD600 of a bacterial liquid reaches 0.6-0.8, adding IPTG (isopropyl thiogalactoside) with the concentration of 0mM, 0.1mM, 0.3mM, 0.5mM, 0.7mM and 0.9mM, carrying out induction expression at 30 ℃ for 6h, collecting thalli, and carrying out electrophoresis after treatment;

b. time of induction: under the condition of the optimal IPTG induction concentration, collecting thalli at 0h, 2h, 4h and 6h after induction, and loading and running electrophoresis after treatment;

(3) and (3) analyzing the solubility of the recombinant protein: SDS-PAGE detects the solubility of the recombinant protein;

III, purification of CCR12 recombinant proteins

(1) The B L21 strain containing recombinant expression vector is expanded to 1000ml, and is shake-cultured at 37 deg.C and 200r/min to OD₆₀₀0.6-0.8, adding IPTG to the optimized final concentration of the step II (2) a, culturing at 30 ℃ and 200r/min to the optimized proper time of the step II (2) b;

(2) centrifuging at 4 deg.C for 1min at 1000g, and collecting all thallus;

(3)50ml of 0.01mM PBS for resuspending the thallus, centrifuging at 4 ℃ for 10min at 1000g, and removing the supernatant;

(4)50ml of L ysis buffer is used for resuspending the thalli, carrying out ultrasonic disruption, and centrifuging at the temperature of 4 ℃ for 10min at 1000g to collect supernatant;

(5) washing the nickel column by a Wash buffer and an Elution buffer containing imidazole with different concentrations in sequence, collecting effluent liquid, and detecting the Elution effect by SDS-PAGE;

(6) and dialyzing the purified protein solution in PBS overnight, concentrating by using an ultrafiltration centrifugal tube, and storing the concentrated solution at the temperature of-80 ℃.

2. The method for cloning and prokaryotic expression and purification of the gene of epinephelus coioides CCR12 according to claim 1, wherein the sequence analysis in step (one) (6) is: predicting the signal peptide of the sequence and the structural domain of the protein by adopting a Smart program, predicting the transmembrane structural domain of a receptor by using TMHMM Server v.2.0, comparing the cloned gene with the corresponding amino acid sequences of other species by using BioEdit and Clustal Omega, and performing phylogenetic tree by using MEGA5.04 Beta2 software;

the sequence analysis result is: grouper CCR12 consists of 1N-terminal region, 3 extracellular regions, 3 intracellular regions, and 1C-terminal region; grouper CCR12 resemblance to Danio rerio and Oryzias latipes was 62% and 73%, respectively, and resemblance to d.rerio other CCR12 and Xenopus tropicalis was 47% -48%; the grouper CCR12 is classified into one branch with other fish CCR12, and the sequence alignment result is consistent.

3. The method for cloning and prokaryotic expression and purification of the gene of the epinephelus coioides CCR12 as claimed in claim 1, wherein the double-enzyme digestion target fragment and the expression vector in the step (II) I (3) comprise: a. adding samples of the target fragments and the expression vector recovered from the gel according to a Quick Cut enzyme digestion system; b. mixing, centrifuging instantaneously, and enzyme cutting at 37 deg.C for 0.5 h; c. and recovering the target fragment and the expression vector after enzyme digestion by using the gel.

4. The method for gene cloning and prokaryotic expression and purification of epinephelus coioides CCR12 as claimed in claim 1, wherein the recombinant expression vector construction in step (II) I (4) comprises a, loading the target fragment recovered after double digestion and the expression vector according to a connection system of the recombinant expression vector, b.16 ℃ connecting overnight, c, transforming the connection product into competent cells of the expression strain B L21, d, identifying positive clones by colony PCR method, and sequencing.

Images