CN112062842A

CN112062842A - Polyclonal antibody of fish multi-poison tolerance protein MRP4/ABCc4, and preparation method and application thereof

Info

Publication number: CN112062842A
Application number: CN202010733699.8A
Authority: CN
Inventors: 陆星; 向莹; 文华; 蒋明; 钟山
Original assignee: Yangtze River Fisheries Research Institute CAFS
Current assignee: Yangtze River Fisheries Research Institute CAFS
Priority date: 2020-07-27
Filing date: 2020-07-27
Publication date: 2020-12-11

Abstract

The invention discloses a polyclonal antibody of fish multi-poison tolerance protein MRP4/ABCc4, a preparation method and application thereof, wherein the preparation method comprises the following steps: constructing a recombinant expression vector containing a fish multi-poison tolerance protein MRP4/ABCc4 gene; transforming the recombinant expression vector into an escherichia coli competent cell for induced expression to obtain a fish multi-poison tolerance protein MRP4/ABCc4 antigen; and (2) immunizing animals by using the fish multi-toxin tolerance protein MRP4/ABCc4 antigen to obtain antiserum, and then separating and purifying to obtain the anti-fish multi-toxin tolerance protein MRP4/ABCc4 polyclonal antibody. The invention can be used for detecting tissue expression of fish MRP on the protein level and specific response to heavy metal lead and mercury stress and organochlorine insecticide DDT and Lindane, thereby being used as a molecular marker for environmental risk assessment.

Description

Polyclonal antibody of fish multi-poison tolerance protein MRP4/ABCc4, and preparation method and application thereof

Technical Field

The invention belongs to the field of aquaculture, and particularly relates to a fish multi-poison tolerant protein gene MRP4/ABbcc4, and a coding protein and application thereof.

Background

Multi-toxin tolerance proteins (MRPs) belong to members of the ABC binder transporter (ATP binding cassette transporters) superfamily. As a transmembrane protein, MRP can recognize various endogenous substances with different structures, is responsible for participating in the transport of II-phase detoxification reaction products (such as reduced glutathione GSH, a conjugate of glucuronide, sulfate, glycine and the like), is considered as a III-phase detoxification factor, and has an important role in the detoxification and excretion of various toxic substances by cells.

Currently, 9 MRP member genes have been reported in humans and other mammals, and most are associated with multidrug Resistance (Multi-drug Resistance). MRPs can be classified as MRP1-MRP9 according to structural features and phylogenetic relationships. Due to differences in living environments, fish MRPs may develop functions different from those of mammalian homologous genes. In addition, MRP transporters have important functions in the aspects of tissue defense, poison detoxification or excretion, signal transduction and the like, so that the development of fish MRP research is beneficial to aquatic product molecular breeding, fish disease control and ecological environment protection. However, the research on the MRP of the fishes is still in the initial stage at present, and particularly, the intensive research results are not obtained in the research on the tissue expression and the positioning of the MRP of the fishes and the response to different environmental toxicant stresses.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides a polyclonal antibody of fish multi-poison resistant protein MRP4/ABCc4, a preparation method and application thereof, which can be used for detecting tissue expression of fish MRP (namely MRP4/ABCc4) on the protein level and specific response to heavy metal lead and mercury stress and organochlorine insecticide DDT and Lindane, and can be used as a molecular marker for environmental risk assessment.

The implementation of the present invention provides the following technical solutions for solving the above technical problems:

provides a preparation method of a polyclonal antibody against fish multiple poison tolerance protein MRP4/ABCc4, which comprises the following steps:

constructing a recombinant expression vector containing a fish multi-poison tolerance protein MRP4/ABCc4 gene;

transforming the recombinant expression vector into an escherichia coli competent cell for induced expression to obtain a fish multi-poison tolerance protein MRP4/ABCc4 antigen;

and (2) immunizing animals by using the fish multi-toxin tolerance protein MRP4/ABCc4 antigen to obtain antiserum, and then separating and purifying to obtain the anti-fish multi-toxin tolerance protein MRP4/ABCc4 polyclonal antibody.

Preferably, the step of constructing the recombinant expression vector containing the fish multi-poison tolerance protein MRP4/ABCc4 gene comprises the following steps: the fish multiple poison tolerance protein MRP4/ABCc4 gene is amplified by adopting a forward primer F1 and a reverse primer R1, wherein the forward primer F1 has a nucleotide sequence shown as SEQ ID NO.1, and the reverse primer R1 has a nucleotide sequence shown as SEQ ID NO. 2.

Preferably, the fish multiple poison tolerance protein MRP4/ABCc4 gene comprises or consists of the following nucleotide sequence:

a) SEQ ID NO: 3; or

b) SEQ ID NO: 3, a complementary, degenerate or homologous sequence of the nucleotide sequence set forth in seq id no; or

c) Under stringent conditions with SEQ ID NO: 3 or the complementary sequence thereof.

Preferably, the homology of the homologous sequence and the nucleotide sequence shown in SEQ ID No.3 is more than or equal to 30%, or more than or equal to 40%, or more than or equal to 50%, or more than or equal to 60%, or more than or equal to 70%, or more than or equal to 75%, or more than or equal to 80%, or more than or equal to 85%, or more than or equal to 86%, or more than or equal to 87%, or more than or equal to 88%, or more than or equal to 89%, or more than or equal to 90%, or more than or equal to 91%, or more than or equal to 92%, or more than or equal to 93%, or more than or equal to 94%, or more than or equal to 95%, or more than or equal to 96%, or more than or equal to 97%, or more than or equal to 98%, or more than or equal to 99%, or more than or equal to 99.1%, or more than or equal to.

Preferably, the nucleotide sequence of the recombinant expression vector is shown as SEQ ID No. 4.

Preferably, the amino acid sequence of the fish multi-poison tolerant protein MRP4/ABCc4 antigen is shown as SEQ ID No. 5.

Preferably, the step of transforming the recombinant expression vector into competent cells of escherichia coli to induce expression comprises:

transforming the recombinant expression vector into escherichia coli E.coliBL21 competent cells, coating the escherichia coli E.coliBL21 competent cells on an LB solid plate for culture, then selecting a monoclonal colony, inoculating the monoclonal colony into an LB liquid culture medium for culture, and adding IPTG (isopropyl-beta-thiogalactoside) for induced expression when the bacterial liquid OD (OD) value is 0.4-0.6 after the culture;

centrifugally collecting bacterial precipitates, discarding supernatant, adding soluble protein lysate, and re-suspending the bacterial precipitates obtained after lysis in the lysate; adding lysozyme into the lysate in which the bacterial precipitates are resuspended and mixing uniformly, centrifuging and collecting the supernatant, and adding an equivalent amount of 5 xSDS loading buffer and mixing uniformly for later use;

taking the supernatant to perform SDS-PAGE electrophoresis;

selecting escherichia coli E.coli BL21 competent cells containing the recombinant expression vector according to the SDS-PAGE electrophoresis result, culturing the competent cells in LB liquid culture, and adding IPTG (isopropyl-beta-thiogalactoside) for induction expression when the OD (OD) value of a bacterial liquid is 0.4-0.6;

centrifugally collecting bacterial sediment, removing supernatant, adding soluble protein lysate, PMSF and lysozyme to resuspend the bacterial sediment; breaking and centrifuging bacteria precipitation cells, and taking supernate for storage;

incubating NTAbeads and the supernatant together, and then washing the incubated hybrid protein by using soluble protein lysate; eluting the hybrid protein;

and putting the eluted hybrid protein into a dialysis bag for dialysis purification to obtain the fish multi-toxin tolerance protein MRP4/ABCc4 antigen.

Preferably, the step of immunizing animals with the fish multiple poison tolerance protein MRP4/ABCc4 antigen to obtain antiserum, and then separating and purifying to obtain the polyclonal antibody against the fish multiple poison tolerance protein MRP4/ABCc4 comprises the following steps:

injecting the fish multi-poison tolerant protein MRP4/ABCc4 antigen into the subcutaneous part of the animal; and after two weeks of primary immunization, subcutaneous injection is performed again to complete animal immunization;

after the immunization is finished, blood is collected from the heart of the anesthetized animal, and the supernatant is collected;

mixing the supernatant with beads uniformly, washing impurities by PBS, adding glycine, mixing uniformly, centrifuging to obtain the supernatant, and adding Tris-HCl into the supernatant for neutralization;

subpackaging and storing for later use.

Also provides a polyclonal antibody of the fish multi-poison resistant protein MRP4/ABCc4 prepared by the preparation method.

Also provides an application of the antibody in detecting tissue expression and/or location of fish multi-poison tolerant protein and/or response of fish to environmental poison stress.

According to the invention, the gene, protein and specific antibody of fish MRP (namely MRP4/Abcc4) are obtained, so that the research on tissue expression, location and response to different environmental toxicant stresses of fish MRP is facilitated, and the antibody can be used for detecting the tissue expression of fish MRP (namely MRP4/Abcc4) on the protein level and the specific response to heavy metal lead and mercury stresses, and organochlorine pesticide DDT and Lindane, so that the antibody can be used as a molecular marker for environmental risk assessment.

Drawings

FIG. 1 is a schematic structural diagram of expression vector pRC/CMV-Abcc4 of the present invention;

FIG. 2 shows the alignment of the amino acid sequences of the fish MRP4/ABCc4 protein and human MRP4/ABCC4 protein of the present invention;

FIG. 3 shows the results of protein expression of MRP4/Abcc4 in the tissues of zebra fish adults;

FIG. 4 is a graph showing the results of protein response of MRP4/Abcc4 of the present invention to heavy metal lead stress in the kidney of zebrafish;

FIG. 5 shows the result of protein response of MRP4/Abcc4 to heavy metal lead stress in zebra fish gills;

FIG. 6 shows the result of the induced expression of MRP4/Abcc4 gene in zebra fish gill, kidney and intestinal tract under mercury treatment;

FIG. 7 shows the result of the induced expression of MRP4/Abcc4 gene in zebra fish embryos treated by DDT and Lindane;

FIG. 8 shows the result of expression and subcellular localization of MRP4/Abcc4 protein in LLC-PK1 cells;

FIG. 9 is the accumulation of DDT or Lindane in cells overexpressing MRP4/Abcc4 gene following DDT or Lindane treatment;

FIG. 10 is the amount of lead accumulated in cells overexpressing MRP4/Abcc4 gene after lead treatment;

FIG. 11 shows the amount of lead accumulated in embryos overexpressing MRP4/Abcc4 gene after DDT and Lindane treatments.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

Example 1:

the embodiment provides a preparation method of a polyclonal antibody against fish multiple poison tolerance protein MRP4/ABCc4, which comprises the following steps:

The specific process comprises the following steps:

gene cloning and recombinant vector construction: selecting adult tissues (including liver, intestinal tract, kidney, gill, muscle and the like) of zebra fish (Danio rerio), extracting RNA, mixing, and synthesizing qualified RNA into first-strand cDNA for later use; based on the predicted zebrafish mRNA sequence (NM — 001007038) in the GenBank nucleotide database, a primer set group for amplification was designed, which included: a forward primer F1 and a reverse primer R1, wherein the sequence of the forward primer F1 is 5'-ATGGAGCCGATAAAGAAAGATGCC-3' (namely the nucleotide sequence shown in SEQ ID NO. 1), and the sequence of the reverse primer R1 is 5'-TTATAAAGCAGTCTCGAATATAATCAAAC-3' (namely the nucleotide sequence shown in SEQ ID NO. 2); amplifying according to a program to obtain a product with the fragment size of about 3984bp, wherein the product is the separated fish multi-poison tolerant protein gene MRP4/ABCc 4; the amplified fish multiple poison tolerance protein gene MRP4/ABCc4 is recovered and purified, and then is connected with p RC/CMV to construct a recombinant expression vector pRC/CMV-ABCc4 (shown in figure 1). Wherein "isolated" means that the gene has been isolated from the DNA sequences flanking it in its native state, and that the gene has been separated from components of the nucleic acid with which it is associated in its native state, and from proteins with which it is associated in the cell.

In this example, the isolated fish multiple poison tolerance protein gene MRP4/ABCc4 comprises or consists of the following nucleotide sequence:

SEQ ID NO: 3, a complementary, degenerate or homologous sequence of the nucleotide sequence set forth in seq id no; or

Under moderate/high stringency conditions with SEQ ID NO: 3 or the complementary sequence thereof.

And the homology of the homologous sequence and the nucleotide sequence shown in SEQ ID No.3 is more than or equal to 30 percent, or more than or equal to 40 percent, or more than or equal to 50 percent, or more than or equal to 60 percent, or more than or equal to 70 percent, or more than or equal to 75 percent, or more than or equal to 80 percent, or more than or equal to 85 percent, or more than or equal to 86 percent, or more than or equal to 87 percent, or more than or equal to 88 percent, or more than or equal to 89 percent, or more than or equal to 90 percent, or more than or equal to 91 percent, or more than or equal to 92 percent, or more than or equal to 93 percent, or more than or equal to 94 percent, or more than or equal to 95 percent, or more than or equal to 96 percent, or more than or equal to 97 percent, or more than 98 percent, or more than or equal to.

Furthermore, the nucleotide sequence of the constructed recombinant expression vector pRC/CMV-Abcc4 is shown as SEQ ID No.4, and the amino acid sequence of the obtained fish multiple poison tolerance protein MRP4/ABcc4 antigen is shown as SEQ ID No. 5.

Amino acid sequence alignment: the amino acid sequence of the obtained fish multi-poison tolerant protein MRP4/ABCc4 antigen consists of 1327 amino acids, has 70 percent of sequence homology with human MRP4/ABCC4 protein, and has all functional domains and key motifs of the protein, including 2 transmembrane domains (TMH1-6 and TMH7-12) and 2 nucleic acid binding domains containing highly conserved Walker A, ABCSinatur and Walker B motifs (figure 2).

The results of amino acid alignment show that the fish multiple poison tolerant protein MRP4/ABCc4 has 70% homology with human and mouse and comprises all functional domains and key motifs, which indicates that the fish multiple poison tolerant protein MRP4/ABCc4 is an ortholog of human MRP4/ABCC4 protein, and suggests that the protein is a potential molecular marker.

First induction expression:

transforming the recombinant expression vector pRC/CMV-Abcc4 into an Escherichia coli E.coli BL21 competent cell, coating the E.coli BL21 competent cell on an LB solid plate for culture, selecting a single round and smooth monoclonal colony after 12 hours, inoculating the single round and smooth monoclonal colony into 8mL of an LB liquid culture medium with resistance for culture, and shaking the colony at 37 ℃ and 200rpm for 4-5 hours; when the OD value of the bacterial liquid reaches 0.4-0.6, adding IPTG with final concentration of 0.2mM for induction expression, and shaking the bacterial liquid at 16 ℃ and 200rpm for 4-5 h;

the bacterial pellet was collected by centrifugation at 12000rpm and the supernatant was discarded, followed by addition of a soluble protein lysate lysine Buffer (50mM Na H)₂PO₄300mM NaCl, 10mM imidazole, pH 8.0), and fully suspending the bacterial pellet obtained after lysis in the lysis solution to avoid air bubbles;

adding lysozyme into the lysate in which the bacterial precipitates are resuspended until the concentration is 1mg/mL, uniformly mixing, standing on ice for 45min, centrifuging at the temperature of 4 ℃ for 10min at 15000g, collecting supernatant, and adding 5 xSDS loading buffer with the same volume for uniformly mixing for later use;

after the above-mentioned supernatant sample was denatured by heating at 95 ℃ 20. mu.L of the supernatant was electrophoresed in 12% SDS-PAGE gel, followed by staining with Coomassie brilliant blue and destaining until clear bands were visible with the naked eye and the molecular weight of the target protein was about 170 Kda.

And (3) secondary induction expression:

and selecting escherichia coli E.coliBL21 competent cells with expression effects meeting the conditions and containing the recombinant expression vector according to the SDS-PAGE electrophoresis result, adding the escherichia coli E.coliBL21 competent cells into 5mL of LB liquid culture with resistance, and shaking the mixture at 37 ℃ and 200rpm for 4-5 h. When the OD value of the bacterial liquid reaches about 0.4-0.6, adding IPTG with final concentration of 0.2mM to induce expression, and shaking overnight at 16 ℃ and 200 rpm;

centrifuging the bacterial liquid at 7500g for 15min, collecting bacterial precipitate, and mixing the bacterial precipitate with the following components in a volume ratio of 1: 10 adding a soluble protein lysate Lysisbuffer (wherein the bacterial precipitation is 1mL, and the soluble protein lysate Lysisbuffer10mL), and adding PMSF with the final concentration of 1m M and lysozyme with the final concentration of 0.4 mg/mL;

resuspending the bacterial precipitate, crushing with a high-pressure cell crusher, transferring into a centrifuge tube, centrifuging at 4 deg.C 15000g for 30min, and collecting supernatant for storage; centrifuging NTA beads at 400g and 4 ℃, discarding the supernatant, washing with soluble protein lysate Lysis Buffer for 2 times, resuspending, and storing for later use;

incubating NTA beads and the supernatant stored in the previous step at 4 ℃ for more than 3h, and washing with soluble protein lysate lysine Buffer until the protein 280 value is below 0.02; add Wash Buffer (50mM NaH)₂PO₄300mM NaCl, 50mM imidazole, pH 8.0, and after completion, the cell was replaced with an Elution Buffer (50mM NaH)₂PO₄300mM NaCl, 250mM imidazole, PH 8.0) to 10mL again;

the eluted heteroproteins were placed in dialysis bags and dialysate (50mM NaH) was added₂PO₄300mM NaCl, pH 8.0), magnetically stirring at 4 deg.C, placing the dialysis bag on a preservative film, adding PEG 8000, cleaning, and purifying to obtain protein (i.e. purified fish)The multiple toxicant-like tolerance protein MRP4/ABCc4 antigen) was transferred into EP tubes and stored at-80 ℃ for further use.

Animal immunization:

diluting the purified fish multi-poison tolerance protein MRP4/ABCc4 antigen to 1mg/mL by using sterilized PBS, dropwise adding Freund's adjuvant, fully and uniformly mixing, transferring to a 1mL syringe, and injecting 8-10 parts of the antigen under the animal skin; in this example, the animal is a rabbit;

two weeks after the initial immunization, 3-5 sites were injected again subcutaneously to complete the immunization of animals.

Antibody separation:

collecting blood from heart of anesthetized rabbit, standing at 37 deg.C for 2 hr, standing at 4 deg.C overnight, centrifuging at 4 deg.C and 6000rpm for 30min, and collecting supernatant;

mixing the supernatant with beads, standing at 4 deg.C overnight, centrifuging at 200g for 3min to remove supernatant, washing with PBS, mixing with 0.2M glycine (pH 2.0), centrifuging at 200g for 3min to obtain supernatant, and rapidly neutralizing with 0.3 volume times of 1M Tris-HCl (pH 8.5);

repeatedly eluting, adding glycerol with equal mass, subpackaging and storing for later use;

and detecting the titer of the antibody by using Western blot, and obtaining the antibody after the detection is finished.

Example 2:

this example provides a polyclonal antibody against the fish multiple poison tolerance protein MRP4/ABCc4 prepared by the preparation method described in example 1.

Example 3:

this example provides the use of an antibody of example 2 to detect tissue expression and/or localization of a fish multi-toxin tolerant protein, and/or a fish response to environmental toxicant stress.

Detecting protein expression of MRP4/Abcc4 in each adult tissue of zebra fish:

collecting each adult tissue of zebra fish, including brain, eyes, gills, heart, intestinal tracts, liver, muscle, kidney, ovary and testis, extracting protein, quantifying the protein by using a BCA method, and collecting a tissue protein sample of 20 mu g for Western blot analysis;

the antibody in the embodiment 2 is diluted according to the proportion of 1:500, and beta-actin is used as an internal reference; the protein signal was quantitatively analyzed by ImageJ software (Nation al Institutes of Health), and the results are shown in FIG. 3.

As shown in the results of fig. 3: the molecular weight of MRP4/Abcc4 protein is about 170KDa, and the displayed band is clear, wherein the protein expression level in the heart is higher, and then the eye, ovary, liver, kidney and the like are carried out. The prepared MRP4/Abcc4 antibody has high specificity and can be used for expression detection and quantitative analysis of fish multi-poison tolerance protein.

Protein response to heavy metal lead stress in zebrafish kidney was examined for MRP4/Abcc 4:

heavy metal lead toxicity test: preparing 20mM heavy metal lead mother liquor, diluting the mother liquor to the concentration of 0 (control), 0.125, 0.25, 0.5 and 1 mu M lead by using deionized water, selecting 5 zebra fish male fishes (the average weight is 0.51 +/-0.04 g) and 5 zebra fish female fishes (the average weight is 0.49 +/-0.02 g) to be placed in a glass aquarium, and filling 20L of aerated tap water into each aquarium; after the test fish is put into an aquarium to be adapted for 48 hours, heavy metal lead is added for treatment for 24 hours, the water temperature is 28 ℃, and no feeding is carried out in the treatment process; after treatment, the fish were anesthetized and dissected using MS222 and kidney tissue was collected for use.

Proteins are extracted from kidney tissues with different lead acute exposure concentrations and quantified, and the protein expression and quantification of MRP4/Abcc4 are respectively detected by using a Western blot method and Image J software, and the results are shown in FIG. 4.

Figure 4 results show that: the protein expression quantity of MRP4/Abcc4 is obviously higher than that of a control group (0 mu M) in the lead concentration range of 0.25-1 mu M, the induction rate is improved by 2.8-3.4 times, and the protein expression of MRP4/Abcc4 can highly respond to the stress of heavy metal lead in the intestinal tract of the zebra fish.

Detection of protein response of MRP4/Abcc4 to heavy metal lead stress in zebrafish gills:

the gill tissue of the zebra fish in the lead toxicity test is collected, and Western blotting analysis is performed after protein is extracted, and the result is shown in fig. 5.

Figure 5 results show that: the protein expression of MRP4/Abcc4 is obviously higher than that of a control group (0 mu M) in the lead concentration range of 0.5-1 mu M, the induction rate is improved by 1.8-2.3 times, and the protein expression of MRP4/Abcc4 can respond to the stress of heavy metal lead in the gills of the zebra fish.

Detecting the expression response of the MRP4/Abcc4 protein gene to heavy metal mercury (Hg) stress in the gill, kidney and intestinal tract of the zebra fish:

heavy metal Hg toxicity test: preparing 20mM heavy metal mercury mother liquor, diluting the heavy metal mercury mother liquor to the concentration of 0 (control), 0.125, 0.25, 0.5 and 1 mu M mercury by using deionized water, selecting 5 zebra fish male fishes (the average weight is 0.52 +/-0.03 g) and 5 zebra fish female fishes (the average weight is 0.51 +/-0.05 g), putting the fish male fishes and the 5 zebra fish female fishes into a glass aquarium, and filling 20L of aerated tap water into each aquarium; after the test fish is put into an aquarium to be adapted for 48 hours, heavy metal lead is added for treatment for 24 hours, the water temperature is 28 ℃, and no feeding is carried out in the treatment process; after treatment, the fish were anesthetized using MS222 and dissected to collect gill, kidney and intestinal tissue for use.

After the sample tissues were collected, the induced expression change of MRP4/Abcc4 gene under Hg stress in gill, kidney and intestinal tissues was analyzed by quantitative PCR, and the results are shown in FIG. 6.

The results in FIG. 6 show that: the expression level of MRP4/Abcc4 gene in gills can be increased by 15.45 times after 1.0 mu M Hg is exposed for 24h, and the expression level of MRP4/Abcc4 gene in kidney and intestinal tract can be respectively increased by 1.94 times and 1.55 times after 0.125 mu M Hg is treated, which shows that the protein expression of MRP4/Abcc4 can respond to the stress of heavy metal Hg in gills, kidney and intestinal tract of zebra fish.

Detecting the expression response of MRP4/Abcc4 protein gene to DDT (namely, bis-p-chlorophenyl trichloroethane) in zebra fish embryos:

DDT toxicity test: DDT was formulated in DMSO as a 1mg/mL stock solution (final DMSO concentration does not exceed 0.4%). Prior to toxicity experiments, zebrafish embryo culture (30% Danieau solution: 19.3mM NaCl, 0.23mM KCl, 0.13mM MgSO 2) was used₄·7H₂O，0.2mMCa(NO₃)₂,1.67mM Hepes[pH7.2]) DDT stock was diluted to concentrations of 0 (control), 0.05, 0.5, 5, 50, 100. mu.g/L and 24hpf zebrafish embryos were exposed to 96 hpf. The embryo culture solution containing DDT was replaced every 12h for each treatment with 100 embryosNo mortality or other non-lethal effects were found during the treatment.

Samples of embryos treated to 96hpf were collected and analyzed for the change in transcriptional expression of the DDT-induced MRP4/Abcc4 gene in zebrafish embryos by quantitative PCR, the results of which are shown in FIG. 7.

A in fig. 7 shows: DDT treatment can obviously induce the transcription expression of MRP4/Abcc4 gene, and the induction efficiency is increased by 1.51, 1.57, 1.6, 1.73 and 2.38 times in sequence.

Detecting the expression response of MRP4/Abcc4 protein gene to Lindane (namely gamma-hexachlorocyclohexane) in zebra fish embryos:

lindane toxicity test: lindane was formulated with DMSO as a 1mg/mL stock solution (final DMSO concentration does not exceed 0.4%). Prior to toxicity experiments, Lindane stock solution was diluted to concentrations of 0 (control), 0.05, 0.5, 5, 50, 100. mu.g/L with zebrafish embryo culture solution (30% Danieu solution: 19.3mM NaCl, 0.23mM KCl, 0.13mM MgSO4 & 7H2O, 0.2mM Ca (NO3)2,1.67mM Hepes [ pH7.2]) and 24hpf zebrafish embryos were exposed to 96 hpf. The Lindane-containing embryo culture medium was replaced every 12h with 100 embryos per treatment, and no mortality or other non-lethal effects were observed during the treatment.

After collecting the embryo samples treated to 96hpf, the Lindane induced changes in the transcriptional expression of MRP4/Abcc4 gene in zebrafish embryos were analyzed by quantitative PCR, and the results are shown in FIG. 7.

The B results in fig. 7 show: the Lindane treatment can remarkably induce the transcriptional expression of MRP4/Abcc4 genes, and the induction efficiency is increased by 1.34, 1.5, 2.08, 2.13 and 2.57 in sequence.

Therefore, from the functional research, the fish MRP4/Abcc4 gene expression can be obviously influenced by environmental toxic substances, and the quantitative PCR method detects that the heavy metal mercury and lead, the organic chlorine pesticide DDT, the Lindane and the like can obviously induce the transcriptional expression of the MRP4/Abcc4 gene in adult kidney, gill, intestinal tract and embryo of the zebra fish, so that the MRP4/Abcc4 gene can be used as a potential molecular marker.

Overexpression of fish MRP4/Abcc4 gene effect:

LLC-PK1 cells are transfected by overexpression vectors pT2/CMV-SV40-Neo (no load, used as a control) and pT2/CMV-Abcc4-Flag-Neo, and cell lines which stably express MRP4/Abcc4 genes and no load (CTRL) are obtained by G418 screening. Western blotting results show that MRP4/Abcc4 protein driven by the CMV promoter can be stably expressed in LLC-PK1 cells (shown as A in figure 8);

next, subcellular localization of MRP4/Abcc4 protein in LLC-PK1 cells was detected by immunofluorescence staining, and as shown in B in FIG. 8, Flag-labeled MRP4/Abcc4 protein localized on the cytoplasmic membrane, confirming that it is a membrane protein.

And respectively treating the over-expressed MRP4/Abcc4 gene and unloaded LLC-PK1 cells with 2.5 mu g/mL DDT and 10 mu g/mL Lindane, and detecting the accumulation content of the DDT or the Lindane in the cells at different time points by adopting a gas chromatograph.

As shown in FIG. 9, accumulation of DDT or Lindane was significantly lower in cells overexpressing MRP4/Abcc4 gene than in unloaded cells at each time point examined. The accumulation of DDT or lindane in unloaded cells increased on average by 1.36-fold and 1.39-fold with increasing exposure time, respectively.

Similarly, cells were treated with 12.5-100. mu.M lead for 12h, and as shown in FIG. 10, A, when the lead exposure concentration was 25-100. mu.M, the accumulation of lead in cells overexpressing MRP4/Abcc4 gene was significantly lower than that of unloaded cells. And under 50 μ M lead stress (shown as B in FIG. 10), the accumulation of lead in the cells overexpressing MRP4/Abcc4 gene was lower than that in the unloaded cells (average content was 25.44% of that in the unloaded cells) in 1h, 3h, 6h and 12 h.

In addition, the molecular function of MRP4/Abcc4 gene for resisting poison accumulation is also verified at the level of zebra fish embryos. Specifically, 24hpf zebrafish embryos are respectively treated by 5 mu g/LDDT or Lindane for different time periods, and the content of DDT or Lindane in the embryos at each time point is detected by a gas chromatograph. As shown in FIG. 11, the accumulation of DDT or Lindane in the embryos overexpressing MRP4/Abcc4 gene was significantly lower than that in the embryos overexpressing GFP and Abcc4-G1188D at each time point examined, and the average accumulation of DDT or Lindane in the embryos overexpressing MRP4/Abcc4 gene over 48h was 54.9% and 63.5% of that in the embryos overexpressing GFP, respectively.

These results indicate that MRP4/Abcc4 may be a main factor for multi-poison tolerance of aquatic organisms such as fishes and the like, and has an important role in poison detoxification and excretion, and the over-expression fish MRP4/Abcc4 gene can significantly enhance the tolerance or excretion of heavy metal lead, DDT and lindane stress of zebra fish cells and embryos. And because the protein is the final product of gene coding and the functional executor, the preparation of the fish MRP4/Abcc4 antibody can effectively detect the tissue expression, the location and the response to different environmental toxicant stresses of the multi-toxicant tolerant protein.

In summary, the invention has the following advantages:

according to the invention, the gene, protein and specific antibody of fish MRP (namely MRP4/Abcc4) are obtained, so that the tissue expression, location and response research on different environmental toxicants (such as heavy metal lead) stress of fish MRP are facilitated, and the antibody can be used for detecting the tissue expression of fish MRP (namely MRP4/Abcc4) on the protein level and the specific response to heavy metal lead, mercury stress, and organochlorine pesticides DDT and Lindane, so that the antibody can be used as the specific response of a molecular marker for environmental risk assessment, and can be used as the molecular marker for environmental risk assessment and used for aquatic product safety and environmental health risk assessment.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> Changjiang aquatic products institute of aquatic science and research in China

<120> polyclonal antibody for resisting fish multiple poison tolerance protein MRP4/ABCc4, and preparation method and application thereof

<160>5

<170> PatentIn version 3.5

<210> 1

<211>24

<212> DNA

<213> Artificial sequence

<400> 1

ATGGA GCCGATAAAGAAAGATGCC 24

<210> 2

<211> 29

<212> DNA

<213> Artificial sequence

<400> 2

TTATAAAGCAGTCTCGAATATAATCAAAC 29

<210> 3

<211> 3984

<212> DNA

<213> Artificial sequence

<400> 3

1 tctgctggct gaatcctctt ttcagtatcg gatctaagag gagacttgag gaggatgaca tgtttaatgt

141 gcttccggag gatcggtcaa agaaactcgg ggaggagctg cagagctact gggaccaaga gaaggagaaa

211 gcagccaaag aactcaagac cccaaaactc acgaaagcca ttatcaggtg ctactggaaa tcttatgcag

281 ttctaggagt gtttactctt attgaggagt caataaaagt gatccagcct gtgttttcgg gcaaactcat

351 taagtatttt gagaactatc ggcacgatga catggcagct ttatctgaag cttatggata tgcaacaggc

421 gtctgtttct ccaccctggg cttggctttg ctccatcatc tctatttcta ccacgttcaa agagctggaa

491 tgaaaatccg cattgcaatg tgtcacatga tctacaggaa ggctctatgt cttagcgctg cagcaatggg

561 ccaaacaacc acagggcaga tcgttaatct tttgtccaat gacgtcaaca aattcgatga gttgactatt

631 tttctgcact tcctgtgggt ggggcctctg caagccgcag ccgtgattgg tctgctttgg caagagattg

701 gaccatcgtg ccttgctggg atggcagttt tagtctttct aatgccgctt cagaccatgt tcgggaaact

771 gttttccaaa tacaggagta aaaccgcagc cttgactgac agccggatac gcactatgaa tgaggtggtt

841 tctggcatac gtataattaa gatgtatgcc tgggagaagc cgttcgccat gctggttaat gatgtacgaa

911 ggaaggagat ctccaaaatc atgagcagct cttacctgcg tggcttgaac atggcctcgt tctttacagc

981 caataaaatc atcctgtttg tgacgttcac tgtgtacgtg ttggtgggaa acaccatgtc tgcgagtcgc

1051 gtgtttgtgg ccgtgtctct gtacagcgcc gtccgcctca ccgtcactct gttcttccct gctgccatcg

1121 agaaagtgtc tgaatctgcc atcagcatcc gcaggatcaa gaagttcctg ttgctggatg agcttgtgaa

1191 aaatcacctt ccgctttctc aggaggagaa gaaagagccg tcggtggaga tgcaggatct catatgctac

1261 tgggacaaga ctctggatgc tccaacatta caaaatgtgt gttttactgt gaagccgggt cagctgctgg

1331 ctgtaattgg tcctgtggga gctggaaagt cgtctctcct cagcaccgtt ctgggagagc ttccggctga

1401 gaagggtgtg ataaaggtga aaggagagct gacctatgcc tcgcagcagc cctgggtctt tccaggcacc

1471 attcgcagca acatactgtt tggaaaagag ctgcagcctc agcgatatga gcgagttctc cgagcctgtg

1541 cgcttaagag ggacatggag ctgcttcctg atggggattt gacagtgatt ggagaccggg gagcaactct

1611 cagtggagga cagaaagcca gagtcaacct ggccagggct gtgtatcagg atgctgatat ttacctgctg

1681 gatgatccat tgagtgctgt ggatgctgaa gtgagcagac atctgtttga acagtgtgtt tgtggtattc

1751 tgaaggacaa gcccaggatc ttggtgaccc atcagctgca gtacctgaag gctgcgaatc agatcctggt

1821 tttgaaagag gggcacatgg tggctcgagg ctcgtactct gagcttcagc agtccggact ggatttcacc

1891 tctcttctga agaaggacga agaagaggag agcggcagtg aaaaaggaga agctcctcga tctccacgca

1961 gtcgcaccgt ttcccagaac tccgtccgtt cacattcttc ctccgttttg tcggtgaaag acgactctga

2031 tcagctcccg gctgagcctg tgcacactat ggctgaggag tcgcgctcag agggaaacat cggcatccgc

2101 atgtattgga agtattttcg agccggagca aacgtggtga tgctggtttt actggtgctg ctcaatctgc

2171 tggcgcagac tttttatatt cttcaggact ggtggctttc gtactgggcc acagagcagg agaaactgga

2241 ccacaatacc aacaatacca ataccaacaa taccagtgct ggaaacacga ctgagcaact cgacctgaac

2311 ttctatttgg gcatctatgc aggtttaaca ggagccacga ttgtcttcgg cttcatgcgt tgtctaatta

2381 tgttcaatgc tctggtgagc tcagcagaga cgcttcacaa ccgcatgttc aacagcatct tgaggacacc

2451 agtgcgcttt ttcgacatca atcccattgg aagaatcctc aaccgcttct ccaaggacat cggccacctt

2521 gactccttac ttccgtggac atttgtggat ttcatccagg tgtttctgca aattgtcggc gtgattgctg

2591 ttgcatcttc tgtcatccct tggattctga tccctgttct tcccctgttg atttgcttcc tgttcctgcg

2661 ccgctacttc ctgcggacat cacgagacgt caagcgcatc gaatccacca ctcgaagtcc tgttttctcc

2731 catctgtcct cctcactgca aggcctgtgg accattcgtg cttttaaagc ggaggaaagg tttcagcaaa

2801 catttgatgc tcaccaggat ctgcattcag aggcctggtt cctgttctta accacttcac gctggtttgc

2871 ggtgcgtttg ggtgggatgt gctctgtgtt tgtgactatc acagcattcg gatgtcttct tcttaaagac

2941 actatgaatg caggagatgt gggcctagca ttgtcctatg ctgtcaccct gatggggatg ttccagtggg

3011 gtgtaagaca gagtgctgag gtggagaaca tgatgacgtc agtggagaga gtagtagagt acacagagct

3081 ggaaagtgaa gcaccttggg aaactcaaaa acgcccctct cccgactggc caaatcgcgg cctgataacc

3151 ttcgacaggg tcaacttctc ctacagttct gacggacccg ttgtcctcaa gaacatctca gccatgttca

3221 gacccagaga gaaggttgga atagttggac ggactggtgc agggaaaagc tccctgattt cagctttgtt

3291 tcgtctgtca gagccagaag gaaaaatcct ggttgacgga gtgttgacct cagagatcgg cctccacgac

3361 ctccgtcaga agatgtccat catcccgcgg gatcctgtcc tgttcacagg aaccatgagg aagaacctgg

3431 accccttcaa ccagcactcg gaccatgacc tgtggaaagc tctggaagag gttcagctga aggcggctgt

3501 ggaggaactg cctggaaaat tggagaccga actggctggg tctggatcaa acttcagcgt gggtcaacgg

3571 cagctcgtct gtctggccag agccatcctg aggaagaatc gcgttctcat catcgatgaa gccaccgcaa

3641 atgtggaccc tcggacagat gagctgatcc agaaaaccat ccgtgataag tttaaggaat gcacagtcct

3711 caccatcgca cacagactca acaccatcat agacagcgac cgcatcctgg ttctagatgc cggtcggatc

3781 cacgaatatg acgctccaca cgttctacta cagaaccaga gcgggatatt ttataagatg gtgcagcaga

3851 cgggaaaagc agaagcgacg tctctgctac agacggccaa acaggcatac gcaaaccgca gtccggccca

3921 ccagctcaat ggttttgcca ccacaggaga tggcagtttg attatattcg agactgcttt ataa

<210> 4

<211> 5761

<212> DNA

<213> Artificial sequence

<400> 4

1 tgtgtgtacg tcttgcttat tagcgcccaa tcaggtttga caggagtgac aatgagccaa

61 tcgctgctcg gatggggcgg ggtttggtct cacgctcaca gtaggaaatg aacggtttta

121 cctcagcctg tagttaccga catgtgcgtg ttagaaagtt atacaacagt ttacaaggta

181 aatgtcttgc gctggttaca ggttatgcga ggggtaccag agtccggctg aaccgcgggg

241 aggatgacaa gcgatatgga gccgataaag aaagatgcca aaagcaaccc ctcagcctcg

301 gctaatctct tctcgcagat atttttctgc tggctgaatc ctcttttcag tatcggatct

361 aagaggagac ttgaggagga tgacatgttt aatgtgcttc cggaggatcg gtcaaagaaa

421 ctcggggagg agctgcagag ctactgggac caagagaagg agaaagcagc caaagaactc

481 aagaccccaa aactcacgaa agccattatc aggtgctact ggaaatctta tgcagttctg

541 ggagtgttta ctcttattga ggagtcaata aaagtgatcc agcctgtgtt tttgggcaaa

601 ctcattaagt attttgagaa ctatcggcac gatgacatgg cagctttatc tgaagcttat

661 ggatatgcaa caggcgtctg tctctccacc ctgggcttgg ctttgctcca tcatctctat

721 ttctaccacg ttcaaagagc tggaatgaaa attcgcattg caatgtgtca catgatctac

781 aggaaggctc tatgtcttag cgctgcagca atgggccaaa caaccacagg gcagatcgtt

841 aatcttttgt ccaatgacgt caacaaattc gatgagttga ctatttttct gcacttcctg

901 tgggtggggc ctctgcaagc cgcagctgtg attggtctgc tttggcaaga gatcggacca

961 tcgtgccttg ctgggatggc agttttagtc tttctaatgc cgcttcagac catgttcggg

1021 aaactgtttt ccaagtacag gagtaaaacc gcagccttga ctgacagccg gatacgcact

1081 atgaatgagg tggtttctgg catacgtata attaagatgt atgcctggga gaagccgttc

1141 gccatgctgg ttaatgatgt acgaaggaag gagatctcca aaatcatgag cagctcttac

1201 ctgcgtggct tgaacatggc ctcgttcttt acagccaata aaatcatcct gtttgtgacg

1261 ttcaccgtgt acgtgttggt gggaaacacc atgtctgcga gtcgcgtgtt tgtggccgtg

1321 tctctgtaca gcgccgtccg cctcaccgtc actctgttct tccctgctgc catcgagaaa

1381 gtgtctgaat ccgccatcag catccgcagg atcaagaagt tcctgttgct ggatgagctt

1441 gtgaaaaatc accttccgct ttctcaggag gagaagaaag agccgtcggt ggagatgcag

1501 gatctcatat gctactggga caagactctg gatgctccaa cattacaaaa tgtgtgtttt

1561 actgtgaagc cgggtcagct gctggctgta attggtcctg tgggagctgg aaagtcgtct

1621 ctcctcagca ccgttctggg agagcttccg gctgagaagg gtgtgataaa ggtgaaagga

1681 gagctgacct acgcctccca gcagccctgg gtctttccag gcaccattcg cagcaacata

1741 ctgtttggaa aagagctgca gccacagcga tatgagcgag tcctccgagc ctgtgcgctt

1801 aagagggaca tggagctgct tcctgatggg gatttgacag tgattggaga ccggggagca

1861 actctcagtg gaggacagaa agccagagtc aacctggcca gggctgtgta tcaggatgct

1921 gatatttacc tgctggatga tccattgagt gctgtggatg ctgaagtgag cagacatctg

1981 tttgaacagt gtgtttgtgg tattctgaag gacaagccca ggatcttggt gacccatcaa

2041 ctgcagtacc tgaaggctgc gaatcagatc ctggttttga aagaggggca catggtggct

2101 cgaggctcgt actctgagct tcagcagtcc ggactggatt tcacctctct tctgaagaag

2161 gacgaagaag aggagagcgg cagtgaaaaa ggagaagctc ctcgatctcc acgcagtcgc

2221 accgtttccc agaactccgt ccgttcacat tcttcctccg ttttgtcggt gaaagacgac

2281 tctgatcagc tcccggctga acctgtgcac actatggccg aggagttgcg ctcagaggga

2341 aacatcggca tccgcatgta ttggaagtat tttcgagccg gagcaaacgt ggtgatgctg

2401 gttttactct tgctgctcaa tctgctggcg cagacttttt atattcttca ggactggtgg

2461 ctttcgtact gggccacaga gcaggagaaa ctggaccaca ataccaacaa taccaatacc

2521 aacaatacca gtgctggaaa cacgactcag caacttgacc tgaacttcta tttgggcatc

2581 tatgcaggtt taacaggagc cacgattgtc ttcggcttca tgcgttgtct aattatgttc

2641 aatgctctgg tgagctcagc agagatgctt cacaaccgca tgttcaacag catcttgagg

2701 acaccagtgc gctttttcga catcaatccc attggaagaa tcctcaaccg cttctccaag

2761 gacatcggcc accttgactc cttacttccg tggacatttg tggatttcat ccaggtgttt

2821 ctgcaaattg tcggcgtgat tgctgttgca tcttctgtca tcccttggat tctgatccct

2881 gttcttcccc tgttgatttg cttcctgttc ctgcgccgct acttcctgcg gacatctcga

2941 gacgtcaagc gcatcgaatc caccactcga agtcctgttt tctcccatct gtcctcctca

3001 ctgcaaggcc tgtggaccat tcgtgctttt aaagcggagg aaaggtttca gcaaacattt

3061 gatgctcacc aggatctgca ttcagaggcc tggttcctgt tcttgaccac ttcacgctgg

3121 tttgcggtgc gtttggatgg gatgtgctct gtgtttgtga ctatcacagc attcggatgt

3181 cttcttctta aagacactat gaatgcagga gatgtgggcc tggcattgtc ctatgctgtc

3241 accctgatgg ggatgttcca gtggggtgta agacagagtg ctgaggtgga gaacatgatg

3301 acgtcagtgg agagagtagt agagtacaca gagctggaaa gtgaagcacc ttgggaaact

3361 caaaaacgcc cctctcccga ctggccaaat cgtggcctga taaccttcga cagggtcaac

3421 ttctcctaca gttctgacgg accagttgtt ctcaagaaca tctcagccat gttcagaccc

3481 agagagaagg ttggaatagt tggacggact ggtgcaggga aaagctccct gatttcagct

3541 ttgtttcgtc tgtcagagcc agaaggaaaa atcctggttg acggagtgtt gacctcagag

3601 atcggcctcc acgacctccg tcagaagatg tccatcatcc cgcaggatcc tgtcctgttc

3661 acaggaacca tgaggaagaa cctggacccc ttcaaccagc actcggacca tgacttgtgg

3721 aaagctctgg aagaggttca gctgaaggcg gctgtggagg aactgcctgg aaaattggag

3781 accgaactgg ctgagtctgg atcaaacttc agcgtgggtc aacggcagct cgtctgtctg

3841 gccagagcca tcctgaggaa gaatcgcgtt ctcatcatcg atgaagccac cgcaaatgtg

3901 gaccctcgga cagatgagct gatccagaaa accatccgtg ataagtttaa ggaatgcaca

3961 gtcctcacca tcgcacacag actcaacacc atcatagaca gcgaccgcat cctggttcta

4021 gatgccggtc ggatccacga atatgacgct ccacacgttc tactacagaa ccagagcggg

4081 atattttata agatggtgca gcagacggga aaagcagaag cgacgtctct gctacagacg

4141 gccaaacagg catacgcaaa ccgcagtccg gcccaccagc tcaatggttt tgccaccaca

4201 ggagatggca gtttgattat attcgagact gctttataat agcctggaag tgcctgatgt

4261 aaacggggca cagcttcccc agaatcctcc tcctgcgcag gacaacaggc acaatttctt

4321 caccaaagaa aacccggctg acagagccaa agacacgtgc atgaacgatc acgccagaga

4381 ggacagagct gcagggagac ttcaacacca gcatttctcc agttcagtgg agattgtaca

4441 ccactgtatg ttatgattat taatacgtgc cttaatgtgt aagtgtagca tcaggactgt

4501 tttgggccaa agagatgctt gcctttgctc aaatgaagct agacttgttt cgttttttgc

4561 tggtgccttt atagtgcatg aacctaaaac actgctgatt ctaacagcag caattaagac

4621 cgttataaat agttcacccc aaaataagca ctccattgtc atttgaaacc cgtgtgaggt

4681 ttttttttct gtgaaaagat gctttgaaaa atgttgaaaa ccaaaaagtt taaagtttaa

4741 tttacaattt tcaaactgct ttgtttagaa tatttgcttt tatcgtcaac agaagaaaga

4801 aaatcgaaac atttagcaat aatgactgaa tttttatttt ggggtgaagt atcgctgtgc

4861 tgagagggcg tctatttgtt tatttattaa tattattatt tttttgtttt gacactccat

4921 ctgccttaaa aaaagtcact tttcaataag ccaacagaaa ataatgtatc tgctgaaaac

4981 aatcgttgtg tagcttatgt tgtcggtcac actttatttt gatggtccgt ttgttgaatt

5041 taggttgcat tgcatctaca tgccaactaa ttctcattag attatacgta gactattagg

5101 ttagggttag tgtaagcaga catgtacttg caaagtttct tatagtcagt tatatgtcag

5161 ttgaaggagc agtatcagca gatattaagc agacaggcta ctaatactca aatggaccat

5221 caaaataaag tgttaccagg ttttctattg actatagtgt gtcttagtgt ttgacacaaa

5281 gtttgtgtgc gatgcaaacc aaattaaacc tacatttgtg tcttaaattt taaagttgat

5341 tcccttttac ttaaacaaac agcttatatt tttatagttt tgtttagtga atttggaact

5401 gagagaatga aagggatgtt gagtgagttg ttgttttgta ttattttatt gttttattca

5461 tgttcaattt atttcctttc atgaaaagga gaaaagaaag ttgcagtatc caccaaaatt

5521 gttattcata ttattattgt tgagtttagt ttagcccaag ggctatattt aagttttacc

5581 tctgaattca acgttttttt taccattaaa tgtttgttgt catctcctgt ctgttgtgtt

5641 ctgtttaaaa tggctgcatg atttctgctg gttggaacaa tcagtgttca acagtccaaa

5701 gaacatgttt gtgttttatt tgttaaacat gtttgcaatt gttcagtctt atcaaaatgt

5761 tattttggga ttaaaccact ttgaatcaca

<210> 5

<211> 1327

<212> PRT

<213> Artificial sequence

<400> 5

Met Glu Pro Ile Lys Lys Asp Ala Lys Ser Asn Pro Ser Ala Ser Ala Asn Leu Phe Ser Gln

Ile Phe Phe Cys Trp Leu Asn Pro Leu Phe Ser Ile Gly Ser Lys Arg Arg Leu Glu Glu Asp

Asp Met Phe Asn Val Leu Pro Glu Asp Arg Ser Lys Lys Leu Gly Glu Glu Leu Gln Ser Tyr

Trp Asp Gln Glu Lys Glu Lys Ala Ala Lys Glu Leu Lys Thr Pro Lys Leu Thr Lys Ala Ile

Ile Arg Cys Tyr Trp Lys Ser Tyr Ala Val Leu Gly Val Phe Thr Leu Ile Glu Glu Ser Ile

Lys Val Ile Gln Pro Val Phe Ser Gly Lys Leu Ile Lys Tyr Phe Glu Asn Tyr Arg His Asp

Asp Met Ala Ala Leu Ser Glu Ala Tyr Gly Tyr Ala Thr Gly Val Cys Phe Ser Thr Leu Gly

Leu Ala Leu Leu His His Leu Tyr Phe Tyr His Val Gln Arg Ala Gly Met Lys Ile Arg Ile

Ala Met Cys His Met Ile Tyr Arg Lys Ala Leu Cys Leu Ser Ala Ala Ala Met Gly Gln Thr

Thr Thr Gly Gln Ile Val Asn Leu Leu Ser Asn Asp Val Asn Lys Phe Asp Glu Leu Thr Ile

Phe Leu His Phe Leu Trp Val Gly Pro Leu Gln Ala Ala Ala Val Ile Gly Leu Leu Trp Gln

Glu Ile Gly Pro Ser Cys Leu Ala Gly Met Ala Val Leu Val Phe Leu Met Pro Leu Gln Thr

Met Phe Gly Lys Leu Phe Ser Lys Tyr Arg Ser Lys Thr Ala Ala Leu Thr Asp Ser Arg Ile

Arg Thr Met Asn Glu Val Val Ser Gly Ile Arg Ile Ile Lys Met Tyr Ala Trp Glu Lys Pro

Phe Ala Met Leu Val Asn Asp Val Arg Arg Lys Glu Ile Ser Lys Ile Met Ser Ser Ser Tyr

Leu Arg Gly Leu Asn Met Ala Ser Phe Phe Thr Ala Asn Lys Ile Ile Leu Phe Val Thr Phe

Thr Val Tur Val Leu Val Gly Asn Thr Met Ser Ala Ser Arg Val Phe Val Ala Val Ser Leu

Tyr Ser Ala Val Arg Leu Thr Val Thr Leu Phe Phe Pro Ala Ala Ile Glu Lys Val Ser Glu

Ser Ala Ile Ser Ile Arg Arg Ile Lys Lys Phe Leu Leu Leu Asp Glu Leu Val Lys Asn His

Leu Pro Leu Ser Gln Glu Glu Lys Lys Glu Pro Ser Val Glu Met Gln Asp Leu Ile Cys Tyr

Trp Asp Lys Thr Leu Asp Ala Pro Thr Leu Gln Asn Val Cys Phe Thr Val Lys Pro Gly Gln

Leu Leu Ala Val Ile Gly Pro Val Gly Ala Gly Lys Ser Ser Leu Leu Ser Thr Val Leu Gly

Glu Leu Pro Ala Glu Lys Gly Val Ile Lys Val Lys Gly Glu Leu Thr Tyr Ala Ser Gln Gln

Pro Trp Val Phe Pro Gly Thr Ile Arg Ser Asn Ile Leu Phe Gly Lys Glu Leu Gln Pro Gln

Arg Tyr Gilu Arg Val Leu Arg Ala Cys Ala Leu Lys Arg Asp Met Glu Leu Leu Pro Asp Gly

Asp Leu Thr Val Ile Gly Asp Arg Gly Ala Thr Leu Ser Gly Glu Gln Lys Ala Arg Val Asn

Leu Ala Arg Ala Val Tyr Gln Asp Ala Asp Ile Tyr Leu Leu Asp Asp Pro Leu Ser Ala Val

Asp Ala Glu Val Ser Arg His Leu Phe Glu Gln Cys Val Cys Gly Ile Leu Lys Asp Lys Pro

Arg Ile Leu Val Thr His Gln Leu Gln Tyr Leu Lys Ala Ala Asn Gln Ile Leu Val Leu Lys

Glu Gly His Met Val Ala Arg Gly Ser Tyr Ser Glu Leu Gln Gln Ser Gly Leu Asp Phe Thr

Ser Leu Leu Lys Lys Asp Glu Glu Glu Glu Ser Gly Ser Glu Lys Gly Glu Ala Pro Arg Ser

Pro Arg Ser Arg Thr Val Ser Gln Asn Ser Val Arg Ser His Ser Ser Ser Val Leu Ser Val

Lys Asp Asp Ser Asp Gln Leu Pro Ala Glu Pro Val His Thr Met Ala Glu Glu Ser Arg Ser

Glu Gly Asn lle Gly Ile Arg Met Tyr Trp Lys Tyr Phe Arg Ala Glu Ala Asn Val Val Met

Leu Val Leu Leu Val Leu Leu Asn Leu Leu Ala Gln Thr Phe Tur Ile Leu Gln Asp Trp Trp

Leu Ser Tyr Trp Ala Thr Glu Gln Glu Lys Leu Asp His Asn Thr Asn Asn Thr Asn Thr Asn

Asn Thr Ser Ala Gly Asn Thr Thr Glu Gln Leu Asp Leu Asn Phe Tyr Leu Leu Gly Ile Tyr

Ala Gly Leu Thr Gly Ala Thr Ile Val Phe Gly Phe Met Arg Cys Leu Ile Met Phe Asn Ala

Leu Val Ser Ser Ala Glu Thr Leu His Asn Arg Met Phe Asn Ser Ile Leu Arg Thr Pro Val

Arg Phe Phe Asp Ile Asn Pro Ile Gly Arg Ile Leu Asn Arg Phe Ser Lys Asp Ile Gly His

Leu Asp Ser Leu Leu Pro Trp Thr Phe Val Asp Phe Ile Gln Val Phe Leu Gln Ile Val Gly

Val Ile Ala Val Ala Ser Ser Val Ile Pro Trp Ile Leu Ile Pro Val Leu Pro Leu Leu Lle

Cys Phe Leu Phe Leu Arg Arg Tyr Phe Leu Ang Thr Set Arg Asp Val Lys Arg Ile Glu Ser

Thr Thr Arg Ser Pro Val Phe Ser His Leu Ser Ser Ser Leu Gln Gly Leu Trp Thr Ile Arg

Ala Phe Lys Ala Glu Glu Arg Phe Gln Gln Thr Phe Asp Ala His Gln Asp Leu His Ser Glu

Ala Trp Phe Leu Phe Leu Thr Thr Ser Arg Trp Phe Ala Val Arg Leu Gly Gly Met Cys Ser

Val Phe Val Thr Ile Thr Ala Phe Gly Cys Leu Leu Leu Lys Asp Thr Met Asn Ala Gly Asp

Val Gly Leu Ala Leu Ser Tyr Ala Val Thr Leu Met Gly Met Phe Gin Trp Gly Val Arg Gln

Ser Ala Glu Val Glu Asn Met Met Thr Ser Val Glu Arg Val Val Glu Tyr Thr Glu Leu Glu

Ser Glu Ala Pro Trp Glu Thr Gln Lys Arg Pro Ser Pro Asp Trp Pro Asn Arg Gly Leu lle

Thr Phe Asp Arg Val Asn Phe Ser Tyr Ser Ser Asp Gly Pro Val Val Leu Lys Asn Ile Ser

Ala Met Phe Arg Pro Arg Glu Lys Val Gly Ile Val Gly Arg Thr Gly Ala Gly Lys Ser Ser

Leu Ile Ser Ala Leu Phe Arg Leu Ser Glu Pro Glu Gly Thr Met Arg Lys Asn Leu Asp Pro

Phe Asn Gin His Ser Asp His Asp Leu Trp Lys Ala Leu Glu Glu Val Gln Leu Lys Ala Ala

Val Glu Glu Leu Pro Gly Lys Leu Glu Thr Glu Leu Ala Gly Ser Gly Ser Asn Phe Ser Val

Gly Gin Arg Gin Leu Val Cys Leu Ala Arg Ala Ile Leu Arg Lys Asn Arg Val Leu Ile Ile

Asp Glu Ala Thr Ala Asn Val Asp Pro Arg Thr Asp Glu Leu Ile Gln Lys Thr Ile Arg Asp

Lys Phe Lys Glu Cys Thr Val Leu Thr Ile Ala His Ara Leu Asn Thr Ile Ile Asp Ser Asp

Arg Ile Leu Val Leu Asp Ala Gly Arg Ile His Glu Tyr Asp Ala Pro His Val Leu Leu Gln

Asn Gln Ser Gly Ile Phe Tyr Lys Met Val Gln Gln Thr Gly Lys Ala Glu Ala Thr Ser Leu

Leu Gln Thr Ala Lys Gln Ala Tyr Ala Asn Arg Ser Pro Ala His Gln Leu Asn Gly Phe Ala

Thr Thr Gly Asp Gly Ser Leu Ile Ile Phe Glu Thr Ala Leu

Claims

1. A preparation method of a polyclonal antibody against fish multiple poison tolerance protein MRP4/ABCc4 is characterized by comprising the following steps:

2. The method of claim 1, wherein the step of constructing a recombinant expression vector containing the fish multiple poison tolerance protein MRP4/ABCc4 gene comprises: the fish multiple poison tolerance protein MRP4/ABCc4 gene is amplified by adopting a forward primer F1 and a reverse primer R1, wherein the forward primer F1 has a nucleotide sequence shown as SEQ ID NO.1, and the reverse primer R1 has a nucleotide sequence shown as SEQ ID NO. 2.

3. The method according to claim 1, wherein the fish multiple poison tolerance protein MRP4/ABCc4 gene comprises or consists of the nucleotide sequence:

a) SEQ ID NO: 3; or

4. The method according to claim 3, wherein the homology of the homologous sequence to the nucleotide sequence shown in SEQ ID No.3 is greater than or equal to 30%, or greater than or equal to 40%, or greater than or equal to 50%, or greater than or equal to 60%, or greater than or equal to 70%, or greater than or equal to 75%, or greater than or equal to 80%, or greater than or equal to 85%, or greater than or equal to 86%, or greater than or equal to 87%, or greater than or equal to 88%, or greater than or equal to 89%, or greater than or equal to 90%, or greater than or equal to 91%, or greater than or equal to 92%, or greater than or equal to 93%, or greater than or equal to 94%, or greater than or equal to 95%, or greater than or equal to 96%, or greater than or equal to 97%, or greater than 98%, or greater than or equal to 99%, or greater than or equal to 99.1%, or greater than or equal to 99.2%, or greater than.

5. The method of claim 1, wherein the recombinant expression vector has a nucleotide sequence as set forth in SEQ ID No. 4.

6. The method for preparing the fish multi-poison tolerant protein MRP4/ABCc4 antigen according to claim 1, wherein the amino acid sequence of the antigen is shown as SEQ ID No. 5.

7. The method of claim 1, wherein the step of transforming the recombinant expression vector into E.coli competent cells to induce expression comprises:

the recombinant expression vector is transformed into escherichia coli E.coli BL21 competent cells, the competent cells are coated on an LB solid plate for culture, and then a monoclonal colony is selected and inoculated into an LB liquid culture medium for culture. When the culture is carried out until the OD value of the bacterial liquid is 0.4-0.6, IPTG is added for induction expression;

taking the supernatant to perform SDS-PAGE electrophoresis;

incubating NTA beads and the supernatant, and cleaning the incubated hybrid protein with soluble protein lysate; eluting the hybrid protein;

8. The method according to claim 1, wherein the step of immunizing an animal with the fish multiple poison tolerance protein MRP4/ABCc4 antigen to obtain antiserum, and then separating and purifying the antiserum to obtain the polyclonal antibody against the fish multiple poison tolerance protein MRP4/ABCc4 comprises:

subpackaging and storing for later use.

9. A polyclonal antibody against the fish multiple poison tolerance protein MRP4/ABCc4, which is prepared by the preparation method according to any one of claims 1 to 8.

10. Use of an antibody according to claim 9 for detecting tissue expression and/or localization of a fish multi-toxin tolerance protein, and/or a fish response to environmental toxicant stress.