CN107254484A - A kind of CPP LUC chimeric proteins and its application in intracellular ATP is detected - Google Patents
A kind of CPP LUC chimeric proteins and its application in intracellular ATP is detected Download PDFInfo
- Publication number
- CN107254484A CN107254484A CN201710627369.9A CN201710627369A CN107254484A CN 107254484 A CN107254484 A CN 107254484A CN 201710627369 A CN201710627369 A CN 201710627369A CN 107254484 A CN107254484 A CN 107254484A
- Authority
- CN
- China
- Prior art keywords
- cpp
- atp
- luc
- chimeric proteins
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/66—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving luciferase
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/61—Fusion polypeptide containing an enzyme fusion for detection (lacZ, luciferase)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A kind of application the invention discloses CPP LUC chimeric proteins and its in intracellular ATP is detected.CPP LUC chimeric proteins of the present invention are obtained by the CPP LUC carrier prokaryotic expressions comprising cell-penetrating peptide gene and luciferase gene.CPP LUC chimeric proteins of the present invention can guide luciferase to enter living cells using cell-penetrating peptide, driven and lighted by ATP in the presence of substrate and ATP, and fluorescence intensity and ATP amount are directly proportional this mechanism, CPP LUC chimeric proteins are used to detect intracellular ATP, the steps such as the required cell cracking of ATP detections can be removed from, error caused by reduction operation, moreover it is possible to realize that routine ATP detects the In vivo detection that can not be carried out and detection (imaging) in real time.When CPP LUC chimeric proteins of the present invention are used to detect intracellular ATP, have the advantages that easy to operate, specific good, sensitivity is high, can also be made into ATP detection kits, have a good application prospect and huge market value.
Description
Technical field
The invention belongs to technical field of biological chemistry detection, more specifically to a kind of the glimmering of cell-penetrating peptide guiding
Application during light element enzyme is built and its ATP is detected in the cell.
Background technology
Luciferase is sensitive, the reliable biology sensor for being used to determine ATP, is probe using the luciferase of clone
Intracellular ATP concentration is quantified, is widely used in cytoactive detection, cytotoxicity screening and cell proliferation research.It is glimmering
Light element (D-luciferin) is present in a variety of luminous organisms as firefly luciferase (Luciferase) substrate.
The catalysis of luciferase and oxygen, ATP, Ca2+/Mg2+In the presence of, fluorescein is oxidized and discharges the light of yellow green
(562nm).ATP is prevalent in including in all living cells including microorganism, being the substrate that luciferase is directly acted on again,
The process that luciferase produces chemiluminescence discharges fluorescence, and the fluorescence intensity discharged and intracellular ATP are participated under aerobic conditions
Content is proportionate.After cell death, intracellular ATP is hydrolyzed rapidly, and the ATP contents of living cells are substantially stationary, therefore is surveyed
The fluorescence intensity reaction obtained can reflect the quantity of living cells.Detected for intracellular ATP, ATP's carries after cell cracking
Take process inevitable, cause intracellular ATP measurements inaccurate, be unfavorable for high-throughout drug screening.
The content of the invention
It is an object of the invention to：Existing conventional ATP detection methods are overcome to need to crack cell, it is impossible to reflect
The time of day of cell and there are problems that complex operation, accuracy are high, simple and efficient to handle there is provided a kind of sensitivity
Application in CPP-LUC chimeric proteins and its ATP detections in the cell.
In order to realize foregoing invention purpose, the present invention provides a kind of CPP-LUC carriers, and it includes cell-penetrating peptide gene and fluorescence
Plain enzyme gene, is reached by common promoter single expression or control table simultaneously.
As CPP-LUC carriers of the present invention one kind improve, the cell-penetrating peptide gene be TAT, VP-22, ANTP,
Transportan, PEP-1, MPG, MAP, KALA, ppTG20, hCT (9-32) or Arg9.
Improved as one kind of CPP-LUC carriers of the present invention, the luciferase is red firefly luciferase, green
Firefly luciferase or jellyfish luciferases.
In order to realize foregoing invention purpose, the present invention also provides a kind of CPP-LUC being made up of cell-penetrating peptide and luciferase
Chimeric protein, is obtained by the CPP-LUC carriers prokaryotic expression.Cell-penetrating peptide (cell penetrating peptides,
CPPs those less than 20 amino acid, positively charged small peptides) are refered in particular to, most cells film can be passed through.They can will be more
Bioactive substance is planted to carry in cell without special culture environment, including micromolecular compound, dyestuff, polypeptide, egg
White matter, plasmid, liposome, virus etc..
CPP-LUC chimeric proteins of the present invention can be used for detecting intracellular ATP, and detection method comprises the following steps：
CPP-LUC chimeric proteins are added in the Tissue Culture Plate containing serum and are incubated, then remove supernatant, fluorescence is added
Plain zymolyte is reacted, and detects fluorescence, you can measure intracellular ATP content.
Detect that a kind of intracellular ATP the of method improves as the present invention, the temperature of the incubation is 37 degrees Celsius, is incubated
Time is 5min~1h.
Detect that a kind of intracellular ATP the of method improves as the present invention, the time of the reaction is 5min~1h.
In order to realize foregoing invention purpose, the present invention also provides a kind of cell ATP detection kit, and it includes CPP-LUC
Chimeric protein and luciferase substrate.
Improved as one kind of cell ATP detection kit of the present invention, the detection kit also includes ATP standard items.
Compared with prior art, the present invention has the advantages that：
CPP-LUC chimeric proteins of the present invention can guide luciferase to enter living cells using cell-penetrating peptide, be deposited in substrate and ATP
Driven under by ATP luminous, and fluorescence intensity and ATP amount be directly proportional this mechanism, and CPP-LUC chimeric proteins are used to detect
Intracellular ATP, can remove the steps, error caused by reduction operation, moreover it is possible to which realization is conventional such as the required cell cracking of ATP detections from
In vivo detection and detection (imaging) in real time that ATP detections can not be carried out.CPP-LUC chimeric proteins of the present invention are used to detect cell
During interior ATP, have the advantages that easy to operate, specific good, sensitivity is high, ATP detection kits can be also made into, with good
Good application prospect and huge market value.
Brief description of the drawings
With reference to the accompanying drawings and detailed description, the present invention and beneficial effect are described in detail.
Fig. 1 is the plasmid map of embodiment 1.
Fig. 2 analyzes for the TAT-LUC SDS-PAGE of embodiment 2；Wherein, A:37 DEG C induce 4h, 1:Full bacterium solution is not induced；
2:Supernatant is not induced；3:Non- induced precipitation；4:Induce full bacterium solution；5:Induce supernatant；6:Induced precipitation；M:Marker；B:22℃
Induce 16h, 1:Full bacterium solution is not induced；2:Supernatant is not induced；3:Non- induced precipitation；4:Induce full bacterium solution；5:Induce supernatant；3:Lure
Lead precipitation；M:Marker.
Fig. 3 is the cell detection standard curve of embodiment 2.
Embodiment
In order that goal of the invention, technical scheme and the advantageous effects of the present invention become apparent from, with reference to embodiments,
The present invention will be described in further detail.It should be appreciated that the embodiment described in this specification is just for the sake of explanation
The present invention, is not intended to limit the present invention, formula, the ratio of embodiment etc. can suit measures to local conditions to make a choice and have no reality to result
Matter influences.
Embodiment 1TAT- firefly luciferases recombinate egg plasmid construction
1st, TAT+LUC sequences such as SEQ ID NO:Shown in 1, wherein, 30 bases are TAT labels before sequence.
2nd, LUC is expanded by the primer containing TAT sequences and produces TAT-LUC gene orders
Primer TAT+LUCBamHIF sequences such as SEQ ID NO:Shown in 2, primer TAT+LUCXhoIR such as SEQ ID NO:3
It is shown.
3rd, PCR is fished and is taken gene
1. PCR reaction systems
Following system is prepared in 0.2mL EP pipes, template takes the plasmid containing LUC to take 0.5 μ L to expand TAT+ after diluting
LUC：
Note：KOD plus neo DNA Polymerase are purchased from ToYoBo companies, article No.:KOD 401.
2. amplification condition
After mixing, the amplification of the type PCR amplification instruments of GeneAmp PCR System 2400 is placed in.
The amplification condition of TAT+LUC genes：
3. PCR primer is reclaimed
1) PCR primer is after 1% gel electrophoresis, under uviol lamp, and the gel of the fragment containing target gene is cut with scalpel
Band is into clean 1.5mL EP pipes, after weighing, and is added in 100 μ L solution Bs D of 100mg gels correspondence ratio into centrifuge tube
Solution B D.
2) 60 DEG C of water-bath 10min dissolve completely to gel, vibration mixing 3 times during water-bath.
3) solution is transferred in DNA purification columns, stands 2min, the 000rpm of room temperature 12 centrifugation 1min, abandon filtrate.
4) to 500 μ L solution PE, the 000rpm of room temperature 12 centrifugation 1min are added on post, filtrate is abandoned.
5) last action is repeated once.
6) 000rpm of room temperature void column 12 centrifuges the liquid that 1min is remained thoroughly to remove in purification column.
7) pillar is placed on new 1.5mL EP pipes, the sterilized water of 30 μ L, 60 DEG C of preheatings, 13 is added to post center
400g centrifuges 1min to elute DNA.
4. PCR recovery products and carrier double digestion：In 2 sterile 0.2mL EP reaction tubes, TAT+LUC PCR are taken respectively
Each 15 μ L of μ L and pet-28a carriers of recovery product 15, with BamHI and XhoI double digestions, digestion system is as follows：
After mixing, 37 DEG C of reaction 3h.
4th, digestion products reclaim (DNA gel QIAquick Gel Extraction Kit, DONGSHENG BIOTECH)
1. digestion products are after 1% gel electrophoresis, under uviol lamp, cut respectively containing purpose fragment and carrier with scalpel
Gel-tape into clean 1.5mL EP pipes, in 100mg gels correspondence 100 μ L solution Bs D ratio added into centrifuge tube
Solution B D.
2. 60 DEG C of water-bath 10min dissolve completely to gel, vibration mixing 3 times during water-bath.
3. solution is transferred in DNA purification columns, stands 2min, the 000rpm of room temperature 12 centrifugation 1min, abandon filtrate.
4. to 500 μ L solution PE, the 000rpm of room temperature 12 centrifugation 1min are added on post, filtrate is abandoned.
5. last action is repeated once.
6. the 000rpm of void column 12 centrifuges the liquid that 1min is remained thoroughly to remove in purification column.
7. pillar is placed on new 1.5mL EP pipes, the sterilized water of 30 μ L, 60 DEG C of preheatings, 13 is added to post center
400g centrifuges 1min to elute DNA.
5th, mesh section fragment is connected with carrier
Following reagent is added into 0.2mL EP pipes, and (T4DNA Ligase enzymes are purchased from TaKaRa companies, article No.：D2011A；)
16 DEG C of connection 1h.
6th, the conversion of connection product
1. 5 μ L connection products are added separately in 50 μ L DH5 α competence tissues in ice bath.Gently rotation is mixed, ice
Bathe 30min.
2. 42 DEG C of water-bath heat shock 90s.
3. quickly pipe is transferred in ice bath, ice bath 2min.
4. 200 μ L LB culture mediums are separately added into, are mixed, 37 DEG C, 200rpm shaken cultivations 1h.
5. in superclean bench, on the LB flat boards that bacterium solution is spread evenly across to that (Kan) containing card (100 μ g/mL), room temperature
It is lower to place, to liquid absorption.
6. flat board is inverted, 37 DEG C of biochemical cultivation case incubated overnights are transferred to.
7th, plasmid enzyme restriction identification positive colony
1. from the incubator overnight culture in 3mL LB pipes of several monoclonals of picking on flat board；
2. plasmid extraction, (high-purity small amount plasmid extraction kit, G-SHUN)
1) 3 μ L bacterium solutions are collected with 1.5mL EP pipes, 12 000rpm centrifugation 1min remove supernatant.
2) 250 μ L solution Is/RNase A mixed liquors are added, thalline is resuspended.
3) 250 μ L solution IIs are added, gently overturns and mixes 6 times repeatedly, room temperature places 2min.
4) 350 μ L solution IIIs are added, gently overturns and mixes 6 times repeatedly.
5) 12 000rpm centrifuge 10min, carefully suck supernatant into DNA purification columns, stand 2min.
6) 12 000rpm centrifuge 1min, abandon filtrate.
7) 500 μ L solution PB are added into post, 12 000rpm centrifugation 1min abandon filtrate.
8) 500 μ L solution Ws are added into post, 12 000rpm centrifugation 1min abandon filtrate.It is repeated once.
9) 000rpm of void column 12 centrifuges 3min.
10) post is taken out and be placed in new 1.5mL EP pipes, added 50 μ L sterilized waters (60 DEG C of preheatings), stand 2min, 13
400rpm centrifuges 1min to elute plasmid (Fig. 1).
8th, plasmid is extracted in digestion identification
Endonuclease reaction system is as follows：
37 DEG C of digestion 2h.
TAT+LUC plasmids obtained by the present embodiment deliver to the sequencing of Shanghai Sheng Gong genome companies, sequencing result such as SEQ ID NO:4
It is shown.
The expression of recombinant proteins of embodiment 2 and intracellular ATP detections
1. the bacterium solution for 50 μ L incubated overnights of transferring is into the 5mL LB liquid mediums containing 50 μ g/mL kanamycins, 37 DEG C
Lower 210rpm/min cultivate to OD600 be about 0.6 when, add final concentration of 0.5Mm IPTG induced expressions, continue at 37 DEG C
Culture 4 hours.Thereafter 10000rpm, 4 DEG C of centrifugation 10min collection thalline, are carried out after the bacterial sediment being collected into is resuspended with PBS
Ultrasonication, work 3s, interval 5s, power 300W, circulates 90 times.10000rpm, 4 DEG C of centrifugation 20min, collects Supernatant samples,
Precipitation is resuspended with appropriate PBS.Appropriate full bacterium solution, supernatant deposit sample is taken to carry out PAGE gel electrophoresis (Fig. 2).
2. in order to detect intracellular ATP content, by A549 cells doubling dilution in the black porocyte culture plates of wall 96 to every
0 to 50000, hole.Then the TAT-LUC3.1mg/mL that 1 μ L are added in 100 μ L cell culture mediums is incubated 2 minutes.Thereafter abandon
Supernatant is removed, it is 150 μ g/mL (culture medium dilution) that D- firefly luciferins sodium salt to ultimate density is added into each hole, at once
Detect that luminous intensity reacts the enzymatic activity (Fig. 3) of luciferase with 96 microwell plate luminometers.
The announcement and teaching of book according to the above description, those skilled in the art in the invention can also be to above-mentioned embodiment party
Formula carries out appropriate change and modification.Therefore, the invention is not limited in embodiment disclosed and described above, to this
Some modifications and changes of invention should also be as falling into the scope of the claims of the present invention.Although in addition, this specification
In used some specific terms, but these terms are merely for convenience of description, do not constitute any limitation to the present invention.
Sequence table
SEQ ID NO:1 TAT+LUC DNA sequence dna
atgaggaagaagcggagacagcgacgaagagaagacgccaaaaacataaagaaaggcccggcgccattctatc
cgctggaagatggaaccgctggagagcaactgcataaggctatgaagagatacgccctggttcctggaacaattgct
tttacagatgcacatatcgaggtggacatcacttacgctgagtacttcgaaatgtccgttcggttggcagaagctat
gaaacgatatgggctgaatacaaatcacagaatcgtcgtatgcagtgaaaactctcttcaattctttatgccggtgt
tgggcgcgttatttatcggagttgcagttgcgcccgcgaacgacatttataatgaacgtgaattgctcaacagtatg
ggcatttcgcagcctaccgtggtgttcgtttccaaaaaggggttgcaaaaaattttgaacgtgcaaaaaaagctccc
aatcatccaaaaaattattatcatggattctaaaacggattaccagggatttcagtcgatgtacacgttcgtcacat
ctcatctacctcccggttttaatgaatacgattttgtgccagagtccttcgatagggacaagacaattgcactgatc
atgaactcctctggatctactggtctgcctaaaggtgtcgctctgcctcatagaactgcctgcgtgagattctcgca
tgccagagatcctatttttggcaatcaaatcattccggatactgcgattttaagtgttgttccattccatcacggtt
ttggaatgtttactacactcggatatttgatatgtggatttcgagtcgtcttaatgtatagatttgaagaagagctg
tttctgaggagccttcaggattacaagattcaaagtgcgctgctggtgccaaccctattctccttcttcgccaaaag
cactctgattgacaaatacgatttatctaatttacacgaaattgcttctggtggcgctcccctctctaaggaagtcg
gggaagcggttgccaagaggttccatctgccaggtatcaggcaaggatatgggctcactgagactacatcagctatt
ctgattacacccgagggggatgataaaccgggcgcggtcggtaaagttgttccattttttgaagcgaaggttgtgga
tctggataccgggaaaacgctgggcgttaatcaaagaggcgaactgtgtgtgagaggtcctatgattatgtccggtt
atgtaaacaatccggaagcgaccaacgccttgattgacaaggatggatggctacattctggagacatagcttactgg
gacgaagacgaacacttcttcatcgttgaccgcctgaagtctctgattaagtacaaaggctatcaggtggctcccgc
tgaattggaatccatcttgctccaacaccccaacatcttcgacgcaggtgtcgcaggtcttcccgacgatgacgccg
gtgaacttcccgccgccgttgttgttttggagcacggaaagacgatgacggaaaaagagatcgtggattacgtcgcc
agtcaagtaacaaccgcgaaaaagttgcgcggaggagttgtgtttgtggacgaagtaccgaaaggtcttaccggaaa
actcgacgcaagaaaaatcagagagatcctcataaaggccaagaagggcggaaagatcgccgtg
SEQ ID NO:2 TAT+LUCBamHIF artificial sequences
cgcggatccATGAGGAAGAAGCGGAGACAGCGACGAAGAGAAGACGCCAAAAACATAAA
SEQ ID NO:3 TAT+LUCXhoIR artificial sequences
ccgctcgagCACGGCGATCTTTCCGCCCTTCTTGGC
SEQ ID NO:4 TAT+LUC plasmids
ggggaggggaaccatttccccctctagaataattttgtttaactttaagaaggagatataccatgggcagcag
ccatcatcatcatcatcacagcagcggcctggtgccgcgcggcagccatatggctagcatgactggtggacagcaaa
tgggtcgcggatccatgaggaagaagcggagacagcgacgaagagaagacgccaaaaacataaagaaaggcccggcg
ccattctatccgctggaagatggaaccgctggagagcaactgcataaggctatgaagagatacgccctggttcctgg
aacaattgcttttacagatgcacatatcgaggtggacatcacttacgctgagtacttcgaaatgtccgttcggttgg
cagaagctatgaaacgatatgggctgaatacaaatcacagaatcgtcgtatgcagtgaaaactctcttcaattcttt
atgccggtgttgggcgcgttatttatcggagttgcagttgcgcccgcgaacgacatttataatgaacgtgaattgct
caacagtatgggcatttcgcagcctaccgtggtgttcgtttccaaaaaggggttgcaaaaaattttgaacgtgcaaa
aaaagctcccaatcatccaaaaaattattatcatggattctaaaacggattaccagggatttcagtcgatgtacacg
ttcgtcacatctcatctacctcccggttttaatgaatacgattttgtgccagagtccttcgatagggacaagacaat
tgcactgatcatgaactcctctggatctactggtctgcctaaaggtgtcgctctgcctcatagaactgcctgcgtga
gattctcgcatgccagagatcctatttttggcaatcaaatcattccggatactgcgattttaagtgttgttccattc
catcacggttttggaatgtttactacactcggatatttgatatgtggatttcgagtcgtcttaatgtatagatttga
aga
Claims (10)
1. a kind of CPP-LUC carriers, it is characterised in that it includes cell-penetrating peptide gene and luciferase gene, by common startup
Sub- single expression or simultaneously control table reach.
2. CPP-LUC carriers according to claim 1, it is characterised in that the cell-penetrating peptide gene be TAT, VP-22,
ANTP, Transportan, PEP-1, MPG, MAP, KALA, ppTG20, hCT (9-32) or Arg9.
3. CPP-LUC carriers according to claim 1, it is characterised in that the luciferase is red firefly fluorescence
Plain enzyme, green firefly luciferase or jellyfish luciferases.
4. a kind of CPP-LUC chimeric proteins, it is characterised in that the CPP- as described in any one claim in claims 1 to 3
LUC carrier prokaryotic expressions are obtained.
5. application of the CPP-LUC chimeric proteins described in claim 4 in intracellular ATP is detected.
6. a kind of method for detecting intracellular ATP, it is characterised in that comprise the following steps：
Will described in claim 4 CPP-LUC chimeric proteins add the Tissue Culture Plate containing serum in be incubated, then remove on
Clearly, add luciferase substrate to be reacted, detect fluorescence, you can measure intracellular ATP content.
7. the intracellular ATP of detection according to claim 6 method, it is characterised in that the temperature of the incubation is taken the photograph for 37
Family name's degree, incubation time is 5min~1h.
8. the intracellular ATP of detection according to claim 6 method, it is characterised in that the time of the reaction is 5min
~1h.
9. a kind of cell ATP detection kit, it is characterised in that including CPP-LUC chimeric proteins and fluorescence described in claim 4
Plain zymolyte.
10. cell ATP detection kit according to claim 9, it is characterised in that the detection kit also includes
ATP standard items.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710627369.9A CN107254484A (en) | 2017-07-28 | 2017-07-28 | A kind of CPP LUC chimeric proteins and its application in intracellular ATP is detected |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710627369.9A CN107254484A (en) | 2017-07-28 | 2017-07-28 | A kind of CPP LUC chimeric proteins and its application in intracellular ATP is detected |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107254484A true CN107254484A (en) | 2017-10-17 |
Family
ID=60025334
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710627369.9A Pending CN107254484A (en) | 2017-07-28 | 2017-07-28 | A kind of CPP LUC chimeric proteins and its application in intracellular ATP is detected |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107254484A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112143748A (en) * | 2020-10-13 | 2020-12-29 | 陕西科技大学 | Protein extraction method without cell lysis |
| CN113105554A (en) * | 2020-01-13 | 2021-07-13 | 中国人民解放军空军军医大学 | Anti-tumor fusion protein and preparation method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101078018A (en) * | 2006-05-26 | 2007-11-28 | 中国医学科学院基础医学研究所 | Fusion protein of vasostatin-luciferase and its preparation method and use |
| CN102863516A (en) * | 2012-07-30 | 2013-01-09 | 三峡大学 | Production of cell-penetrating peptide hPP10 (human Pancreatic Polypeptide) and transfection method for mediated plasmid DNA (Deoxyribose Nucleic Acid) of hPP10 |
| CN104004726A (en) * | 2014-06-17 | 2014-08-27 | 覃启红 | Transmembrane type TALEN-R11 protein with fluorescent label and preparation method and application thereof |
| CN106399256A (en) * | 2016-08-23 | 2017-02-15 | 东北大学 | Human APP promoter-containing Luci cell line and construction method and application thereof |
-
2017
- 2017-07-28 CN CN201710627369.9A patent/CN107254484A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101078018A (en) * | 2006-05-26 | 2007-11-28 | 中国医学科学院基础医学研究所 | Fusion protein of vasostatin-luciferase and its preparation method and use |
| CN102863516A (en) * | 2012-07-30 | 2013-01-09 | 三峡大学 | Production of cell-penetrating peptide hPP10 (human Pancreatic Polypeptide) and transfection method for mediated plasmid DNA (Deoxyribose Nucleic Acid) of hPP10 |
| CN104004726A (en) * | 2014-06-17 | 2014-08-27 | 覃启红 | Transmembrane type TALEN-R11 protein with fluorescent label and preparation method and application thereof |
| CN106399256A (en) * | 2016-08-23 | 2017-02-15 | 东北大学 | Human APP promoter-containing Luci cell line and construction method and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 杨晓林: "生物发光及化学发光在生物医学领域中应用的进展", 《生物物理学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113105554A (en) * | 2020-01-13 | 2021-07-13 | 中国人民解放军空军军医大学 | Anti-tumor fusion protein and preparation method and application thereof |
| CN113105554B (en) * | 2020-01-13 | 2022-07-26 | 广东泰禾医药科技有限公司 | Anti-tumor fusion protein and preparation method and application thereof |
| CN112143748A (en) * | 2020-10-13 | 2020-12-29 | 陕西科技大学 | Protein extraction method without cell lysis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP3258658B2 (en) | Universal eubacterial nucleic acid probe and method | |
| ES2711534T3 (en) | A method and a detection kit for antibiotic resistant bacteria | |
| CN108251446A (en) | A kind of construction method of lead ion responsive type whole-cell biological sensor | |
| CN107254484A (en) | A kind of CPP LUC chimeric proteins and its application in intracellular ATP is detected | |
| CN114891902A (en) | Primer-probe combination for rapidly detecting five virulent pathogenic bacteria based on liquid drop digital PCR and application method thereof | |
| CN106755342A (en) | Based on the ring mediated isothermal amplification that color judges（LAMP）Technology for detection chestnut phytophthora Heisui River germ | |
| CN110373502B (en) | Complete set of nucleic acid, kit and detection method for detecting Hantaan virus by RPA | |
| CN112725339B (en) | Promoter element for improving sensitivity of explosive molecule detection and screening method and application thereof | |
| CN113604495A (en) | Explosive molecule biosensor synthesized by utilizing regulating element and preparation method and application thereof | |
| CN101565753A (en) | Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof | |
| CN113528704A (en) | Primer group, probe, kit and detection method for rapidly identifying novel coronavirus | |
| Yun et al. | Auto-microfluidic thin-film chip for genetically modified maize detection | |
| CN112114154A (en) | Kit for detecting nuclear factor-kappa B and application thereof | |
| CN111172301A (en) | PCR fluorescence detection kit for clostridium difficile toxin B and application thereof | |
| CN113373102B (en) | Photosynthetic bacteria for detecting explosives and preparation method and application thereof | |
| CN114085890B (en) | miRNA detection and imaging method, composition and kit | |
| CN114480388B (en) | Screening and application of novel promoter element responding to explosive molecules | |
| CN108707682A (en) | One kind is for detecting the active fluorescence RAA primers of salmonella, probe and detection method | |
| CN113528563B (en) | Preparation method and application of visual biosensor synthesized by using explosive molecule degradation genes | |
| CN111378724B (en) | RNA amplification detection method and detection kit | |
| CN105506126B (en) | With the small annular nucleotide probe and its preparation method and application compared with hightension | |
| CN108642164A (en) | MiRNA capture probes, separation expand integrated detection method and detection kit | |
| CN103571942A (en) | Isothermal amplification method of vibrio parahaemolyticus VP nucleic acid | |
| CN110512010B (en) | Kit and method for detecting transcription rate of rRNA of escherichia coli | |
| CN107418559A (en) | A kind of bacteriophage electrochemical luminescence signals amplification probe and its preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20171017 |