CN106399256A - Human APP promoter-containing Luci cell line and construction method and application thereof - Google Patents
Human APP promoter-containing Luci cell line and construction method and application thereof Download PDFInfo
- Publication number
- CN106399256A CN106399256A CN201610708258.6A CN201610708258A CN106399256A CN 106399256 A CN106399256 A CN 106399256A CN 201610708258 A CN201610708258 A CN 201610708258A CN 106399256 A CN106399256 A CN 106399256A
- Authority
- CN
- China
- Prior art keywords
- clone
- cell
- luciferase
- app
- luci
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0603—Embryonic cells ; Embryoid bodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2503/00—Use of cells in diagnostics
- C12N2503/02—Drug screening
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/60—Vectors containing traps for, e.g. exons, promoters
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/10—Screening for compounds of potential therapeutic value involving cells
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Cell Biology (AREA)
- Hematology (AREA)
- Physics & Mathematics (AREA)
- Urology & Nephrology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biophysics (AREA)
- Food Science & Technology (AREA)
- Toxicology (AREA)
- Analytical Chemistry (AREA)
- Plant Pathology (AREA)
- Pathology (AREA)
- Developmental Biology & Embryology (AREA)
- Gynecology & Obstetrics (AREA)
- Reproductive Health (AREA)
- Enzymes And Modification Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a construction method of a human APP promoter-containing Luci cell line, and the specific method is as follows: construction of an expression vector containing a human APP promoter region-luciferase chimeric gene; cotransfection of constructed pGL3-APPP Luc-Puro plasmids and pRL-SV40 plasmids into a human embryonic kidney cell line HEK-293T cell line; laying and planting of transfected HEK-293T cells after trypsinization into a 10cm culture dish, puromycin pressurization screening to obtain five cell lines with genomes capable of stably integrating the human APP promoter region-luciferase chimeric gene, and detection of activity of firefly luciferase and renilla luciferase in the five cell lines to obtain the cell line containing the human APP promoter region-luciferase chimeric gene. The cell line prepared by the cell line construction method can be used for screening of new anti senile dementia compounds and therapeutic drugs for inhibiting the expression of human APP.
Description
Technical field
The invention belongs to clone construction method technical field is and in particular to a kind of promoter-luci cell of APP containing people
System, the invention still further relates to the construction method of above-mentioned APP containing people promoter-luci clone and application.
Background technology
Alzheimer disease (Alzheimer ' s Disease, AD), is commonly called as senile dementia；It is to be with progressive dementia
The neurodegenerative diseases of its main clinical characteristics.Patients with Alzheimer disease is cognitive and memory capability constantly declines, and
With various neuropsychic symptoms and behavior disorder.For prior art, Alzheimer disease clinically there is no effectively
Treatment method.
State, inside and outside research show in recent years：In Alzheimer disease disease progression, A beta peptide aggregation simultaneously forms amyloid fibril
Dimension is the committed step that senile plaque expelling is formed, and is also the key factor leading to neure damage.APP abnormal expression in neuronal cell
Increase one of key factor being to accelerate A β to produce and assemble.For many years, researcher be devoted to research and develop one kind can suppress APP
Expression and the medicine of no obvious cytotoxic effect.But still lack high frequency zone suppression APP promoter in technical field at present
The platform of area's active medicine.
Content of the invention
It is an object of the invention to provide a kind of promoter-luci clone of APP containing people, screening suppression people APP can be used for
The new anti-senile dementia compound of expression and curative drug.
It is a further object of the present invention to provide the construction method of the above-mentioned promoter-luci clone of APP containing people.
Third object of the present invention is to provide the above-mentioned promoter-luci clone of APP containing people in screening suppression people's APP table
Application in the new anti-senile dementia compound reaching and curative drug.
The first technical scheme of the present invention is, the promoter-luci clone of APP containing people, and it has SEQ ID
NO：Amino acid sequence shown in 1.
Second technical scheme of the present invention is, the construction method of the promoter-luci clone of APP containing people, tool
Body is implemented according to following steps：
Step 1, build the expression vector of the promoter region of APP containing people-luciferase mosaic gene, this expression vector is：
PGL3-APPP_luc-puro plasmid；
Step 2, by step 1 build pGL3-APPP_luc-puro plasmid and pRL-SV40 plasmid co-transfection human embryo kidney (HEK)
Clone HEK-293T clone；
Step 3, by transfected HEK-293T cell in step 2 through pancreatin digestion after cover plant in 10cm culture dish, and
Obtained in genome using puromycin pressurization screening and be possible to stable integration people APP promoter region-luciferase mosaic gene
Clone, totally five plants, respectively：1A3,2A3,2A6,1B3 and 2B3；By to the light of firefly in five plants of clones obtaining of screening
Luciferase and the Activity determination of renilla luciferase, obtain the promoter-luci clone of APP containing people, as 1A3 cell
System.
The feature of second technical scheme of the present invention also resides in：
Step 1 is specifically implemented according to following steps：
Step 1.1, with pRL-SV40 carrier as template, and adopt primer 1 and primer 2, through PCR expand obtain SV40 strengthen
Son/promoter region sequence fragment；
Primer 1 is：
TGGTAAAATCGATAAGAGTCCGCGCAGCACCATGGCCTGAA；
Primer 2 is：
GTGGGCTTGTACTCGGTCATGGATCCTTGCAAAAGCCTAGG；
With pBrit-HA/Flag carrier as template, and adopt primer 3 and primer 4, expand acquisition puromycin through PCR and resist
Property gene order fragment；
Primer 3 is：
CCTAGGCTTTTGCAAGGATCCATGACCGAGTACAAGCCCAC；
Primer 4 is：
CTCTCAAGGGCATCGGTCGACTCAGGCACCGGGCTTGCGGG；
Step 1.2, treat that step 1.1 completes, with secondary PCR method, recycle primer 1 and primer 4, after gel-purified
SV40 enhancers/promoters region sequence fragment and puromycin resistance gene sequence fragment be template, through PCR expand obtain
SV40 enhancers/promoters and puromycin resistance gene merge fragment；
Step 1.3, through after step 1.2, first by pGL3-basic expression vector with Restriction Enzyme enzyme cutting BamH I-HF and
Sal I-HF carries out double digestion, then carries out dephosphorylation process using temperature-sensitive alkaline phosphatase to digestion products, finally adopts
Gel extraction method reclaims carrier segments；
Step 1.4, the carrier pGL3- being obtained after step 1.3 double digestion using the connection of Infusion-HD ligase
Basic and genes of interest fragment SV40 enhancers/promoters and puromycin resistance gene merge fragment, obtain connection product A；
Step 1.5, the connection product A obtaining through step 1.4 is converted bacillus coli DH 5 alpha competent cell, and in next day
Picking positive colony, extracts plasmid and send sequencing, the carrier of acquisition is named as pGL3-puro1, and this carrier of acquisition also retains
Original ampicillin resistance of pGL3-basic carrier and firefly luciferase gene sequence fragment；
Step 1.6, the genomic DNA of extraction human glial cell system A172 cell, specifically implement in accordance with the following methods：
Using primer 5 and primer 6, expand people APP, i.e. amyloid precursor protein gene, promoter region base through PCR method
Because of fragment；
Described primer 5 is：
CTATCGATAGGTACCGAGCTCTGCATTTTTAGTAGAGATGGGGG；
Described primer 6 is：
ACTTAGATCGCAGATCTCGAGGGGTTAAGGTCTTGGGGGGTAT；
Step 1.7, first by the pGL3-puro1 obtaining through step 1.5 expression vector Restriction Enzyme enzyme cutting Sac I-HF and
Xho I-HF carries out double digestion, then carries out dephosphorylation process using temperature-sensitive alkaline phosphatase to digestion products, finally adopts
Gel extraction method reclaims carrier segments；
Step 1.8, connected using Infusion-HD ligase carrier pGL3-puro1 after step 1.7 double digestion and
Genes of interest fragment APPP, obtains connection product B；
Step 1.9, by the connection product B obtaining through step 1.8 convert bacillus coli DH 5 alpha competent cell, next day picking
Positive colony, extracts plasmid and send sequencing, the carrier of acquisition is named as pGL3-APPP_luc-puro, described pGL3-APPP_
The original ampicillin resistance of pGL3-puro1 carrier, puromycin resistance gene sequence and SV40 is remained in luc-puro carrier
Promoter/enhancer gene order fragment.
In step 1.3, the condition of double digestion is：React 3.5h～4.5h under the conditions of prior to 37 DEG C, go out under the conditions of 65 DEG C
Live 20min～30min；
In step 1.3, the reaction condition of dephosphorylation process is：React 30min～60min under the conditions of prior to 37 DEG C, be
10min～12min is inactivated under the conditions of 65 DEG C.
Reaction condition in step 1.4 is：13min～17min is reacted under the conditions of prior to 50 DEG C；Cold under the conditions of 4 DEG C
But 1min～3min.
Reaction condition in step 1.7 is specific as follows：
Double digestion condition is：React 3h～5h under the conditions of prior to 37 DEG C, inactivate 20min～30min under the conditions of 65 DEG C；
The reaction condition of dephosphorylation process is：50min～70min is reacted, then at 65 DEG C of conditions under the conditions of prior to 37 DEG C
Lower 65 DEG C of inactivation 10min～12min.
Reaction condition in step 1.8 is specific as follows：React 15min under the conditions of prior to 50 DEG C, cool down under the conditions of 4 DEG C
2min～4min.
Step 2 is specifically implemented according to following steps：
Step 2.1, by 1 × 105Individual HEK-293T cell cover plant is in 24 orifice plates；
Step 2.2, treat 24h after, using liposome 2000 by the pGL3-APPP_luc-puro plasmid of 0.8 microgram and
PRL-SV40 plasmid transfection human embryonic kidney cell line's HEK-293T clone of 0.2 microgram.
Step 3 specifically implements i according to following steps:
Step 3.1, the transfected cell being obtained through step 2 using pancreatin digestion；
Step 3.2, through after step 3.1, by transfected cell respectively cover plant in two a diameter of 10cm Tissue Culture Dish,
It is previously added the DMEM culture medium that 10mL contains 10% hyclone and 1 μ g/mL puromycin in each culture dish；
Under 1 μ g/mL puromycin pressurized conditions, screening cell 2 weeks, it is able to observe that in culture dish and form multiple positives
Cell clone group；
Step 3.3, treat that step 3.2 completes, first the aseptic filter paper after soaking through cell dissociation buffer is covered in single positive
In cell clone group, after total positives cell clone group is covered by filter paper, then culture dish is placed in incubation in cell culture incubator
Culture dish is taken out after 3min～6min；
Then the filter paper speckling with positive cell clone group is transferred to by 24 orifice plates using aseptic nipper；
Finally adopt the DMEM medium culture cell containing 1 μ g/mL puromycin and 10% hyclone；
The clone that step 3.4, screening obtain through step 3.3, preliminary five plants of energy stable integration people's APP promoters of acquisition
Area-firefly luciferase and the clone of renilla luciferase gene, referred to as APP containing people promoter-luci clone, and
This five plants of clones are respectively designated as：1A3,2A3,2A6,1B3 and 2B3；
Step 3.5, five plants of clones in step 3.4 are incubated at 1 μ g/mL puromycin and contain 10% hyclone
In DMEM culture medium；
Step 3.6, through after step 3.5, using Dual-luciferase reportor systerm kit to five screening in step 3.4
Strain APPP-luci clone：1A3,2A3,2A6,1B3 and 2B3 carry out firefly luciferase and renilla luciferase expression inspection
Survey, expressed with determining that can APP promoter region sequence normally start firefly luciferase, finally give in a pnca gene group really
Surely stable integration people APP promoter region-luciferase mosaic gene and high efficient expression firefly luciferase and sea pansy fluorescence
The clone of the clone of plain enzyme, as APP containing people promoter region-luciferase mosaic gene；
To the five plants of APPP-luci clones screening：1A3,2A3,2A6,1B3 and 2B3 carry out detection of expression, and it is concrete
Method as follows：
Step a, respectively by five plants of APPP-luci clones：1A3,2A3,2A6,1B3 and 2B3 cover plant is in 24 well culture plates
In, every hole 1 × 105Individual cell, cultivates 24h,
Step b, after step a, remove cell culture fluid, every hole adds 50 μ L cell pyrolysis liquid 1 × Passive lysis
Buffer, reacts 15min～20min under room temperature condition；
Step c, take cell pyrolysis liquid in 5 μ L steps b, add in White-opalescent 96 orifice plate, and add 50 μ in every hole
L firefly luciferase substrate solution, reads fluorescence intensity, is subsequently adding 50 μ L renilla luciferase substrate solutions, reads fluorescence strong
Degree；
Step d, determine the insertion light of firefly by comparing in 5 plants of clones the relatively strong and weak RLA of firefly luciferase activity
Whether the people source APP promoter region gene order of luciferase gene upstream can drive firefly luciferase to express, the light of firefly
Luciferin enzymatic activity relatively strong weak according to following algorithm obtain：
RLA=firefly luciferase activity (LAF)/renilla luciferase activity (LAR)；
Obtain after being computed：In the five plants of stable cell lines screening, 1A3,1B3 and 2B3 had both expressed firefly luciferin
Enzyme, expresses renilla luciferase, wherein in 1A3 cell line, two kinds of luciferase expression efficiency are higher again, and=this clone can use
There is the compound of regulation and control people's APP promoter region active function in screening.
The third technical scheme of the present invention is that the above-mentioned promoter-luci clone of APP containing people is in screening suppression
Application in the new anti-senile dementia compound of people APP expression and curative drug.
The beneficial effects of the present invention is：
(1) in the method building present invention APP containing people promoter-luci clone, insert in pGL3-basic carrier
Entered SV40 promoter/enhancer and puromycin resistance gene and merged fragment, constructed go out pGL3-puro1 carrier have
Puromycin-resistant, after transfectional cell, can carry out screening cell using puromycin, have inexpensive excellent with high efficiency
Point.
(2) in the construction method of present invention APP containing people promoter-luci clone, people source APP promoter region sequence piece
Section derives from human glial cell genome, and this fragment is inserted on the firefly luciferase gene in pGL3-puro1 carrier
Trip, the pGL3-APPP_luc-puro carrier constructing, through transfection human embryo kidney (HEK) HEK-293T cell and using puromycin screening
After obtain stable cell lines, wherein in 1A3 cell firefly luciferase and renilla luciferase expression higher, can be as explanation
Shown in Fig. 7 in book, new anti-senile dementia compound and therapeutic medicine that Large-scale Screening suppresses people APP expression can be used for
Thing.
Brief description
Fig. 1 is SV40 enhancers/promoters area genetic fragment agarose gel electrophoresis figure；
Fig. 2 is puromycin resistance gene fragment agarose gel electrophoresis figure；
Fig. 3 is that gel-purified reclaims APPP fragment, SV40 enhancers/promoters area's genetic fragment and BamH I-HF/Sal
Figure after agarose gel electrophoresis for the pGL3-basic carrier segments after I-HF double digestion；
Fig. 4 is the structural representation of pGL3-puro1 carrier；
Fig. 5 is APPP genetic fragment agarose gel electrophoresis figure；
Fig. 6 is the structural representation of pGL3-APPP_luc-puro carrier；
Fig. 7 is firefly luciferase and renilla luciferase expression in 1A3,2A3,2A6,1B3 and 2B3 stable cell lines
Testing result.
Specific embodiment
The present invention is described in detail with reference to the accompanying drawings and detailed description.
Present invention APP containing people promoter-luci clone, it has SEQ ID NO：Amino acid sequence shown in 1.
The construction method of present invention APP containing people promoter-luci clone, specifically implements according to following steps：
Step 1, build the expression vector of the promoter region of APP containing people-luciferase mosaic gene, this expression vector is：
PGL3-APPP_luc-puro plasmid, specifically builds according to following steps：
Step 1.1, with pRL-SV40 carrier as template, and adopt primer 1 and primer 2, through PCR expand obtain SV40 strengthen
Son/promoter region sequence fragment；
SV40 enhancers/promoters region sequence fragment can be as shown in Figure 1：Agarose gel electrophoresis analyzes PCR primer；Fig. 1
The the 7th and the 8th swimming lane planted is the SV40 enhancers/promoters region sequence fragment obtaining through PCR, and its size is about 450bp, and
Band is single, product amount is big, can be used for gel-purified and the reaction of follow-up secondary PCR；
In addition, primer 1 and primer 2 are as follows respectively：
Primer 1 is：
TGGTAAAATCGATAAGAGTCCGCGCAGCACCATGGCCTGAA；
Primer 2 is：
GTGGGCTTGTACTCGGTCATGGATCCTTGCAAAAGCCTAGG；
With pBrit-HA/Flag carrier as template, and adopt primer 3 and primer 4, expand acquisition puromycin through PCR and resist
Property gene order fragment；
Puromycin resistance gene sequence fragment can be as shown in Figure 2：Agarose gel electrophoresis analyzes PCR primer, in Fig. 2
2nd swimming lane is the puromycin resistance gene sequence fragment obtaining through PCR, and its size is about 650bp, and band is single, produce
Thing concentration is relatively low, but still can make to can be used for gel-purified and the reaction of follow-up secondary PCR；
In addition, primer 3 and primer 4 are as follows respectively：
Primer 3 is：
CCTAGGCTTTTGCAAGGATCCATGACCGAGTACAAGCCCAC；
Primer 4 is：
CTCTCAAGGGCATCGGTCGACTCAGGCACCGGGCTTGCGGG；
Step 1.2, treat that step 1.1 completes, with secondary PCR method, recycle primer 1 and primer 4, after gel-purified
SV40 enhancers/promoters region sequence fragment and puromycin resistance gene sequence fragment be template, through PCR expand obtain
SV40 enhancers/promoters and puromycin resistance gene merge fragment；
Step 1.3, through after step 1.2, first by pGL3-basic expression vector with Restriction Enzyme enzyme cutting BamH I-HF and
Sal I-HF carries out double digestion；Then dephosphorylation process is carried out to digestion products using temperature-sensitive alkaline phosphatase, finally adopt
Gel extraction method reclaims carrier segments；
The pGL3-basic carrier segments reclaiming can be as shown in the 4th swimming lane in Fig. 3：Band is single and concentration is higher, can
For follow-up coupled reaction.
In step 1.3：
The condition of double digestion is：Under the conditions of prior to 37 DEG C react 3.5h～4.5h, under the conditions of 65 DEG C inactivation 20min～
30min；
The reaction condition of dephosphorylation process is：React 30min～60min under the conditions of prior to 37 DEG C, be 65 DEG C of conditions
Lower inactivation 10min～12min.
Step 1.4, the carrier pGL3- being obtained after step 1.3 double digestion using the connection of Infusion-HD ligase
Basic and genes of interest fragment SV40 enhancers/promoters and puromycin resistance gene merge fragment, obtain connection product A；
Reaction condition in step 1.4 is specific as follows：
13min～17min is reacted under the conditions of prior to 50 DEG C；
1min～3min is cooled down under the conditions of 4 DEG C.
Step 1.5, the connection product A obtaining through step 1.4 is converted bacillus coli DH 5 alpha competent cell, and in next day
Picking positive colony, extracts plasmid and send sequencing, and its sequencing result is as shown in figure 4, the carrier obtaining is named as pGL3-puro1；
As shown in Figure 4：In pGL3-puro1 carrier, it is mould that SV40 promoter/enhancer gene order fragment is located at purine
Plain resistance gene sequences fragment upstream, starts puromycin resistance gene expression；
This carrier obtaining also retains original ampicillin resistance and the firefly luciferase of pGL3-basic carrier
Gene order fragment.
Step 1.6, the genomic DNA of extraction human glial cell system A172 cell, concrete grammar is as follows：
Using primer 5 and primer 6, through PCR method amplification people APP (amyloid precursor protein) gene promoter area gene
Fragment, as shown in the swimming lane 2 in Fig. 5, after agarose gel electrophoresis, APP promoter region genetic fragment size is about 2250bp,
Band is single；
Reclaim through gel-purified, as shown in the 2nd swimming lane in Fig. 3, APP promoter region genetic fragment purity after purification
Height, agarose gel electrophoresis band is single, can be used for subsequently coupled reaction.
APP promoter region genetic fragment fragment is abbreviated as：APPP, this section of gene order is located at app gene transcription initiation position
Point upstream 1823bp is to downstream 329bp (- 1823bp/+329bp) place；
In addition, primer 5 and primer 6 are respectively：
Primer 5 is：
CTATCGATAGGTACCGAGCTCTGCATTTTTAGTAGAGATGGGGG；
Primer 6 is：
ACTTAGATCGCAGATCTCGAGGGGTTAAGGTCTTGGGGGGTAT.
Step 1.7, first by the pGL3-puro1 obtaining through step 1.5 expression vector Restriction Enzyme enzyme cutting Sac I-HF and
Xho I-HF carries out double digestion, then carries out dephosphorylation process using temperature-sensitive alkaline phosphatase to digestion products, finally adopts
Gel extraction method reclaims carrier segments；
In step 1.7：
Double digestion condition is：React 3h～5h under the conditions of prior to 37 DEG C, inactivate 20min～30min under the conditions of 65 DEG C；
The reaction condition of dephosphorylation process is：50min～70min is reacted, then at 65 DEG C of conditions under the conditions of prior to 37 DEG C
Lower 65 DEG C of inactivation 10min～12min；
Step 1.8, connected using Infusion-HD ligase carrier pGL3-puro1 after step 1.7 double digestion and
Genes of interest fragment APPP, obtains connection product B；
Reaction condition in step 1.8 is specific as follows：
15min is reacted under the conditions of prior to 50 DEG C；
2min～4min is cooled down under the conditions of 4 DEG C.
Step 1.9, by the connection product B obtaining through step 1.8 convert bacillus coli DH 5 alpha competent cell, next day picking
Positive colony, extracts plasmid and send sequencing, the carrier of acquisition is named as pGL3-APPP_luc-puro；
The structural representation of pGL3-APPP_luc-puro carrier is as shown in fig. 6, in pGL3-APPP_luc-puro carrier
In, APPP is located at firefly luciferase gene Sequences upstream, starts firefly luciferase expression；pGL3-APPP_luc-
Remain the original ampicillin resistance of pGL3-puro1 carrier, puromycin resistance gene sequence and SV40 in puro carrier to start
Son/enhancer gene order fragment.
Step 2, by step 1 build pGL3-APPP_luc-puro plasmid and pRL-SV40 plasmid co-transfection human embryo kidney (HEK)
Clone HEK-293T clone, specifically implements in accordance with the following methods：
Step 2.1, by 1 × 105Individual HEK-293T cell cover plant is in 24 orifice plates；
Step 2.2, treat 24h after, using liposome 2000 by the pGL3-APPP_luc-puro plasmid of 0.8 microgram and
PRL-SV40 plasmid transfection human embryonic kidney cell line's HEK-293T clone of 0.2 microgram.
Step 3, by transfected HEK-293T cell in step 2 through pancreatin digestion after cover plant in 10cm culture dish, and
Obtained in genome using puromycin pressurization screening and be possible to stable integration people APP promoter region-luciferase mosaic gene
Clone, totally five plants, respectively：1A3,2A3,2A6,1B3 and 2B3；By to the light of firefly in five plants of clones obtaining of screening
Luciferase and the Activity determination of renilla luciferase, obtain the promoter-luci clone of APP containing people, as 1A3 cell
System, specifically implements according to following steps：
Step 3.1, the transfected cell being obtained through step 2 using pancreatin digestion；
Step 3.2, through after step 3.1, by transfected cell respectively cover plant in two a diameter of 10cm Tissue Culture Dish；
It is previously added the DMEM culture medium that 10mL contains 10% hyclone and 1 μ g/mL puromycin in each culture dish；
Under 1 μ g/mL puromycin pressurized conditions, screening cell 2 weeks, it is able to observe that in culture dish and form multiple positive cell clones
Group；
Step 3.3, treat that step 3.2 completes, first the aseptic filter paper after soaking through cell dissociation buffer is covered in single positive
In cell clone group, after total positives cell clone group is covered by filter paper, then culture dish is placed in incubation in cell culture incubator
Culture dish is taken out after 3min～6min；Then the filter paper speckling with positive cell clone group is transferred to by 24 holes using aseptic nipper
Plate；Finally adopt the DMEM medium culture cell containing 1 μ g/mL puromycin and 10% hyclone；
The cell that step 3.4, screening obtain through step 3.3, preliminary five plants of energy stable integration people's APP promoter regions of acquisition-
Firefly luciferase and the clone of renilla luciferase gene, referred to as APPP-luci clone, and by this five plants of cells
System is respectively designated as：1A3,2A3,2A6,1B3 and 2B3；
Step 3.5, five plants of clones in step 3.4 are incubated at 1 μ g/mL puromycin and contain 10% hyclone
In DMEM culture medium；
Step 3.6, through after step 3.5, using Dual-luciferase reportor systerm kit to five screening in step 3.4
Strain APPP-luci clone：1A3,2A3,2A6,1B3 and 2B3 carry out firefly luciferase and renilla luciferase expression inspection
Survey, expressed with determining that can APP promoter region sequence normally start firefly luciferase, finally give in a pnca gene group really
Surely stable integration people APP promoter region-luciferase mosaic gene and high efficient expression firefly luciferase and sea pansy fluorescence
The clone of the clone of plain enzyme, as APP containing people promoter region-luciferase mosaic gene；
Wherein, to the five plants of APPP-luci clones screening：1A3,2A3,2A6,1B3 and 2B3 are detected respectively,
Its specific method is as follows：
Step a, respectively by five plants of APPP-luci clones：1A3,2A3,2A6,1B3 and 2B3 cover plant is in 24 well culture plates
In, every hole 1 × 105Individual cell, cultivates 24h,
Step b, after step a, remove cell culture fluid, every hole adds 50 μ L cell pyrolysis liquid (1 × Passive
Lysis buffer), react 15min～20min under room temperature condition；
Step c, take cell pyrolysis liquid in 5 μ L steps b, add in White-opalescent 96 orifice plate, and add 50 μ in every hole
L firefly luciferase substrate solution, reads fluorescence intensity, is subsequently adding 50 μ L renilla luciferase substrate solutions, reads fluorescence strong
Degree；
Step d, by comparing in 5 plants of clones, firefly luciferase activity is relatively strong and weak (RLA) to determine insertion firefly
Whether the people source APP promoter region gene order of fireworm luciferase gene upstream can drive firefly luciferase to express, firefly
Fireworm uciferase activity is relatively strong and weak to be obtained according to following algorithm：
RLA=firefly luciferase activity (LAF)/renilla luciferase activity (LAR)；
Concrete outcome can as shown in fig. 7, in five plants of stable cell lines screening 1A3,1B3 and 2B3 both expressed firefly
Luciferase, expresses renilla luciferase, wherein in 1A3 cell line, two kinds of luciferase expression efficiency are higher, and therefore this is thin again
Born of the same parents system can be used for screening the compound with regulation and control people's APP promoter region active function.
The 1A3 cell finally giving can be applicable to the anti-ageing year that high flux screening suppresses the expression of people's app gene after setting up
Anti-dementia agent, particular exam method is：
Testing compound using variable concentrations processes 1A3 cell, detection firefly luciferase and sea pansy fluorescence after 24h
Plain expression of enzymes, concrete grammar is as follows：
Cell, after 1 × Passive lysis buffer cracking, adds firefly luciferase substrate and sea pansy fluorescence
Plain zymolyte, reads fluorescence intensity respectively；After comparing testing compound before processing, APP promoter region activity is strong and weak, i.e. firefly
Fireworm uciferase activity relatively strong and weak (RLA) determining the impact to APP promoter region for the testing compound；
RLA=firefly luciferase activity (LAF)/renilla luciferase activity (LAR).
Testing compound is specific as follows to the computing formula of APP promoter region suppression efficiency：
In above formula：
LAFcRepresent control group (i.e. solvent group) firefly luciferase activity value；
LARcRepresent control group (i.e. solvent group) renilla luciferase activity value；
LAFcRepresent experimental group (i.e. testing compound group) firefly luciferase activity value；
LARcRepresent experimental group (i.e. testing compound group) renilla luciferase activity value；
BLAFc, BLARc、BLAFtAnd BLARtRepresent the background light absorption value of corresponding 96 orifice plates respectively；
S.e. represent suppression efficiency.
Criterion：
If S.e. value, close to 0, illustrates that this compound has no significant effect to APP promoter region activity；
If S.e. value, close to 1, illustrates that this compound can significantly inhibit APP promoter region activity.
Claims (10)
1. the promoter of APP containing people-luci clone is it is characterised in that it has SEQ ID NO：Amino acid sequence shown in 1.
2. a kind of construction method of the promoter-luci clone of APP containing people as claimed in claim 1 is it is characterised in that specifically
Implement according to following steps：
Step 1, build the expression vector of the promoter region of APP containing people-luciferase mosaic gene, this expression vector is：pGL3-
APPP_luc-puro plasmid；
Step 2, by step 1 build pGL3-APPP_luc-puro plasmid and pRL-SV40 plasmid co-transfection HEKC
It is HEK-293T clone；
Step 3, by transfected HEK-293T cell in step 2, after pancreatin digestion, cover plant, in 10cm culture dish, and adopts
Puromycin pressurization screening obtains in genome and is possible to the thin of stable integration people APP promoter region-luciferase mosaic gene
Born of the same parents system, totally five plants, respectively：1A3,2A3,2A6,1B3 and 2B3；By glimmering to screening firefly in the five plants of clones obtaining
Light element enzyme and the Activity determination of renilla luciferase, obtain the promoter-luci clone of APP containing people, as 1A3 clone.
3. the construction method of the promoter-luci clone of APP containing people according to claim 2 is it is characterised in that described step
Rapid 1 specifically implements according to following steps：
Step 1.1, with pRL-SV40 carrier as template, and adopt primer 1 and primer 2, through PCR expand obtain SV40 enhancer/
Promoter region sequence fragment；
Primer 1 is：
TGGTAAAATCGATAAGAGTCCGCGCAGCACCATGGCCTGAA；
Primer 2 is：
GTGGGCTTGTACTCGGTCATGGATCCTTGCAAAAGCCTAGG；
With pBrit-HA/Flag carrier as template, and adopt primer 3 and primer 4, expand through PCR and obtain puromycin-resistant base
Because of sequence fragment；
Primer 3 is：
CCTAGGCTTTTGCAAGGATCCATGACCGAGTACAAGCCCAC；
Primer 4 is：
CTCTCAAGGGCATCGGTCGACTCAGGCACCGGGCTTGCGGG；
Step 1.2, treat that step 1.1 completes, with secondary PCR method, recycle primer 1 and primer 4, after gel-purified
SV40 enhancers/promoters region sequence fragment and puromycin resistance gene sequence fragment are template, expand through PCR and obtain SV40
Enhancers/promoters and puromycin resistance gene merge fragment；
Step 1.3, through after step 1.2, first by pGL3-basic expression vector Restriction Enzyme enzyme cutting BamH I-HF and Sal I-
HF carries out double digestion, then carries out dephosphorylation process using temperature-sensitive alkaline phosphatase to digestion products, finally adopts gel pure
Change method reclaims carrier segments；
Step 1.4, connected using Infusion-HD ligase the carrier pGL3-basic that obtains after step 1.3 double digestion and
Genes of interest fragment SV40 enhancers/promoters and puromycin resistance gene merge fragment, obtain connection product A；
Step 1.5, the connection product A obtaining through step 1.4 is converted bacillus coli DH 5 alpha competent cell, and in next day picking
Positive colony, extracts plasmid and send sequencing, the carrier of acquisition is named as pGL3-puro1, and this carrier of acquisition also retains
Original ampicillin resistance of pGL3-basic carrier and firefly luciferase gene sequence fragment；
Step 1.6, the genomic DNA of extraction human glial cell system A172 cell, specifically implement in accordance with the following methods：
Using primer 5 and primer 6, expand people APP, i.e. amyloid precursor protein gene, promoter region gene piece through PCR method
Section；
Described primer 5 is：
CTATCGATAGGTACCGAGCTCTGCATTTTTAGTAGAGATGGGGG；
Described primer 6 is：
ACTTAGATCGCAGATCTCGAGGGGTTAAGGTCTTGGGGGGTAT；
Step 1.7, first by the pGL3-puro1 obtaining through step 1.5 expression vector Restriction Enzyme enzyme cutting Sac I-HF and Xho
I-HF carries out double digestion, then carries out dephosphorylation process using temperature-sensitive alkaline phosphatase to digestion products, finally adopts gel
Purification process reclaims carrier segments；
Step 1.8, carrier pGL3-puro1 after step 1.7 double digestion and purpose are connected using Infusion-HD ligase
Genetic fragment APPP, obtains connection product B；
Step 1.9, the connection product B obtaining through step 1.8 is converted bacillus coli DH 5 alpha competent cell, next day picking is positive
Clone, extracts plasmid and send sequencing, the carrier of acquisition is named as pGL3-APPP_luc-puro, described pGL3-APPP_luc-
Remain the original ampicillin resistance of pGL3-puro1 carrier, puromycin resistance gene sequence and SV40 in puro carrier to start
Son/enhancer gene order fragment.
4. the construction method of the promoter-luci clone of APP containing people according to claim 3 is it is characterised in that described step
In rapid 1.3, the condition of double digestion is：Under the conditions of prior to 37 DEG C react 3.5h～4.5h, under the conditions of 65 DEG C inactivation 20min～
30min；
In described step 1.3, the reaction condition of dephosphorylation process is：React 30min～60min under the conditions of prior to 37 DEG C, be
10min～12min is inactivated under the conditions of 65 DEG C.
5. the construction method of the promoter-luci clone of APP containing people according to claim 3 is it is characterised in that described step
Reaction condition in rapid 1.4 is specific as follows：13min～17min is reacted under the conditions of prior to 50 DEG C；Cool down under the conditions of 4 DEG C
1min～3min.
6. the construction method of the promoter-luci clone of APP containing people according to claim 3 is it is characterised in that described step
Reaction condition in rapid 1.7 is specific as follows：
Double digestion condition is：React 3h～5h under the conditions of prior to 37 DEG C, inactivate 20min～30min under the conditions of 65 DEG C；
The reaction condition of dephosphorylation process is：50min～70min is reacted, 65 under the conditions of 65 DEG C under the conditions of prior to 37 DEG C
DEG C inactivation 10min～12min.
7. the construction method of the promoter-luci clone of APP containing people according to claim 3 is it is characterised in that described step
Reaction condition in rapid 1.8 is：React 15min under the conditions of prior to 50 DEG C, cool down 2min～4min under the conditions of 4 DEG C.
8. the construction method of the promoter-luci clone of APP containing people according to claim 2 is it is characterised in that described step
Rapid 2 specifically implement according to following steps：
Step 2.1, by 1 × 105Individual HEK-293T cell cover plant is in 24 orifice plates；
Step 2.2, treat 24h after, will be micro- to the pGL3-APPP_luc-puro plasmid of 0.8 microgram and 0.2 using liposome 2000
Gram pRL-SV40 plasmid transfection human embryonic kidney cell line's HEK-293T clone.
9. the construction method of the promoter-luci clone of APP containing people according to claim 2 is it is characterised in that described step
Rapid 3 specifically implement i according to following steps:
Step 3.1, the transfected cell being obtained through step 2 using pancreatin digestion；
Step 3.2, through after step 3.1, by transfected cell respectively cover plant in two a diameter of 10cm Tissue Culture Dish, each
All it is previously added the DMEM culture medium that 10mL contains 10% hyclone and 1 μ g/mL puromycin in culture dish；
Under 1 μ g/mL puromycin pressurized conditions, screening cell 2 weeks, it is able to observe that in culture dish and form multiple positive cells
Cloning cluster；
Step 3.3, treat that step 3.2 completes, first the aseptic filter paper after soaking through cell dissociation buffer is covered in single positive cell
In cloning cluster, after total positives cell clone group is covered by filter paper, then culture dish is placed in incubation 3min in cell culture incubator
Culture dish is taken out after～6min；
Then the filter paper speckling with positive cell clone group is transferred to by 24 orifice plates using aseptic nipper；
Finally adopt the DMEM medium culture cell containing 1 μ g/mL puromycin and 10% hyclone；
The clone that step 3.4, screening obtain through step 3.3, preliminary five plants of energy stable integration people APP promoter region-fireflies of acquisition
Fireworm luciferase and the clone of renilla luciferase gene, referred to as APP containing people promoter-luci clone, and by this
Five plants of clones are respectively designated as：1A3,2A3,2A6,1B3 and 2B3；
Step 3.5, five plants of clones in step 3.4 are incubated at 1 μ g/mL puromycin contain 10% hyclone DMEM training
In foster base；
Step 3.6, through after step 3.5, using Dual-luciferase reportor systerm kit to five plants screening in step 3.4
APPP-luci clone：1A3,2A3,2A6,1B3 and 2B3 carry out firefly luciferase and renilla luciferase detection of expression,
Expressed with determining that can APP promoter region sequence normally start firefly luciferase, finally give in a pnca gene group and determine
Can stable integration people APP promoter region-luciferase mosaic gene and high efficient expression firefly luciferase and sea pansy fluorescein
The clone of the clone of enzyme, as APP containing people promoter region-luciferase mosaic gene；
To the five plants of APPP-luci clones screening：1A3,2A3,2A6,1B3 and 2B3 carry out detection of expression, specific method
As follows：
Step a, respectively by five plants of APPP-luci clones：1A3,2A3,2A6,1B3 and 2B3 cover plant in 24 well culture plates, often
Hole 1 × 105Individual cell, cultivates 24h；
Step b, after step a, remove cell culture fluid, every hole adds 50 μ L cell pyrolysis liquid 1 × Passive lysis
Buffer, reacts 15min～20min under room temperature condition；
Step c, take cell pyrolysis liquid in 5 μ L steps b, add in White-opalescent 96 orifice plate, and add 50 μ L fireflies in every hole
Fireworm luciferase substrate liquid, reads fluorescence intensity, is subsequently adding 50 μ L renilla luciferase substrate solutions, reads fluorescence intensity；
Step d, determine that insertion firefly is glimmering by comparing in 5 plants of clones the relatively strong and weak RLA of firefly luciferase activity
Whether the people source APP promoter region gene order of light element enzyme gene upstream can drive firefly luciferase to express, and firefly is glimmering
Light element enzymatic activity is relatively strong and weak to be obtained according to following algorithm：
RLA=firefly luciferase activity (LAF)/renilla luciferase activity (LAR)；
Obtain after being computed：In the five plants of stable cell lines screening, 1A3,1B3 and 2B3 both expressed firefly luciferase, and
Expression renilla luciferase, wherein in 1A3 cell line, two kinds of luciferase expression efficiency are higher, and=this clone can be used for screening
There is the compound of regulation and control people's APP promoter region active function.
10. a kind of promoter-luci clone of APP containing people as claimed in claim 1 is it is characterised in that it is in screening suppression
Application in the new anti-senile dementia compound of people APP expression and curative drug.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610708258.6A CN106399256A (en) | 2016-08-23 | 2016-08-23 | Human APP promoter-containing Luci cell line and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610708258.6A CN106399256A (en) | 2016-08-23 | 2016-08-23 | Human APP promoter-containing Luci cell line and construction method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106399256A true CN106399256A (en) | 2017-02-15 |
Family
ID=58004657
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610708258.6A Pending CN106399256A (en) | 2016-08-23 | 2016-08-23 | Human APP promoter-containing Luci cell line and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106399256A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107254484A (en) * | 2017-07-28 | 2017-10-17 | 广州医科大学附属第五医院 | A kind of CPP LUC chimeric proteins and its application in intracellular ATP is detected |
| CN107794246A (en) * | 2017-11-08 | 2018-03-13 | 扬州大学 | A kind of the NF κ B Dual-Luciferases reporter cell lines and its construction method of stable expression ox source TLR8 acceptor genes |
| CN107893085A (en) * | 2017-12-19 | 2018-04-10 | 浙江大学 | A kind of luciferase reporter gene plasmid and its structure available for lonely nuclear receptor activities regulator screening is with applying |
| CN108486155A (en) * | 2018-04-27 | 2018-09-04 | 中国医学科学院输血研究所 | Build double inducible expression carriers with fluorescent protein marker gene that Doxycycline/Mifepristone inductions are overexpressed |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102115762A (en) * | 2009-12-30 | 2011-07-06 | 上海中医药大学附属普陀医院 | Method for establishment of recombinant human colon cancer cell line for high-level expression of human cyclooxygenase-2, and application thereof |
-
2016
- 2016-08-23 CN CN201610708258.6A patent/CN106399256A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102115762A (en) * | 2009-12-30 | 2011-07-06 | 上海中医药大学附属普陀医院 | Method for establishment of recombinant human colon cancer cell line for high-level expression of human cyclooxygenase-2, and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| JESSIE THEUNS等: "promoter mutations that increase amyloid precursor-protein expression are associated with Alzheimer disease", 《THE AMERICAN JOURNAL OF HUMAN GENETICS》 * |
| 刘靖: "稳定表达人淀粉样前体蛋白HEK293细胞系的建立及鉴定", 《中国优秀硕士学位论文全文数据库基础科学辑》 * |
| 孙高英: "人参皂苷Rb1对神经内肽酶基因启动子活性的影响", 《中国优秀硕士学位论文全文数据库医药卫生科技辑》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107254484A (en) * | 2017-07-28 | 2017-10-17 | 广州医科大学附属第五医院 | A kind of CPP LUC chimeric proteins and its application in intracellular ATP is detected |
| CN107794246A (en) * | 2017-11-08 | 2018-03-13 | 扬州大学 | A kind of the NF κ B Dual-Luciferases reporter cell lines and its construction method of stable expression ox source TLR8 acceptor genes |
| CN107893085A (en) * | 2017-12-19 | 2018-04-10 | 浙江大学 | A kind of luciferase reporter gene plasmid and its structure available for lonely nuclear receptor activities regulator screening is with applying |
| CN108486155A (en) * | 2018-04-27 | 2018-09-04 | 中国医学科学院输血研究所 | Build double inducible expression carriers with fluorescent protein marker gene that Doxycycline/Mifepristone inductions are overexpressed |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106399256A (en) | Human APP promoter-containing Luci cell line and construction method and application thereof | |
| Nakanishi et al. | CRISPR/Cas-mediated targeted mutagenesis in Daphnia magna | |
| DeWitt et al. | Genome editing via delivery of Cas9 ribonucleoprotein | |
| Quan et al. | Exploring the secrets of long noncoding RNAs | |
| Wang et al. | Progress and challenges: development and implementation of CRISPR/Cas9 technology in filamentous fungi | |
| US20160102324A1 (en) | New compact scaffold of cas9 in the type ii crispr system | |
| Shepelev et al. | Production of recombinant proteins in the milk of transgenic animals: current state and prospects | |
| Mastroianni et al. | Group II intron-based gene targeting reactions in eukaryotes | |
| Naitou et al. | Heterodimeric TALENs induce targeted heritable mutations in the crustacean Daphnia magna | |
| CN110257435B (en) | Construction method and application of PROM1-KO mouse model | |
| Chen et al. | CRISPR start-loss: a novel and practical alternative for gene silencing through base-editing-induced start codon mutations | |
| Xu et al. | CRISPR/Cas9 genome surgery for retinal diseases | |
| CA3236802A1 (en) | Serine recombinases | |
| Qin et al. | Molecular organization and chromosomal localization analysis of 5S rDNA clusters in autotetraploids derived from Carassius auratus Red Var.(♀)× Megalobrama amblycephala (♂) | |
| Ansori et al. | Application of CRISPR-Cas9 genome editing technology in various fields: A review | |
| Chen et al. | Potential application of TALENs against murine cytomegalovirus latent infections | |
| Zhang et al. | Rapid assembly of customized TALENs into multiple delivery systems | |
| Godbout et al. | Successful Correction by Prime Editing of a Mutation in the RYR1 Gene Responsible for a Myopathy | |
| Karginov et al. | A Split-marker system for CRISPR-Cas9 genome editing in methylotrophic yeasts | |
| Zheng et al. | Efficient PAM-less base editing for zebrafish modeling of human genetic disease with zSpRY-ABE8e | |
| Miskei et al. | Molecular evolution of phosphoprotein phosphatases in Drosophila | |
| CN111979241A (en) | Method for preparing non-human mammal model of retinitis pigmentosa | |
| ES2229250T3 (en) | PROCEDURE FOR THE USE OF THE PA-ADH PROMOTING SYSTEM IN A YEAST FOR THE BIIOTECHNOLOGICAL PRODUCTION OF HETEROLOGICAL PROTEINS IN HIGH PERFORMANCES. | |
| LU102620B1 (en) | A gRNA and Related Kit and Application | |
| CN104498481A (en) | DNA fragment of porcine H11 site and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170215 |
|
| RJ01 | Rejection of invention patent application after publication |