CN113528704A - Primer group, probe, kit and detection method for rapidly identifying novel coronavirus - Google Patents
Primer group, probe, kit and detection method for rapidly identifying novel coronavirus Download PDFInfo
- Publication number
- CN113528704A CN113528704A CN202010290259.XA CN202010290259A CN113528704A CN 113528704 A CN113528704 A CN 113528704A CN 202010290259 A CN202010290259 A CN 202010290259A CN 113528704 A CN113528704 A CN 113528704A
- Authority
- CN
- China
- Prior art keywords
- rpa
- probe
- novel coronavirus
- primer
- lfd
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention belongs to the technical field of virus strain identification methods, and particularly relates to a primer group, a probe, a kit and a detection method for quickly identifying novel coronavirus, wherein the nucleotide sequences of the primer group and the probe are respectively SEQ ID NO: 1. SEQ ID NO: 2 and SEQ ID NO: 3, biotin is arranged at the 5 ' end of the downstream primer nucleotide sequence, carboxyfluorescein is arranged at the 5 ' end of the probe nucleotide sequence, a C3-spacer group is arranged at the 3 ' end of the probe nucleotide sequence, and the primer group and the probe have strong specificity and high sensitivity. The detection method has the advantages of strong specificity, simple operation process, no initial heating step, high sensitivity and capability of accurately detecting SARS-CoV-2 in shorter time.
Description
Technical Field
The invention belongs to the technical field of virus strain identification methods, and particularly relates to a primer group, a probe, a kit and a detection method for quickly identifying a novel coronavirus.
Background
The novel Coronavirus pneumonia (COVID-19, NCP) is pneumonia caused by novel Coronavirus (SARS-CoV-2), is mainly characterized by fever, hypodynamia and dry cough in clinical manifestation, has less upper Respiratory symptoms such as nasal obstruction, watery nasal discharge and the like, is a main transmission path of the disease due to Respiratory droplets and close contact transmission, and has the possibility of being transmitted through aerosol when being exposed to high-concentration aerosol for a long time in a relatively closed environment. Based on the current epidemiological investigation, the latent period of the disease is 1-14 days, mostly 3-7 days, the main manifestations of fever, hypodynamia and dry cough are shown, and a few patients are accompanied with symptoms of nasal obstruction, watery nasal discharge, pharyngalgia, diarrhea and the like. Patients with severe illness often have dyspnea and/or hypoxemia after one week of onset, severe patients rapidly progress to acute respiratory distress syndrome, septic shock, metabolic acidosis difficult to correct and blood coagulation dysfunction, and patients with severe illness and critical illness can have moderate-low fever or even no obvious fever.
NCP threatens human health seriously, and brings heavy burden and serious challenge to economy and society, and research on virus source tracing, transmission mechanism, prevention and control strategy and the like corresponding to NCP becomes a great demand.
Currently, for the diagnosis of suspected cases, detection is mainly performed by two methods: the first method is to detect the positive of the novel coronavirus nucleic acid through real-time fluorescence RT-PCR of a respiratory tract specimen or a blood specimen; the second method is to highly homologous with the known novel coronavirus through virus gene sequencing of a respiratory tract specimen or a blood specimen; one of the above etiological evidences is the confirmed case.
The two detection methods are relatively complicated in process, and a rapid and simple detection method for identifying SARS-CoV-2 needs to be found, and the RPA-LFD technology is widely applied to the identification of avian influenza virus, animal influenza A virus, infectious laryngotracheitis of chicken and other viruses as a rapid and simple detection method. Recombinase polymerase amplification techniques (RPA) rely primarily on three enzymes: recombinase (recombination), single-strand binding protein and DNA polymerase, the whole RPA reaction process is very fast, and a large amount of target products can be amplified after the reaction is carried out for 20 minutes at a constant 37 ℃. The RPA reaction product can be rapidly detected by a flow measuring immune test strip (LFD), and the RPA-LFD technology has the advantages of strong specificity, simple operation process, no initial heating step, high sensitivity, rapid detection and the like.
The invention provides an invention patent application 201910769954.1 in 2019, 8, 20 by the China people's liberation force disease prevention control center of the applicant, discloses an RPA primer, a probe set and a kit for respiratory virus detection, and belongs to the technical field of virus detection, wherein the respiratory virus comprises respiratory syncytial virus A, coronavirus NL63 and adenovirus-7; the primer and probe set disclosed by the invention have the advantages of good specificity and high sensitivity, and can be used for rapidly detecting respiratory syncytial virus A, coronavirus NL63 and adenovirus 7 on site.
The invention patent application 201910688530.2 is proposed by the Lanzhou veterinary research institute of the Chinese academy of agricultural sciences of the applicant in 2019, 7.29.A, and discloses a primer probe set and a kit for rapidly detecting porcine delta coronavirus LFD-RPA, wherein the primer probe set provided by the invention comprises an upstream primer, a downstream primer and a probe; the 5 'end of the nucleotide sequence of the downstream primer is modified with a substance of biotin, the 3' end of the nucleotide sequence of the probe is modified with C3Spacer, the 5 'end is modified with fluorescein, and the 30 th base from the 5' end is modified with a substance of tetrahydrofuran residue. The primer probe set can be used for rapidly detecting the porcine delta coronavirus, is simple, high in sensitivity and strong in specificity, and can improve the effectiveness of the current PDCoV control scheme.
The above two patent applications disclose primer probe set and kit for detecting coronavirus NL63 by RPA technology and for detecting porcine delta coronavirus by LFD-RPA technology, respectively, but do not mention the primer probe set and kit for detecting novel coronavirus SARS-CoV-2 related in the present invention.
Therefore, the technical problems to be solved by the invention are as follows: how to construct a primer group, a probe, a kit and a detection method for quickly identifying novel coronavirus.
Disclosure of Invention
The invention aims to provide a primer group and a probe for quickly identifying a novel coronavirus, wherein the primer group comprises an upstream primer and a downstream primer with biotin at the 5 ' end, the 5 ' end of a nucleotide sequence of the probe is provided with carboxyfluorescein, the 3 ' end of the nucleotide sequence of the probe is provided with a C3-spacer group, and the primer group and the probe have strong specificity and high sensitivity.
The invention also aims to provide an RPA test strip kit for rapidly identifying the novel coronavirus.
Another objective of the present invention is to provide a RPA-LFD detection method for rapidly identifying novel coronavirus, which has the advantages of strong specificity, simple operation process, no initial heating step, high sensitivity, and accurate detection of SARS-CoV-2 in a shorter time.
The technical scheme of the invention is as follows:
a primer group and a probe for quickly identifying a novel coronavirus have the following nucleotide sequences:
the upstream primer SARS-CoV-2-F1: 5 'AGTCTCTAGTCAGTGTGTTAATCTTACAA 3' (SEQ ID NO: 1);
downstream primer SARS-CoV-2-R1: 5 'Biotin-TTCGCACTAGAATAAACTCTGAACTCACTT 3' (SEQ ID NO: 2);
fluorescent probe SARS-CoV-2-P1: 5 '[ FAM ] TTCCATGCTATACATGTCTCTGGGACCAAT [ THF ] GGTACTAAGAGGTTT [ C3-spacer ] 3' (SEQ ID NO: 3);
wherein biotin represents biotin, FAM represents carboxyfluorescein, THF represents a tetrahydrofuran linker, and C3-spacer means 3 methylene groups for preventing chain extension.
An RPA test strip kit for rapidly identifying novel coronavirus comprises the primer group and a probe.
Further, the kit also comprises a positive control substance and a negative control substance, wherein the positive control substance is plasmid DNA containing an S gene of the novel coronavirus SARS-CoV-2; the negative control is deionized water.
Further, the kit also comprises an RNA extraction reagent, a reverse transcription reagent, an RPA amplification reagent and a lateral flow test strip.
Further, the kit also comprises magnesium acetate and ddH2O、5×Extration Buffer。
A RPA-LFD detection method for rapidly identifying novel coronavirus by using the primer group and the probe comprises the following steps:
(1) extracting RNA of a sample to be detected;
(2) inverting the RNA in the step (1) into cDNA;
(3) taking the cDNA in the step (2) as a template, and carrying out RPA amplification reaction on a sample by using the primer group and the probe to obtain an amplification product A1;
(4) reacting the amplification product A1 with 5 × extraction Buffer to obtain a product B1;
(5) and (4) dropwise adding the product B1 into a sample adding hole of a lateral flow test strip to perform LFD reaction, and observing the result.
Further, the method for observing the result in the step (5) comprises the following steps:
when the test strip detection area is colored and the quality control area is also colored, the virus in the sample to be detected is a novel coronavirus;
when the test strip detection area does not develop color and the quality control area develops color, the virus in the sample to be detected is not the novel coronavirus;
when the quality control area does not develop color, the test strip is ineffective, and a new test strip is needed for re-determination.
Further, the specific method of the step (3) is as follows:
taking 2.1 mu L of each of the upstream primer and the downstream primer with the concentration of 10 mu mol/L, 0.6 mu L of the probe with the concentration of 10 mu mol/L, 29.5 mu L of the regeneration Buffer and ddH of the RNase Inhibitor2O12.2 mu L and cDNA template 1 mu L are mixed, added into an RPA enzyme tube and uniformly shaken, then added with 2.5 mu L magnesium acetate, and then the reaction system is placed in a water bath kettle at 37 ℃ for reaction for 20min without high-temperature denaturation, annealing and extension, thus obtaining an amplification product A1.
Further, the RPA enzyme tube comprises the recombinase uvx, a single-strand binding protein, and a DNA polymerase.
Further, the volume of the amplification product A1 in the step (4) is 10 μ L; the volume of 5 × extraction Buffer was 80 μ L.
Further, the product B1 in step (5) had a volume of 75. mu.L, and was loaded into the wells and the results were read within 5 min.
The invention has the following beneficial effects:
1. RPA is used for amplifying a target fragment by using a specific primer pair and a probe under a constant temperature condition, the whole process is very fast, and an amplification product with a detectable level can be obtained within ten minutes generally; LFD is used for carrying out test strip detection on the RPA amplification product, the detection result of the amplification product on a lateral flow test strip can be observed within a few minutes, complex instruments and equipment are not needed, and the LFD is suitable for on-site rapid detection.
2. According to the invention, by skillfully designing the areas of the primers and the probes, whether a detected sample contains the novel coronavirus can be simply, conveniently and rapidly identified, and the result can be observed by naked eyes through detection of a test strip.
3. The detection method has the advantages of simple operation, strong specificity, high sensitivity and the like, only generates specific amplification reaction on the cDNA of SARS-CoV-2, and has no amplification reaction on nucleic acids of coronavirus 229E, coronavirus OC43, coronavirus SARS, coronavirus NL63, coronavirus HKU1, coronavirus MERS and the like.
4. The kit provides a new means for detecting the novel coronavirus, is convenient and fast to apply and operate clinically, has strong practicability, can be used for epidemic situation monitoring and identification of the novel coronavirus pneumonia and epidemic disease purification, and can also be used for rapid identification of the novel coronavirus in a professional laboratory.
Drawings
FIG. 1 shows the results of the RPA-LFD test of the sample to be tested in example 1.
FIG. 2 shows the results of the test for the electrophoretic verification of the RPA product of the sample to be tested in example 1.
FIG. 3 shows the result of the specificity test of the RPA-LFD detection method for SARS-CoV-2.
FIG. 4 shows the result of the sensitivity test of the RPA-LFD detection method of SARS-CoV-2.
Detailed Description
The technical solution of the present invention will be described in further detail with reference to the following embodiments, but the present invention is not limited thereto.
Example 1
In the following examples: the RNA extraction kit is a viral nucleic acid RNA extraction test of Qiagen companyA cartridge (cat. No. 52904); the reverse transcription kit adopts Baori doctor's technology (Beijing) Co, Ltd reverse transcriptase (Cat No.: 6215A), and 20. mu.L of the reaction system: 5 XPrimeScript IV cDNA Synthesis Mix 4. mu.L, Random 6mers (50. mu.M) 2. mu.L, template RNA 5. mu.L, RNase Free H2O9 μ L, mixed and reacted under the following conditions: deactivating at 30 deg.C for 10min, 42 deg.C for 20min, and 70 deg.C for 15 min; the regeneration Buffer, RNase Inhibitor, extraction Buffer, recombinase uvs X, single-stranded binding protein and DNA polymerase are all available from TwistDx, UK
nfo KIT (cat # TANFO02 KIT); the recombinase uvs X, single-strand binding protein and DNA polymerase have been added to the RPA enzyme tube at the time of purchase in the kit.
A primer set and a probe for rapidly identifying a novel coronavirus, the primer set and the probe being designed from a specific primer pair and a probe set which are highly conserved in S gene and front and rear part sequences thereof and have specific regions, i.e., the first 600bp of SARS-CoV-2S gene, of a novel coronavirus (SARS-CoV-2, MN908947.3) published in GenBanK database of NCBI (national center for Biotechnology information) by a large number of comparison by the inventors, and the nucleotide sequences of the primer set and the probe are as follows:
the upstream primer SARS-CoV-2-F1: 5 'AGTCTCTAGTCAGTGTGTTAATCTTACAA 3' (SEQ ID NO: 1);
downstream primer SARS-CoV-2-R1: 5 'Biotin-TTCGCACTAGAATAAACTCTGAACTCACTT 3' (SEQ ID NO: 2);
fluorescent probe SARS-CoV-2-P1: 5 '[ FAM ] TTCCATGCTATACATGTCTCTGGGACCAAT [ THF ] GGTACTAAGAGGTTT [ C3-spacer ] 3' (SEQ ID NO: 3);
wherein biotin represents biotin, FAM represents carboxyfluorescein, THF represents a tetrahydrofuran linker, and C3-spacer means 3 methylene groups for preventing chain extension.
The primer group and the probe are used for amplifying a fragment of a novel coronavirus (SARS-CoV-2) S gene by an RPA method, and the length of the fragment is 462bp and 299bp respectively.
At the same time, the utility modelThe embodiment also discloses an RPA test strip kit for rapidly identifying the novel coronavirus, which comprises the primer group, a probe, a positive reference substance, a negative reference substance, an RNA extraction reagent, a reverse transcription reagent, an RPA amplification reagent, a lateral flow test strip, magnesium acetate and ddH2O and 5 × extraction Buffer, wherein the positive control is plasmid DNA containing S gene of novel coronavirus SARS-CoV-2; the negative control is deionized water.
In addition, the embodiment also discloses an RPA-LFD detection method for rapidly identifying the novel coronavirus by using the primer group and the probe, which comprises the following steps:
(1) extracting virus RNA from a sample to be detected according to the instruction of the RNA extraction kit;
(2) inverting the viral RNA in step (1) into cDNA according to the reverse transcription kit instructions;
(3) taking the cDNA in the step (2) as a template, and carrying out RPA amplification reaction on a sample by using the primer group and the probe;
it employs a 50 μ L reaction system: 2.1 mu L of each of upstream primer and downstream primer (10 mu mol/L), 0.6 mu L of RPA probe (10 mu mol/L), 29.5 mu L of regeneration Buffer, 12.2 mu L of ddH2O 12.2 of RNase Inhibitor and 1 mu L of cDNA template, adding the mixture into an RPA enzyme tube containing recombinase uvs X, single-chain binding protein and DNA polymerase after mixing, shaking and mixing uniformly, adding 2.5 mu L of magnesium acetate, placing the reaction system in a water bath kettle at 37 ℃ for reaction for 20min, and obtaining an amplification product A1 without high-temperature denaturation, annealing and extension;
(4) reacting 10. mu.L of the amplification product A1 with 80. mu.L of 5 × extraction Buffer to obtain a product B1;
(5) dropwise adding 75 mu L of the product B1 into a sample adding hole of a lateral flow test strip, carrying out LFD reaction, and observing the result within 5 min;
the result of the RPA-LFD test of the sample to be tested is shown in figure 1, wherein C represents a quality control band, and T represents a detection band; 1 represents a primer group and a probe plus negative control, and 2 represents the primer group and the probe plus a sample to be detected; FIG. 1 illustrates that the sample to be tested contains the novel coronavirus.
Nucleic acid electrophoresis verification experiment of RPA reaction product of sample to be detected
The RPA electrophoresis experiment was performed as follows:
a. mixing the amplification product A1 in the step (3) according to a volume ratio of 1: 1, adding a phenol chloroform solution (the volume ratio of phenol to chloroform to isopropanol is 25:24:1) for purification, centrifuging for 8min at the rotating speed of 12000rmp/min, and taking supernatant;
b. and (b) taking 10 mu L of the supernatant obtained in the step (a), adding 1 mu L of 10xloading buffer, mixing, then spotting the mixture into a 2% agarose gel hole, carrying out electrophoresis in 1 XTAE electrophoresis buffer solution at the voltage of 120V, and observing the result by a gel imaging system.
The experimental result is shown in figure 2, wherein M represents DL2000 marker, 1 represents primer group and probe + sample to be tested, 2 represents primer group and probe + negative control, figure 2 shows that the sample to be tested contains novel coronavirus, and the RPA electrophoresis verification result is consistent with the RPA-LFD experimental result.
First, specificity test
1. Artificially synthesizing a gene by using a complete sequence of an S gene of a novel coronavirus (SARS-CoV-2) published in a GenBanK database, connecting the gene with a pJET1.2 cloning vector, converting an escherichia coli competent cell DH5 alpha, coating the cell on an LB (lysogeny broth) culture medium plate containing 100mg/L ampicillin, culturing for 12-16 h at 37 ℃, selecting bacteria, screening, sequencing and identifying, amplifying and culturing positive bacteria liquid, extracting plasmids, and respectively naming the positive plasmids as pJET1.2-SARS-CoV-2-S, namely positive plasmids; wherein the complete sequence of S gene of the novel coronavirus virus (SARS-CoV-2) is artificially synthesized, and the nucleotide sequence of the gene is shown as follows:
SARS-CoV-2-S：5’
ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATAATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTCACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAAGACATCAGTAGATTGTACAATGTACATTTGTGGTGATTCAACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTTGTACACAATTAAACCGTGCTTTAACTGGAATAGCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAACAAATTTACAAAACACCACCAATTAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACCAAGCAAGAGGTCATTTATTGAAGATCTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATTGCCTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACCTTTGCTCACAGATGAAATGATTGCTCAATACACTTCTGCACTGTTAGCGGGTACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGCATTACAAATACCATTTGCTATGCAAATGGCTTATAGGTTTAATGGTATTGGAGTTACACAGAATGTTCTCTATGAGAACCAAAAATTGATTGCCAACCAATTTAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGAAAACTTCAAGATGTGGTCAACCAAAATGCACAAGCTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAATTTCAAGTGTTTTAAATGATATCCTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCAGACTTCAAAGTTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCTACTAAAATGTCAGAGTGTGTACTTGGACAATCAAAAAGAGTTGATTTTTGTGGAAAGGGCTATCATCTTATGTCCTTCCCTCAGTCAGCACCTCATGGTGTAGTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAAGAACTTCACAACTGCTCCTGCCATTTGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTGTCTTTGTTTCAAATGGCACACACTGGTTTGTAACACAAAGGAATTTTTATGAACCACAAATCATTACTACAGACAACACATTTGTGTCTGGTAACTGTGATGTTGTAATAGGAATTGTCAACAACACAGTTTATGATCCTTTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATACATCACCAGATGTTGATTTAGGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTTGCCAAGAATTTAAATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCCATGGTACATTTGGCTAGGTTTTATAGCTGGCTTGATTGCCATAGTAATGGTGACAATTATGCTTTGCTGTATGACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAAGGAGTCAAATTACATTACACATAA3’(SEQ ID NO：4)；
2. following the RPA-LFD detection method of example 1 for 1: pJET1.2-SARS-CoV-2-S positive plasmid; 2: coronavirus 229E; 3: coronavirus OC 43; 4: coronavirus SARS; 5: coronavirus NL 63; 6: coronavirus HKU 1; 7: coronavirus MERS; 8: detecting with negative control (deionized water), wherein the detection result is shown in figure 3, wherein C represents quality control band; t represents a detection zone.
As can be seen from fig. 3, the corresponding 1: pJET1.2-SARS-CoV-2-S positive plasmid test strip detected positive, whereas other common coronaviruses, such as 2: coronavirus 229E; 3: coronavirus OC 43; 4: coronavirus SARS; 5: coronavirus NL 63; 6: coronavirus HKU 1; 7: coronavirus MERS; 8: the test strip corresponding to the negative control (deionized water) is negative, which indicates that the RPA-LFD detection method in example 1 has better specificity to SARS-CoV-2.
Second, sensitivity test
Diluting the positive plasmid pJET1.2-SARS-CoV-2-S to 100、101、102、103、104、105、106、1078 concentration gradients of copies/. mu.L.
Following the RPA-LFD procedure of example 1 for 1: negative control (deionized water); 2: 100Copy/. mu.L; 3: 101Copy/. mu.L; 4: 102Copy/. mu.L; 5: 103Copy/. mu.L; 6: 104Copy/. mu.L; 7: 105Copy/. mu.L; 8: 106Copy/. mu.L; 9: 107The results of the test were shown in FIG. 4 for different concentrations of the positive plasmid at each μ L.
As can be seen in FIG. 4, the negative control (DI water), 100The test strip with copy/mu L positive plasmid concentration only shows color in a quality control zone, and does not show color in a detection zone; 101-107The test strip and the quality control strip of the copy/mu L positive plasmid concentration are colored, which shows that the sensitivity of the RPA-LFD detection method in the embodiment 1 can reach 101Copies/. mu.L.
It will be evident to those skilled in the art that the invention is not limited to the details of the foregoing illustrative embodiments, and that the present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof. The present embodiments are therefore to be considered in all respects as illustrative and not restrictive, the scope of the invention being indicated by the appended claims rather than by the foregoing description, and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein. Any reference sign in a claim should not be construed as limiting the claim concerned.
SEQUENCE LISTING
<110> southern China university of agriculture
<120> primer group, probe, kit and detection method for rapidly identifying novel coronavirus
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 29
<212> DNA
<213> Artificial Synthesis
<400> 1
agtctctagt cagtgtgtta atcttacaa 29
<210> 2
<211> 30
<212> DNA
<213> Artificial Synthesis
<400> 2
ttcgcactag aataaactct gaactcactt 30
<210> 3
<211> 45
<212> DNA
<213> Manual engineering
<400> 3
ttccatgcta tacatgtctc tgggaccaat ggtactaaga ggttt 45
<210> 4
<211> 3822
<212> DNA
<213> Artificial Synthesis
<400> 4
atgtttgttt ttcttgtttt attgccacta gtctctagtc agtgtgttaa tcttacaacc 60
agaactcaat taccccctgc atacactaat tctttcacac gtggtgttta ttaccctgac 120
aaagttttca gatcctcagt tttacattca actcaggact tgttcttacc tttcttttcc 180
aatgttactt ggttccatgc tatacatgtc tctgggacca atggtactaa gaggtttgat 240
aaccctgtcc taccatttaa tgatggtgtt tattttgctt ccactgagaa gtctaacata 300
ataagaggct ggatttttgg tactacttta gattcgaaga cccagtccct acttattgtt 360
aataacgcta ctaatgttgt tattaaagtc tgtgaatttc aattttgtaa tgatccattt 420
ttgggtgttt attaccacaa aaacaacaaa agttggatgg aaagtgagtt cagagtttat 480
tctagtgcga ataattgcac ttttgaatat gtctctcagc cttttcttat ggaccttgaa 540
ggaaaacagg gtaatttcaa aaatcttagg gaatttgtgt ttaagaatat tgatggttat 600
tttaaaatat attctaagca cacgcctatt aatttagtgc gtgatctccc tcagggtttt 660
tcggctttag aaccattggt agatttgcca ataggtatta acatcactag gtttcaaact 720
ttacttgctt tacatagaag ttatttgact cctggtgatt cttcttcagg ttggacagct 780
ggtgctgcag cttattatgt gggttatctt caacctagga cttttctatt aaaatataat 840
gaaaatggaa ccattacaga tgctgtagac tgtgcacttg accctctctc agaaacaaag 900
tgtacgttga aatccttcac tgtagaaaaa ggaatctatc aaacttctaa ctttagagtc 960
caaccaacag aatctattgt tagatttcct aatattacaa acttgtgccc ttttggtgaa 1020
gtttttaacg ccaccagatt tgcatctgtt tatgcttgga acaggaagag aatcagcaac 1080
tgtgttgctg attattctgt cctatataat tccgcatcat tttccacttt taagtgttat 1140
ggagtgtctc ctactaaatt aaatgatctc tgctttacta atgtctatgc agattcattt 1200
gtaattagag gtgatgaagt cagacaaatc gctccagggc aaactggaaa gattgctgat 1260
tataattata aattaccaga tgattttaca ggctgcgtta tagcttggaa ttctaacaat 1320
cttgattcta aggttggtgg taattataat tacctgtata gattgtttag gaagtctaat 1380
ctcaaacctt ttgagagaga tatttcaact gaaatctatc aggccggtag cacaccttgt 1440
aatggtgttg aaggttttaa ttgttacttt cctttacaat catatggttt ccaacccact 1500
aatggtgttg gttaccaacc atacagagta gtagtacttt cttttgaact tctacatgca 1560
ccagcaactg tttgtggacc taaaaagtct actaatttgg ttaaaaacaa atgtgtcaat 1620
ttcaacttca atggtttaac aggcacaggt gttcttactg agtctaacaa aaagtttctg 1680
cctttccaac aatttggcag agacattgct gacactactg atgctgtccg tgatccacag 1740
acacttgaga ttcttgacat tacaccatgt tcttttggtg gtgtcagtgt tataacacca 1800
ggaacaaata cttctaacca ggttgctgtt ctttatcagg atgttaactg cacagaagtc 1860
cctgttgcta ttcatgcaga tcaacttact cctacttggc gtgtttattc tacaggttct 1920
aatgtttttc aaacacgtgc aggctgttta ataggggctg aacatgtcaa caactcatat 1980
gagtgtgaca tacccattgg tgcaggtata tgcgctagtt atcagactca gactaattct 2040
cctcggcggg cacgtagtgt agctagtcaa tccatcattg cctacactat gtcacttggt 2100
gcagaaaatt cagttgctta ctctaataac tctattgcca tacccacaaa ttttactatt 2160
agtgttacca cagaaattct accagtgtct atgaccaaga catcagtaga ttgtacaatg 2220
tacatttgtg gtgattcaac tgaatgcagc aatcttttgt tgcaatatgg cagtttttgt 2280
acacaattaa accgtgcttt aactggaata gctgttgaac aagacaaaaa cacccaagaa 2340
gtttttgcac aagtcaaaca aatttacaaa acaccaccaa ttaaagattt tggtggtttt 2400
aatttttcac aaatattacc agatccatca aaaccaagca agaggtcatt tattgaagat 2460
ctacttttca acaaagtgac acttgcagat gctggcttca tcaaacaata tggtgattgc 2520
cttggtgata ttgctgctag agacctcatt tgtgcacaaa agtttaacgg ccttactgtt 2580
ttgccacctt tgctcacaga tgaaatgatt gctcaataca cttctgcact gttagcgggt 2640
acaatcactt ctggttggac ctttggtgca ggtgctgcat tacaaatacc atttgctatg 2700
caaatggctt ataggtttaa tggtattgga gttacacaga atgttctcta tgagaaccaa 2760
aaattgattg ccaaccaatt taatagtgct attggcaaaa ttcaagactc actttcttcc 2820
acagcaagtg cacttggaaa acttcaagat gtggtcaacc aaaatgcaca agctttaaac 2880
acgcttgtta aacaacttag ctccaatttt ggtgcaattt caagtgtttt aaatgatatc 2940
ctttcacgtc ttgacaaagt tgaggctgaa gtgcaaattg ataggttgat cacaggcaga 3000
cttcaaagtt tgcagacata tgtgactcaa caattaatta gagctgcaga aatcagagct 3060
tctgctaatc ttgctgctac taaaatgtca gagtgtgtac ttggacaatc aaaaagagtt 3120
gatttttgtg gaaagggcta tcatcttatg tccttccctc agtcagcacc tcatggtgta 3180
gtcttcttgc atgtgactta tgtccctgca caagaaaaga acttcacaac tgctcctgcc 3240
atttgtcatg atggaaaagc acactttcct cgtgaaggtg tctttgtttc aaatggcaca 3300
cactggtttg taacacaaag gaatttttat gaaccacaaa tcattactac agacaacaca 3360
tttgtgtctg gtaactgtga tgttgtaata ggaattgtca acaacacagt ttatgatcct 3420
ttgcaacctg aattagactc attcaaggag gagttagata aatattttaa gaatcataca 3480
tcaccagatg ttgatttagg tgacatctct ggcattaatg cttcagttgt aaacattcaa 3540
aaagaaattg accgcctcaa tgaggttgcc aagaatttaa atgaatctct catcgatctc 3600
caagaacttg gaaagtatga gcagtatata aaatggccat ggtacatttg gctaggtttt 3660
atagctggct tgattgccat agtaatggtg acaattatgc tttgctgtat gaccagttgc 3720
tgtagttgtc tcaagggctg ttgttcttgt ggatcctgct gcaaatttga tgaagacgac 3780
tctgagccag tgctcaaagg agtcaaatta cattacacat aa 3822
Claims (10)
1. A primer group and a probe for quickly identifying a novel coronavirus are characterized in that the nucleotide sequences of the primer group and the probe are as follows:
the upstream primer SARS-CoV-2-F1: 5 'AGTCTCTAGTCAGTGTGTTAATCTTACAA 3' (SEQ ID NO: 1);
downstream primer SARS-CoV-2-R1: 5 'Biotin-TTCGCACTAGAATAAACTCTGAACTCACTT 3' (SEQ ID NO: 2);
fluorescent probe SARS-CoV-2-P1: 5 '[ FAM ] TTCCATGCTATACATGTCTCTGGGACCAAT [ THF ] GGTACTAAGAGGTTT [ C3-spacer ] 3' (SEQ ID NO: 3).
2. An RPA test strip kit for rapidly identifying a novel coronavirus, which comprises the primer group and the probe as described in claim 1.
3. The RPA strip kit for rapidly identifying a novel coronavirus according to claim 2, wherein the kit further comprises an RNA extraction reagent, a reverse transcription reagent, an RPA amplification reagent and a lateral flow strip.
4. The RPA test strip kit for rapidly identifying novel coronavirus according to claim 2, wherein the kit further comprises magnesium acetate and ddH2O、5×Extration Buffer。
5. A method for detecting RPA-LFD by using the primer set and probe of claim 1 to rapidly identify a novel coronavirus, which comprises the following steps:
(1) extracting RNA of a sample to be detected;
(2) inverting the RNA in the step (1) into cDNA;
(3) taking the cDNA in the step (2) as a template, and carrying out RPA amplification reaction on a sample by using the primer group and the probe to obtain an amplification product A1;
(4) reacting the amplification product A1 with 5 × extraction Buffer to obtain a product B1;
(5) and (4) dropwise adding the product B1 into a sample adding hole of a lateral flow test strip to perform LFD reaction, and observing the result.
6. The method for detecting RPA-LFD to rapidly identify new coronavirus according to claim 5, wherein the observation result in step (5) is obtained by:
when the test strip detection area is colored and the quality control area is also colored, the virus in the sample to be detected is a novel coronavirus;
when the test strip detection area does not develop color and the quality control area develops color, the virus in the sample to be detected is not the novel coronavirus;
when the quality control area does not develop color, the test strip is ineffective, and a new test strip is needed for re-determination.
7. The method for detecting RPA-LFD to rapidly identify novel coronavirus according to claim 5, wherein the specific method in step (3) comprises:
taking 2.1 mu L of each of the upstream primer and the downstream primer with the concentration of 10 mu mol/L, 0.6 mu L of the probe with the concentration of 10 mu mol/L, 29.5 mu L of the regeneration Buffer and ddH of the RNase Inhibitor2O12.2 mu L and cDNA template 1 mu L are mixed, added into an RPA enzyme tube and uniformly shaken, then added with 2.5 mu L magnesium acetate, and then the reaction system is placed in a water bath kettle at 37 ℃ for reaction for 20min without high-temperature denaturation, annealing and extension, thus obtaining an amplification product A1.
8. The method for detecting RPA-LFD to rapidly identify novel coronavirus according to claim 7, wherein the RPA enzyme tube contains recombinase uvs X, single-strand binding protein and DNA polymerase.
9. The method for detecting RPA-LFD to rapidly identify a novel coronavirus according to claim 5, wherein the volume of the amplification product A1 in step (4) is 10 μ L; the volume of 5 × extraction Buffer was 80 μ L.
10. The method for detecting RPA-LFD for rapidly identifying novel coronavirus according to claim 5, wherein the volume of product B1 in step (5) is 75 μ L, and the result is read within 5min after loading into the loading well.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010290259.XA CN113528704A (en) | 2020-04-14 | 2020-04-14 | Primer group, probe, kit and detection method for rapidly identifying novel coronavirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010290259.XA CN113528704A (en) | 2020-04-14 | 2020-04-14 | Primer group, probe, kit and detection method for rapidly identifying novel coronavirus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113528704A true CN113528704A (en) | 2021-10-22 |
Family
ID=78087986
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010290259.XA Pending CN113528704A (en) | 2020-04-14 | 2020-04-14 | Primer group, probe, kit and detection method for rapidly identifying novel coronavirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113528704A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114410835A (en) * | 2021-12-02 | 2022-04-29 | 华南农业大学 | RPA-LFD kit for rapidly detecting novel coronavirus |
| CN115725794A (en) * | 2022-10-28 | 2023-03-03 | 圣湘生物科技股份有限公司 | Composition, method and application for combined detection of novel coronavirus and monkeypox virus |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110951916A (en) * | 2019-12-04 | 2020-04-03 | 华南农业大学 | Primer and kit for detecting SADS-CoV based on real-time fluorescent reverse transcription recombinase polymerase nucleic acid amplification technology |
| CN110982945A (en) * | 2020-03-04 | 2020-04-10 | 珠海丽珠试剂股份有限公司 | Nucleic acid composition, kit and method for detecting 2019 novel coronavirus |
-
2020
- 2020-04-14 CN CN202010290259.XA patent/CN113528704A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110951916A (en) * | 2019-12-04 | 2020-04-03 | 华南农业大学 | Primer and kit for detecting SADS-CoV based on real-time fluorescent reverse transcription recombinase polymerase nucleic acid amplification technology |
| CN110982945A (en) * | 2020-03-04 | 2020-04-10 | 珠海丽珠试剂股份有限公司 | Nucleic acid composition, kit and method for detecting 2019 novel coronavirus |
Non-Patent Citations (5)
| Title |
|---|
| CHUNBAO XIE ET AL.: "comparison of different samples for 2019 novel coronavirus detection by nucleic acid amplification tests", 《INT J INFECT DIS.》 * |
| SIMIN XIA ET AL.: "Ultrasensitive and whole-course encapsulated field detection of 2019-nCoV gene applying exponential amplification from RNA combined with chemical probes", 《BIOLOGICAL AND MEDICINAL CHEMISTRY》 * |
| 张晓元等: "新型冠状病毒SARS-CoV-2检测技术的研究进展", 《生物化学与生物物理进展》 * |
| 邱峰;王慧君;张子康;操龙斌;王陈龙;吴静标;杜庆锋;: "新型冠状病毒SARS-CoV-2的实验室检测技术", 南方医科大学学报 * |
| 郭正洋等: "重组酶聚合酶扩增技术的研究进展", 《食品科技》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114410835A (en) * | 2021-12-02 | 2022-04-29 | 华南农业大学 | RPA-LFD kit for rapidly detecting novel coronavirus |
| CN115725794A (en) * | 2022-10-28 | 2023-03-03 | 圣湘生物科技股份有限公司 | Composition, method and application for combined detection of novel coronavirus and monkeypox virus |
| CN115725794B (en) * | 2022-10-28 | 2024-02-02 | 圣湘生物科技股份有限公司 | Compositions, methods and uses for novel coronavirus and monkey pox virus joint detection |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101939336B1 (en) | Composition for Detecting Virus Relating Respiratory Disease and Kit for Detecting Virus Relating Respiratory Disease Comprising the Same | |
| CN110777220B (en) | Primer group, probe, RPA test strip kit and identification method | |
| CN112063756B (en) | Method and kit for multiple detection of respiratory virus nucleic acid | |
| CN111286559B (en) | Primer, probe and kit for detecting African swine fever virus | |
| CN103614489B (en) | Constant-temperature amplification detection kit for dengue viruses and detection method | |
| CN107488748B (en) | Composition for detecting 23 respiratory pathogens, kit and detection method thereof | |
| CN112538550B (en) | RT-RPA and CRISPR/Cas-based DHAV-1 and DHAV-3 detection system and application | |
| CN103773896B (en) | The fluorescence quantitative RT-PCR detecting agent of west nile virus, test kit and detection method thereof | |
| CN111560478B (en) | Kit for detecting novel coronavirus by combining reverse transcription PCR with Sanger sequencing in one-step method | |
| CN113528704A (en) | Primer group, probe, kit and detection method for rapidly identifying novel coronavirus | |
| CN112831600A (en) | Primer probe combination for detecting SARS-CoV-2 virus and its application | |
| CN110938711A (en) | Real-time fluorescent RAA primer, probe and kit for detecting avian infectious laryngotracheitis virus and using method of real-time fluorescent RAA primer, probe and kit | |
| CN101768636A (en) | Composition and kit for detecting vibrio cholerae and detection method | |
| CN116042927B (en) | CRISPR-Cas13 system for detecting novel coronaviruses, kit and method thereof | |
| CN114196769B (en) | Primer and kit for detecting salmonella and application method of primer and kit | |
| CN112941240B (en) | Primer pair, kit and method for detecting goose astrovirus and goose goblet virus | |
| KR20130045863A (en) | Primer and probe for diagnosing tuberculosis, a kit comprising the same and a tu-berculosis-diagnosing method using the kit | |
| CN103305629B (en) | Detection method for CVA16 in environmental water body | |
| CN103305628B (en) | Detection method for EV71virus in environmental water body | |
| CN112553379A (en) | Method and kit for detecting respiratory infectious disease virus based on liquid-phase chip | |
| CN102344970B (en) | Primer sequences and quantitative determination kit used for simultaneously detecting human CMV and BK virus DNA | |
| CN111733287A (en) | Kit for detecting pathogenic nucleic acid of fever with thrombocytopenia syndrome | |
| CN114836581B (en) | Primer combination for detecting pathogens of digestive tract infectious diseases | |
| RU2813519C1 (en) | Set of oligonucleotide primers and probes for identifying rift valley fever virus rna using isothermal pcr with hybridization-fluorescence detection in real time | |
| KR102496414B1 (en) | Primer sets for simultaneous detection of 18S rRNA gene and 28S rRNA gene of Kudoa Septempunctata |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |