CN107201352B - β -galactosidase combined mutant with high transglycosidic activity and preparation method and application thereof - Google Patents

Abstract

The invention belongs to the field of genetic engineering and genetic engineering, and discloses a β -galactosidase combined mutant with high transglycosylation activity, which is obtained by double-site fixed-point saturation mutation on the basis of an amino acid sequence of β -galactosidase of aspergillus leucatus and aspergillus oryzae from which a signal peptide is removed, wherein the transglycosylation reaction rate of the mutant is improved by more than 100% compared with that of a wild type under the condition that the generation amount of oligosaccharide is kept unchanged.

Description

β -galactosidase combined mutant with high transglycosidic activity and preparation method and application thereof

The application is a divisional application of an invention patent application with the name of 'β -galactosidase combined mutant with high transglycosidic activity, a preparation method and application', wherein the application number is 201410514519.1, and the application date is 9/29/2014.

Technical Field

The invention relates to the field of genetic engineering and genetic engineering, in particular to an β -galactosidase combined mutant with high transglycosidic activity and a preparation method and application thereof.

Background

The galacto-oligosaccharides (GOS) are oligosaccharides with special biological functions that are not digested and absorbed in the gastrointestinal tract of the human body and directly enter the large intestine to be well utilized by various bifidobacteria. It can improve the micro-ecological environment in human body, is favorable for the proliferation of bifidobacterium and other beneficial bacteria and can improve the immunologic function of human body. Meanwhile, GOS produces organic acid through metabolism to reduce the pH value in the intestines, inhibit the growth of salmonella and putrefying bacteria in the intestines, reduce the generation of toxic fermentation products and harmful bacterial enzymes, regulate the gastrointestinal function and reduce the burden of the liver for decomposing toxin. The galacto-oligosaccharide has better properties than other functional oligosaccharides, so that the galacto-oligosaccharide is more convenient and feasible to be applied on a large scale as an additive, can adapt to more food types and wider consumer groups, and has huge application value and market potential.

The GOS preparation method generally comprises five methods, namely extraction from natural raw materials, acid hydrolysis of natural polysaccharide, chemical synthesis, fermentation and enzymatic synthesis, wherein the GOS is low in natural content, colorless and uncharged, so that the GOS is difficult to extract and separate, the natural polysaccharide is low in conversion product yield, the product components are complex and difficult to purify, the chemical method is high in toxicity and easy to remain, and heavy in environmental pollution, the research on producing the GOS by the fermentation method is few, the GOS is still on a laboratory scale and cannot be produced in large quantities, the industrial production of the galactooligosaccharides is completed by β -galactosidase, β -galactosidase (β -D-galactosidase galatosohydrolase (Lactase) which has double functions of hydrolysis and transglycosylation, and the research on the β -galactosidase is mainly focused on producing the galactooligosaccharides by utilizing the hydrolysis function of the galactooligosaccharides, so as to relieve diarrhea, adverse reactions and the like of lactose intolerant patients caused by eating dairy products, along with the determination of the health care function of the galactooligosaccharides, the research on the production of β -galactooligosaccharides by utilizing the special galactooligosaccharides is focused on the following three aspects:

1. screening β -galactosidase producing strain with high transglycosidic activity

A study shows that β -galactosidase from different sources has different enzymatic properties, so that reaction conditions during synthesis of galactooligosaccharides are greatly different, β -galactosidase can be divided into acid and neutral according to the optimal pH, β -galactosidase from mould is generally an acid enzyme with the optimal pH being 2.5-5.5 and the optimal reaction temperature being higher (50-60 ℃), β -galactosidase from yeast and bacteria is a neutral enzyme with the optimal pH being 6-7.5 and the optimal reaction temperature being lower (30-40 ℃), the substrate types of the β -galactosidase from different sources are different, the types and proportions of oligosaccharides in the galactooligosaccharides produced by the yeast and bacteria are different, so that new members of the galactooligosaccharide family cannot be differentiated, the screened natural β -galactosidase with the highest transglycosidase activity is low, and the production yield is generally 30-5%, and the production of the galactooligosaccharides cannot generally meet the requirement of the industrial production requirement.

2. Reaction condition optimization and production process improvement

The main method is to increase the concentration of initial lactose, control the water activity with organic solvent and use immobilization technique, since β -galactosidase hydrolysis and transglycosylation are reversible, when the substrate concentration is lower, the concentration of hydrolysis product galactose is lower, the inhibition effect on hydrolysis is smaller, at this time, the enzyme shows higher hydrolysis activity, and the transglycosylation activity is lower, therefore, the monosaccharide content in the product is higher, when the lactose concentration is higher, the concentration of hydrolysis product galactose is higher, when it reaches a certain value, the inhibition effect on the hydrolase activity is generated, galactose is the substrate of transglycosylation, the synthesis of galactose oligosaccharide is facilitated by high concentration, therefore, when the substrate concentration is higher, the oligosaccharide content in the product is higher, the synthesis of oligosaccharide is facilitated by using organic solvent, because the organic solvent can reduce the water in the reaction system to affect the active site and reaction mechanism of the enzyme, guide the hydrolytic enzyme to catalyze the reverse transgalactosidactose reaction, so that the reaction equilibrium of the oligosaccharide is shifted from hydrolysis to synthesis of immobilized oligosaccharides, the immobilized enzyme, the problem of reducing the heat-exchange cost of immobilized enzyme, β% can be found, and the immobilized enzyme can be used to improve the yield of immobilized phenolaldehyde-immobilized enzyme.

3. Improving expression and property of β -galactosidase by genetic engineering means

The wild β -galactosidase GOS yield in nature is generally maintained between 20% and 45%, the yield is low, and the production requirement is difficult to meet, so that screening of mutant enzymes with excellent transglycosidic properties through molecular modification becomes a research hotspot, HansenO (2001) and the like find that β -galactosidase BIF3 from bifidobacteria is changed into high-efficiency transglycosidase after losing 580 amino acids at the C terminal, the enzyme protein can generate GOS by using almost 90% of lactose, the hydrolysis component accounts for 10%, and the transglycosidic activity and the hydrolytic activity of 9:1 ratio can be maintained under the lactose concentration of 10% to 40%, Placier G performs directed evolution on β -galactosidase from Geobacillus stearothermophilus KVE39 in 2009, improves the transglycosidic activity, reduces the hydrolytic activity as a screening basis, successfully screens three-strain mutants R35109, R109 and R K, respectively achieves 23% of low-lactose yield, 11.5%, 21% of wild-galactosidase GOS, 2, and the optimal yield of wild-galactosidase is found to 18% (W739.23%, 9.9-9) and the wild-galactosidase is researched under the optimal production condition of 18% W493 3.23% and the wild-3.23% of the wild-3-9-year-9-year sulfurylase strain.

Then, the scholars propose an iterative combinatorial mutation method (Ji J, Fan K.et al,2012), namely, the mutant with the highest activity in each round of screening results is used as a template to carry out the next round of combinatorial mutation until the activity of the generated mutant cannot exceed that of the original template, and iterative combinatorial mutation is finished, 11 mutants with improved activity are screened from 24 mutants in the four rounds of combinatorial mutation by the method, and the final mutant with the highest activity (C155Y Y184H V275I C281Y) is improved by 1874% compared with the original wild enzyme, but the combinatorial mutation method is not reported to be applied to the molecular modification of β -galactosidase.

So far, no matter the screening and separation of natural enzyme, the process optimization or the improvement of expression and property of β -galactosidase by means of genetic engineering, the current situations of low transglycosidic activity and low yield of β -galactosidase are not changed, so that the synthetic yield of galactooligosaccharides is low, the reaction time is long, the production cost is too high, and the cheap production and popularization and application of the galactooligosaccharides are severely restricted.

Therefore, creating a novel β -galactosidase with high transglycosidic activity and making it inexpensive to produce is one of the major problems that needs to be solved in current research and production.

Disclosure of Invention

In view of the above-mentioned drawbacks of the prior art, the present invention provides an β -galactosidase combination mutant with high transglycosylation activity, which is obtained by site-specific saturation mutagenesis of two sites based on aspergillus leucatus or aspergillus oryzae β -galactosidase, preferably based on an amino acid sequence shown in sequence 2 or sequence 4, wherein the transglycosylation reaction rate of the mutant is increased by more than 100%, preferably more than 150%, and more preferably more than 200% compared with the wild type while the oligosaccharide production amount is kept unchanged.

In a preferred embodiment of the invention, the mutation sites are the amino acids at position 219 and 785, respectively.

In a further preferred embodiment of the invention, the site-directed saturation mutation at two sites is a substitution of the serine residue at position 219 with a glycine residue (S219G) and the glutamic acid residue at position 785 with a valine residue (E785V), a substitution of the serine residue at position 219 with an alanine residue (S219A) and the glutamic acid residue at position 785 with a valine residue (E785V), a substitution of the serine residue at position 219 with an asparagine residue (S219N) and the glutamic acid residue at position 785 with a valine residue (E785V), or a substitution of the serine residue at position 219 with a valine residue (S219V) and the glutamic acid residue at position 785 with a valine residue (E785V), respectively.

In another aspect of the invention, there is provided a DNA molecule encoding the above combinatorial mutant.

In a further aspect, the present invention provides a recombinant expression vector, preferably a recombinant yeast expression vector, comprising the above-described DNA molecule.

In a further aspect of the invention there is provided a host cell expressing the DNA molecule described above, preferably a strain of Saccharomyces, Kluyveromyces, Schizosaccharomyces and methylotrophic yeast, more preferably a strain of Pichia.

In a further aspect of the present invention, there is provided a method for preparing β -galactosidase with high transglycosidic activity, comprising the steps of:

1. transforming host cells by using the recombinant expression vector to obtain a recombinant strain;

2. culturing the recombinant strain, and inducing the expression of recombinant β -galactosidase;

3. recovering and purifying the expressed β -galactosidase with high transglycosidic activity.

In a final aspect, the invention provides the use of the combinatorial mutants, DNA molecules, recombinant expression vectors and host cells of the invention for the preparation of β -galactosidase.

The invention adopts a double-site-directed saturated mutation technology to carry out site-directed saturated mutation on β -galactosidase gene lacb 'of aspergillus leucatus from which signal peptides are removed and β -galactosidase gene laco' of aspergillus oryzae from which the signal peptides are removed, and obtains a β -galactosidase combined mutant with high transglycosylation activity, so that the transglycosylation reaction rate is improved by more than 100 percent compared with that of a wild type, even by more than 200 percent, the preparation of β -galactosidase with high efficiency and high transglycosylation activity becomes practical, and a good foundation is laid for the application of β -galactosidase.

Drawings

FIG. 1 molecular docking of β -galactosidase with substrate from Aspergillus leucrosus and Aspergillus oryzae.

FIG. 2 shows the spatial relationship between the mutation site of β -galactosidase and the lactose molecule of Aspergillus candidus and Aspergillus oryzae.

FIG. 3 shows the construction process of recombinant expression vector containing mutant β -galactosidase gene.

FIG. 4: production amount of galactooligosaccharide of typical mutant at S219 site.

FIG. 5: and (3) the yield trend of the galactooligosaccharide of the F245 site mutant library.

FIG. 6: production of galactooligosaccharide from a typical mutant at the F245 site.

FIG. 7: and E785 site mutant library galactooligosaccharide production amount trend.

FIG. 8: and (3) the production amount of the S219/E785 double-site mutant galactooligosaccharide.

Detailed Description

The present invention is further illustrated by the following examples, which are intended to be illustrative, but not limiting, of the present invention. It should be noted that, for those skilled in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications also fall into the protection scope of the present invention.

Example 1 prediction of β -galactosidase Tertiary Structure and mutation site

The β -galactosidase gene lacb' with the self signal peptide removed is cloned from Aspergillus candidus (Aspergillus candidus) in the laboratory, the gene with the self signal peptide sequence removed consists of 2958 nucleotides, the specific sequence is shown as sequence 1, and the protein coded by the gene consists of 986 amino acids, and the specific sequence is shown as sequence 2.

β -galactosidase gene laco 'with its signal peptide removed, which is cloned from aspergillus oryzae (aspergillus oryzae) in the laboratory, also consists of 2958 nucleotides, the specific sequence is shown as sequence 3, the gene encodes a protein also consisting of 986 amino acids, the specific sequence is shown as sequence 4, the amino acid sequence of the gene differs from the protein encoded by the gene lacb' by only three amino acids, namely lacb '(Gly), laco' (Ser), lacb '(Met), laco' (Ile), at position 401, lacb '(Asp), laco' (Asn), at position 970.

The materials studied were The β -galactosidase from Aspergillus leukawae and Aspergillus oryzae to obtain The crystal structures of The proteins of Penicillium β -galactosidase (PDB accession No.: 1TG7), Aspergillus oryzae β -galactosidase (PDB accession No.: 4IUG) and Trichoderma reesei β -galactosidase (PDB accession No.: 3OG2) as homology models, The 3D structure of β -galactosidase and The region binding to The substrate were predicted, The predicted structure was highly similar to The literature (see The crystallstretus structure of acidic β -galase from Aspergillus oryzae, Mirkom. Maksimainen, International Journal of local Macromolecules, 2013, 109. 115) The protein consisted of 5 domains, domain 1 (1-394) near The N-terminus, The active central domains of The immobilized Macromolecules, 2013, 31-160, The central structural domain consisting of 5 domains of The homologous motif, 250-7-19-7, 21-7, The central structural motif consisting of The homologous motif of The amino acids of The motif, The motif of The amino acids found by The homologous motif, The homologous motif of The homologous motif, The homologous structure consisting of 5 domains of The motif, The motif of The amino acids belonging to The motif, The motif of The homologous domains of The homologous genes belonging to The homologous domains of The homologous genes belonging to The homologous genes.

According to the obtained three-dimensional structure of β -galactosidase, molecular docking simulation of enzyme and substrate is carried out by using Discovery Studio software (see figure 1), amino acids which have interaction with the substrate can be obtained by analyzing docking results (see figure 2), the evolutionary entropy of the amino acids is evaluated one by using computational biology software, and finally six amino acid sites with larger evolutionary entropy change, namely S219, D239, S240, Y241, F245 and E785 (see table 1), are screened and determined to be used for site-directed saturation mutation.

TABLE 1 entropy of evolution of typical amino acids of 1 β -galactosidase

Example 2: construction of Pichia pastoris single-point saturation mutant library

1. Materials and methods

(1) Strains and carriers

The wild-type genes are derived from β -galactosidase gene lacb 'of aspergillus leucatus from which signal peptides are removed and β -galactosidase gene laco' of aspergillus oryzae, and are obtained by early-stage cloning in the laboratory, specific sequences are shown as sequence 1 and sequence 3, are connected to a pPIC9 expression vector and are expressed in pichia pastoris GS115, Escherichia coli Trans1-T1 competent cells are purchased from TransGen company, pPIC9 expression vector and pichia pastoris GS115 is purchased from Invitrogen company.

(2) Preparation of culture media and related solutions

For pichia pastoris transformation, culture and screening conventional media and reagents refer to the instructions of Invitrogen corporation.

PTM trace salts: 0.6% CuSO₄，0.008％NaI₂，0.3％MnSO₄，0.02％Na₂MoO₄，0.002％H₃BO₃，0.05％CoCl₂，2％ZnCl₂，6.5％FeSO₄0.5% sulfuric acid (v/v).

Yeast Fermentation Basal Salts Medium (FBSM): 0.5% KH₂PO₄，5％NH₄H₂PO₄，1.485％MgSO₄，1.82％K₂SO₄，0.093％CaSO₄0.15% KOH, 0.00011% Biotin, 0.44% PTM trace salt, 2% glucose.

Yeast fermentation basal salt induction medium (FBIM): 0.5 percentKH₂PO₄，5％NH₄H₂PO₄，1.485％MgSO₄，1.82％K₂SO₄，0.093％CaSO₄0.15% KOH, 0.00011% Biotin, 0.44% PTM trace salt, 0.5% methanol.

Na₂HPO₄Citrate buffer (0.1mol/L pH 5.2): 0.2mol/L disodium hydrogen phosphate 536ml and 0.1mol/L citric acid 464ml, and after mixing uniformly, the pH is adjusted to 5.2.

(3) Oligonucleotide primer

The specific primer sequences used in the gene mutation are shown in table 2.

TABLE 2 introduction tables used in Gene mutation

2. Overlapping PCR amplification of mutant sites

The method of overlapping PCR (overlap PCR) is adopted to carry out saturation mutation on a single site of the gene. That is, the two fragments were amplified separately by PCR and then fused by overlap extension. A pair of degenerate primers were designed to overlap to some extent near the target site (see primer B, C in FIG. 3) and combined with the 5 'and 3' primers of the gene (see primer A, D in FIG. 3), respectively, to amplify the upstream and downstream fragments containing the mutated target site, and since these primers are complementary, the resulting PCR product strands will overlap each other, and the upstream and downstream fragments will be staggered at the target site and overlap each other as templates to extend the full length gene. mu.L of pPIC 9-lacb' plasmid was used as a template, and the PCR products were detected by agarose gel electrophoresis using the primer pairs A and C and B and D, respectively, and the TransStart FastPfu DNA polymerase for amplification, and the correct size fragment was recovered (see Tiangen Biochemical reagent (Beijing) Co., Ltd., agarose gel DNA recovery kit).

3. Construction of expression vector by in vitro homologous recombination

Two PCR fragments with homologous arms are mixed in equimolar amounts and homologous recombinase is added for in vitro recombination. The mixture was reacted at 25 ℃ for 30min, and then left on ice for 5 min. It can be immediately transformed or stored at-20 ℃. 10ul of each homologous recombination product was chemically transferred to 100ul of E.coli Trans1-T1 competent cells, spread on an Amp-containing LB plate, and cultured overnight at 37 ℃ by inversion.

All mutation sites can be covered by growing 3-5 times of theoretical mutants on an LB plate (mutation codons are MNN, the theoretical value of a variant library is 4 multiplied by 2 which is 32, and 32 clones can be selected by single-point saturation mutation to cover all mutation). 6-8 monoclonals are randomly selected from LB plates of each mutant library to carry out DNA sequence determination, and sequencing work is finished by the Beijing Mei Aoden biotechnology limited. Each mutant library is named as an S219 library, a D239 library, an S240 library, a Y241 library, an F245 library and an E785 library in sequence according to different mutation sites.

4.β -galactosidase mutant expression in pichia pastoris and screening method of high transglycosidic activity strain

(1) Expression of recombinant plasmid in Pichia pastoris

Extracting mixed plasmids (about 200-.

(2) β -galactosidase activity determination method based on oNPG substrate

Accurately weighing 0.1g of oNPG substrate, dissolving in 40mL of Na₂HPO₄Citrate buffer (pH 5.2, 0.1mol/L), i.e. oNPG solution with a concentration of 0.25% (W/V). The crude enzyme solution to be detected uses Na with pH of 5.2 and 0.1mol/L₂HPO₄Diluting citric acid to appropriate times, adding 800 μ L substrate solution into test tube, preheating in 60 deg.C water bath for 2min, adding 200 μ L diluted enzyme solution, mixing, reacting for 15min, sequentially adding 1mL 10% TCA, terminating, and 2mL 1mol/L Na₂CO₃Color development and measurement of light absorption at 420nm (OD)₄₂₀). By adding Na₂HPO₄Using a citric acid buffer solution (with the concentration of 0.1mol/L and the pH value of 5.2) as a blank control, calculating the amount of oNP generated by the reaction by using a standard curve, and further calculating the enzyme activity of β -galactosidase, wherein the enzyme activity unit is defined in the following way, wherein the β -galactosidase activity of one unit (1U) refers to the enzyme amount required for catalyzing a substrate o-nitrophenol- β -D-galactopyranoside (oNPG) to generate 1 mu mol of o-nitrophenol (oNP) per minute under the conditions of 60 ℃ and the pH value of 5.2.

According to the result of β -galactosidase standard curve, the enzyme activity calculation formula is as follows:

enzyme activity (U/mL) ═ 5 × N (0.9472X +0.0046)/15

x: light absorption at 420 nm; n: dilution times of enzyme solutions; 15: reacting for 15 min; 5: the enzyme activity in 200. mu.L of the diluted enzyme solution was converted to 1mL of enzyme activity.

(3) Basic reaction system and reaction conditions for determining transglycosidic activity of mutant strain

Subjecting the crude enzyme solution of each mutant to Na with pH of 5.2 and 0.1mol/L₂HPO₄Citrate buffer diluted to an equal protein concentration, i.e.containing 5. mu.g of protein per 60. mu.L of enzyme solution (concentration about 0.08 mg/mL). 60. mu.L of the diluted enzyme solution was pipetted into an EP tube, 440. mu.L of 30% (w/v) lactose substrate was added, and the substrate and enzyme solution were mixed as quickly as possible to ensure the minimum initial reaction time interval for each sample. Each reaction was placed in a constant temperature shaker at 50 ℃ and 200rpm for various times. After the reaction is finished, the mixture is centrifuged at 12000rpm for 10min and placed in a water bath at 100 ℃ to be boiled for 10min to terminate the reaction.

The reaction product was diluted 16-fold with ultrapure water, centrifuged at 12000rpm for 10min, and 700. mu.L of the product was collected and subjected to HPLC analysis.

High Performance Liquid Chromatography (HPLC) detection conditions:

and drawing standard curves of glucose, galactose and lactose before HPLC quantitative detection. The detection intervals of glucose, galactose and lactose are all 0-25.6 mg/mL, and the detection conditions are as follows: waters e2695Separations Moule, mobile phase: 50mM EDTA calcium sodium salt; column temperature: 85 ℃; flow rate, time: 0.5ml/min, 12 min/sample.

Oligosaccharide GOS yield (mg/mL) ═ initial lactose amount (mg/mL) -residual lactose amount (mg/mL) -glucose amount (mg/mL) -half lactose amount (mg/mL) (Jorgensen F et al, 2001);

GOS conversion ═ amount of oligosaccharide (mg/mL)/amount of starting lactose (mg/mL);

yield of consumed lactose conversion to GOS ═ amount of oligosaccharides (mg/mL)/[ amount of starting lactose (mg/mL) — amount of lactose remaining (mg/mL) ].

Example 3: screening of S219 saturated mutant library and oligosaccharide synthesis

Sequencing shows that the transglycosidation activity (oligosaccharide production) of the mutant enzyme can be improved by respectively mutating the mutants into 8 different amino acids (see table 3), particularly, amino acids with smaller side chains such as Gly, Ala and Val and polar amino acid Glu with negative charges are more prominent, wherein the mutation is the most obvious Gly (see figure 4), the oligosaccharide production amount can be improved by 26.6%, the oligosaccharide production amount is improved by 25.7% after mutating into small side chains and Glu with negative charges, the oligosaccharide production amount is respectively improved by 15.0% and 15.5% after mutating into Ala and Val, the oligosaccharide production amount is respectively improved by 10.4%, 7.9% and 8.2% after mutating into Asp, Arg and Leu, respectively, the amino acid Phe with large side chains is also greatly improved, the oligosaccharide production amount is improved by 16.4%, the transglycosidation capacity of Pro and Trp is obviously reduced, the transglycosidation capacity is respectively reduced by 16.7% and 28.7%, thus, the mutation of S219 into other aromatic amino acid Phe with large side chains has a high transglycosidation capacity, and the substrate production capacity of galactoside-84 is a certain conservative site which has a high activity and a high activity in the central site of the existing galactoside-84.

TABLE 3 oligosaccharide production of different amino acid mutants of S219

Note: WT represents a wild enzyme.

Example 4: screening of F245 saturated mutant library and synthesis of oligosaccharide

The results of transglycosidic activity assay and sequencing show that all mutants have the situation of high or low oligosaccharide production (see figure 5), the production of partial mutant oligosaccharides is greatly reduced compared with that of wild enzyme, and the production of partial mutant oligosaccharides is about 30% higher than that of wild enzyme, so that the F245 site is also an important site related to the production of β -galactosidase oligosaccharides.

Specifically, the mutation at the F245 site resulted in the most significant increase in Arg post-oligosaccharide production, about 35%, followed by Lys and Gly, which increased by about 30% and 24.7%, respectively. After mutation into other amino acids such as Ser, Glu, Ala, Thr and Met, etc., the oligosaccharide yield is greatly improved (see figure 6).

Example 5: screening of E785 saturated mutant library and oligosaccharide synthesis

Compared with the wild type, the oligosaccharide synthesis amount of only a small amount of mutants in the E785 saturated mutant library is increased by not more than 20% (see figure 7). In the mutant with improved E785 mutant library oligosaccharide production, after Glu is mutated into Val, the yield is improved by 15 percent, and the yield of the rest most of mutant oligosaccharides is lower than that of the wild type or is not greatly different from that of the wild type enzyme.

Example 6 construction and screening of combinatorial mutant libraries

1. Materials and methods

(1) Strains and carriers

The initial mutant is a mutant E785V of β -galactosidase gene lacb' of Aspergillus candidus, which is linked to a pPIC9 expression vector and expressed in Pichia pastoris GS115, Escherichia coli Trans1-T1 competent cells are purchased from TransGen, and pPIC9 expression vector and Pichia pastoris GS115 are purchased from Invitrogen.

(2) Preparation of culture media and related solutions

For pichia pastoris transformation, culture and screening conventional media and reagents refer to the instructions of Invitrogen corporation.

PTM trace salts: 0.6% CuSO₄，0.008％NaI₂，0.3％MnSO₄，0.02％Na₂MoO₄，0.002％H₃BO₃，0.05％CoCl₂，2％ZnCl₂，6.5％FeSO₄0.5% sulfuric acid (v/v).

Yeast Fermentation Basal Salts Medium (FBSM): 0.5% KH₂PO₄，5％NH₄H₂PO₄，1.485％MgSO₄，1.82％K₂SO₄，0.093％CaSO₄0.15% KOH, 0.00011% Biotin, 0.44% PTM trace salt, 2% glucose.

Yeast fermentation basal salt induction medium (FBIM): 0.5% KH₂PO₄，5％NH₄H₂PO₄，1.485％MgSO₄，1.82％K₂SO₄，0.093％CaSO₄0.15% KOH, 0.00011% Biotin, 0.44% PTM trace salt, 0.5% methanol.

Na₂HPO₄Citrate buffer (0.1mol/L pH 5.2): 0.2mol/L disodium hydrogen phosphate 536ml and 0.1mol/L citric acid 464ml, and after mixing uniformly, the pH is adjusted to 5.2.

(3) Oligonucleotide primer for mutation

The specific primer sequences employed in the combinatorial mutations are shown in table 4.

TABLE 4 introduction tables used in combination mutagenesis

Note: bold font is the mutated base.

2. Construction of combinatorial mutant libraries

Based on the analysis of the saturated mutant library of different sites, two sites S219 and E785 are selected as sites for combined mutation, and the target mutant amino acid of each site is determined according to the sequencing result of the positive mutant of each site. . After determining mutation sites and target mutation amino acids, designing primers, and constructing a combined mutant library by a fractional mutation method, namely constructing a mutation plasmid of one site, and mutating the other site on the basis until the target mutation is completed. For the S219/E785 double-point combined mutation, mutation of the S219 locus is carried out by mutating an E785 single point and then using an E785 single point mutation plasmid.

The construction of the combined mutation recombinant plasmid is established on the basis of the single-point mutation, namely, the double-point mutant is obtained by taking the mixed plasmid with the single-point mutation as a template and continuously performing the PCR amplification and recombination technology.

The combined mutant recombinant plasmid was transformed into pichia pastoris GS115, expressed in pichia pastoris GS115, and β -galactosidase activity of the positive mutant was determined.

3. Screening of combinatorial mutant libraries

As shown in FIG. 8, most of the mutants in the S219/E785 double-point mutant library had higher oligosaccharide production than the wild type, more importantly, the GOS production rate of the partially combined mutant was significantly increased compared to the wild type, the time required for reaching the highest GOS yield was also significantly shortened, and the transglycosidic properties of the different mutants are shown in Table 5, respectively.

TABLE 5 transglycosidic Properties of the different mutants

As can be seen from the data in Table 5, the screened high transglycosidic mutant enzyme has a significantly increased oligosaccharide production rate in the same lactose substrate, i.e., the transglycosidic reaction rate is increased, and the S219G/E785V mutant is most significant. The yield of the oligosaccharide is extremely high when S219G/E785V reacts for 2 hours, most mutants reach the maximum oligosaccharide synthesis amount within 5-6 hours, namely the hydrolysis and transglycosylation reaction speed phase is balanced, the maximum oligosaccharide generation amount is reached only within 36 hours by the E785V mutant, the transglycosylation and hydrolysis balance phase is reached only within 48 hours by the wild enzyme, and the reaction period is very long. Most mutants increase the GOS yield while increasing the reaction rate, and the highest conversion rate such as S219V/E785V is increased by 16 percent from 23.3 percent to 27.1 percent. According to the calculation of the production rate of each mutant oligosaccharide by the yield of the oligosaccharide after reacting for 2h, except that the E785V mutant is improved by about 22 percent compared with the wild enzyme, the improvement amount of the other mutants is over 100 percent, wherein the improvement amount of the S219G/E785V mutant with the fastest reaction rate is about 211 percent and is more than 3 times of that of the wild enzyme.

Sequence listing

<110> institute of biotechnology of Chinese academy of agricultural sciences

<120> β -galactosidase combined mutant with high transglycosidic activity, and preparation method and application thereof

<160>24

<170>PatentIn version 3.3

<210>1

<211>2958

<212>DNA

<213> Artificial sequence

<400>1

tccatcaagc atcgtctcaa tggcttcacg atcctggaac atccggatcc ggcgaaaaga 60

gacttgctgc aagacattgt tacatgggat gacaaatctc tgttcatcaa tggagagagg 120

attatgttat tcagcggaga agtgcatcct ttcagattgc cagtaccttc gctttggctt 180

gatatcttcc acaagatcag agctcttggt ttcaactgtg tatctttcta tattgattgg 240

gctcttctgg agggaaagcc tggcgactac agagcagaag gcatctttgc tctggaaccc 300

ttcttcgatg cagccaagga agcaggcatt tatctgatcg cccgccccgg ttcgtacatc 360

aatgccgagg tctcaggcgg tggcttccct ggatggttgc agagggtcaa tggcactctt 420

cgctcgtctg atgagccatt ccttaaagct actgataact atatcgccaa tgccgctgct 480

gccgtggcga aggctcaaat cacgaatgga gggccagtaa ttctctacca gcccgaaaac 540

gaatacagcg gtggctgctg cggtgtcaaa taccccgatg cagactacat gcagtatgtt 600

atggatcagg cccggaaggc tgacattgtt gtacctttca tcagcaacga tgcctcacct 660

tctgggcaca atgctcctgg aagtggaacg ggcgctgttg atatttatgg tcacgatagc 720

tatccccttg gctttgattg cgcaaaccca tccgtatggc ccgagggtaa actgcccgac 780

aacttccgca cgctccatct tgagcagagc ccatcaactc cgtattcact tcttgagttc 840

caagcgggtg ctttcgaccc atggggtgga cccggctttg aaaaatgcta tgccctcgtt 900

aaccacgaat tctcgagagt tttctatagg aacgacttga gtttcggagt ttctaccttt 960

aacttataca tgactttcgg cggaacaaac tggggtaacc tcggacatcc cggtggatat 1020

acatcctacg actacggctc gcctataact gaaacgcgaa acgttacacg ggagaagtac 1080

agcgacataa agctccttgc caactttgtc aaagcatcgc catcctatct caccgctact 1140

cccagaaacc tgactactgg tgtttacaca gacacatctg acctggctgt caccccgtta 1200

atgggtgata gtccaggctc attcttcgtg gtcagacata cggactattc cagccaagag 1260

tcaacctcgt acaaacttaa gcttcctacc agtgctggta acctgactat tccccagctg 1320

gagggcactc taagtctcaa cggacgtgac tcaaaaattc atgttgttga ttataatgtg 1380

tctggaacga acattatcta ttcgacagct gaagtcttca cctggaagaa gtttgacggt 1440

aacaaggtcc tggtgttata cggcggaccg aaggaacacc atgaattggc cattgcctcc 1500

aagtcaaatg tgaccatcat cgaaggttcg gactctggaa ttgtctcaac gaggaagggc 1560

agctctgtta tcattggctg ggatgtctct tctactcgtc gcatcgttca agtcggtgac 1620

ttgagagtgt tcctgcttga tagaaactct gcttacaact actgggtccc cgaactcccc 1680

acagaaggta cttctcccgg gttcagcact tcgaagacga ccgcctcctc cattattgtg 1740

aaggccggct acctcctccg aggggctcac ctggatggtg ctgatcttca tcttactgct 1800

gatttcaatg ccaccacccc gattgaagtg atcggtgctc caacaggcgc caagaatctg 1860

ttcgtgaatg gtgaaaaggc tagccacaca gtcgacaaaa acggcatctg gagtagtgag 1920

gtcaagtacg cggctccaga gatcaagctc cccggtttga aggatttgga ctggaagtat 1980

ctggacacgc ttcccgaaat taagtcttcc tatgatgact cggcctgggt ttcggcagac 2040

cttccaaaga caaagaacac tcaccgtcct cttgacacac caacatcgct atactcctct 2100

gactatggct tccacactgg ctacctgatc tacaggggtc acttcgttgc caacggcaag 2160

gaaagcgaat tttttattcg cacacaaggc ggtagcgcat tcggaagttc cgtatggctg 2220

aacgagacgt atctgggctc ttggactggt gccgattatg cgatggacgg taactctacc 2280

tacaagctat ctcagctgga gtcgggcaag aattacgtca tcactgtggt tattgataac 2340

ctgggtctcg acgagaattg gacggtcggc gaggaaacca tgaagaatcc tcgtggtatt 2400

cttagctaca agctgagcgg acaagacgcc agcgcaatca cctggaagct cactggtaac 2460

ctcggaggag aagactacca ggataaggtt agaggacctc tcaacgaagg tggactgtac 2520

gcagagcgcc agggcttcca tcagcctcag cctccaagcg aatcctggga gtcgggcagt 2580

ccccttgaag gcctgtcgaa gccgggtatc ggattctaca ctgcccagtt cgaccttgac 2640

ctcccgaagg gctgggatgt gccgctgtac ttcaactttg gcaacaacac ccaggcggct 2700

cgggcccagc tctacgtcaa cggttaccag tatggcaagt tcactggaaa cgttgggcca 2760

cagaccagct tccctgttcc cgaagggatc ctgaactacc gcggaaccaa ctatgtggca 2820

ctgagtcttt gggcattgga gtcggacggt gctaagctgg gtagcttcga actgtcctac 2880

accaccccag tgctgaccgg atacggggat gttgagtcac ctgagcagcc caagtatgag 2940

cagcggaagg gagcatac 2958

<210>2

<211>986

<212>PRT

<213> Artificial sequence

<400>2

Ser Ile Lys His Arg Leu Asn Gly Phe Thr Ile Leu GluHis Pro Asp

1 5 10 15

Pro Ala Lys Arg Asp Leu Leu Gln Asp Ile Val Thr Trp Asp Asp Lys

20 25 30

Ser Leu Phe Ile Asn Gly Glu Arg Ile Met Leu Phe Ser Gly Glu Val

35 40 45

His Pro Phe Arg Leu Pro Val Pro Ser Leu Trp Leu Asp Ile Phe His

50 55 60

Lys Ile Arg Ala Leu Gly Phe Asn Cys Val Ser Phe Tyr Ile Asp Trp

65 70 75 80

Ala Leu Leu Glu Gly Lys Pro Gly Asp Tyr Arg Ala Glu Gly Ile Phe

85 90 95

Ala Leu Glu Pro Phe Phe Asp Ala Ala Lys Glu Ala Gly Ile Tyr Leu

100 105 110

Ile Ala Arg Pro Gly Ser Tyr Ile Asn Ala Glu Val Ser Gly Gly Gly

115 120 125

Phe Pro Gly Trp Leu Gln Arg Val Asn Gly Thr Leu Arg Ser Ser Asp

130 135 140

Glu Pro Phe Leu Lys Ala Thr Asp Asn Tyr Ile Ala Asn Ala Ala Ala

145 150 155 160

Ala Val Ala Lys Ala Gln Ile Thr Asn Gly Gly Pro Val Ile Leu Tyr

165 170 175

Gln Pro Glu Asn Glu Tyr Ser Gly Gly Cys Cys Gly Val Lys Tyr Pro

180 185 190

Asp Ala Asp Tyr Met Gln Tyr Val Met Asp Gln Ala Arg Lys Ala Asp

195 200 205

Ile Val Val Pro Phe Ile Ser Asn Asp Ala Ser Pro Ser Gly His Asn

210 215 220

Ala Pro Gly Ser Gly Thr Gly Ala Val Asp Ile Tyr Gly His Asp Ser

225 230 235 240

Tyr Pro Leu Gly Phe Asp Cys Ala Asn Pro Ser Val Trp Pro Glu Gly

245 250 255

Lys Leu Pro Asp Asn Phe Arg Thr Leu His Leu Glu Gln Ser Pro Ser

260 265 270

Thr Pro Tyr Ser Leu Leu Glu Phe Gln Ala Gly Ala Phe Asp Pro Trp

275 280 285

Gly Gly Pro Gly Phe Glu Lys Cys Tyr Ala Leu Val Asn His Glu Phe

290 295 300

Ser Arg Val Phe Tyr Arg Asn Asp Leu Ser Phe Gly Val Ser Thr Phe

305 310 315 320

Asn Leu Tyr Met Thr Phe Gly Gly Thr Asn Trp Gly Asn Leu Gly His

325 330 335

Pro Gly Gly Tyr Thr Ser Tyr Asp Tyr Gly Ser Pro Ile Thr Glu Thr

340 345 350

Arg Asn Val Thr Arg Glu Lys Tyr Ser Asp Ile Lys Leu Leu Ala Asn

355 360 365

Phe Val Lys Ala Ser Pro Ser Tyr Leu Thr Ala Thr Pro Arg Asn Leu

370 375 380

Thr Thr Gly Val Tyr Thr Asp Thr Ser Asp Leu Ala Val Thr Pro Leu

385 390 395 400

Met Gly Asp Ser Pro Gly Ser Phe Phe Val Val Arg His Thr Asp Tyr

405 410 415

Ser Ser Gln Glu Ser Thr Ser Tyr Lys Leu Lys Leu Pro Thr Ser Ala

420 425 430

Gly Asn Leu Thr Ile Pro Gln Leu Glu Gly Thr Leu Ser Leu Asn Gly

435 440 445

Arg Asp Ser Lys Ile His Val Val Asp Tyr Asn Val Ser Gly Thr Asn

450 455 460

Ile Ile Tyr Ser Thr Ala Glu Val Phe Thr Trp Lys Lys Phe Asp Gly

465 470 475 480

Asn Lys Val Leu Val Leu Tyr Gly Gly Pro Lys Glu His His Glu Leu

485 490 495

Ala Ile Ala Ser Lys Ser Asn Val Thr Ile Ile Glu Gly Ser Asp Ser

500 505 510

Gly Ile Val Ser Thr Arg Lys Gly Ser Ser Val Ile Ile Gly Trp Asp

515 520 525

Val Ser Ser Thr Arg Arg Ile Val Gln Val Gly Asp Leu Arg Val Phe

530 535 540

Leu Leu Asp Arg Asn Ser Ala Tyr Asn Tyr Trp Val Pro Glu Leu Pro

545 550 555 560

Thr Glu Gly Thr Ser Pro Gly Phe Ser Thr Ser Lys Thr Thr Ala Ser

565 570 575

Ser Ile Ile Val Lys Ala Gly Tyr Leu Leu Arg Gly Ala His Leu Asp

580 585 590

Gly Ala Asp Leu His Leu Thr Ala Asp Phe Asn Ala Thr Thr Pro Ile

595 600 605

Glu Val Ile Gly Ala Pro Thr Gly Ala Lys Asn Leu Phe Val Asn Gly

610 615 620

Glu Lys Ala Ser His Thr Val Asp Lys Asn Gly Ile Trp Ser Ser Glu

625 630 635 640

Val Lys Tyr Ala Ala Pro Glu Ile Lys Leu Pro Gly Leu Lys Asp Leu

645 650 655

Asp Trp Lys Tyr Leu Asp Thr Leu Pro Glu Ile Lys Ser Ser Tyr Asp

660 665 670

Asp Ser Ala Trp Val Ser Ala Asp Leu Pro Lys Thr Lys Asn Thr His

675 680 685

Arg Pro Leu Asp Thr Pro Thr Ser Leu Tyr Ser Ser Asp Tyr Gly Phe

690 695 700

His Thr Gly Tyr Leu Ile Tyr Arg Gly His Phe Val Ala Asn Gly Lys

705 710 715 720

Glu Ser Glu Phe Phe Ile Arg Thr Gln Gly Gly Ser Ala Phe Gly Ser

725 730 735

Ser Val Trp Leu Asn Glu Thr Tyr Leu Gly Ser Trp Thr Gly Ala Asp

740 745 750

Tyr Ala Met Asp Gly Asn Ser Thr Tyr Lys Leu Ser Gln Leu Glu Ser

755 760 765

Gly Lys Asn Tyr Val Ile Thr Val Val Ile Asp Asn Leu Gly Leu Asp

770 775 780

Glu Asn Trp Thr Val Gly Glu Glu Thr Met Lys Asn Pro Arg Gly Ile

785 790 795 800

Leu Ser Tyr Lys Leu Ser Gly Gln Asp Ala Ser Ala Ile Thr Trp Lys

805 810 815

Leu Thr Gly Asn Leu Gly Gly Glu Asp Tyr Gln Asp Lys Val Arg Gly

820 825 830

Pro Leu Asn Glu Gly Gly Leu Tyr Ala Glu Arg Gln Gly Phe His Gln

835 840 845

Pro Gln Pro Pro Ser Glu Ser Trp Glu Ser Gly Ser Pro Leu Glu Gly

850 855 860

Leu Ser Lys Pro Gly Ile Gly Phe Tyr Thr Ala Gln Phe Asp Leu Asp

865 870 875 880

Leu Pro Lys Gly Trp Asp Val Pro Leu Tyr Phe Asn Phe Gly Asn Asn

885 890 895

Thr Gln Ala Ala Arg Ala Gln Leu Tyr Val Asn Gly Tyr Gln Tyr Gly

900 905 910

Lys Phe Thr Gly Asn Val Gly Pro Gln Thr Ser Phe Pro Val Pro Glu

915 920 925

Gly Ile Leu Asn Tyr Arg Gly Thr Asn Tyr Val Ala Leu Ser Leu Trp

930 935 940

Ala Leu Glu Ser Asp Gly Ala Lys Leu Gly Ser Phe Glu Leu Ser Tyr

945 950 955 960

Thr Thr Pro Val Leu Thr Gly Tyr Gly Asp Val Glu Ser Pro Glu Gln

965 970 975

Pro Lys Tyr Glu Gln Arg Lys Gly Ala Tyr

980 985

<210>3

<211>2958

<212>DNA

<213> Artificial sequence

<400>3

tccatcaagc atcgtctcaa tggcttcacg atcctggaac atccggatcc ggcgaaaaga 60

gacttgctgc aagacattgt tacatgggat gacaaatctc tgttcatcaa tggagagagg 120

attatgttat tcagcggaga agtgcatcct ttcagattgc cagtaccttc gctttggctt 180

gatatcttcc acaagatcag agctcttggt ttcaactgtg tatctttcta tattgattgg 240

gctcttctgg agggaaagcc tggcgactac agagcagaag gcatctttgc tctggaaccc 300

ttctttgatg cagccaagga agcaggcatt tatctgatcg cccgccccgg ttcgtacatc 360

aatgccgagg tctcaggcgg tggcttccct ggatggttgc agagggtcaa tggcactctt 420

cgctcgtctg atgagccatt ccttaaagct actgataact atatcgccaa tgccgctgct 480

gccgtggcga aggctcaaat cacgaatgga gggccagtaa ttctctacca gcccgaaaac 540

gaatacagcg gtggctgctg cggtgtcaaa taccccgatg cagactacat gcagtatgtt 600

atggatcagg cccggaaggc tgacattgtt gtacctttca tcagcaacga tgcctcacct 660

tctgggcaca atgctcctgg aagtggaacg agcgctgttg atatttatgg tcacgatagc 720

tatcccctcg gctttgattg cgcaaaccca tccgtatggc ccgagggtaa actgcccgac 780

aacttccgca cgctccatct tgagcagagcccatcaactc cgtattcact tcttgagttc 840

caagcgggtg ctttcgaccc atggggtgga cccggctttg aaaaatgcta tgccctcgtt 900

aaccacgaat tctcgagagt tttctatagg aacgacttga gtttcggagt ttctaccttt 960

aacttataca tgactttcgg cggaacaaac tggggtaacc tcggacatcc cggtggatat 1020

acatcctacg actacggatc gcctataact gaaacgcgaa acgttacgcg ggagaagtac 1080

agcgacataa agctccttgc caactttgtc aaagcatcgc catcctatct caccgctact 1140

cccagaaacc tgactactgg tgtttacaca gacacatctg acctggctgt caccccgtta 1200

attggtgata gtccaggctc attcttcgtg gtcagacata cggactattc cagccaagag 1260

tcaacctcgt acaaacttaa gcttcctacc agtgctggta acctgactat tccccagctg 1320

gagggcactc taagtctcaa cggacgtgac tcaaaaattc atgttgttga ttataatgtg 1380

tctggaacga acattatcta ttcgacagct gaagtcttca cctggaagaa gtttgacggt 1440

aacaaggtcc tggtgttata cggcggaccg aaggaacacc atgaattggc cattgcctcc 1500

aagtcaaatg tgaccatcat cgaaggttcg gactctggaa ttgtctcaac gaggaagggc 1560

agctctgtta tcattggctg ggatgtctct tctactcgtc gcatcgttca agtcggtgac 1620

ttgagagtgt tcctgcttga taggaactct gcttacaact actgggtccc cgaactcccc 1680

acagaaggta cttctcccgg gttcagcact tcgaagacga ccgcctcctc cattattgtg 1740

aaggctggct acctcctccg aggcgctcac cttgatggtg ctgatcttca tcttactgct 1800

gatttcaatg ccaccacccc gattgaagtg atcggtgctc caacaggcgc taagaatctg 1860

ttcgtgaatg gtgaaaaggc tagccacaca gtcgacaaga acggcatctg gagcagtgag 1920

gtcaagtacg cggctccaga gatcaagctc cccggtttga aggatttgga ctggaagtat 1980

ctggacacgc ttcccgaaat taagtcttcc tatgatgact cggcctgggt ttcggcagac 2040

cttccaaaga caaagaacac tcaccgtcct cttgacacac caacatcgct atactcctct 2100

gactatggct tccacactgg ctacctgatc tacaggggtc acttcgttgc caacggcaag 2160

gaaagcgaat tttttattcg cacacaaggc ggtagcgcat tcggaagttc cgtatggctg 2220

aacgagacgt atctgggctc ttggactggt gccgattatg cgatggacgg taactctacc 2280

tacaagctat ctcagctgga gtcgggcaag aattacgtca tcactgtggt tattgataac 2340

ctgggtctcg acgagaattg gacggtcggc gaggaaacca tgaagaatcc tcgtggtatt 2400

cttagctaca agctgagcgg acaagacgcc agcgcaatca cctggaagct cactggtaac 2460

ctcggaggag aagactacca ggataaggtt agaggacctc tcaacgaagg tggactgtac 2520

gcagagcgcc agggcttcca tcagcctcag cctccaagcg aatcctggga gtcgggcagt 2580

ccccttgaag gcctgtcgaa gccgggtatc ggattctaca ctgcccagtt cgaccttgac 2640

ctcccgaagg gctgggatgt gccgctgtac ttcaactttg gcaacaacac ccaggcggct 2700

cgggcccagc tctacgtcaa cggttaccag tatggcaagt tcactggaaa cgttgggcca 2760

cagaccagct tccctgttcc cgaaggtatc ctgaactacc gcggaaccaa ctatgtggca 2820

ctgagtcttt gggcattgga gtcggacggt gctaagctgg gtagcttcga actgtcctac 2880

accaccccag tgctgaccgg atacgggaat gttgagtcac ctgagcagcc caagtatgag 2940

cagcggaagg gagcatac 2958

<210>4

<211>986

<212>PRT

<213> Artificial sequence

<400>4

Ser Ile Lys His Arg Leu Asn Gly Phe Thr Ile Leu Glu His Pro Asp

1 5 10 15

Pro Ala Lys Arg Asp Leu Leu Gln Asp Ile Val Thr Trp Asp Asp Lys

20 25 30

Ser Leu Phe Ile Asn Gly Glu Arg Ile Met Leu Phe Ser Gly Glu Val

35 40 45

His Pro Phe Arg Leu Pro Val Pro Ser Leu Trp Leu Asp Ile Phe His

50 55 60

Lys Ile Arg Ala Leu Gly Phe Asn Cys Val Ser Phe Tyr Ile Asp Trp

65 70 75 80

Ala Leu Leu Glu Gly Lys Pro Gly Asp Tyr Arg Ala Glu Gly Ile Phe

85 90 95

Ala Leu Glu Pro Phe Phe Asp Ala Ala Lys Glu Ala Gly Ile Tyr Leu

100 105 110

Ile Ala Arg Pro Gly Ser Tyr Ile Asn Ala Glu Val Ser Gly Gly Gly

115 120 125

Phe Pro Gly Trp Leu Gln Arg Val Asn Gly Thr Leu Arg Ser Ser Asp

130135 140

Glu Pro Phe Leu Lys Ala Thr Asp Asn Tyr Ile Ala Asn Ala Ala Ala

145 150 155 160

Ala Val Ala Lys Ala Gln Ile Thr Asn Gly Gly Pro Val Ile Leu Tyr

165 170 175

Gln Pro Glu Asn Glu Tyr Ser Gly Gly Cys Cys Gly Val Lys Tyr Pro

180 185 190

Asp Ala Asp Tyr Met Gln Tyr Val Met Asp Gln Ala Arg Lys Ala Asp

195 200 205

Ile Val Val Pro Phe Ile Ser Asn Asp Ala Ser Pro Ser Gly His Asn

210 215 220

Ala Pro Gly Ser Gly Thr Ser Ala Val Asp Ile Tyr Gly His Asp Ser

225 230 235 240

Tyr Pro Leu Gly Phe Asp Cys Ala Asn Pro Ser Val Trp Pro Glu Gly

245 250 255

Lys Leu Pro Asp Asn Phe Arg Thr Leu His Leu Glu Gln Ser Pro Ser

260 265 270

Thr Pro Tyr Ser Leu Leu Glu Phe Gln Ala Gly Ala Phe Asp Pro Trp

275 280 285

Gly Gly Pro Gly Phe Glu Lys Cys Tyr Ala Leu Val Asn His Glu Phe

290 295 300

Ser Arg Val Phe Tyr Arg Asn Asp Leu Ser Phe Gly Val Ser Thr Phe

305 310 315 320

Asn Leu Tyr Met Thr Phe Gly Gly Thr Asn Trp Gly Asn Leu Gly His

325 330 335

Pro Gly Gly Tyr Thr Ser Tyr Asp Tyr Gly Ser Pro Ile Thr Glu Thr

340 345 350

Arg Asn Val Thr Arg Glu Lys Tyr Ser Asp Ile Lys Leu Leu Ala Asn

355 360 365

Phe Val Lys Ala Ser Pro Ser Tyr Leu Thr Ala Thr Pro Arg Asn Leu

370 375 380

Thr Thr Gly Val Tyr Thr Asp Thr Ser Asp Leu Ala Val Thr Pro Leu

385 390 395 400

Ile Gly Asp Ser Pro Gly Ser Phe Phe Val Val Arg His Thr Asp Tyr

405 410 415

Ser Ser Gln Glu Ser Thr Ser Tyr Lys Leu Lys Leu Pro Thr Ser Ala

420 425 430

Gly Asn Leu Thr Ile Pro Gln Leu Glu Gly Thr Leu Ser Leu Asn Gly

435 440 445

Arg Asp Ser Lys Ile His Val Val Asp Tyr Asn Val Ser Gly Thr Asn

450 455460

Ile Ile Tyr Ser Thr Ala Glu Val Phe Thr Trp Lys Lys Phe Asp Gly

465 470 475 480

Asn Lys Val Leu Val Leu Tyr Gly Gly Pro Lys Glu His His Glu Leu

485 490 495

Ala Ile Ala Ser Lys Ser Asn Val Thr Ile Ile Glu Gly Ser Asp Ser

500 505 510

Gly Ile Val Ser Thr Arg Lys Gly Ser Ser Val Ile Ile Gly Trp Asp

515 520 525

Val Ser Ser Thr Arg Arg Ile Val Gln Val Gly Asp Leu Arg Val Phe

530 535 540

Leu Leu Asp Arg Asn Ser Ala Tyr Asn Tyr Trp Val Pro Glu Leu Pro

545 550 555 560

Thr Glu Gly Thr Ser Pro Gly Phe Ser Thr Ser Lys Thr Thr Ala Ser

565 570 575

Ser Ile Ile Val Lys Ala Gly Tyr Leu Leu Arg Gly Ala His Leu Asp

580 585 590

Gly Ala Asp Leu His Leu Thr Ala Asp Phe Asn Ala Thr Thr Pro Ile

595 600 605

Glu Val Ile Gly Ala Pro Thr Gly Ala Lys Asn Leu Phe Val Asn Gly

610 615620

Glu Lys Ala Ser His Thr Val Asp Lys Asn Gly Ile Trp Ser Ser Glu

625 630 635 640

Val Lys Tyr Ala Ala Pro Glu Ile Lys Leu Pro Gly Leu Lys Asp Leu

645 650 655

Asp Trp Lys Tyr Leu Asp Thr Leu Pro Glu Ile Lys Ser Ser Tyr Asp

660 665 670

Asp Ser Ala Trp Val Ser Ala Asp Leu Pro Lys Thr Lys Asn Thr His

675 680 685

Arg Pro Leu Asp Thr Pro Thr Ser Leu Tyr Ser Ser Asp Tyr Gly Phe

690 695 700

His Thr Gly Tyr Leu Ile Tyr Arg Gly His Phe Val Ala Asn Gly Lys

705 710 715 720

Glu Ser Glu Phe Phe Ile Arg Thr Gln Gly Gly Ser Ala Phe Gly Ser

725 730 735

Ser Val Trp Leu Asn Glu Thr Tyr Leu Gly Ser Trp Thr Gly Ala Asp

740 745 750

Tyr Ala Met Asp Gly Asn Ser Thr Tyr Lys Leu Ser Gln Leu Glu Ser

755 760 765

Gly Lys Asn Tyr Val Ile Thr Val Val Ile Asp Asn Leu Gly Leu Asp

770 775 780

Glu Asn Trp Thr Val Gly Glu Glu Thr Met Lys Asn Pro Arg Gly Ile

785 790 795 800

Leu Ser Tyr Lys Leu Ser Gly Gln Asp Ala Ser Ala Ile Thr Trp Lys

805 810 815

Leu Thr Gly Asn Leu Gly Gly Glu Asp Tyr Gln Asp Lys Val Arg Gly

820 825 830

Pro Leu Asn Glu Gly Gly Leu Tyr Ala Glu Arg Gln Gly Phe His Gln

835 840 845

Pro Gln Pro Pro Ser Glu Ser Trp Glu Ser Gly Ser Pro Leu Glu Gly

850 855 860

Leu Ser Lys Pro Gly Ile Gly Phe Tyr Thr Ala Gln Phe Asp Leu Asp

865 870 875 880

Leu Pro Lys Gly Trp Asp Val Pro Leu Tyr Phe Asn Phe Gly Asn Asn

885 890 895

Thr Gln Ala Ala Arg Ala Gln Leu Tyr Val Asn Gly Tyr Gln Tyr Gly

900 905 910

Lys Phe Thr Gly Asn Val Gly Pro Gln Thr Ser Phe Pro Val Pro Glu

915 920 925

Gly Ile Leu Asn Tyr Arg Gly Thr Asn Tyr Val Ala Leu Ser Leu Trp

930 935 940

Ala Leu Glu Ser Asp Gly Ala Lys Leu Gly Ser Phe Glu Leu Ser Tyr

945 950 955 960

Thr Thr Pro Val Leu Thr Gly Tyr Gly Asn Val Glu Ser Pro Glu Gln

965 970 975

Pro Lys Tyr Glu Gln Arg Lys Gly Ala Tyr

980 985

<210>5

<211>32

<212>DNA

<213> Artificial sequence

<400>5

cgcgaggcag agatcttgag ataaatttca cg 32

<210>6

<211>33

<212>DNA

<213> Artificial sequence

<400>6

acgtgaaatt tatctcaaga tctctgcctc gcg 33

<210>7

<211>40

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<222>(29)..(30)

<223>n is a, c, g, or t

<400>7

acttccagga gcattgtgcc cagaaggmnn ggcatcgttg 40

<210>8

<211>31

<212>DNA

<213> Artificial sequence

<400>8

ttctgggcac aatgctcctg gaagtggaac g 31

<210>9

<211>36

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<222>(29)..(30)

<223>n is a, c, g, or t

<400>9

tgcgcaatca aagccaaggg gatagctmnn gtgacc 36

<210>10

<211>27

<212>DNA

<213> Artificial sequence

<400>10

tccccttggc tttgattgcg caaaccc 27

<210>11

<211>36

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<222>(26)..(27)

<223>n is a, c, g, or t

<400>11

tgcgcaatca aagccaaggg gatamnnatc gtgacc 36

<210>12

<211>32

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<222>(25)..(26)

<223>n is a, c, g, or t

<400>12

tttgcgcaat caaagccaag gggmnngcta tc 32

<210>13

<211>30

<212>DNA

<213> Artificial sequence

<400>13

tggctttgat tgcgcaaacc catccgtatg 30

<210>14

<211>31

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<222>(24)..(25)

<223>n is a, c, g, or t

<400>14

atacggatgg gtttgcgcaa tcmnngccaa g 31

<210>15

<211>24

<212>DNA

<213> Artificial sequence

<400>15

tgcgcaaacc catccgtatg gccc 24

<210>16

<211>29

<212>DNA

<213> Artificial sequence

<400>16

tttcctcgcc gaccgtccaa ttaacgtcg 29

<210>17

<211>27

<212>DNA

<213> Artificial sequence

<400>17

tggacggtcg gcgaggaaac catgaag 27

<210>18

<211>32

<212>DNA

<213> Artificial sequence

<400>18

cgcgaggcag agatcttgag ataaatttca cg 32

<210>19

<211>33

<212>DNA

<213> Artificial sequence

<400>19

acgtgaaatt tatctcaaga tctctgcctc gcg 33

<210>20

<211>40

<212>DNA

<213> Artificial sequence

<400>20

acttccagga gcattgtgcc cagaaggaak ggcatcgttg 40

<210>21

<211>40

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<222>(29)

<223>n is a, c, g, or t

<400>21

acttccagga gcattgtgcc cagaaggmnc ggcatcgttg 40

<210>22

<211>31

<212>DNA

<213> Artificial sequence

<400>22

ttctgggcac aatgctcctg gaagtggaac g 31

<210>23

<211>29

<212>DNA

<213> Artificial sequence

<400>23

tttcctcgcc gaccgtccaa ttaacgtcg 29

<210>24

<211>27

<212>DNA

<213> Artificial sequence

<400>24

tggacggtcg gcgaggaaac catgaag 27

Claims (9)

1. An β -galactosidase combinatorial mutant having high transglycosidic activity, which is obtained by site-directed mutation of two sites based on the amino acid sequence of Aspergillus leucatus or Aspergillus oryzae β -galactosidase shown in SEQ ID NO. 2 or SEQ ID NO. 4, wherein the site-directed mutation of two sites is a substitution of a valine residue for the serine residue at position 219 (S219V) and a valine residue for the glutamic acid residue at position 785 (E785V).

2. A DNA molecule encoding the combinatorial mutant of claim 1.

3. A recombinant expression vector comprising the DNA molecule of claim 2.

4. The recombinant expression vector of claim 3, which is a recombinant yeast expression vector.

5. A host cell expressing the DNA molecule of claim 2.

6. The host cell of claim 5, selected from the group consisting of Saccharomyces, Kluyveromyces, Schizosaccharomyces, and methylotrophic yeast strains.

7. The host cell of claim 6, wherein the methylotrophic yeast strain is a Pichia strain.

8. A method for preparing β -galactosidase with high transglycosidic activity, comprising the steps of:

1) transforming a host cell with the recombinant expression vector of claim 3 or 4 to obtain a recombinant strain;

2) culturing the recombinant strain, and inducing the expression of recombinant β -galactosidase;

3) recovering and purifying the expressed β -galactosidase with high transglycosidic activity.

9. Use of the combinatorial mutant of claim 1, the DNA molecule of claim 2, the recombinant expression vector of claim 3 or 4, the host cell of any one of claims 5 to 7 for the preparation of β -galactosidase.

Images