CN110804602A

CN110804602A - L-aspartic acid β -decarboxylase mutant and application thereof

Info

Publication number: CN110804602A
Application number: CN201911127316.6A
Authority: CN
Inventors: 周哲敏; 刘中美; 于佳印; 赵庭; 周丽; 崔文璟; 郭军玲
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2019-11-18
Filing date: 2019-11-18
Publication date: 2020-02-18
Anticipated expiration: 2039-11-18
Also published as: CN110804602B

Abstract

The invention discloses an L-aspartic acid β -decarboxylase mutant and application thereof, belonging to the technical field of biological engineering.A catalytic enzyme activity of L-aspartic acid β -decarboxylase mutants N35D and A179E provided by the invention is respectively improved by 238 percent and 244 percent under the condition of pH 7.0, enzyme activity of 12h processed under the condition of pH 4.5 is respectively remained 83.9 percent and 85.5 percent, and compared with the residual enzyme activity of a contrast wild enzyme, the stability of mutant acid is obviously improved, therefore, the L-aspartic acid β -decarboxylase mutants N35D and A179E provided by the invention have better enzymological properties.

Description

L-aspartic acid β -decarboxylase mutant and application thereof

Technical Field

The invention relates to an L-aspartic acid β -decarboxylase mutant and application thereof, belonging to the technical field of biological engineering.

Background

L-alanine is an amino acid with important value, and has wide application in daily chemical industry, food industry and pharmaceutical industry. In the field of daily chemicals, L-alanine is a raw material for synthesizing amino acid surfactants; in the field of food, L-alanine has sweet taste, can be prepared into mixed seasonings with sodium glutamate, can modulate and obviously improve the flavor of food without damaging the original flavor of the food; in the field of medicine, L-alanine is the main raw material for synthesizing vitamin B6 and L-aminopropanol (levofloxacin hydrochloride synthesis precursor); meanwhile, the L-alanine is the main component of the compound amino acid injection and transfusion and is also the cardiac muscle function enhancer.

In the chemical synthesis production, a propionic acid chlorination method is a common idea for synthesizing L-alanine, but the method has the defects of poor product quality, long synthesis route, low yield, high cost, serious environmental pollution and the like, and is basically eliminated at present. The preparation of L-alanine by means of bio-enzyme catalysis and fermentation has become the main method for industrial production.

The current biosynthesis methods for preparing L-alanine are mainly two, one is to optimize metabolic pathways, knock out secondary metabolite coding genes and L-alanine consumption bypass genes to obtain L-alanine producing strains, synthesize L-alanine in the process of culturing microorganisms, Zhou Li et al use wild type Escherichia coli as a starting strain, knock out metabolite synthesis pathway coding genes and alanine racemase coding genes, transfer L-alanine dehydrogenase genes into defective strains to obtain target strains, the strains ferment to produce L-alanine with the yield of 67.2g/L at the shake flask level (citation: Zhou Li, Deng, Trauda 26299Liuzhou, Zhou Zhen min. temperature regulation gene switch regulates the fermentation of Escherichia coli to synthesize L-alanine [ J ] most microbiological report, 2015 too long, 42(11): 10.). the method is a biological enzyme method, namely, the method is a biological decarboxylation method by expressing L-aspartate β -decarboxylase, uses L-aspartate as a substrate, and removes β -carboxyl to generate L-alanine coding gene, the L-alanine-decarboxylase has a low enzyme activity ratio in Pseudomonas aeruginosa strain, Pseudomonas sp.12, Pseudomonas aeruginosa strain, etc. (No. 12. Sjohniki.7. A. a strain is produced by expressing L-A. a strain with a high-A. a low enzyme with a low enzyme catalyzing enzyme activity of Escherichia coli catalyzing enzyme with a low enzyme activity of Escherichia coli catalyzing enzyme activity of Escherichia coli strain with a low enzyme activity of Escherichia coli strain, a low enzyme activity.

Therefore, the method for producing L-alanine with high yield, the L-aspartate β -decarboxylase with higher enzyme activity and higher acid stability, and the method has important significance for producing L-alanine by industrial application.

Disclosure of Invention

In order to solve the problems, the invention constructs two mutants N35D and A179E with improved acid stability by mutating a gene encoding L-aspartic acid β -decarboxylase derived from Acinetobacter radiodurans (Acinetobacter radiodurans).

The first purpose of the invention is to provide an L-aspartate β -decarboxylase mutant, wherein the L-aspartate β -decarboxylase contains an amino acid sequence shown in SEQ ID NO.1 or SEQ ID NO. 2.

The second purpose of the invention is to provide a gene for coding the L-aspartic acid β -decarboxylase mutant, and the nucleotide sequence of the gene is shown as SEQ ID NO.3 or SEQ ID NO. 4.

The third object of the present invention is to provide a vector containing the above gene.

It is a fourth object of the invention to provide a cell expressing said mutant L-aspartate β -decarboxylase.

The fifth purpose of the invention is to provide a genetically engineered bacterium, which takes escherichia coli as a host and expresses the L-aspartic acid β -decarboxylase mutant.

In one embodiment of the invention, the genetically engineered bacterium takes escherichia coli BL21 as a host.

In one embodiment of the invention, the genetically engineered bacterium uses pET series plasmids as vectors.

In one embodiment of the invention, the vector is pET28 a.

The sixth purpose of the invention is to provide a method for preparing L-aspartate β -decarboxylase, which comprises the steps of inoculating the genetic engineering bacteria expressing the L-aspartate β -decarboxylase mutant into LB culture medium, and culturing at 35-37 ℃ to OD₆₀₀When the temperature is 0.6-0.8 ℃, adding an inducer IPTG to induce for 15-25h at 20-30 ℃.

The invention also provides the L-aspartic acid β -decarboxylase mutant and application of the genetic engineering bacteria in preparing products containing L-alanine.

The invention has the beneficial effects that:

firstly, the L-aspartate β -decarboxylase mutant N35D (the amino acid sequence is shown as SEQ ID NO.1, the nucleotide sequence for coding the mutant is shown as SEQ ID NO. 3) and A179E (the amino acid sequence is shown as SEQ ID NO.2, the nucleotide sequence for coding the mutant is shown as SEQ ID NO. 4) respectively improve the catalytic enzyme activity under the condition of pH 7.0 by 238 percent and 244 percent, respectively, the residual enzyme activity after 12 hours of treatment under the condition of pH 4.5 is respectively 83.9 percent and 85.5 percent, compared with the residual enzyme activity of a contrast wild type enzyme is 24.8 percent, the stability of the mutant acid is obviously improved, the residual enzyme activity after 3 hours of treatment at 50 ℃ is respectively 76.7 percent and 51.3 percent, compared with the residual enzyme activity after 30 minutes of treatment at 50 ℃ of the contrast enzyme mutant, the thermal stability is reduced a little, therefore, the L-aspartate β -decarboxylase mutant N35D and A179E have better enzymatic properties, and are beneficial to the production of β -alanine by a biological method.

Secondly, the recombinant Escherichia coli expressing the L-aspartic acid β -decarboxylase mutant is constructed to obtain L-aspartic acid β -decarboxylase strains N35D and A179E with high enzyme activity under the condition of pH 7.0, the pure enzyme specific activity of the strains reaches 793U/mg and 765U/mg, the recombinant bacteria are subjected to shake flask fermentation, L-sodium aspartate is used as a substrate, a whole-cell catalytic reaction is carried out to prepare the L-alanine, and the yield of the L-alanine reaches 26.7 g/L.

Drawings

FIG. 1: SDS-PAGE electrophoresis images of wild ArASD and mutant pure enzymes, wherein M is a protein molecular weight standard, and 1 is a wild purified protein; 2 is N35D purified protein; 3 is the protein purified by A179E.

FIG. 2: treating the enzyme activity residue of 12h under the conditions of the enzyme activity at the pH of 7.0 and the pH of 4.5.

FIG. 3: thermal stability profile of the enzyme after 3h incubation at 50 ℃.

FIG. 4: the catalytic effect of the wild strain added with high-concentration substrate at one time under the condition of pH 4.5 is shown.

FIG. 5: and (3) a catalytic effect graph of the mutant strain added with high-concentration substrate at one time under the condition of pH 4.5.

FIG. 6: and (3) a catalytic effect graph of the mutant strain added with high-concentration substrate at one time under the condition of pH 7.0.

Detailed Description

Method for determining enzyme activity of L-aspartic acid β -decarboxylase

The method for measuring the enzyme activity of the fermentation liquor comprises the following steps: taking 100 mu L of the fermented recombinant Escherichia coli cells, adding 100 mu L of 1mol/L L-sodium aspartate solution, adding 800 mu L of phosphate buffer solution with pH 4.5, reacting at 37 ℃ for 30min, and inactivating at 100 ℃ for 10 min. Centrifuging at 12000rpm for 2min, and collecting supernatant to derive and detect the yield of L-alanine. The reaction mixture was filtered through a 0.22 μm microporous membrane and loaded onto a C18 column for HPLC analysis.

The method for determining the enzyme activity of the L-aspartic acid β -decarboxylase comprises the steps of adding a proper amount of enzyme liquid into a 1.5mL centrifuge tube, adding 40mmol/L L-sodium aspartate in final concentration and 0.5mmol/L PLP in final concentration, reacting for 30min at 37 ℃ and pH 4.5, and detecting the enzyme activity.

(II) culture Medium

LB medium (g/L): 10.0 parts of peptone, 5.0 parts of yeast powder and 10.0 parts of NaCl.

2YT medium (g/L): peptone 16.0, yeast powder 10.0 and NaCl 5.0.

(III) HPLC (high Performance liquid chromatography) method for detecting contents of sodium L-aspartate and L-alanine

The reaction solution is derived by using benzene isothiocyanate (PITC), and the specific steps are as follows: adding 500 mu L of reaction solution into a 2.0mL centrifuge tube, adding 250 mu L of 0.1mol/L PITC-acetonitrile solution and 250 mu L of 1mol/L triethylamine-acetonitrile solution, fully and uniformly mixing, standing at room temperature in a dark place for 1.0h, adding 750 mu L of n-hexane solution to terminate derivatization, oscillating for 1min by a vortex oscillator, standing for 30-60min, absorbing the lower layer solution, filtering by a 0.22 mu m organic filter membrane, and then injecting a sample, wherein the sample injection amount is 10 mu L.

The derivatized product was determined by HPLC: the column was La Chrom C18(5 μm, 4.6X 250 mm); the mobile phase A solution is 80 percent (V/V) acetonitrile water solution, and the B solution is 97:3(V/V, pH 6.5) 0.1mol/L sodium acetate-acetonitrile solution; gradient elution was used: the solution B is reduced from 95% to 65% in 0-20 min; after 20-30min, the liquid B is increased from 65% to 95%; 30-35min, and the gradient of the solution B is unchanged. The detection wavelength was 254nm and the column temperature was 40 ℃.

(IV) measurement of temperature stability

Wild-type enzyme was used as a control. Placing the wild enzyme and the mutant enzyme in a phosphate buffer solution with the pH value of 7.0, and respectively incubating at 50 ℃ for 3h, and then determining the residual enzyme activity to obtain a temperature stability result.

(V) determination of pH stability

Wild-type enzyme was used as a control. Placing the wild enzyme and the mutant enzyme in a phosphate buffer solution with the pH value of 4.5, and measuring the residual enzyme activity after placing for 12 hours at the temperature of 0 ℃ to obtain a stability result under the condition of the pH value of 4.5. Placing the wild enzyme and the mutant enzyme in a phosphate buffer solution with the pH value of 7.0, and measuring the residual enzyme activity after placing for 12 hours at the temperature of 0 ℃ to obtain a stability result under the condition of the pH value of 7.0.

Example 1 construction of recombinant E.coli

Asd gene sequence (1415236 to 1416837 of the gene with NCBI accession number AP 019740.1) was artificially synthesized, and specific primers P1 and P2 (the underlined parts are EcoRI and Xho I restriction enzyme cutting sites, respectively) were designed.

TABLE 1 primer Table

P1	5'-CCGGAATTCATGGGGAATGTAGATTATTCTAAAT-3'
		P2	5'-CCGCTCGAGTCAGGACTCATCTTTTTTAGTTCCC-3'

The L-aspartic acid β -decarboxylase gene Asd was ligated to an expression vector pET28a (+) digested with the same restriction enzymes after double digestion with EcoR I and Xho I to obtain a recombinant plasmid pET28 a-ArAsd.

It has been shown that altering the charged amino acid residues on the surface of an enzyme molecule has some effect on the optimal reaction pH of the enzyme (Alan J. Russell A R F. random modification of enzyme catalysis by biology surface charge [ J ] Nature,1987,328: 5.). According to this principle, four surface amino acids of the enzyme molecule were selected in this experiment: asn35, Ala36, Leu44, Thr175 and Ala179 were mutated to construct N35D, A36D, L44D and A179E mutants.

(1) Construction of mutants BL21/pET28a-N35D, BL21/pET28 a-A179E: PCR was performed using pET28a-ArASD plasmid as a template under the conditions shown in Table 1, in which the sequence information of the upstream and downstream primers used in N35D are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively, and the sequence information of the upstream and downstream primers used in A179E are shown in SEQ ID NO.7 and SEQ ID NO.8, respectively.

TABLE 1 Whole plasmid PCR amplification reaction System

The PCR amplification reaction conditions are as follows:

the PCR product was identified by agarose gel electrophoresis. Coli JM109 was transformed with the resulting PCR product to obtain recombinant plasmids pET28a-N35D and pET28a-A179E carrying the gene encoding the mutant. E.coli BL21 strain was transformed with the recombinant plasmids pET28a-N35D and pET28a-A179E to obtain recombinant strains BL21/pET28a-N35D and BL21/pET28 a-A179E.

(2) BL21/pET28a-N35D, BL21/pET28a-A179E recombinant E.coli was inoculated in 5mL LB medium containing 50. mu.g/mL kanamycin, and cultured overnight at 37 ℃ with shaking at 200 rpm.

EXAMPLE 2 expression and purification of L-aspartic acid β -decarboxylase

BL21/pET28a-N35D, BL21/pET28a-A179E recombinant E.coli was inoculated in 5mL LB medium containing 50. mu.g/mL kanamycin, and cultured overnight at 37 ℃ with shaking at 200 rpm. The overnight culture was inoculated at 1% inoculum size to 2YT medium containing 50. mu.g/mL kanamycin, and was cultured at 37 ℃ and 200rpm with shaking to OD of bacterial liquid₆₀₀When the concentration is 0.6-0.8, IPTG is added to the final concentration of 0.2mmol/L, and the thalli are obtained after induced culture for about 20 hours at the temperature of 20 ℃. After centrifugation at 6000rpm, the strain was sonicated, purified using His Trap HP affinity column, and the target protein was detected by SDS-PAGE, the results are shown in FIG. 1. The specific enzyme activity of pure enzyme is determined, and the specific enzyme activity of enzyme mutants N35D and A179E respectively reaches 793U/mg and 765U/mg.

Example 3 pH stability assay

As shown in FIG. 2, the enzyme activities of the L-aspartate β -decarboxylase mutants N35D and A179E are respectively increased by 238% and 244% under the condition of pH 7.0.

Residual enzyme activities of 12h enzyme mutants N35D and A179E are respectively remained 83.9 percent and 85.5 percent after treatment under the condition of pH 4.5, compared with the residual enzyme activity of a contrast wild enzyme, the residual enzyme activity is 24.8 percent, and the stability of the mutant acid is obviously improved.

Example 4 thermal stability assay

The purified enzyme is diluted to the same concentration, treated at 50 ℃ for 3h respectively, reacted at 37 ℃ for 10min, and then treated at 100 ℃ for 10min to terminate the reaction. The results are shown in FIG. 3.

Example 5 catalysis of wild type strains with one-time addition of solid substrate at pH 4.5

After the induced cells are collected by centrifugation, whole cell catalytic reaction is carried out. Cell OD in 50mL reaction System (containing cells, acetate buffer at pH 4.5, substrate)₆₀₀The pH value is 20, the reaction temperature is 35-37 ℃, and the solid substrate L-sodium aspartate is added at one time until the final concentration is 0.3 mol/L. Samples were taken at intervals to examine the amount of L-alanine produced. The results are shown in FIG. 4. The conversion produced 173mmol/L of L-alanine, with a molar conversion of 57.7%.

Example 6 catalytic Process of mutant strains with one-time addition of solid substrate under pH 4.5

After the induced cells are collected by centrifugation, whole cell catalytic reaction is carried out. Cell OD in 50mL reaction System (containing cells, acetate buffer at pH 4.5, substrate)₆₀₀The pH value is 20, the reaction temperature is 35-37 ℃, and the solid substrate L-sodium aspartate is added at one time until the final concentration is 0.3 mol/L. Samples were taken at intervals to examine the amount of L-alanine produced. The results are shown in FIG. 5. Mutants N35D and A179E were transformed to produce 295mmol/L and 293 mmol/L-alanine, respectively, with molar conversions of 98.3% and 97.6%.

Example 7 one-shot addition of solid substrate catalysis Process at pH 7.0

After the induced cells are collected by centrifugation, whole cell catalytic reaction is carried out. Cell OD in 50mL reaction System (phosphate buffer solution at pH 7.0 containing cells, substrate)₆₀₀The pH value is 50, the reaction temperature is 35-37 ℃, and the solid substrate L-sodium aspartate is added at one time until the final concentration is 0.3 mol/L. Samples were taken at intervals to examine the amount of L-alanine produced. The results are shown in FIG. 6. Mutants N35D and A179E, respectivelyThe conversion yielded L-alanine 260mmol/L and 253mmol/L, and the molar conversion was 86.7% and 84.3%.

Comparative example 1

The results of the remaining examples show that the pure enzyme of A36D has 21% of wild-type specific enzyme activity and that L-alanine converted from L-sodium aspartate as a substrate by whole cells under the condition of pH 4.5 is 32mmol/L, wherein L-aspartate β -decarboxylase derived from Acinetobacter radiodurans (the gene encoding the parent enzyme is 1415236 to 1416837 of the gene with NCBI accession number AP 019740.1), and the mutation site is modified to A36D (alanine at position 36 is mutated to aspartate).

Comparative example 2

The results of the remaining examples show that L44D pure enzyme has 15% specific enzyme activity of wild type and that L-alanine is 24mmol/L when L-aspartic acid sodium is converted into L-alanine by whole cells under the condition of pH 4.5, wherein L-aspartic acid β -decarboxylase from Acinetobacter radiodurans (Acinetobacter radiodurans) is used as a parent enzyme (the gene for coding the parent enzyme is 1415236 to 1416837 of the gene with NCBI accession number of AP 019740.1), and the mutation site is modified to L44D (leucine at 44 is mutated to aspartic acid).

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> L-aspartic acid β -decarboxylase mutant and application thereof

<160>10

<170>PatentIn version 3.3

<210>1

<211>533

<212>PRT

<213> Artificial Synthesis

<400>1

Met Gly Asn Val Asp Tyr Ser Lys Tyr Ser Lys Leu Ser Pro Phe Glu

1 5 10 15

Leu Lys Asp Ser Leu Ile Ala Leu Ala Gln Ser Lys Arg Asp Arg Leu

20 25 30

Met Leu Asp Ala Gly Arg Gly Asn Pro Asn Phe Leu Ala Thr Leu Pro

35 40 45

Arg Arg Ala Phe Phe Gln Leu Gly Leu Phe Ser Ala Thr Glu Ser Glu

50 55 60

Phe Ser Phe Ser Tyr Met Pro Glu Gly Leu Gly Gly Phe Pro Arg Pro

65 70 75 80

Val Gly Leu Gln Ser Arg Phe Asp Asn Phe Leu Met Gln Asn Arg Asp

85 90 95

Lys Pro Gly Val Leu Phe Leu Gly Lys Ala Val Ser Tyr Val Arg Asp

100 105 110

Gln Leu Gly Leu Asp Pro Asp Met Phe Leu Leu Glu Met Val Glu Gly

115 120 125

Ile Leu Gly Cys Asn Tyr Pro Val Pro Asp Arg Met Leu Arg Val Ser

130 135 140

Glu Thr Ile Ile Lys Glu Tyr Leu Leu Gln Glu Met Gly Val Lys Ser

145 150 155 160

Met Pro Lys Glu Gly Leu Asp Leu Phe Ala Val Glu Gly Gly Thr Ala

165 170 175

Ala Met Glu Tyr Ile Phe Asn Ser Leu Lys Glu Asn Lys Ile Ile Asn

180 185 190

Thr AspAsp Arg Ile Ala Ile Gly Arg Pro Ile Phe Thr Pro Tyr Leu

195 200 205

Glu Ile Pro Lys Leu Asn Asp Tyr Gln Leu Glu Glu Ile Phe Ile Glu

210 215 220

Ala Asp Pro Asn Leu Gly Trp Gln Tyr Pro Glu Ser Glu Leu Arg Lys

225 230 235 240

Leu Glu Asp Pro Ser Ile Lys Ala Phe Phe Leu Val Asn Pro Ser Asn

245 250 255

Pro Pro Ser Val Lys Ile Ser Asp Glu Gly Leu Leu Ile Leu Ala Asp

260 265 270

Ile Val Arg Lys Arg Pro Asp Leu Ile Ile Leu Thr Asp Asp Val Tyr

275 280 285

Gly Thr Phe Ala Asp Asp Phe Lys Ser Leu Phe Ala Ile Cys Pro Asn

290 295 300

Asn Thr Ile Leu Val Tyr Ser Phe Ser Lys Tyr Phe Gly Ala Thr Gly

305 310 315 320

Trp Arg Leu Gly Ile Ile Ala Leu Ser Asn Asn Asn Ile Ile Asp Gln

325 330 335

Lys Ile Ala Ala Leu Ser Asp Gln Glu Lys Gln Glu Leu Glu Glu Arg

340 345 350

Tyr Ser Ser LeuThr Thr Glu Pro Glu Lys Ile Lys Phe Ile Asp Arg

355 360 365

Leu Val Ala Asp Ser Arg Asn Val Ala Leu Asn His Thr Ala Gly Leu

370 375 380

Ser Thr Pro Gln Gln Val Gln Met Val Leu Phe Ala Leu Phe Asn Met

385 390 395 400

Met Asp Ser Arg Gln Ala Tyr Lys Lys Ala Val Lys Ser Val Val Arg

405 410 415

Glu Arg Asp Ala Ala Leu Tyr Arg Gln Leu Gly Val Glu Val Pro Glu

420 425 430

Asp Leu Asn Ala Val Asp Tyr Tyr Thr Leu Val Asp Leu Glu Arg Thr

435 440 445

Ala Arg Ile Leu Tyr Gly Asp Asp Phe Ala Asn Trp Val Met Val Asn

450 455 460

Lys Asn Pro Thr Glu Leu Leu Phe Arg Val Ala Asp Glu Thr Gly Val

465 470 475 480

Val Leu Leu Pro Gly Ser Gly Phe Gly Val Ser His Pro Ser Ala Arg

485 490 495

Ala Ser Leu Ala Asn Leu Asn Ala Tyr Gln Tyr Ala Ala Ile Gly Asp

500 505 510

Ser Leu Arg Arg Phe AlaGlu Asp Ala Tyr Gln Glu Tyr Leu Gly Thr

515 520 525

Lys Lys Asp Glu Ser

530

<210>2

<211>533

<212>PRT

<213> Artificial Synthesis

<400>2

Met Gly Asn Val Asp Tyr Ser Lys Tyr Ser Lys Leu Ser Pro Phe Glu

1 5 10 15

Leu Lys Asp Ser Leu Ile Ala Leu Ala Gln Ser Lys Arg Asp Arg Leu

20 25 30

Met Leu Asn Ala Gly Arg Gly Asn Pro Asn Phe Leu Ala Thr Leu Pro

35 40 45

Arg Arg Ala Phe Phe Gln Leu Gly Leu Phe Ser Ala Thr Glu Ser Glu

50 55 60

Phe Ser Phe Ser Tyr Met Pro Glu Gly Leu Gly Gly Phe Pro Arg Pro

65 70 75 80

Val Gly Leu Gln Ser Arg Phe Asp Asn Phe Leu Met Gln Asn Arg Asp

85 90 95

Lys Pro Gly Val Leu Phe Leu Gly Lys Ala Val Ser Tyr Val Arg Asp

100 105 110

Gln Leu Gly Leu Asp Pro Asp Met Phe LeuLeu Glu Met Val Glu Gly

115 120 125

Ile Leu Gly Cys Asn Tyr Pro Val Pro Asp Arg Met Leu Arg Val Ser

130 135 140

Glu Thr Ile Ile Lys Glu Tyr Leu Leu Gln Glu Met Gly Val Lys Ser

145 150 155 160

Met Pro Lys Glu Gly Leu Asp Leu Phe Ala Val Glu Gly Gly Thr Ala

165 170 175

Ala Met Ala Tyr Ile Phe Asn Ser Leu Lys Glu Asn Lys Ile Ile Asn

180 185 190

Thr Asp Asp Arg Ile Ala Ile Gly Arg Pro Ile Phe Thr Pro Tyr Leu

195 200 205

Glu Ile Pro Lys Leu Asn Asp Tyr Gln Leu Glu Glu Ile Phe Ile Glu

210 215 220

Ala Asp Pro Asn Leu Gly Trp Gln Tyr Pro Glu Ser Glu Leu Arg Lys

225 230 235 240

Leu Glu Asp Pro Ser Ile Lys Ala Phe Phe Leu Val Asn Pro Ser Asn

245 250 255

Pro Pro Ser Val Lys Ile Ser Asp Glu Gly Leu Leu Ile Leu Ala Asp

260 265 270

Ile Val Arg Lys Arg Pro Asp Leu Ile Ile Leu ThrAsp Asp Val Tyr

275 280 285

Gly Thr Phe Ala Asp Asp Phe Lys Ser Leu Phe Ala Ile Cys Pro Asn

290 295 300

Asn Thr Ile Leu Val Tyr Ser Phe Ser Lys Tyr Phe Gly Ala Thr Gly

305 310 315 320

Trp Arg Leu Gly Ile Ile Ala Leu Ser Asn Asn Asn Ile Ile Asp Gln

325 330 335

Lys Ile Ala Ala Leu Ser Asp Gln Glu Lys Gln Glu Leu Glu Glu Arg

340 345 350

Tyr Ser Ser Leu Thr Thr Glu Pro Glu Lys Ile Lys Phe Ile Asp Arg

355 360 365

Leu Val Ala Asp Ser Arg Asn Val Ala Leu Asn His Thr Ala Gly Leu

370 375 380

Ser Thr Pro Gln Gln Val Gln Met Val Leu Phe Ala Leu Phe Asn Met

385 390 395 400

Met Asp Ser Arg Gln Ala Tyr Lys Lys Ala Val Lys Ser Val Val Arg

405 410 415

Glu Arg Asp Ala Ala Leu Tyr Arg Gln Leu Gly Val Glu Val Pro Glu

420 425 430

Asp Leu Asn Ala Val Asp Tyr Tyr Thr Leu Val Asp Leu GluArg Thr

435 440 445

Ala Arg Ile Leu Tyr Gly Asp Asp Phe Ala Asn Trp Val Met Val Asn

450 455 460

Lys Asn Pro Thr Glu Leu Leu Phe Arg Val Ala Asp Glu Thr Gly Val

465 470 475 480

Val Leu Leu Pro Gly Ser Gly Phe Gly Val Ser His Pro Ser Ala Arg

485 490 495

Ala Ser Leu Ala Asn Leu Asn Ala Tyr Gln Tyr Ala Ala Ile Gly Asp

500 505 510

Ser Leu Arg Arg Phe Ala Glu Asp Ala Tyr Gln Glu Tyr Leu Gly Thr

515 520 525

Lys Lys Asp Glu Ser

530

<210>3

<211>1602

<212>DNA

<213> Artificial Synthesis

<400>3

atggggaatg tagattattc taaatattca aaacttagcc cattcgagtt aaaagatagc 60

ctgattgctt tggcacagag taagcgggac cgcttaatgc tcgatgctgg acgaggaaac 120

cctaattttc tggctaccct gccacgtagg gctttttttc aattaggttt attttctgcc 180

acagaatcag aattttcatt ttcttacatg ccagaaggct taggtgggtt cccccgtcct 240

gtcggtttgc aatcacgttt tgataatttt ctcatgcaga accgggataa acctggagtt 300

ttatttctgg gaaaagcagt gtcttatgtg agagaccaat tgggtttaga tccagatatg 360

tttctgcttg aaatggtcga agggattcta ggatgtaact accctgtacc tgatcgcatg 420

ctccgtgtca gtgaaacaat tattaaagag tatctgttac aggaaatggg cgtaaaaagt 480

atgcccaagg aaggcttgga cctgtttgcg gttgaaggcg gaaccgcagc catggcttat 540

atatttaact ccttaaaaga aaacaagatt attaatactg acgaccgaat tgcaatcggc 600

agaccgattt ttacgccgta tctggaaatt cccaaactga atgactatca gcttgaagaa 660

atttttattg aagctgatcc caatctgggc tggcaatatc ctgagtctga attaagaaag 720

ttagaagacc cttcaatcaa ggcattcttt ttagtcaatc cgagcaaccc gccttctgtc 780

aaaataagtg atgaaggatt gctaatactg gcagatattg taagaaaacg tcctgacctg 840

attattttga cagatgatgt atatggaact tttgcagatg actttaagtc actttttgca 900

atttgcccaa ataatactat tttagtttat tcattctcaa agtactttgg ggctacaggc 960

tggagacttg gcattattgc gctgtcgaat aacaatatca ttgatcagaa gattgcagcg 1020

ctttcagatc aggaaaagca ggaacttgaa gaacgttatt catcattaac tactgaacca 1080

gaaaaaatca agtttattga ccgtttggta gcagatagcc gtaatgttgc actgaatcac 1140

accgcaggtc tgtcaacacc gcagcaggta cagatggttc tttttgccct gtttaatatg 1200

atggattctc gtcaggctta taaaaaagct gtcaagtctg tagtccggga acgcgatgct 1260

gcactttata gacagcttgg tgttgaagtc cctgaagatc ttaacgctgt tgactattac 1320

accttggtag atctggaaag aacagcccgc atattatatg gtgacgattttgccaactgg 1380

gtcatggtca ataaaaaccc gacagaatta ttatttcggg tagcagatga aaccggtgtc 1440

gttctgttgc caggttctgg ctttggggta tcccatccat cggcacgtgc ttcattagcc 1500

aatctgaatg cttaccaata tgctgcaatc ggtgattctc tacgacgctt tgccgaagat 1560

gcctatcagg aatatctggg aactaaaaaa gatgagtcct ga 1602

<210>4

<211>1602

<212>DNA

<213> Artificial Synthesis

<400>4

atggggaatg tagattattc taaatattca aaacttagcc cattcgagtt aaaagatagc 60

ctgattgctt tggcacagag taagcgggac cgcttaatgc tcaatgctgg acgaggaaac 120

cctaattttc tggctaccct gccacgtagg gctttttttc aattaggttt attttctgcc 180

acagaatcag aattttcatt ttcttacatg ccagaaggct taggtgggtt cccccgtcct 240

gtcggtttgc aatcacgttt tgataatttt ctcatgcaga accgggataa acctggagtt 300

ttatttctgg gaaaagcagt gtcttatgtg agagaccaat tgggtttaga tccagatatg 360

tttctgcttg aaatggtcga agggattcta ggatgtaact accctgtacc tgatcgcatg 420

ctccgtgtca gtgaaacaat tattaaagag tatctgttac aggaaatggg cgtaaaaagt 480

atgcccaagg aaggcttgga cctgtttgcg gttgaaggcg gaaccgcagc catggaatat 540

atatttaact ccttaaaaga aaacaagatt attaatactg acgaccgaat tgcaatcggc 600

agaccgattt ttacgccgta tctggaaatt cccaaactga atgactatca gcttgaagaa 660

atttttattg aagctgatcc caatctgggc tggcaatatc ctgagtctga attaagaaag 720

ttagaagacc cttcaatcaa ggcattcttt ttagtcaatc cgagcaaccc gccttctgtc 780

aaaataagtg atgaaggatt gctaatactg gcagatattg taagaaaacg tcctgacctg 840

attattttga cagatgatgt atatggaact tttgcagatg actttaagtc actttttgca 900

atttgcccaa ataatactat tttagtttat tcattctcaa agtactttgg ggctacaggc 960

tggagacttg gcattattgc gctgtcgaat aacaatatca ttgatcagaa gattgcagcg 1020

ctttcagatc aggaaaagca ggaacttgaa gaacgttatt catcattaac tactgaacca 1080

gaaaaaatca agtttattga ccgtttggta gcagatagcc gtaatgttgc actgaatcac 1140

accgcaggtc tgtcaacacc gcagcaggta cagatggttc tttttgccct gtttaatatg 1200

atggattctc gtcaggctta taaaaaagct gtcaagtctg tagtccggga acgcgatgct 1260

gcactttata gacagcttgg tgttgaagtc cctgaagatc ttaacgctgt tgactattac 1320

accttggtag atctggaaag aacagcccgc atattatatg gtgacgattt tgccaactgg 1380

gtcatggtca ataaaaaccc gacagaatta ttatttcggg tagcagatga aaccggtgtc 1440

gttctgttgc caggttctgg ctttggggta tcccatccat cggcacgtgc ttcattagcc 1500

aatctgaatg cttaccaata tgctgcaatc ggtgattctc tacgacgctt tgccgaagat 1560

gcctatcagg aatatctggg aactaaaaaa gatgagtcct ga 1602

<210>5

<211>35

<212>DNA

<213> Artificial Synthesis

<400>5

gggaccgctt aatgctcgat gctggacgag gaaac 35

<210>6

<211>35

<212>DNA

<213> Artificial Synthesis

<400>6

gtttcctcgt ccagcatcga gcattaagcg gtccc 35

<210>7

<211>36

<212>DNA

<213> Artificial Synthesis

<400>7

cggaaccgca gccatggaat atatatttaa ctcctt 36

<210>8

<211>36

<212>DNA

<213> Artificial Synthesis

<400>8

aaggagttaa atatatattc catggctgcg gttccg 36

<210>9

<211>34

<212>DNA

<213> Artificial Synthesis

<400>9

ccggaattca tggggaatgt agattattct aaat 34

<210>10

<211>34

<212>DNA

<213> Artificial Synthesis

<400>10

ccgctcgagt caggactcat cttttttagt tccc 34

Claims

1. An L-aspartic acid β -decarboxylase mutant is characterized by comprising an amino acid sequence shown in SEQ ID NO.1 or SEQ ID NO. 2.

2. A gene encoding the L-aspartate β -decarboxylase mutant of claim 1.

3. A vector comprising the gene of claim 2.

4. A cell expressing the L-aspartate β -decarboxylase mutant of claim 1.

5. A genetically engineered bacterium which expresses the L-aspartic acid β -decarboxylase mutant according to claim 1 using Escherichia coli as a host.

6. The genetically engineered bacterium of claim 5, wherein the genetically engineered bacterium is based on Escherichia coli BL 21.

7. The genetically engineered bacterium of claim 5 or 6, wherein the genetically engineered bacterium uses a pET series plasmid as a vector.

8. The genetically engineered bacterium of claim 7, wherein the vector is pET28 a.

9. A method for preparing L-aspartic acid β -decarboxylase, characterized in that the genetically engineered bacteria expressing the L-aspartic acid β -decarboxylase mutant of claim 1 are inoculated in LB culture medium and cultured at 35-37 ℃ to OD₆₀₀When the temperature is 0.6-0.8 ℃, adding an inducer IPTG to induce for 15-25h at 20-30 ℃.

10. Use of the mutant L-aspartate β -decarboxylase of claim 1 or the genetically engineered bacterium of any one of claims 5 to 8 for the preparation of products containing L-alanine.