CN113564151A

CN113564151A - Method for improving CE enzyme structure isomerization catalytic activity and mutant thereof

Info

Publication number: CN113564151A
Application number: CN202110839002.XA
Authority: CN
Inventors: 吕小妹; 王璐; 杨瑞金
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2021-07-23
Filing date: 2021-07-23
Publication date: 2021-10-29
Anticipated expiration: 2041-07-23
Also published as: CN113564151B

Abstract

The invention discloses a method for improving CE enzyme structure isomerization catalytic activity and a mutant thereof, belonging to the field of enzyme engineering. According to the invention, cellobiose epimerase (CsCE) from Caldicellulosriptorccharolyticus is taken as a research object, and point saturation mutation is carried out on sites related to substrate combination based on a semi-rational strategy of sequence comparison and crystal structure analysis, so that multiple mutants with obviously improved structural isomerization catalytic activity are obtained, and the structural isomerization activity of the mutants is improved by about 36-232% compared with that of a wild CE enzyme. The invention provides a feasible scheme for improving the CE enzyme and has important significance for promoting the enzymatic industrial synthesis of lactulose.

Description

Method for improving CE enzyme structure isomerization catalytic activity and mutant thereof

Technical Field

The invention relates to a method for improving CE enzyme structure isomerization catalytic activity and a mutant thereof, belonging to the field of enzyme engineering.

Background

Lactulose (Lactulose, β -D-galactosyl-1, 4-D-fructose) is a non-digestible disaccharide and is widely used in the food and pharmaceutical industries because of its prebiotic properties such as promoting the growth of bifidobacteria, regulating the pH of the intestinal tract, inhibiting the growth of pathogenic bacteria, etc. At present, the commercial lactulose on the market is mainly produced by a chemical method, high-level byproducts are produced in the production process, and the chemical method involving complicated separation and purification steps easily causes serious environmental pollution, so that the application of the lactulose is limited. The enzymatic synthesis of lactulose has mild catalytic conditions and safer production, and becomes a research hotspot for the current production of lactulose. The enzymes currently used for the enzymatic production of lactulose are mainly beta-galactosidase and Cellobiose Epimerase (CE). Among them, the beta-galactosidase production process requires the addition of fructose as a co-substrate, and has the disadvantages of more by-products and lower lactulose conversion (about 15%).

The CE enzymes reported at present mainly have epimeric activity, while some CE enzymes derived from thermophilic microorganisms, such as Caldcellulosruroptera saccharolyticus (CsCE), Dictyoglyces turgidum (DtCE), Spirochaeta thermophila (StCE), Caldcellulosruroptera biosidians (CoCE) and Dictyoglyces thermophilum (DhCE), have structural isomerization catalytic activity, i.e., can catalyze the production of lactulose from lactose substrate, and become a novel method for producing lactulose. Compared with the traditional beta-galactosidase method for producing lactulose, the CE enzyme has higher production efficiency and does not need the participation of co-substrates, which provides a better choice for the production of lactulose.

However, the method for preparing lactulose by using CE still has the defects of poor substrate affinity, low structural isomerization activity (not more than 10% of epimerization activity in most cases), generation of byproducts such as lactose and the like, and limits the industrial application process. So far, the transformation of CsCE has achieved many achievements, such as the improvement of its structural isomeric activity by random mutagenesis; the thermal stability of the CE enzyme is improved by a site-directed mutagenesis method, but the catalytic properties such as substrate affinity, lactulose conversion rate, thermal stability and the like are not greatly improved.

Disclosure of Invention

[ problem ] to

In the prior art, the substrate affinity, lactulose conversion rate and thermal stability of CE enzyme are not greatly improved, and the CE enzyme can not be applied to industrial production of lactulose.

[ solution ]

The invention provides a molecular modification method for improving CE enzyme catalytic performance, namely, based on semi-rational design, a CE substrate binding pocket is remolded by a point saturation mutation technology, and the CE enzyme with high substrate affinity and structural isomerization activity is obtained. The mutant constructed by the invention has good catalytic property and has important significance for promoting green and efficient synthesis of lactulose.

The first purpose of the invention is to provide a cellobiose epimerase mutant, which is obtained by mutating 371 th site and/or 355 th site on the basis of a wild enzyme with an amino acid sequence shown as SEQ ID NO. 1.

In one embodiment, the mutant is obtained by mutating glutamine 371 to alanine, glutamic acid, cysteine, phenylalanine, glycine or arginine and tryptophan 355 to alanine or glutamine on the basis of a wild enzyme with an amino acid sequence shown as SEQ ID No. 1.

In one embodiment, the amino acid sequence of the mutant is shown as SEQ ID NO. 2-SEQ ID NO. 9.

It is a second object of the present invention to provide a gene encoding the cellobiose epimerase mutant.

The third purpose of the invention is to provide a carrier for expressing the cellobiose epimerase mutant or containing the gene.

The fourth object of the present invention is to provide a recombinant bacterium containing the cellobiose epimerase mutant or the vector.

In one embodiment, the genetically engineered bacterium is a host escherichia coli.

In one embodiment, the escherichia coli comprises BL21(DE 3).

In one embodiment, the expression vector of the genetically engineered bacterium comprises a pET series vector.

In one embodiment, the expression vector of the genetically engineered bacterium comprises pET-28 b.

The fifth object of the present invention is to provide a method for improving the structural isomerization activity of cellobiose epimerase by mutating the 371 th glutamine and/or 355 th tryptophan on the basis of the wild enzyme having the amino acid sequence shown in SEQ ID NO. 1.

In one embodiment, the mutation is to change the 371 th glutamine into alanine, glutamic acid, cysteine, phenylalanine, glycine or arginine and the 355 th tryptophan into alanine or glutamine on the basis of the wild enzyme with the amino acid sequence shown as SEQ ID NO. 1.

The invention also provides application of the cellobiose epimerase mutant or the recombinant bacterium in preparation of lactulose.

In one embodiment, the cellobiose epimerase mutant or the recombinant bacterium is added to 150 to 250mM lactose as a substrate under a reaction condition of 70 to 80 ℃ at pH7 to 8 for 5 to 480 min.

The invention also provides application of the cellobiose epimerase mutant or the recombinant bacterium in preparation of food and medicines.

Has the advantages that:

through the modification of CsCE substrate binding related sites, mutants with improved catalytic performance are successfully obtained. Compared with the original enzyme, the structural isomerism activity of the mutant CsCE-Q371A, CsCE-Q371E, CsCE-Q371C, CsCE-Q371F, CsCE-Q371G and CsCE-Q371R is improved by about 36-232% compared with that of the wild-type CE enzyme, wherein the mutant CsCE-Q371E shows better catalytic performance, the structural isomerism activity is improved by about 232%, and the half-life period is improved by about 42% at 75 ℃; and the conversion efficiency of the substrate lactose is improved by about 14 percent compared with the original enzyme CsCE when the reaction reaches the equilibrium. Moreover, the structural isomerization activities of the CsCE-W355A and the CsCE-W355Q are improved by about 45 percent and 198 percent compared with the original enzyme CsCE, wherein the epimerization activity of the CsCE-W355A mutant is also improved by about 25 percent compared with the original enzyme CsCE, and the conversion rate of lactose is improved to 85 percent when the reaction reaches the balance.

Drawings

FIG. 1 is a crystal structure diagram of CsCE substrate binding-related site and an AGE family and CE enzyme sequence alignment;

FIG. 2 shows the relative activities and decay constants of CsCE and positive mutants at 75 ℃;

FIG. 3 is a graph showing the conversion of the CsCE and positive mutants to lactose substrate.

Detailed Description

PrimerStar Mix DNA polymerase (Takara), loading buffer (Takara), SanPrep column PCR product purification kit, and SanPrep column plasmid DNA miniprep kit (Sangon Biotech, Shanghai);

LE agarose (nucleic acid electrophoresis), S4 nucleic acid electrophoresis dye (Takara). The low molecular weight standard protein, DNA 5000ladder and DNA 10000ladder are purchased from Shanghai Baobao biology Limited company; tryptone and yeast extract were purchased from Oxoid, UK.

LB liquid medium configuration (1L): 10g of NaCl, 10g of tryptone and 5g of yeast extract.

LB agar medium configuration (1L): adding 15g of agar sugar powder into LB liquid culture medium with the volume of 1L, sterilizing by high-pressure steam, and pouring into a 9cm sterile plate to obtain an antibiotic-free LB solid culture medium; adding antibiotics to obtain corresponding antibiotic selective LB solid culture medium, condensing, and placing in a refrigerator at 4 deg.C for use.

Determination of the epimeric and structural isomeric Activity of Cellobiose epimerase: adding 0.2mg/mL of purified enzyme solution to 200mM lactose as a substrate under reaction conditions of pH7.5 and 75 ℃ to carry out reaction 10 orAnd (3) 20min, wherein the reaction liquid after reacting for 10min is used for detecting the activity of the epimerase, the reaction liquid after reacting for 20min is used for detecting the activity of the structural isomerization reaction, and 15% trichloroacetic acid (TCA) solution is used for removing protein in the reaction liquid, and HPLC detection is carried out after dilution. Detecting lactose and lactulose by HPLC method, and separating and detecting sugar concentration by using refractive index detector; wherein the chromatographic column is

An AsahipakVG-504E pre-packed column and a VG-504E chromatographic separation column, and the mobile phase is a mixed solution of acetonitrile, methanol and water (75:20: 5).

And (3) detecting lactulose by a 96-well plate colorimetric method:

(1) the colonies were transferred to 900. mu.L LB medium (containing kana 30 ng/. mu.L, IPTG 0.4mM) in a 96-deep well plate using sterilized toothpicks. Sealing a 96-well plate by using a sealing film, and culturing for 24h at 30 ℃ and 800 rpm; 100 μ L of the culture broth was taken from each well and transferred to a new 96-well plate for storage.

(2) The original 96 deep well plate was centrifuged at 3500rpm for 15min, the supernatant was discarded, and the cells were resuspended in 50. mu.L LPIPES (50mM, pH7.5, containing 10mg/mL lysozyme) and reacted in a 37 ℃ incubator for 1 h.

(3) To each well of the 96-deep well plate in step (2), 50. mu.L of 25 mM lactose solution was added, and after mixing by using a microplate shaker, the reaction was carried out at 75 ℃ for 10min, and concentrated HCl (final concentration: 200mM) was added to terminate the reaction.

(4) The reaction solution was diluted 2-fold with PIPES buffer (50mM, pH7.5), 50. mu.L was put in a new 96-well reaction plate, and 150. mu.L of a lactulose assay reagent (140. mu.L of 75% sulfuric acid + 10. mu.L of a color developer; the color developer is 2.5% cysteine hydrochloride and 0.08% tryptophan solution) was added.

(5) Keeping in water bath at 48 deg.C for 70min, and detecting absorbance value with enzyme labeling instrument at 518 nm.

Example 1: determination of substrate binding site of CsCE and construction of mutant plasmid

(1) Amino acid sequence and crystal structure comparative analysis to determine mutation site

As shown in the crystal structure alignment chart and the amino acid sequence alignment of fig. 1, two tryptophans (W) at the active center of CE enzyme can recognize and fix the disaccharide substrate, the Tryptophan W308 near the reducing end of the substrate is conserved in the N-acetyl-glucosamine superfamily, while the Tryptophan W372 at the non-reducing end is conserved only in the CE enzyme family. It is therefore assumed that the W372 site affects the activity of the CE enzyme catalyzing the disaccharide.

(2) Construction of wild-type recombinant plasmid pET-28b-CsCE

Firstly, the whole genome of Caldicellulosirius DSM 8903 was extracted as a template, primers were designed based on the Gene sequence of CsCE (Gene Access: YP-0011791132.1), restriction sites BamHI and EcoRI were introduced, and the Gene fragment expressing CsCE was amplified by PCR.

Secondly, the C end of the target gene contains 6 His-tags, and the target gene and pET-28b (+) plasmid are subjected to BamHI and EcoRI double enzyme digestion respectively and are connected through T4 ligase to obtain recombinant DNA.

③ introduction of the recombinant DNA into competent E.coli Top10 strain by heat shock method, plating the transformed cells on an LB agar plate containing kana, and culturing the cells in an inverted state at 37 ℃ for 16 hours.

And fourthly, selecting a single colony on the plate to carry out colony PCR, detecting a band by using agarose nucleic acid electrophoresis, and selecting a single colony with the correct size of the band to carry out sequencing.

Fifthly, plasmid extraction is carried out on the bacterial liquid with successful sequencing, the plasmid is transformed into E.coli BL21(DE3), colony PCR and sequencing are carried out again to verify the plasmid, and finally the wild recombinant plasmid pET-28b-CsCE is obtained.

CE-F：CGCGGATCCATGGATATTACAAGGTTTTAAG；

CE-R：CCGGAATTCTTAGTCAACCCTTTTTATTATC。

(3) Construction of mutant plasmids

In order to verify the function of the W372 site in CE enzyme catalysis, the wild type recombinant plasmid pET-28b-CsCE constructed in the step (2) is used as a template, a primer is designed, and a PCR method is adopted to carry out saturation mutation on the CsCE-W372 site at the non-reducing end of a substrate.

The mutant primers are shown below:

TABLE 1 CsCE-W372 mutant primers as follows

And (3) PCR amplification: the reaction system is referred to table 2, and the total volume is 50 μ L:

TABLE 2 PCR reaction System

Reaction procedure: PCR reaction amplification conditions refer to table 3:

TABLE 3 PCR reaction amplification conditions

Purifying the PCR product by using a PCR product purification kit to obtain a high-quality DNA purified product, adding QuickCut Dpn I enzyme into the purified PCR reaction solution, and digesting for 5min at 37 ℃; then transforming to a competent E.coli Top10 system cloning host; coating the transformation liquid on an LB flat plate containing kana, and culturing for 12h in a constant temperature and humidity incubator at 37 ℃; and (3) selecting a single colony, culturing at 37 ℃ overnight at 200rpm for recombinant plasmid extraction and sequencing verification, and obtaining the correct 19 CsCE-W372 site mutant plasmids after sequence comparison.

(4) Expression purification of mutant enzymes

Respectively transferring the 19 successfully sequenced mutant plasmids in the step (3) into E.coli BL21(DE3) competent cells, coating a flat plate with a transformation solution, and culturing at 37 ℃ overnight; then selecting single colony to culture overnight to obtain activated bacterial liquid, inoculating the activated bacterial liquid into LB culture medium with the inoculum size of 1% (v/v), and culturing at 37 deg.C to OD₆₀₀The value is 0.8, IPTG with the concentration of 1M is added for induction for 8 hours, and fermentation liquor is obtained.

Centrifuging the fermentation liquid, and collecting thallusFor purification of proteins: the collected cells were washed with Lysis Buffer (50mM Na)₂HPO₄200mM NaCl, 10mM imidazole, pH7.5), placing in an ice bath for ultrasonication to obtain a crude enzyme solution, and filtering the crude enzyme solution by using a 0.22 mu m filter membrane for later use;

the filtered crude enzyme solution was passed through a Ni ion affinity column using Washing Buffer (50mM Na)₂HPO₄200mM NaCl, 100mM imidazole, pH7.5) and finally washing the protein with an Elution Buffer (50mM Na)₂HPO₄200mM NaCl, 250mM imidazole, pH7.5), and collecting the eluate containing the target protein; dialyzing the eluate containing the target protein with 10mM PIPES pH7.5 buffer solution for 3 times (6 hr each time), collecting pure enzyme solution in dialysis bag, placing in EP tube, and storing at 4 deg.C. And (3) detecting the purification efficiency and purity of the protein by SDS-PAGE protein electrophoresis.

(5) Substrate binding site catalytic activity assay

The results of measuring the structural isomerization catalytic activity and the epimerization catalytic activity of the 19 mutant enzymes obtained in the step (4) are shown in Table 4, most of the mutants of the CsCE-W372 site subjected to saturation mutation completely lose the catalytic activity, wherein the structural isomerization catalytic activity is greatly influenced, and only two mutants of CsCE-W372F and CsCE-W372Y respectively retain about 22 percent and 49 percent of the structural isomerization catalytic activity; the W372 site mutant also has reduced epimerization catalytic activity to different degrees. These results indicate the catalytic recognition and immobilization of lactose substrates by the 372 nd aromatic amino acid tryptophan.

TABLE 4 determination of the structural isomerism and epimerisation activities of CsCE-W372 site mutants

Example 2: remodeling substrate binding pocket and constructing mutant based on semi-rational design

To improve the structural isomerism activity of CsCE, amino acids around the substrate binding related sites CsCE-W308 and CsCE-W372 were subjected to saturation mutagenesis using a semi-rational design strategy. Performing sequence comparison and crystal structure analysis on the CE family enzyme, selecting residues near two tryptophans and at a substrate inlet for molecular modification (figure 2), namely CsCE-I306 and CsCE-W307 (divided into an A region) near a substrate reducing end CsCE-W308; CsCE-Q371 (divided into B region) near the non-reducing end CsCE-W372 of the substrate; CsCE-W355 (divided into C region) at the entrance of the CsCE active center, and saturation mutagenesis was performed for these 4 sites by PCR.

The PCR amplification reaction system and the reaction amplification conditions were the same as in step (3) of example 1, and the mutant plasmids were constructed, subjected to sequencing verification and sequence alignment to obtain 84 correct mutant plasmids, which were introduced into E.coli BL21(DE3) as a host cell, respectively, cultured overnight at 37 ℃, and single colonies were picked up and inoculated into 96-well deep-well plates containing 900. mu.L of LB medium (containing kana 30 ng/. mu.L, IPTG 0.4mM) for 24h to obtain a fermentation broth. The formation of lactulose was detected by colorimetric method, and 8 positive mutants with higher structural isomeric activity than wild-type CE enzyme were initially selected (table 5), and none of the other mutants had improved or reduced color.

TABLE 5 colorimetric detection of lactulose

The mutant enzyme was purified by the method of step (4) of example 2 and was used in subsequent experiments.

Example 3: enzymatic Properties of Cellobiose epimerase

And (3) measuring the thermal stability: the 8 purified mutant enzymes obtained in example 2 were reacted with lactose, respectively, and the amount of lactulose produced was measured: 2mg/mL of the mutant enzyme was reacted with 200mM lactose at 75 ℃ and sampled at various time points (5min,10min,20min, 30min,60min,120min,240min,480min), and the reaction solution collected at the various time points was diluted to measure the amount of lactulose produced by HPLC to determine the residual activity of the mutant enzyme, as shown in FIG. 2. Before heat treatmentThe enzyme activity is initial enzyme activity (U)₀) The enzyme activity after heat treatment is residual enzyme activity (U)₀) The data obtained are according to the equation ln (U)_t/U₀)＝k_dPlotting t to obtain decay constant k_dAs shown in fig. 2. Half-life of the enzyme is from t_1/2＝ln(2)/-k_dAnd (6) calculating.

Enzyme reaction time profile: the 8 purified mutant enzymes obtained in example 2 were reacted with lactose, respectively, and the amount of lactulose produced was measured: 2mg/mL of the mutant enzyme was reacted with 200mM lactose at 75 ℃ and sampled at different time points (5min,10min,20min, 30min,60min,120min,240min,480min), the concentrations of the product (lactulose, iprifactone) and the remaining substrate lactose in the samples at the different time points were determined by HPLC, and the enzyme reaction time curves were plotted (FIG. 3).

Nonlinear Michaelis-Menten fitting is carried out on the lactulose generation rate and the substrate concentration by using software GraphPadprism 8 to obtain a Km value of a Michael constant and a maximum reaction rate Vmax, and then the catalytic constant kcat is calculated by a formula of Vmax ═ kcat [ E ].

The enzyme catalytic activity is shown in Table 6, and the structural isomeric activity of CsCE-Q371A, CsCE-Q371E, CsCE-Q371C, CsCE-Q371F, CsCE-Q371G and CsCE-Q371R is improved by about 36-232% compared with that of a wild type CE enzyme, wherein the mutant CsCE-Q371E shows better catalytic performance, the structural isomeric activity is improved by about 232%, and the half-life period is improved by about 42% at 75 ℃ (Table 7); the conversion efficiency to the substrate lactose increased to 80% when the reaction reached equilibrium, 14% compared to the wild type (70% conversion of wild type lactose) (fig. 3). Not only does this, the structural isomeric activity of CsCE-W355A and CsCE-W355Q is improved by about 45% and 198% compared with the wild type CE enzyme, wherein the epimeric activity of the CsCE-W355A mutant is also improved by about 25% compared with the wild type CE enzyme, and the lactose conversion rate is improved to 83% when the reaction reaches the equilibrium.

TABLE 6 determination of enzymatic Activity and kinetic parameters

TABLE 7 CsCE and its mutant thermostability parameters

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> method for improving CE enzyme structure isomerization catalytic activity and mutant thereof

<130> BAA210938A

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 390

<212> PRT

<213> Artificial sequence

<400> 1

Met Asp Ile Thr Arg Phe Lys Glu Asp Leu Lys Ala His Leu Glu Glu

1 5 10 15

Lys Ile Ile Pro Phe Trp Gln Ser Leu Lys Asp Asp Glu Phe Gly Gly

20 25 30

Tyr Tyr Gly Tyr Met Asp Phe Asn Leu Asn Ile Asp Arg Lys Ala Gln

35 40 45

Lys Gly Cys Ile Leu Asn Ser Arg Ile Leu Trp Phe Phe Ser Ala Cys

50 55 60

Tyr Asn Val Leu Lys Ser Glu Lys Cys Lys Glu Met Ala Phe His Ala

65 70 75 80

Phe Glu Phe Leu Lys Asn Lys Phe Trp Asp Lys Glu Tyr Glu Gly Leu

85 90 95

Phe Trp Ser Val Ser His Lys Gly Val Pro Val Asp Val Thr Lys His

100 105 110

Val Tyr Val Gln Ala Phe Gly Ile Tyr Gly Leu Ser Glu Tyr Tyr Glu

115 120 125

Ala Ser Gly Asp Glu Glu Ala Leu His Met Ala Lys Arg Leu Phe Glu

130 135 140

Ile Leu Glu Thr Lys Cys Lys Arg Glu Asn Gly Tyr Thr Glu Gln Phe

145 150 155 160

Glu Arg Asn Trp Gln Glu Lys Glu Asn Arg Phe Leu Ser Glu Asn Gly

165 170 175

Val Ile Ala Ser Lys Thr Met Asn Thr His Leu His Val Leu Glu Ser

180 185 190

Tyr Thr Asn Leu Tyr Arg Leu Leu Lys Leu Asp Asp Val Tyr Glu Ala

195 200 205

Leu Glu Trp Ile Val Arg Leu Phe Val Asp Lys Ile Tyr Lys Lys Gly

210 215 220

Thr Gly His Phe Lys Val Phe Cys Asp Asp Asn Trp Asn Glu Leu Ile

225 230 235 240

Lys Ala Val Ser Tyr Gly His Asp Ile Glu Ala Ser Trp Leu Leu Asp

245 250 255

Gln Ala Ala Lys Tyr Leu Lys Asp Glu Lys Leu Lys Glu Glu Val Glu

260 265 270

Lys Leu Ala Leu Glu Val Ala Gln Ile Thr Leu Lys Glu Ala Phe Asp

275 280 285

Gly Gln Ser Leu Ile Asn Glu Met Ile Glu Asp Arg Ile Asp Arg Ser

290 295 300

Lys Ile Trp Trp Val Glu Ala Glu Thr Val Val Gly Phe Phe Asn Ala

305 310 315 320

Tyr Gln Lys Thr Lys Glu Glu Lys Tyr Leu Asp Ala Ala Ile Lys Thr

325 330 335

Trp Glu Phe Ile Lys Glu His Leu Val Asp Arg Arg Lys Asn Ser Glu

340 345 350

Trp Leu Trp Lys Val Asn Glu Asp Leu Glu Ala Val Asn Met Pro Ile

355 360 365

Val Glu Gln Trp Lys Cys Pro Tyr His Asn Gly Arg Met Cys Leu Glu

370 375 380

Ile Ile Lys Arg Val Asp

385 390

<210> 2

<211> 390

<212> PRT

<213> Artificial sequence

<400> 2

Met Asp Ile Thr Arg Phe Lys Glu Asp Leu Lys Ala His Leu Glu Glu

1 5 10 15

Lys Ile Ile Pro Phe Trp Gln Ser Leu Lys Asp Asp Glu Phe Gly Gly

20 25 30

Tyr Tyr Gly Tyr Met Asp Phe Asn Leu Asn Ile Asp Arg Lys Ala Gln

35 40 45

Lys Gly Cys Ile Leu Asn Ser Arg Ile Leu Trp Phe Phe Ser Ala Cys

50 55 60

Tyr Asn Val Leu Lys Ser Glu Lys Cys Lys Glu Met Ala Phe His Ala

65 70 75 80

Phe Glu Phe Leu Lys Asn Lys Phe Trp Asp Lys Glu Tyr Glu Gly Leu

85 90 95

Phe Trp Ser Val Ser His Lys Gly Val Pro Val Asp Val Thr Lys His

100 105 110

Val Tyr Val Gln Ala Phe Gly Ile Tyr Gly Leu Ser Glu Tyr Tyr Glu

115 120 125

Ala Ser Gly Asp Glu Glu Ala Leu His Met Ala Lys Arg Leu Phe Glu

130 135 140

Ile Leu Glu Thr Lys Cys Lys Arg Glu Asn Gly Tyr Thr Glu Gln Phe

145 150 155 160

Glu Arg Asn Trp Gln Glu Lys Glu Asn Arg Phe Leu Ser Glu Asn Gly

165 170 175

Val Ile Ala Ser Lys Thr Met Asn Thr His Leu His Val Leu Glu Ser

180 185 190

Tyr Thr Asn Leu Tyr Arg Leu Leu Lys Leu Asp Asp Val Tyr Glu Ala

195 200 205

Leu Glu Trp Ile Val Arg Leu Phe Val Asp Lys Ile Tyr Lys Lys Gly

210 215 220

Thr Gly His Phe Lys Val Phe Cys Asp Asp Asn Trp Asn Glu Leu Ile

225 230 235 240

Lys Ala Val Ser Tyr Gly His Asp Ile Glu Ala Ser Trp Leu Leu Asp

245 250 255

Gln Ala Ala Lys Tyr Leu Lys Asp Glu Lys Leu Lys Glu Glu Val Glu

260 265 270

Lys Leu Ala Leu Glu Val Ala Gln Ile Thr Leu Lys Glu Ala Phe Asp

275 280 285

Gly Gln Ser Leu Ile Asn Glu Met Ile Glu Asp Arg Ile Asp Arg Ser

290 295 300

Lys Ile Trp Trp Val Glu Ala Glu Thr Val Val Gly Phe Phe Asn Ala

305 310 315 320

Tyr Gln Lys Thr Lys Glu Glu Lys Tyr Leu Asp Ala Ala Ile Lys Thr

325 330 335

Trp Glu Phe Ile Lys Glu His Leu Val Asp Arg Arg Lys Asn Ser Glu

340 345 350

Trp Leu Trp Lys Val Asn Glu Asp Leu Glu Ala Val Asn Met Pro Ile

355 360 365

Val Glu Ala Trp Lys Cys Pro Tyr His Asn Gly Arg Met Cys Leu Glu

370 375 380

Ile Ile Lys Arg Val Asp

385 390

<210> 3

<211> 390

<212> PRT

<213> Artificial sequence

<400> 3

Met Asp Ile Thr Arg Phe Lys Glu Asp Leu Lys Ala His Leu Glu Glu

1 5 10 15

Lys Ile Ile Pro Phe Trp Gln Ser Leu Lys Asp Asp Glu Phe Gly Gly

20 25 30

Tyr Tyr Gly Tyr Met Asp Phe Asn Leu Asn Ile Asp Arg Lys Ala Gln

35 40 45

Lys Gly Cys Ile Leu Asn Ser Arg Ile Leu Trp Phe Phe Ser Ala Cys

50 55 60

Tyr Asn Val Leu Lys Ser Glu Lys Cys Lys Glu Met Ala Phe His Ala

65 70 75 80

Phe Glu Phe Leu Lys Asn Lys Phe Trp Asp Lys Glu Tyr Glu Gly Leu

85 90 95

Phe Trp Ser Val Ser His Lys Gly Val Pro Val Asp Val Thr Lys His

100 105 110

Val Tyr Val Gln Ala Phe Gly Ile Tyr Gly Leu Ser Glu Tyr Tyr Glu

115 120 125

Ala Ser Gly Asp Glu Glu Ala Leu His Met Ala Lys Arg Leu Phe Glu

130 135 140

Ile Leu Glu Thr Lys Cys Lys Arg Glu Asn Gly Tyr Thr Glu Gln Phe

145 150 155 160

Glu Arg Asn Trp Gln Glu Lys Glu Asn Arg Phe Leu Ser Glu Asn Gly

165 170 175

Val Ile Ala Ser Lys Thr Met Asn Thr His Leu His Val Leu Glu Ser

180 185 190

Tyr Thr Asn Leu Tyr Arg Leu Leu Lys Leu Asp Asp Val Tyr Glu Ala

195 200 205

Leu Glu Trp Ile Val Arg Leu Phe Val Asp Lys Ile Tyr Lys Lys Gly

210 215 220

Thr Gly His Phe Lys Val Phe Cys Asp Asp Asn Trp Asn Glu Leu Ile

225 230 235 240

Lys Ala Val Ser Tyr Gly His Asp Ile Glu Ala Ser Trp Leu Leu Asp

245 250 255

Gln Ala Ala Lys Tyr Leu Lys Asp Glu Lys Leu Lys Glu Glu Val Glu

260 265 270

Lys Leu Ala Leu Glu Val Ala Gln Ile Thr Leu Lys Glu Ala Phe Asp

275 280 285

Gly Gln Ser Leu Ile Asn Glu Met Ile Glu Asp Arg Ile Asp Arg Ser

290 295 300

Lys Ile Trp Trp Val Glu Ala Glu Thr Val Val Gly Phe Phe Asn Ala

305 310 315 320

Tyr Gln Lys Thr Lys Glu Glu Lys Tyr Leu Asp Ala Ala Ile Lys Thr

325 330 335

Trp Glu Phe Ile Lys Glu His Leu Val Asp Arg Arg Lys Asn Ser Glu

340 345 350

Trp Leu Trp Lys Val Asn Glu Asp Leu Glu Ala Val Asn Met Pro Ile

355 360 365

Val Glu Cys Trp Lys Cys Pro Tyr His Asn Gly Arg Met Cys Leu Glu

370 375 380

Ile Ile Lys Arg Val Asp

385 390

<210> 4

<211> 390

<212> PRT

<213> Artificial sequence

<400> 4

Met Asp Ile Thr Arg Phe Lys Glu Asp Leu Lys Ala His Leu Glu Glu

1 5 10 15

Lys Ile Ile Pro Phe Trp Gln Ser Leu Lys Asp Asp Glu Phe Gly Gly

20 25 30

Tyr Tyr Gly Tyr Met Asp Phe Asn Leu Asn Ile Asp Arg Lys Ala Gln

35 40 45

Lys Gly Cys Ile Leu Asn Ser Arg Ile Leu Trp Phe Phe Ser Ala Cys

50 55 60

Tyr Asn Val Leu Lys Ser Glu Lys Cys Lys Glu Met Ala Phe His Ala

65 70 75 80

Phe Glu Phe Leu Lys Asn Lys Phe Trp Asp Lys Glu Tyr Glu Gly Leu

85 90 95

Phe Trp Ser Val Ser His Lys Gly Val Pro Val Asp Val Thr Lys His

100 105 110

Val Tyr Val Gln Ala Phe Gly Ile Tyr Gly Leu Ser Glu Tyr Tyr Glu

115 120 125

Ala Ser Gly Asp Glu Glu Ala Leu His Met Ala Lys Arg Leu Phe Glu

130 135 140

Ile Leu Glu Thr Lys Cys Lys Arg Glu Asn Gly Tyr Thr Glu Gln Phe

145 150 155 160

Glu Arg Asn Trp Gln Glu Lys Glu Asn Arg Phe Leu Ser Glu Asn Gly

165 170 175

Val Ile Ala Ser Lys Thr Met Asn Thr His Leu His Val Leu Glu Ser

180 185 190

Tyr Thr Asn Leu Tyr Arg Leu Leu Lys Leu Asp Asp Val Tyr Glu Ala

195 200 205

Leu Glu Trp Ile Val Arg Leu Phe Val Asp Lys Ile Tyr Lys Lys Gly

210 215 220

Thr Gly His Phe Lys Val Phe Cys Asp Asp Asn Trp Asn Glu Leu Ile

225 230 235 240

Lys Ala Val Ser Tyr Gly His Asp Ile Glu Ala Ser Trp Leu Leu Asp

245 250 255

Gln Ala Ala Lys Tyr Leu Lys Asp Glu Lys Leu Lys Glu Glu Val Glu

260 265 270

Lys Leu Ala Leu Glu Val Ala Gln Ile Thr Leu Lys Glu Ala Phe Asp

275 280 285

Gly Gln Ser Leu Ile Asn Glu Met Ile Glu Asp Arg Ile Asp Arg Ser

290 295 300

Lys Ile Trp Trp Val Glu Ala Glu Thr Val Val Gly Phe Phe Asn Ala

305 310 315 320

Tyr Gln Lys Thr Lys Glu Glu Lys Tyr Leu Asp Ala Ala Ile Lys Thr

325 330 335

Trp Glu Phe Ile Lys Glu His Leu Val Asp Arg Arg Lys Asn Ser Glu

340 345 350

Trp Leu Trp Lys Val Asn Glu Asp Leu Glu Ala Val Asn Met Pro Ile

355 360 365

Val Glu Glu Trp Lys Cys Pro Tyr His Asn Gly Arg Met Cys Leu Glu

370 375 380

Ile Ile Lys Arg Val Asp

385 390

<210> 5

<211> 390

<212> PRT

<213> Artificial sequence

<400> 5

Met Asp Ile Thr Arg Phe Lys Glu Asp Leu Lys Ala His Leu Glu Glu

1 5 10 15

Lys Ile Ile Pro Phe Trp Gln Ser Leu Lys Asp Asp Glu Phe Gly Gly

20 25 30

Tyr Tyr Gly Tyr Met Asp Phe Asn Leu Asn Ile Asp Arg Lys Ala Gln

35 40 45

Lys Gly Cys Ile Leu Asn Ser Arg Ile Leu Trp Phe Phe Ser Ala Cys

50 55 60

Tyr Asn Val Leu Lys Ser Glu Lys Cys Lys Glu Met Ala Phe His Ala

65 70 75 80

Phe Glu Phe Leu Lys Asn Lys Phe Trp Asp Lys Glu Tyr Glu Gly Leu

85 90 95

Phe Trp Ser Val Ser His Lys Gly Val Pro Val Asp Val Thr Lys His

100 105 110

Val Tyr Val Gln Ala Phe Gly Ile Tyr Gly Leu Ser Glu Tyr Tyr Glu

115 120 125

Ala Ser Gly Asp Glu Glu Ala Leu His Met Ala Lys Arg Leu Phe Glu

130 135 140

Ile Leu Glu Thr Lys Cys Lys Arg Glu Asn Gly Tyr Thr Glu Gln Phe

145 150 155 160

Glu Arg Asn Trp Gln Glu Lys Glu Asn Arg Phe Leu Ser Glu Asn Gly

165 170 175

Val Ile Ala Ser Lys Thr Met Asn Thr His Leu His Val Leu Glu Ser

180 185 190

Tyr Thr Asn Leu Tyr Arg Leu Leu Lys Leu Asp Asp Val Tyr Glu Ala

195 200 205

Leu Glu Trp Ile Val Arg Leu Phe Val Asp Lys Ile Tyr Lys Lys Gly

210 215 220

Thr Gly His Phe Lys Val Phe Cys Asp Asp Asn Trp Asn Glu Leu Ile

225 230 235 240

Lys Ala Val Ser Tyr Gly His Asp Ile Glu Ala Ser Trp Leu Leu Asp

245 250 255

Gln Ala Ala Lys Tyr Leu Lys Asp Glu Lys Leu Lys Glu Glu Val Glu

260 265 270

Lys Leu Ala Leu Glu Val Ala Gln Ile Thr Leu Lys Glu Ala Phe Asp

275 280 285

Gly Gln Ser Leu Ile Asn Glu Met Ile Glu Asp Arg Ile Asp Arg Ser

290 295 300

Lys Ile Trp Trp Val Glu Ala Glu Thr Val Val Gly Phe Phe Asn Ala

305 310 315 320

Tyr Gln Lys Thr Lys Glu Glu Lys Tyr Leu Asp Ala Ala Ile Lys Thr

325 330 335

Trp Glu Phe Ile Lys Glu His Leu Val Asp Arg Arg Lys Asn Ser Glu

340 345 350

Trp Leu Trp Lys Val Asn Glu Asp Leu Glu Ala Val Asn Met Pro Ile

355 360 365

Val Glu Phe Trp Lys Cys Pro Tyr His Asn Gly Arg Met Cys Leu Glu

370 375 380

Ile Ile Lys Arg Val Asp

385 390

<210> 6

<211> 390

<212> PRT

<213> Artificial sequence

<400> 6

Met Asp Ile Thr Arg Phe Lys Glu Asp Leu Lys Ala His Leu Glu Glu

1 5 10 15

Lys Ile Ile Pro Phe Trp Gln Ser Leu Lys Asp Asp Glu Phe Gly Gly

20 25 30

Tyr Tyr Gly Tyr Met Asp Phe Asn Leu Asn Ile Asp Arg Lys Ala Gln

35 40 45

Lys Gly Cys Ile Leu Asn Ser Arg Ile Leu Trp Phe Phe Ser Ala Cys

50 55 60

Tyr Asn Val Leu Lys Ser Glu Lys Cys Lys Glu Met Ala Phe His Ala

65 70 75 80

Phe Glu Phe Leu Lys Asn Lys Phe Trp Asp Lys Glu Tyr Glu Gly Leu

85 90 95

Phe Trp Ser Val Ser His Lys Gly Val Pro Val Asp Val Thr Lys His

100 105 110

Val Tyr Val Gln Ala Phe Gly Ile Tyr Gly Leu Ser Glu Tyr Tyr Glu

115 120 125

Ala Ser Gly Asp Glu Glu Ala Leu His Met Ala Lys Arg Leu Phe Glu

130 135 140

Ile Leu Glu Thr Lys Cys Lys Arg Glu Asn Gly Tyr Thr Glu Gln Phe

145 150 155 160

Glu Arg Asn Trp Gln Glu Lys Glu Asn Arg Phe Leu Ser Glu Asn Gly

165 170 175

Val Ile Ala Ser Lys Thr Met Asn Thr His Leu His Val Leu Glu Ser

180 185 190

Tyr Thr Asn Leu Tyr Arg Leu Leu Lys Leu Asp Asp Val Tyr Glu Ala

195 200 205

Leu Glu Trp Ile Val Arg Leu Phe Val Asp Lys Ile Tyr Lys Lys Gly

210 215 220

Thr Gly His Phe Lys Val Phe Cys Asp Asp Asn Trp Asn Glu Leu Ile

225 230 235 240

Lys Ala Val Ser Tyr Gly His Asp Ile Glu Ala Ser Trp Leu Leu Asp

245 250 255

Gln Ala Ala Lys Tyr Leu Lys Asp Glu Lys Leu Lys Glu Glu Val Glu

260 265 270

Lys Leu Ala Leu Glu Val Ala Gln Ile Thr Leu Lys Glu Ala Phe Asp

275 280 285

Gly Gln Ser Leu Ile Asn Glu Met Ile Glu Asp Arg Ile Asp Arg Ser

290 295 300

Lys Ile Trp Trp Val Glu Ala Glu Thr Val Val Gly Phe Phe Asn Ala

305 310 315 320

Tyr Gln Lys Thr Lys Glu Glu Lys Tyr Leu Asp Ala Ala Ile Lys Thr

325 330 335

Trp Glu Phe Ile Lys Glu His Leu Val Asp Arg Arg Lys Asn Ser Glu

340 345 350

Trp Leu Trp Lys Val Asn Glu Asp Leu Glu Ala Val Asn Met Pro Ile

355 360 365

Val Glu Gly Trp Lys Cys Pro Tyr His Asn Gly Arg Met Cys Leu Glu

370 375 380

Ile Ile Lys Arg Val Asp

385 390

<210> 7

<211> 390

<212> PRT

<213> Artificial sequence

<400> 7

Met Asp Ile Thr Arg Phe Lys Glu Asp Leu Lys Ala His Leu Glu Glu

1 5 10 15

Lys Ile Ile Pro Phe Trp Gln Ser Leu Lys Asp Asp Glu Phe Gly Gly

20 25 30

Tyr Tyr Gly Tyr Met Asp Phe Asn Leu Asn Ile Asp Arg Lys Ala Gln

35 40 45

Lys Gly Cys Ile Leu Asn Ser Arg Ile Leu Trp Phe Phe Ser Ala Cys

50 55 60

Tyr Asn Val Leu Lys Ser Glu Lys Cys Lys Glu Met Ala Phe His Ala

65 70 75 80

Phe Glu Phe Leu Lys Asn Lys Phe Trp Asp Lys Glu Tyr Glu Gly Leu

85 90 95

Phe Trp Ser Val Ser His Lys Gly Val Pro Val Asp Val Thr Lys His

100 105 110

Val Tyr Val Gln Ala Phe Gly Ile Tyr Gly Leu Ser Glu Tyr Tyr Glu

115 120 125

Ala Ser Gly Asp Glu Glu Ala Leu His Met Ala Lys Arg Leu Phe Glu

130 135 140

Ile Leu Glu Thr Lys Cys Lys Arg Glu Asn Gly Tyr Thr Glu Gln Phe

145 150 155 160

Glu Arg Asn Trp Gln Glu Lys Glu Asn Arg Phe Leu Ser Glu Asn Gly

165 170 175

Val Ile Ala Ser Lys Thr Met Asn Thr His Leu His Val Leu Glu Ser

180 185 190

Tyr Thr Asn Leu Tyr Arg Leu Leu Lys Leu Asp Asp Val Tyr Glu Ala

195 200 205

Leu Glu Trp Ile Val Arg Leu Phe Val Asp Lys Ile Tyr Lys Lys Gly

210 215 220

Thr Gly His Phe Lys Val Phe Cys Asp Asp Asn Trp Asn Glu Leu Ile

225 230 235 240

Lys Ala Val Ser Tyr Gly His Asp Ile Glu Ala Ser Trp Leu Leu Asp

245 250 255

Gln Ala Ala Lys Tyr Leu Lys Asp Glu Lys Leu Lys Glu Glu Val Glu

260 265 270

Lys Leu Ala Leu Glu Val Ala Gln Ile Thr Leu Lys Glu Ala Phe Asp

275 280 285

Gly Gln Ser Leu Ile Asn Glu Met Ile Glu Asp Arg Ile Asp Arg Ser

290 295 300

Lys Ile Trp Trp Val Glu Ala Glu Thr Val Val Gly Phe Phe Asn Ala

305 310 315 320

Tyr Gln Lys Thr Lys Glu Glu Lys Tyr Leu Asp Ala Ala Ile Lys Thr

325 330 335

Trp Glu Phe Ile Lys Glu His Leu Val Asp Arg Arg Lys Asn Ser Glu

340 345 350

Trp Leu Trp Lys Val Asn Glu Asp Leu Glu Ala Val Asn Met Pro Ile

355 360 365

Val Glu Arg Trp Lys Cys Pro Tyr His Asn Gly Arg Met Cys Leu Glu

370 375 380

Ile Ile Lys Arg Val Asp

385 390

<210> 8

<211> 390

<212> PRT

<213> Artificial sequence

<400> 8

Met Asp Ile Thr Arg Phe Lys Glu Asp Leu Lys Ala His Leu Glu Glu

1 5 10 15

Lys Ile Ile Pro Phe Trp Gln Ser Leu Lys Asp Asp Glu Phe Gly Gly

20 25 30

Tyr Tyr Gly Tyr Met Asp Phe Asn Leu Asn Ile Asp Arg Lys Ala Gln

35 40 45

Lys Gly Cys Ile Leu Asn Ser Arg Ile Leu Trp Phe Phe Ser Ala Cys

50 55 60

Tyr Asn Val Leu Lys Ser Glu Lys Cys Lys Glu Met Ala Phe His Ala

65 70 75 80

Phe Glu Phe Leu Lys Asn Lys Phe Trp Asp Lys Glu Tyr Glu Gly Leu

85 90 95

Phe Trp Ser Val Ser His Lys Gly Val Pro Val Asp Val Thr Lys His

100 105 110

Val Tyr Val Gln Ala Phe Gly Ile Tyr Gly Leu Ser Glu Tyr Tyr Glu

115 120 125

Ala Ser Gly Asp Glu Glu Ala Leu His Met Ala Lys Arg Leu Phe Glu

130 135 140

Ile Leu Glu Thr Lys Cys Lys Arg Glu Asn Gly Tyr Thr Glu Gln Phe

145 150 155 160

Glu Arg Asn Trp Gln Glu Lys Glu Asn Arg Phe Leu Ser Glu Asn Gly

165 170 175

Val Ile Ala Ser Lys Thr Met Asn Thr His Leu His Val Leu Glu Ser

180 185 190

Tyr Thr Asn Leu Tyr Arg Leu Leu Lys Leu Asp Asp Val Tyr Glu Ala

195 200 205

Leu Glu Trp Ile Val Arg Leu Phe Val Asp Lys Ile Tyr Lys Lys Gly

210 215 220

Thr Gly His Phe Lys Val Phe Cys Asp Asp Asn Trp Asn Glu Leu Ile

225 230 235 240

Lys Ala Val Ser Tyr Gly His Asp Ile Glu Ala Ser Trp Leu Leu Asp

245 250 255

Gln Ala Ala Lys Tyr Leu Lys Asp Glu Lys Leu Lys Glu Glu Val Glu

260 265 270

Lys Leu Ala Leu Glu Val Ala Gln Ile Thr Leu Lys Glu Ala Phe Asp

275 280 285

Gly Gln Ser Leu Ile Asn Glu Met Ile Glu Asp Arg Ile Asp Arg Ser

290 295 300

Lys Ile Trp Trp Val Glu Ala Glu Thr Val Val Gly Phe Phe Asn Ala

305 310 315 320

Tyr Gln Lys Thr Lys Glu Glu Lys Tyr Leu Asp Ala Ala Ile Lys Thr

325 330 335

Trp Glu Phe Ile Lys Glu His Leu Val Asp Arg Arg Lys Asn Ser Glu

340 345 350

Trp Leu Ala Lys Val Asn Glu Asp Leu Glu Ala Val Asn Met Pro Ile

355 360 365

Val Glu Cys Trp Lys Cys Pro Tyr His Asn Gly Arg Met Cys Leu Glu

370 375 380

Ile Ile Lys Arg Val Asp

385 390

<210> 9

<211> 390

<212> PRT

<213> Artificial sequence

<400> 9

Met Asp Ile Thr Arg Phe Lys Glu Asp Leu Lys Ala His Leu Glu Glu

1 5 10 15

Lys Ile Ile Pro Phe Trp Gln Ser Leu Lys Asp Asp Glu Phe Gly Gly

20 25 30

Tyr Tyr Gly Tyr Met Asp Phe Asn Leu Asn Ile Asp Arg Lys Ala Gln

35 40 45

Lys Gly Cys Ile Leu Asn Ser Arg Ile Leu Trp Phe Phe Ser Ala Cys

50 55 60

Tyr Asn Val Leu Lys Ser Glu Lys Cys Lys Glu Met Ala Phe His Ala

65 70 75 80

Phe Glu Phe Leu Lys Asn Lys Phe Trp Asp Lys Glu Tyr Glu Gly Leu

85 90 95

Phe Trp Ser Val Ser His Lys Gly Val Pro Val Asp Val Thr Lys His

100 105 110

Val Tyr Val Gln Ala Phe Gly Ile Tyr Gly Leu Ser Glu Tyr Tyr Glu

115 120 125

Ala Ser Gly Asp Glu Glu Ala Leu His Met Ala Lys Arg Leu Phe Glu

130 135 140

Ile Leu Glu Thr Lys Cys Lys Arg Glu Asn Gly Tyr Thr Glu Gln Phe

145 150 155 160

Glu Arg Asn Trp Gln Glu Lys Glu Asn Arg Phe Leu Ser Glu Asn Gly

165 170 175

Val Ile Ala Ser Lys Thr Met Asn Thr His Leu His Val Leu Glu Ser

180 185 190

Tyr Thr Asn Leu Tyr Arg Leu Leu Lys Leu Asp Asp Val Tyr Glu Ala

195 200 205

Leu Glu Trp Ile Val Arg Leu Phe Val Asp Lys Ile Tyr Lys Lys Gly

210 215 220

Thr Gly His Phe Lys Val Phe Cys Asp Asp Asn Trp Asn Glu Leu Ile

225 230 235 240

Lys Ala Val Ser Tyr Gly His Asp Ile Glu Ala Ser Trp Leu Leu Asp

245 250 255

Gln Ala Ala Lys Tyr Leu Lys Asp Glu Lys Leu Lys Glu Glu Val Glu

260 265 270

Lys Leu Ala Leu Glu Val Ala Gln Ile Thr Leu Lys Glu Ala Phe Asp

275 280 285

Gly Gln Ser Leu Ile Asn Glu Met Ile Glu Asp Arg Ile Asp Arg Ser

290 295 300

Lys Ile Trp Trp Val Glu Ala Glu Thr Val Val Gly Phe Phe Asn Ala

305 310 315 320

Tyr Gln Lys Thr Lys Glu Glu Lys Tyr Leu Asp Ala Ala Ile Lys Thr

325 330 335

Trp Glu Phe Ile Lys Glu His Leu Val Asp Arg Arg Lys Asn Ser Glu

340 345 350

Trp Leu Gln Lys Val Asn Glu Asp Leu Glu Ala Val Asn Met Pro Ile

355 360 365

Val Glu Cys Trp Lys Cys Pro Tyr His Asn Gly Arg Met Cys Leu Glu

370 375 380

Ile Ile Lys Arg Val Asp

385 390

Claims

1. A cellobiose epimerase mutant, which is characterized in that the mutant is subjected to mutation at 371 th site and/or 355 th site on the basis of a wild enzyme with an amino acid sequence shown as SEQ ID NO. 1;

the mutation is to mutate 371 th glutamine into alanine, glutamic acid, cysteine, phenylalanine, glycine or arginine, and to mutate 355 th tryptophan into alanine or glutamine.

2. A gene encoding the cellobiose epimerase mutant of claim 1.

3. A vector carrying the gene of claim 2.

4. A recombinant bacterium comprising the cellobiose epimerase mutant of claim 1 or the vector of claim 3.

5. The recombinant bacterium according to claim 4, wherein Escherichia coli is used as a host.

6. The recombinant bacterium of claim 5, wherein said E.coli comprises BL21(DE 3).

7. The recombinant bacterium of claim 4, wherein the expression vector comprises pET-28 b.

8. A method for improving the structure isomerization activity of cellobiose epimerase is characterized in that on the basis of wild enzyme with an amino acid sequence shown as SEQ ID NO.1, the 371 th glutamine is mutated into alanine, glutamic acid, cysteine, phenylalanine, glycine or arginine;

or, on the basis of the wild enzyme with the amino acid sequence shown as SEQ ID NO.1, tryptophan at position 355 is mutated into alanine or glutamine.

9. Use of the cellobiose epimerase mutant as claimed in claim 1 or the recombinant bacterium as claimed in any one of claims 4 to 7 in the preparation of lactulose.

10. Use of the cellobiose epimerase mutant as claimed in claim 1 or the recombinant bacterium as claimed in any one of claims 4 to 7 in the preparation of food and medicine.