CN107058310A - A kind of amplicon library constructing method for improving gene low frequency abrupt climatic change sensitivity - Google Patents
A kind of amplicon library constructing method for improving gene low frequency abrupt climatic change sensitivity Download PDFInfo
- Publication number
- CN107058310A CN107058310A CN201710382858.2A CN201710382858A CN107058310A CN 107058310 A CN107058310 A CN 107058310A CN 201710382858 A CN201710382858 A CN 201710382858A CN 107058310 A CN107058310 A CN 107058310A
- Authority
- CN
- China
- Prior art keywords
- sequence
- sequences
- primer
- hairpin structure
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of for amplicon amplified library and the multiple upstream hairpin structure primer used when being enriched with and the amplicon library constructing method for using the multiple upstream hairpin structure primer to improve gene low frequency abrupt climatic change sensitivity, the primer includes from 3 ' ends to 5 ' ends：With the specific sequence A1 of target area sequence complementary pairing；The critical sequences A2 of hairpin structure；With the reverse complementary sequence A3 of 5 ' end A7 sequences；Hairpin structure removes critical sequences A4；Sequence of barcodes A5；Joint sequence A6；5 ' terminal sequence A7；A3 and A7 complementary pairings, form the stem structure of the multiple upstream hairpin structure primer；A4, A5 and A6 form the loop section of the multiple upstream hairpin structure primer.
Description
Technical field
The invention belongs to high-flux sequence field, specifically, detection in Gene Mutation is improved the present invention relates to one kind sensitive
The amplicon library constructing method of degree.
Background technology
Amplicon capture sequencing technologies are a kind of target capture sequencing technologies, main to utilize multiple PCR technique simultaneously to many
Individual target area sequence carries out specific amplification and enrichment, obtains expanding sublibrary, then using two generation sequencing technologies to amplification
Sublibrary is sequenced, so as to obtain the sequence information of target area.Amplicon captures sequencing technologies because of combination (panel) design
Flexibly, flux is high, the economic advantage such as quick, has become the mainstream technology that field is sequenced in target capture, is widely used in biology
Basic research and clinical disease diagnosis.
Although amplicon capture sequencing technologies are widely used, its performance in gene low frequency abrupt climatic change field is poor
Strong man anticipates, and false positive easily occurs in testing result, therefore is faced with severe challenge.The experimental results show false positive occur
As a result mainly caused by following two reasons：The read error of single base in first, Illumina microarray dataset sequencing procedure
Rate is 0.2%, and the error rate that archaeal dna polymerase introduces false bases is 10-7-10-5, based on this reason, amplicon capture sequencing skill
The sensitivity of art detection mutator is about 1%；Second, tumour gDNA or ctDNA, because containing a large amount of heterogeneous DNA,
Cause that the accounting of mutator is extremely low, the frequency of mutation is generally between 0.01%-1%.Therefore, amplicon capture sequencing technologies
Because detection sensitivity is less than the frequency that target site is mutated, testing result is caused false positive easily occur.In order to solve the problem,
Scientific research personnel uses for reference the thinking that liquid phase capture sequencing technologies solve the problem, sequence and sequence measuring joints sequence in target area
(adapter) sequence of barcodes (barcode) of one section of 12 degeneracy base composition is introduced between, is distinguished as molecular label true
Positive natural mutation, makes every effort to improve the sensitivity of detection, reduces false positive.Related experiment result shows that the strategy is improved really
The sensitivity of detection, but be due to the presence of 12 degeneracy bases, between causing primer sequence complementary pairing forms substantial amounts of
Primer dimer and non-specific amplification band, cause the sequencing quality in library to decline, comparison rate decline, capture rate decline,
Homogeneity decline, the increase of sequencing noise, sequencing cost increase, and amplicon capture sequencing technologies answering in the field is constrained on the contrary
With.
Therefore, the higher amplicon capture sequencing technologies of sensitivity are badly in need of in gene low frequency abrupt climatic change field.
The content of the invention
In order to solve the problem of prior art is present, present invention improves over the side that sequence of barcodes is incorporated into amplification sublibrary
There is provided a kind of amplicon library constructing method for improving gene low frequency abrupt climatic change sensitivity for formula.This method is improving gene
While abrupt climatic change sensitivity, the high flux for expanding sublibrary, coverage rate height, capture rate height, homogeneity still can be kept
The advantage such as good.
Present disclosure includes two aspects, and first aspect is to devise one kind to be used for amplicon amplified library and enrichment
When the multiple upstream hairpin structure primer that uses, the primer includes sequence A1-A7 from 3 ' ends to 5 ' ends：
A1 sequences are specific sequence, with target area sequence complementary pairing, trigger the specific amplification and richness of amplicon
Collection；
A2 sequences are the critical sequences of hairpin structure, are made up of the continuous C and G bases of two or more；
A3 sequences are the reverse complementary sequence of 5 ' end A7 sequences；
A4 sequences are the critical sequences that go of hairpin structure, and base number is 2-8, and A and T is more than G and C in base sequence；
A5 sequences are sequence of barcodes, are made up of 8-16 degeneracy base；
A6 sequences are sequence measuring joints sequence；
A7 sequences are 5 ' terminal sequences, with A3 sequence reverse complementals；
A3 and A7 complementary pairings, form the stem structure of the multiple upstream hairpin structure primer；
A4, A5 and A6 form the loop section of the multiple upstream hairpin structure primer.
In preferred embodiments, the A1 specific sequences are designed according to design of primers principle.
In preferred embodiments, in the A2 sequences, critical sequences are generally by the continuous C and G bases of two or more
Constitute, but the number and sequence of base are unrestricted, preferably less than 20, most preferably more preferably less than 10, less than 5.
In preferred embodiments, the 5 ' ends that A3 sequences and A7 sequences form local double-strand can be single-stranded, or
The double-strand (in the case of being the double-strand of closing at 5 ' ends of local double-strand, 5 ' ends of A2 sequences and A7 sequences are complementary) of closing, institute
State the stem portion that double-strand is the multiple upstream hairpin structure primer.The base and number that A3 and A7 form local double-strand will not
Ask, but local duplex structure is stable between 55 DEG C -67 DEG C, such as 59-64 DEG C, it is stable at preferably 62 DEG C, at 70 DEG C -78
DEG C, such as unwind, can be unwind to be single-stranded at preferably 71 DEG C -74 DEG C between 70-76 DEG C.
In preferred embodiments, in the A4 sequences, the base number of critical sequences is gone to be preferably generally 2-4,
A and T is more than G and C, preferably all A or T in base sequence.
In preferred embodiments, in the A5 sequences, sequence of barcodes is generally by 12 bases (NNNNNNNNNNNN, N
Represent any one of A, T, G, C) Sequence composition, but the number of base can be increased and decreased according to the flux of amplicon.
In preferred embodiments, the A6 sequences are full length sequence or the removal portion of Illumina sequence measuring joints P5 sequences
Divide the Illumina sequence measuring joints P5 sequences of 5 ' sequences.
In preferred embodiments, the A7 sequences can be the partial sequence of A6 sequences 5 ', or other sequences.
In preferred embodiments, A5 and A6 form the loop section of the multiple upstream hairpin structure primer.
The second aspect of the present invention provides a kind of amplicon library construction for improving gene low frequency abrupt climatic change sensitivity
Method, the described method comprises the following steps：
S1：The 1st, which is carried out, using multiple upstream hairpin structure primer and the multiple downstream primer with universal sequence takes turns multiplex PCR
Reaction, obtains amplicon, while A5 sequence of barcodes and A6 sequences to be incorporated into the 5 ' ends of amplification subsequence；By in next round PCR
The complementary series of P7 adapter-primers identification is incorporated into the 3 ' ends of amplification subsequence；
S2：Protease is added into last round of reaction system, 62 DEG C of incubation 15min inactivate archaeal dna polymerase, then 94
15min, inactivated proteases are incubated at DEG C；
S3：The 2nd wheel joint sequence PCR reactions are carried out, using the 1st wheel amplified production as template, with Illumina P5 joint sequences
Sense primer is classified as, P7 joint sequences are anti-sense primer, P5 and P7 sequences are introduced between to the both sides of amplicon, expanded
Sublibrary；
S4：The library of S3 steps is purified using magnetic bead, the sequencing of two generations is carried out after quantifying.
In optimization experiment scheme, in the step S1 of methods described, sense primer used is this in PCR reaction systems
The hairpin structure primer of invention part 1 design, downstream primer sequence is divided into two parts, and its 3 ' terminal sequence is specific sequence
Row, can be with target area sequence complementary pairing；Its 5 ' terminal sequence is universal sequence, can be drawn by the P7 in the 2nd wheel PCR reactions
Thing complementary pairing.Final concentration of the upstream and downstream primer in reaction system is generally between 20nM-120nM, specific concentration and amplification
Sub- flux is related.Template used in PCR reaction systems is usually DNA, and archaeal dna polymerase is commercially available exo+ polymerase.
In preferred embodiments, in the step S1 of methods described, the period of PCR reactions is usually 2-4, reaction
Condition is as follows：95 DEG C of pre-degeneration 3min30s；98 DEG C of denaturation 20s, 64 DEG C of annealing 6min 30s, 72 DEG C of extension 45s；Final step
72 DEG C of extension 5min.Reaction condition can do corresponding adjustment according to the initial amount of template and the flux in library.
In preferred embodiments, in the step S2 of methods described, protease generally uses commercially available Proteinase K.
In preferred embodiments, in the step S3 of methods described, the amplification taken turns in PCR reaction systems with part the 1st
Product is template, and sequence measuring joints P5 and P7 sequence use commercially available high-fidelity DNA polymerase as primer, DNA enzymatic.PCR's is anti-
Answer condition as follows：95 DEG C of pre-degeneration 3min 30s；98 DEG C of denaturation 20s, 72 DEG C of annealing 4min, expand 18-25 circulation；Last 72
DEG C extension 5min.Reaction condition does corresponding adjustment according to the initial amount of template and the flux in library.
Brief description of the drawings
Present invention is illustrated by the following drawings：
Fig. 1 shows the sequence the Nomenclature Composition and Structure of Complexes of multiple upstream hair fastener primer；
Fig. 2 shows to expand the structure flow of sublibrary；
Fig. 3 shows exemplary multiple upstream hair fastener primer A2-A7 sequence information；
Fig. 4 shows the 50 re-spread quality inspection results for increasing sublibrary.
Embodiment
In order to solve the problem of prior art is present, present invention improves over the side that sequence of barcodes is incorporated into amplification sublibrary
There is provided a kind of amplicon library constructing method for improving gene low frequency abrupt climatic change sensitivity for formula.This method is improving gene
While abrupt climatic change sensitivity, the high flux for expanding sublibrary, coverage rate height, capture rate height, homogeneity still can be kept
The advantage such as good.
Present disclosure includes two aspects, and first aspect is to devise one kind to be used for amplicon amplified library and enrichment
When the multiple upstream hairpin structure primer that uses, the primer includes sequence A1-A7 from 3 ' ends to 5 ' ends (referring to Fig. 1)：
A1 sequence-specific sequences, with target area sequence complementary pairing, trigger specific amplification and the enrichment of amplicon；
A2 sequences are the critical sequences of hairpin structure；
A3 sequences are the complementary series of 5 ' end A7 sequences；
A4 sequences remove critical sequences for hairpin structure；
A5 sequences are sequence of barcodes, are generally made up of 12 degeneracy bases；
A6 sequences are the P5 joint sequences that use in Illumina microarray datasets；
A7 sequences are 5 ' terminal sequences, with A3 sequence reverse complementals；
A3 sequences are the reverse complementary sequence of A7 5 ' terminal sequences, A3 and A7 complementary pairings, are formed in hairpin structure primer
Local duplex structure；
For the A1 specific sequences, the design principle and mode of primer are preferably as follows described in text；
In the A2 sequences, critical sequences are generally made up of two continuous C and G bases, but the number and sequence of base
Row are unrestricted；
In the A3 sequences, A3 sequences are the reverse complementary sequence of 5 ' end A7 sequences, and both form the 5 ' of local double-strand
End can be single-stranded, or the double-strand of closing (in the case of double-strand of the 5 ' ends of local double-strand for closing, A2 sequences and
5 ' ends of A7 sequences are complementary), the double-strand is the stem portion of the multiple upstream hairpin structure primer.A3 and A7 form local double
The base and number of chain are not required, but the structure of local double-strand is stable in 55 DEG C of -67 DEG C of stabilizations, preferably 62 DEG C, 70
DEG C -78 DEG C unwind, and can be unwind to be single-stranded at preferably 70 DEG C -74 DEG C；
In the A4 sequences, the base number for removing critical sequences is usually 2-4, and base sequence is usually A or T；
In the A5 sequences, generally by 12 base sequences, (NNNNNNNNNNNN, N are represented in A, T, G, C sequence of barcodes
Any one) constitute, but the number of base can be increased and decreased according to the flux of amplicon；
The A6 sequences are the full length sequence of Illumina sequence measuring joints P5 sequences or remove the sequence of part 5 '
Illumina sequence measuring joints P5 sequences
In preferred embodiments, the A7 sequences can be the partial sequence of A6 sequences 5 ', or other sequences.
A4, A5 and A6 form the loop section of the multiple upstream hairpin structure primer.
The second aspect of the present invention provides a kind of amplicon library construction for improving gene low frequency abrupt climatic change sensitivity
Method, the described method comprises the following steps：
S1：The 1st, which is carried out, using multiple upstream hairpin structure primer and the multiple downstream primer with universal sequence takes turns multiplex PCR
Reaction, obtains amplicon, while A5 sequence of barcodes and A6 sequences to be incorporated into the 5 ' ends of amplification subsequence；By in next round PCR
The complementary series of P7 adapter-primers identification is incorporated into the 3 ' ends of amplification subsequence；
S2：The archaeal dna polymerase that albumen enzyme-deactivating the 1st takes turns multi-PRC reaction is added into last round of reaction system, then will
The albumen enzyme-deactivating；
S3：The 2nd wheel joint sequence PCR reactions are carried out, using the 1st wheel amplified production as template, with Illmuna P5 joint sequences
Sense primer is classified as, P7 joint sequences are anti-sense primer, P5 and P7 sequences are introduced between to the both sides of amplicon, expanded
Sublibrary；
S4：Purifying is carried out using magnetic bead to the library of S3 steps to be sequenced.
In a specific embodiment, the specific primer includes the specific sequence for target sequence, institute
Have and meet following condition between specific sequence：(1) each specific sequence is not expanded with the sequence outside target sequence,
(2) dimer is not formed between specific sequence, (3) specific sequence does not form hairpin structure；
In a specific embodiment, following condition is met between the specific sequence：(1) the specific sequence
Tm >=5 DEG C of row and the Tm of target area-with nontarget area, preferably >=10 DEG C；(2) specific sequence and target area
Tm-with other specific sequences formation dimer Tm >=5 DEG C, preferably >=10 DEG C；(3) specific sequence and target area
Tm >=5 DEG C of the Tm in domain-formation hairpin structure, preferably >=10 DEG C, preferably Tm value is joined based on SantaLucia2007 thermodynamics
The nearest neighbor algorithm of number table is calculated.
In a specific embodiment, there is increase steric hindrance at the base at 3 ' ends of the specific sequence
Modification, it is described to modify the combination and extension of the template for not blocking itself and the specific sequence to match completely, but it is blocked substantially
And the combination and extension of the template of Incomplete matching.Preferably, modify and be included at the base at 3 ' ends of the specific sequence
On 3 ' -2, -3 bit bases of end, ribose or the phosphodiester bond of the specific sequence；In preferred embodiments, the spy
The G/C content of 5 bases at 3 ' ends of different in nature sequence is more than 50%, that is, the base for having three or more than three is C or G, the spy
Modification is additionally included in 3 ' -4 bit bases of end, ribose or the di-phosphate ester of the specific sequence at the base at 3 ' ends of different in nature sequence
At key.I.e., in preferred embodiments, it is more than 50% in the G/C content of 5 bases at 3 ' ends of the specific sequence
In the case of, that is, the base for having three or more than three is to modify also to include at C or G, the base at 3 ' ends of the specific sequence
Held the 3 ' of the specific sequence at -2, -3, -4 at bit base, ribose or phosphodiester bond.
In a specific embodiment, the modification of the increase steric hindrance is selected from：It is deoxyinosine (dI), de-
Oxygen uracil (dU), 5-Methyl dC, 2'-O-Me-dC, phosphate group, thio group, digoxin, biotin,
AminolinkerC7, BHQ1, BHQ2, Dabcyl, JOE, ROX, FAM, TAMRA, alkyl group, fluoro group, amino group and
Thiol-C3S-S。
In a specific embodiment, it is described 3 ' end bases at increase steric hindrance modification include 3 ' end -1, -
2nd, the thio-modification at -3 bit bases.
In a specific embodiment, the G/C content of 5 bases at 3 ' ends of the specific sequence is more than 50%,
There is thio-modification at 3 ' -4 bit bases of end of the specific sequence.
In a specific embodiment, the specific primer sequence has consistent thermodynamic parameter, preferably Tm marks
It is accurate it is poor≤5 DEG C；More preferably Tm standard deviation≤2 DEG C；Most preferably Tm standard deviation≤1 DEG C.Tm standard deviations are that all specificity are drawn
The standard deviation of Tm between thing sequence and respective objects DNA sequence dna.
In preferred embodiments, in the step S1 of methods described, sense primer used is this in PCR reaction systems
The hairpin structure primer of invention part 1 design, downstream primer sequence is divided into two parts, and its 3 ' terminal sequence is specific sequence
Row, can be with target area sequence complementary pairing；Its 5 ' terminal sequence is universal sequence, can be drawn by the P7 in the 2nd wheel PCR reactions
Thing complementary pairing.Final concentration of the upstream and downstream primer in reaction system is generally between 20nM-120nM, specific concentration and amplification
Sub- flux is related.Template used in PCR reaction systems is usually DNA, and archaeal dna polymerase is commercially available exo+ polymerase.
In preferred embodiments, in the step S1 of methods described, the period of PCR reactions is usually 2-4, reaction
Condition is as follows：95 DEG C of pre-degeneration 3min 30s；98 DEG C of denaturation 20s, 64 DEG C of annealing 6min 30s, 72 DEG C of extension 45s；Final step
72 DEG C of extension 5min.Reaction condition can do corresponding adjustment according to the initial amount of template and the flux in library.
In preferred embodiments, in the step S2 of methods described, protease generally uses commercially available Proteinase K.
In preferred embodiments, in the step S3 of methods described, the amplification taken turns in PCR reaction systems with part the 1st
Product is template, and sequence measuring joints P5 and P7 sequence use commercially available high-fidelity DNA polymerase as primer, DNA enzymatic.PCR's is anti-
Answer condition as follows：95 DEG C of pre-degeneration 3min 30s；98 DEG C of denaturation 20s, 72 DEG C of annealing 4min, expand 18-25 circulation；Last 72
DEG C extension 5min.Reaction condition does corresponding adjustment according to the initial amount of template and the flux in library.
Embodiment
It is as follows that the re-spread embodiment 1 for increasing sublibrary of single reaction tube 50 is built using this method.
1st step：50 weight PCR reaction amplification targeting products
1.1 50 weight PCR reaction system is as shown in table 1 below：Archaeal dna polymerase, buffer solution and dNTP are NEB product
(article No. M0493L)；Template is the gDNA that the standard items (article No. HD728) of Horizon companies and wild type gDNA are mixed with；
The concentration of multi-primerses is 0.188 μM/bar, final concentration of 30nM/ bars.All multiple sense primers are hair fastener primer (such as Fig. 1
It is shown), as shown in table 2, A2-A7 sequences are consistent, are illustrated in fig. 3 shown below, wherein A5 for their A1 sequences (3 ' end sequence)
Sequence is by 10 degeneracy base compositions.The sequence of all multiple downstream primers is by 5 ' end universal sequences and the 3 ' specific sequences held
Composition；5 ' end universal sequences be
5 ' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT3 ', the specific sequence at 3 ' ends is as shown in table 2 below.
The weight of table 1 50 PCR reaction system
| Reagent | Volume (μ l) |
| Nuclease-free water | 10.3 |
| 5×Q5Reaction Buffer | 5 |
| dNTPs(10mM) | 0.5 |
| Primer mixture (0.188 μM/bar) | 4 |
| Template DNA (10ng/ μ l) | 5 |
| Q5 Hot Start High-Fidelity archaeal dna polymerases (2U/ μ l) | 0.2 |
The sequence information (SEQID NO.1-100) of the weight primer of table 2 50
1.2 50 weight PCR reactions are operated according to table 3 below
The weight of table 3 50 PCR reaction condition
2nd step：Protease digestion archaeal dna polymerase, terminates multi-PRC reaction
After 1st wheel multi-PRC reaction terminates, 5 μ l Proteinase Ks (180 μ g/ml) are added into PCR reaction systems, vibration is mixed
After even, 64 DEG C of incubation 15min digest archaeal dna polymerase；94 DEG C of incubation 15min, inactivate protease.
3rd step：2nd wheel joint PCR reactions
3.1 the 2nd wheel joint PCR reaction system is as shown in table 4 below, and archaeal dna polymerase is KAPA Biosystems companies
Product (article No. KK2600)；Upstream and downstream primer is respectively the joint sequence P5 and P7 of Illumina microarray datasets；DNA profiling is
The reaction product of 2 steps, i.e., the multiple PCR products obtained after protease K digesting；
The wheel joint of table 4 the 2nd PCR reaction system
| Reagent | Volume (μ l) |
| KAPA HiFi HotStart ReadyMix(2X) | 12.5 |
| Forward primer P5 (10 μM) | 1 |
| Reverse primer P7 (10 μM) | 1 |
| DNA profiling | 10.5 |
3.2 joint PCR react to be run according to the condition of following table：
The joint PCR of table 5 reaction condition
4th step：Magnetic beads for purifying the 2nd takes turns PCR primer
The 4.1 AMPure XP magnetic beads added into 25 μ l PCR primers after 25 μ l equilibrium at room temperature, are inhaled with pipettor and play mixing
For several times；
After 4.2 incubation at room temperature 10min, PCR pipe is placed in 3min on DynaMag-96Side magnetic frames；
4.3 remove supernatant, and PCR pipe continues to be placed on magnetic frame, and the ethanol solutions of 180 μ l 80% are added into pipe, stand
30s；
4.4 remove supernatant, add the ethanol solutions of 180 μ l 80%, stand the thorough supernatant that removes after 30s and (are moved using 10 μ l
Liquid device removes bottom residual ethanol solution)；
4.5 are stored at room temperature 10min, residual ethanol is thoroughly volatilized；
4.6 remove PCR pipe from magnetic frame, add 22 μ l nuclease-free waters, and pipettor, which is gently inhaled to beat, is resuspended magnetic bead, it is to avoid
Bubble is produced, 2min is stored at room temperature；
4.7 are replaced in PCR pipe on magnetic frame, stand 4min；
4.8 draw 20 μ l supernatants with pipettor, are transferred in 200 new μ l PCR pipes, and supernatant is to build in pipe
Multiple library.
5th step：Measurement of concetration is carried out to amplification sublibrary
2 μ l libraries are taken to use3.0Fluorometer (Qubit dsDNA HS Assay Kit) carries out concentration
Measurement, obtained library concentration is 6.12ng/ μ l；
6th step：Quality inspection is carried out to the fragment distribution for expanding sublibrary
Take 2 μ l to expand sublibrary and carry out quality inspection using the full-automatic nucleic acid-protein analysis systems of Qsep100 (thick pool is biological), obtain
The quality inspection peak figure arrived is as shown in Figure 4：The target pillar location in library is correct, and between distribution 250-400bp, peak position is in 301bp；
There is micro primer dimer in library at 150bp；There is micro miscellaneous peak after 500bp, both do not influence substantially
The sequencing quality in library.
7th step：The sequencing of two generations is carried out to library and data analysis is carried out
The sequencing of two generations is carried out to above-mentioned library using the microarray datasets of Next-seq 500 of Illumina companies, to what is obtained
Sequencing data carries out statistical analysis, as a result as shown in table 6 below：The base quality score (%) in library is 85.72%, and comparison rate is
93.42%, coverage rate is 100%, and 20% average sequencing depth is 96.75%, and homogeneity is high.Every data target table in library
It is existing excellent.
The re-spread sequencing data statistical result for increasing sublibrary of table 6 50
8th step：The frequency analysis in mutational site
The template that the present embodiment is used is what Horizon standard items (article No. HD728) were mixed to get with wild type gDNA
gDNA.There are 12 mutational sites to be covered by this 50 heavy library Panel in the gDNA.The theoretical mutations in 12 mutational sites
Frequency and this detection frequency are as shown in table 7.The frequency of mutation of detection is substantially consistent with the theoretical frequency of mutation, as a result accurate
Really, without false positive.
The theoretical mutations frequency in 7 12 mutational sites of table and the frequency of mutation of detection
SEQUENCE LISTING
<110>Ai Jitaikang biotechnologies（Beijing）Co., Ltd
<120>A kind of amplicon library constructing method for improving gene low frequency abrupt climatic change sensitivity
<130> CP20170623
<150> 2016106597621
<151> 2016-08-12
<160> 100
<170> PatentIn version 3.5
<210> 1
<211> 29
<212> DNA
<213>Artificial sequence
<400> 1
atcagtggaa aaatagcctc aattcttac 29
<210> 2
<211> 28
<212> DNA
<213>Artificial sequence
<400> 2
actgttttcc tttacttact acacctca 28
<210> 3
<211> 23
<212> DNA
<213>Artificial sequence
<400> 3
caaaaagatc aaagtgctgg gct 23
<210> 4
<211> 18
<212> DNA
<213>Artificial sequence
<400> 4
aaggactctg ggctcccc 18
<210> 5
<211> 18
<212> DNA
<213>Artificial sequence
<400> 5
accgtgcagc tcatcacg 18
<210> 6
<211> 22
<212> DNA
<213>Artificial sequence
<400> 6
tgtgaggatc ctggctcctt at 22
<210> 7
<211> 23
<212> DNA
<213>Artificial sequence
<400> 7
gacccttgtc tctgtgttct tgt 23
<210> 8
<211> 23
<212> DNA
<213>Artificial sequence
<400> 8
tgccagggac cttaccttat aca 23
<210> 9
<211> 19
<212> DNA
<213>Artificial sequence
<400> 9
ccacactgac gtgcctctc 19
<210> 10
<211> 22
<212> DNA
<213>Artificial sequence
<400> 10
ttgtctttgt gttcccggac at 22
<210> 11
<211> 26
<212> DNA
<213>Artificial sequence
<400> 11
cgacacaaca caaaatagcc gtataa 26
<210> 12
<211> 25
<212> DNA
<213>Artificial sequence
<400> 12
attcttgaca gtgtgttcac agaga 25
<210> 13
<211> 27
<212> DNA
<213>Artificial sequence
<400> 13
catgcaaaat cacattattg ccaacat 27
<210> 14
<211> 22
<212> DNA
<213>Artificial sequence
<400> 14
atcaccaaat ggcaccatac ga 22
<210> 15
<211> 23
<212> DNA
<213>Artificial sequence
<400> 15
gcctcccttt ccaatggact att 23
<210> 16
<211> 24
<212> DNA
<213>Artificial sequence
<400> 16
tttaattgcc cgtgatgttc catg 24
<210> 17
<211> 24
<212> DNA
<213>Artificial sequence
<400> 17
gaggtgacat tttcaaagca gtgt 24
<210> 18
<211> 30
<212> DNA
<213>Artificial sequence
<400> 18
catcgtcatt caagagaata ttttccctaa 30
<210> 19
<211> 31
<212> DNA
<213>Artificial sequence
<400> 19
aatcattaaa atcgtttttg acagtttgac a 31
<210> 20
<211> 25
<212> DNA
<213>Artificial sequence
<400> 20
caaagtacat gaacttgtct tcccg 25
<210> 21
<211> 19
<212> DNA
<213>Artificial sequence
<400> 21
cagaggaagc cttcgcctg 19
<210> 22
<211> 31
<212> DNA
<213>Artificial sequence
<400> 22
attcttacag aaaacaagtg gttatagatg g 31
<210> 23
<211> 30
<212> DNA
<213>Artificial sequence
<400> 23
agtatttcat gaaacaaatg aatgatgcac 30
<210> 24
<211> 26
<212> DNA
<213>Artificial sequence
<400> 24
ctttgcctgc tgagagttat taacag 26
<210> 25
<211> 23
<212> DNA
<213>Artificial sequence
<400> 25
atccttccag gttctgaagc atc 23
<210> 26
<211> 22
<212> DNA
<213>Artificial sequence
<400> 26
atagctgaaa acccatccca cc 22
<210> 27
<211> 27
<212> DNA
<213>Artificial sequence
<400> 27
caaatagcac agtaaacatg tggctat 27
<210> 28
<211> 22
<212> DNA
<213>Artificial sequence
<400> 28
aacagtgcct ggcatatagt gg 22
<210> 29
<211> 25
<212> DNA
<213>Artificial sequence
<400> 29
catctttaga ccagaacctc tcctg 25
<210> 30
<211> 24
<212> DNA
<213>Artificial sequence
<400> 30
tcattctccc ctaaccgatg tcta 24
<210> 31
<211> 22
<212> DNA
<213>Artificial sequence
<400> 31
ccagcagggt ctaagtattc cg 22
<210> 32
<211> 18
<212> DNA
<213>Artificial sequence
<400> 32
aggagggtgc ggaaagga 18
<210> 33
<211> 26
<212> DNA
<213>Artificial sequence
<400> 33
tacagaaggt cattgatcag tttgga 26
<210> 34
<211> 18
<212> DNA
<213>Artificial sequence
<400> 34
ctcggactac cagcgtgc 18
<210> 35
<211> 23
<212> DNA
<213>Artificial sequence
<400> 35
gtgctgagca gaggatgaac ata 23
<210> 36
<211> 22
<212> DNA
<213>Artificial sequence
<400> 36
aaacccacac tcatcttgtg ct 22
<210> 37
<211> 19
<212> DNA
<213>Artificial sequence
<400> 37
ccagctctgc tttggggag 19
<210> 38
<211> 25
<212> DNA
<213>Artificial sequence
<400> 38
tcccctactt ttgtttttct ccctt 25
<210> 39
<211> 24
<212> DNA
<213>Artificial sequence
<400> 39
aagaataaga aatggggccc tctc 24
<210> 40
<211> 25
<212> DNA
<213>Artificial sequence
<400> 40
ttatattcac atgcaggtag gccaa 25
<210> 41
<211> 25
<212> DNA
<213>Artificial sequence
<400> 41
gcttcttgtc ttaggaagtt catgc 25
<210> 42
<211> 28
<212> DNA
<213>Artificial sequence
<400> 42
tacagaaata tgcatttgga aagtggag 28
<210> 43
<211> 29
<212> DNA
<213>Artificial sequence
<400> 43
agacttaccc attttggaat tcctatagt 29
<210> 44
<211> 19
<212> DNA
<213>Artificial sequence
<400> 44
gcctggtttg ccctctacc 19
<210> 45
<211> 30
<212> DNA
<213>Artificial sequence
<400> 45
ttcaagagag gtgagatttt tcaaatgatt 30
<210> 46
<211> 28
<212> DNA
<213>Artificial sequence
<400> 46
tctacccttc attccatctc taacattc 28
<210> 47
<211> 21
<212> DNA
<213>Artificial sequence
<400> 47
cagcttctca ggggtccaat c 21
<210> 48
<211> 17
<212> DNA
<213>Artificial sequence
<400> 48
tggcggcatg ctgaagg 17
<210> 49
<211> 23
<212> DNA
<213>Artificial sequence
<400> 49
agttccctcc aaaaatcagt gct 23
<210> 50
<211> 29
<212> DNA
<213>Artificial sequence
<400> 50
accaacatcc aagataccag atttatagt 29
<210> 51
<211> 24
<212> DNA
<213>Artificial sequence
<400> 51
cctaagggag taacatgagc aaca 24
<210> 52
<211> 20
<212> DNA
<213>Artificial sequence
<400> 52
agggagcaga cagatgacga 20
<210> 53
<211> 16
<212> DNA
<213>Artificial sequence
<400> 53
gcaggtgcag ctgcca 16
<210> 54
<211> 22
<212> DNA
<213>Artificial sequence
<400> 54
tctccatccc ccacatttga ac 22
<210> 55
<211> 17
<212> DNA
<213>Artificial sequence
<400> 55
agagagcccg ctggagg 17
<210> 56
<211> 22
<212> DNA
<213>Artificial sequence
<400> 56
taccaagcca acttctttgc ct 22
<210> 57
<211> 25
<212> DNA
<213>Artificial sequence
<400> 57
gatcacacct aatccgaact tctca 25
<210> 58
<211> 30
<212> DNA
<213>Artificial sequence
<400> 58
ataaatctgt actaggaatc agctctttca 30
<210> 59
<211> 29
<212> DNA
<213>Artificial sequence
<400> 59
caagataaat aagattccac ttgtgagca 29
<210> 60
<211> 24
<212> DNA
<213>Artificial sequence
<400> 60
attcaaggat ggagaagctt cctc 24
<210> 61
<211> 20
<212> DNA
<213>Artificial sequence
<400> 61
gccaggttgc atttgggttc 20
<210> 62
<211> 24
<212> DNA
<213>Artificial sequence
<400> 62
caaggaaaca agcagaagcc taag 24
<210> 63
<211> 20
<212> DNA
<213>Artificial sequence
<400> 63
ggacaccagc tgacacttcc 20
<210> 64
<211> 20
<212> DNA
<213>Artificial sequence
<400> 64
gcccatacgt ctggcagatc 20
<210> 65
<211> 20
<212> DNA
<213>Artificial sequence
<400> 65
agggctctat gggaaggacc 20
<210> 66
<211> 24
<212> DNA
<213>Artificial sequence
<400> 66
caagaagccc ctttctttgt tcag 24
<210> 67
<211> 29
<212> DNA
<213>Artificial sequence
<400> 67
tagctgaaag atgaggagtc aagaaatat 29
<210> 68
<211> 23
<212> DNA
<213>Artificial sequence
<400> 68
catgatgtgg tccaaggatc cat 23
<210> 69
<211> 29
<212> DNA
<213>Artificial sequence
<400> 69
gtgtagagtc tgtattctta aatacccca 29
<210> 70
<211> 24
<212> DNA
<213>Artificial sequence
<400> 70
tacagtcttg ccttttccag aaca 24
<210> 71
<211> 20
<212> DNA
<213>Artificial sequence
<400> 71
cctcagtacg caccatggtc 20
<210> 72
<211> 21
<212> DNA
<213>Artificial sequence
<400> 72
actctgttcc ctccccaaag a 21
<210> 73
<211> 21
<212> DNA
<213>Artificial sequence
<400> 73
tcttacctgt gagtcctgcc a 21
<210> 74
<211> 22
<212> DNA
<213>Artificial sequence
<400> 74
caggctgtca accaacttct ct 22
<210> 75
<211> 28
<212> DNA
<213>Artificial sequence
<400> 75
ggttaattga ctcatcattt tgcaatgg 28
<210> 76
<211> 30
<212> DNA
<213>Artificial sequence
<400> 76
cagtaatcac aataacaaga tgaagatggt 30
<210> 77
<211> 16
<212> DNA
<213>Artificial sequence
<400> 77
ggcccgggtt gctgac 16
<210> 78
<211> 22
<212> DNA
<213>Artificial sequence
<400> 78
cccttgaccc cagatttctg ag 22
<210> 79
<211> 20
<212> DNA
<213>Artificial sequence
<400> 79
ggggtaggga gatggagctt 20
<210> 80
<211> 23
<212> DNA
<213>Artificial sequence
<400> 80
acttgtccac attctcaaag cct 23
<210> 81
<211> 25
<212> DNA
<213>Artificial sequence
<400> 81
ttggatatgc actaaatgag gggag 25
<210> 82
<211> 20
<212> DNA
<213>Artificial sequence
<400> 82
ttgctatgct agtggtggcg 20
<210> 83
<211> 25
<212> DNA
<213>Artificial sequence
<400> 83
gttgatgatg atgaaaactc acccc 25
<210> 84
<211> 28
<212> DNA
<213>Artificial sequence
<400> 84
actaaacttc tttgggcttc aattttct 28
<210> 85
<211> 30
<212> DNA
<213>Artificial sequence
<400> 85
taaagtcaaa gtaagaacag aaaactggag 30
<210> 86
<211> 27
<212> DNA
<213>Artificial sequence
<400> 86
ctcctgtgtt tctgtacatg ctaaatc 27
<210> 87
<211> 24
<212> DNA
<213>Artificial sequence
<400> 87
cagatgtccc ctatgtgtaa tgca 24
<210> 88
<211> 27
<212> DNA
<213>Artificial sequence
<400> 88
aactcagtga aaccctgtca ctaaata 27
<210> 89
<211> 21
<212> DNA
<213>Artificial sequence
<400> 89
tgtggaaggg gaagctgttt c 21
<210> 90
<211> 30
<212> DNA
<213>Artificial sequence
<400> 90
aaattgtgga aaaatagaca cgagttctta 30
<210> 91
<211> 30
<212> DNA
<213>Artificial sequence
<400> 91
cactgagaca ttggaagatt aaaaattgtg 30
<210> 92
<211> 25
<212> DNA
<213>Artificial sequence
<400> 92
aaacaagagg aaagaaaacg agcag 25
<210> 93
<211> 21
<212> DNA
<213>Artificial sequence
<400> 93
agaggacaca caaaacacgc t 21
<210> 94
<211> 28
<212> DNA
<213>Artificial sequence
<400> 94
tagtatgttt taatagctgg tagggcaa 28
<210> 95
<211> 27
<212> DNA
<213>Artificial sequence
<400> 95
tttctgcgtc aagactgata tcttact 27
<210> 96
<211> 19
<212> DNA
<213>Artificial sequence
<400> 96
accctccctc tgatgcctc 19
<210> 97
<211> 20
<212> DNA
<213>Artificial sequence
<400> 97
ccgtcacctc caatccaagg 20
<210> 98
<211> 28
<212> DNA
<213>Artificial sequence
<400> 98
tcagcaagct agagaaatac tccaaata 28
<210> 99
<211> 27
<212> DNA
<213>Artificial sequence
<400> 99
cacctggcct aaagacattt taaaact 27
<210> 100
<211> 27
<212> DNA
<213>Artificial sequence
<400> 100
ctctgttctc cttgtcctca tatcaat 27
Claims (10)
1. a kind of multiple upstream hairpin structure primer used for amplicon amplified library and when being enriched with, the primer is held from 3 '
Include sequence A1-A7 to 5 ' ends：
A1 sequences are specific sequence, with target area sequence complementary pairing, trigger specific amplification and the enrichment of amplicon；
A2 sequences are the critical sequences of hairpin structure, are made up of the continuous C and G bases of two or more；
A3 sequences are the reverse complementary sequence of 5 ' end A7 sequences；
A4 sequences are the critical sequences that go of hairpin structure, and base number is 2-8, and A and T is more than G and C in base sequence；
A5 sequences are sequence of barcodes, are made up of 8-16 degeneracy base；
A6 sequences are sequence measuring joints sequence；
A7 sequences are 5 ' terminal sequences, with A3 sequence reverse complementals；
A3 and A7 complementary pairings, form the stem structure of the multiple upstream hairpin structure primer；
A4, A5 and A6 form the loop section of the multiple upstream hairpin structure primer.
2. the multiple upstream hairpin structure primer of claim 1, the A2 sequences are made up of C and G bases, base number preferably 20
It is individual following, more preferably less than 10, most preferably less than 5.
3. the multiple upstream hairpin structure primer of claim 1 or 2, A3 sequences are single with the 5 ' ends that A7 sequences form local double-strand
Chain, or A2 and A3 sequences and A7 sequences form double-strand of the 5 ' ends of local double-strand for closing, the double-strand for it is described it is multiple on
Swim the stem portion of hairpin structure primer.
4. any one of claim 1-3 multiple upstream hairpin structure primer, the equilibrium temperature of the stem structure is 62 DEG C -66
DEG C, such as 59-64 DEG C, preferably 63 DEG C -65 DEG C；The melting temperature of the stem structure is 70 DEG C -78 DEG C, such as 70-76 DEG C, preferably
71℃-74℃。
5. any one of claim 1-4 multiple upstream hairpin structure primer, the base number of the A4 sequences is 2-4.
6. any one of claim 1-5 multiple upstream hairpin structure primer, the A5 sequences are made up of 12 base sequences, but
It is that the number of base can be increased and decreased according to the flux of amplicon.
7. any one of claim 1-6 multiple upstream hairpin structure primer, the A6 sequences are Illumina sequence measuring joints P5
The full length sequence of sequence or the Illumina sequence measuring joints P5 sequences for removing the sequence of part 5 '.
It is sensitive that 8. a kind of usage right requires that any one of 1-7 multiple upstream hairpin structure primer improves gene low frequency abrupt climatic change
The amplicon library constructing method of degree, the described method comprises the following steps：
S1：1st wheel multiplex PCR is carried out using multiple upstream hairpin structure primer and the multiple downstream primer with universal sequence anti-
Should, amplicon is obtained, while A5 sequence of barcodes and A6 sequences to be incorporated into the 5 ' ends of amplification subsequence；By P7 in next round PCR
The complementary series of adapter-primer identification is incorporated into the 3 ' ends of amplification subsequence；
S2：The archaeal dna polymerase that albumen enzyme-deactivating the 1st takes turns multi-PRC reaction is added into last round of reaction system, then will be described
Albumen enzyme-deactivating；
S3：Carry out the 2nd wheel joint sequence PCR reaction, using the 1st wheel amplified production as template, using Illumuna P5 joint sequences as
Sense primer, P7 joint sequences are anti-sense primer, P5 and P7 sequences are introduced between to the both sides of amplicon, obtain expanding Ziwen
Storehouse；
S4：The library of S3 steps is purified using magnetic bead, the sequencing of two generations is carried out after quantifying.
9. the method for claim 10, in the step S1 of methods described, sense primer used is right in PCR reaction systems
It is required that any one of 1-7 multiple upstream hairpin structure primer, downstream primer sequence is divided into two parts, its 3 ' terminal sequence is special
Property sequence, can be with target area sequence complementary pairing；Its 5 ' terminal sequence is universal sequence, can be by the 2nd wheel PCR reactions
P7 Primers complementaries are matched.
10. the method for claim 8 or 9, in step s 2, the protease are Proteinase K.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2016106597621 | 2016-08-12 | ||
| CN201610659762 | 2016-08-12 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107058310A true CN107058310A (en) | 2017-08-18 |
Family
ID=59610673
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710382858.2A Pending CN107058310A (en) | 2016-08-12 | 2017-05-26 | A kind of amplicon library constructing method for improving gene low frequency abrupt climatic change sensitivity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107058310A (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107217052A (en) * | 2017-07-07 | 2017-09-29 | 上海交通大学 | The preparation method and its matched reagent box of a kind of quantitative high-throughput sequencing library |
| CN108929901A (en) * | 2018-07-27 | 2018-12-04 | 博奥生物集团有限公司 | A kind of multiplex amplification banking process and its dedicated kit for trace amount DNA |
| WO2019076018A1 (en) * | 2017-10-19 | 2019-04-25 | 北京泛生子基因科技有限公司 | Method for constructing amplicon library for detecting low-frequency mutation of target gene |
| CN109797197A (en) * | 2019-02-11 | 2019-05-24 | 杭州纽安津生物科技有限公司 | It a kind of single chain molecule label connector and single stranded DNA banking process and its is applied in detection Circulating tumor DNA |
| CN109797196A (en) * | 2019-01-30 | 2019-05-24 | 艾吉泰康生物科技(北京)有限公司 | A kind of extensible application of the probe in cfDNA library construction of zip mode |
| CN110656156A (en) * | 2019-10-14 | 2020-01-07 | 湖南大地同年生物科技有限公司 | Ultralow frequency mutation nucleic acid fragment detection method, library construction method, primer design method and reagent |
| CN112011599A (en) * | 2020-09-07 | 2020-12-01 | 苏州贝康医疗器械有限公司 | PCR primer set for reducing non-specific amplification and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1496413A (en) * | 2003-05-09 | 2004-05-12 | 清华大学 | Method for multiple PCR condition optimization and its component |
| CN104736722A (en) * | 2012-05-21 | 2015-06-24 | 斯克利普斯研究所 | Methods of sample preparation |
| CN105531375A (en) * | 2012-12-10 | 2016-04-27 | 分析生物科学有限公司 | Methods for targeted genomic analysis |
| CN105705659A (en) * | 2013-08-28 | 2016-06-22 | 赛卢拉研究公司 | Massively parallel single cell analysis |
-
2017
- 2017-05-26 CN CN201710382858.2A patent/CN107058310A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1496413A (en) * | 2003-05-09 | 2004-05-12 | 清华大学 | Method for multiple PCR condition optimization and its component |
| CN104736722A (en) * | 2012-05-21 | 2015-06-24 | 斯克利普斯研究所 | Methods of sample preparation |
| CN105531375A (en) * | 2012-12-10 | 2016-04-27 | 分析生物科学有限公司 | Methods for targeted genomic analysis |
| CN105705659A (en) * | 2013-08-28 | 2016-06-22 | 赛卢拉研究公司 | Massively parallel single cell analysis |
Non-Patent Citations (1)
| Title |
|---|
| ANDERS ST˚AHLBERG ET AL.: "Simple, multiplexed, PCR-based barcoding of DNA enables sensitive mutation detection in liquid biopsies using sequencing", 《NUCLEIC ACIDS RESEARCH》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107217052A (en) * | 2017-07-07 | 2017-09-29 | 上海交通大学 | The preparation method and its matched reagent box of a kind of quantitative high-throughput sequencing library |
| WO2019076018A1 (en) * | 2017-10-19 | 2019-04-25 | 北京泛生子基因科技有限公司 | Method for constructing amplicon library for detecting low-frequency mutation of target gene |
| CN108929901A (en) * | 2018-07-27 | 2018-12-04 | 博奥生物集团有限公司 | A kind of multiplex amplification banking process and its dedicated kit for trace amount DNA |
| CN108929901B (en) * | 2018-07-27 | 2022-02-01 | 博奥生物集团有限公司 | Multiple amplification library building method for trace DNA and special kit thereof |
| CN109797196A (en) * | 2019-01-30 | 2019-05-24 | 艾吉泰康生物科技(北京)有限公司 | A kind of extensible application of the probe in cfDNA library construction of zip mode |
| CN109797196B (en) * | 2019-01-30 | 2022-06-07 | 艾吉泰康生物科技(北京)有限公司 | Application of zipper type extensible probe in cfDNA library construction |
| CN109797197A (en) * | 2019-02-11 | 2019-05-24 | 杭州纽安津生物科技有限公司 | It a kind of single chain molecule label connector and single stranded DNA banking process and its is applied in detection Circulating tumor DNA |
| CN110656156A (en) * | 2019-10-14 | 2020-01-07 | 湖南大地同年生物科技有限公司 | Ultralow frequency mutation nucleic acid fragment detection method, library construction method, primer design method and reagent |
| CN112011599A (en) * | 2020-09-07 | 2020-12-01 | 苏州贝康医疗器械有限公司 | PCR primer set for reducing non-specific amplification and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107058310A (en) | A kind of amplicon library constructing method for improving gene low frequency abrupt climatic change sensitivity | |
| JP6842450B2 (en) | Methods for Targeted Genome Analysis | |
| JP6894501B2 (en) | Isothermal nucleic acid self-amplification method | |
| JP2021168659A (en) | Methods for next generation genome walking and related compositions and kits | |
| CN107406875A (en) | Use the composition and method of CRISPR/Cas systematic proteins targeting abatement, enrichment and segmentation nucleic acid | |
| JP7240337B2 (en) | LIBRARY PREPARATION METHODS AND COMPOSITIONS AND USES THEREOF | |
| CN107208137A (en) | Detect the composition and method of RNA virus | |
| WO2017185766A1 (en) | Method for designing primers and probe for amplifying low-concentration mutant target sequence | |
| WO2016181128A1 (en) | Methods, compositions, and kits for preparing sequencing library | |
| CN107058573A (en) | A kind of method that utilization Cas9/gRNA system constructings expand sublibrary | |
| US20180195119A1 (en) | Methods and compositions for reducing redundant molecular barcodes created in primer extension reactions | |
| US20180223350A1 (en) | Duplex adapters and duplex sequencing | |
| CN107760772A (en) | For the method for nucleic acid match end sequencing, composition, system, instrument and kit | |
| JP2020536525A (en) | A method for concentrating the probe and the target region to which it is applied for high-throughput sequencing | |
| WO2013173774A2 (en) | Molecular inversion probes | |
| CN107893109A (en) | A kind of low abundance gene mutation enrichment method based on removal wild-type sequence | |
| CN107058361A (en) | Ligase dependent/non-dependent gene clone method based on ribonucleotide Mdification primer | |
| CN111278974A (en) | Hook probe, nucleic acid ligation method and sequencing library construction method | |
| CN111020711A (en) | Single-chain library construction method with molecular label, joint combination and kit | |
| US20230220475A1 (en) | Compositions and methods for dna methylation analysis | |
| WO2022144003A1 (en) | Method for constructing multiplex pcr library for high-throughput targeted sequencing | |
| US11920190B2 (en) | Method of amplifying and determining target nucleotide sequence | |
| JP2024515305A (en) | Nucleic Acid Concentration and Detection | |
| CN114364813B (en) | Method for multiplex isothermal amplification of nucleic acid sequences | |
| JP2022546485A (en) | Compositions and methods for tumor precision assays |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170818 |
|
| WD01 | Invention patent application deemed withdrawn after publication |