CN105705659A - Massively parallel single cell analysis - Google Patents

Massively parallel single cell analysis Download PDF

Info

Publication number
CN105705659A
CN105705659A CN201480059505.3A CN201480059505A CN105705659A CN 105705659 A CN105705659 A CN 105705659A CN 201480059505 A CN201480059505 A CN 201480059505A CN 105705659 A CN105705659 A CN 105705659A
Authority
CN
China
Prior art keywords
cell
solid support
sample
nucleic acid
oligonucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201480059505.3A
Other languages
Chinese (zh)
Other versions
CN105705659B (en
Inventor
克里斯蒂娜·范
斯蒂芬·P·A·福多尔
格伦·K·弗
杰弗里·理查德·菲舍
朱莉·威廉米
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Becton Dickinson and Co
Original Assignee
Cellular Research Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=51519182&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=CN105705659(A) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Cellular Research Inc filed Critical Cellular Research Inc
Priority to CN201911165393.0A priority Critical patent/CN110964796B/en
Publication of CN105705659A publication Critical patent/CN105705659A/en
Application granted granted Critical
Publication of CN105705659B publication Critical patent/CN105705659B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L3/00—Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
    • B01L3/50—Containers for the purpose of retaining a material to be analysed, e.g. test tubes
    • B01L3/508—Containers for the purpose of retaining a material to be analysed, e.g. test tubes rigid containers not provided for above
    • B01L3/5085—Containers for the purpose of retaining a material to be analysed, e.g. test tubes rigid containers not provided for above for multiple samples, e.g. microtitration plates
    • B01L3/50857—Containers for the purpose of retaining a material to be analysed, e.g. test tubes rigid containers not provided for above for multiple samples, e.g. microtitration plates using arrays or bundles of open capillaries for holding samples
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L7/00—Heating or cooling apparatus; Heat insulating devices
    • B01L7/52—Heating or cooling apparatus; Heat insulating devices with provision for submitting samples to a predetermined sequence of different temperatures, e.g. for treating nucleic acid samples
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1075—Isolating an individual clone by screening libraries by coupling phenotype to genotype, not provided for in other groups of this subclass
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C12Q1/6874—Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6881—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00—Additional constructional details
    • B01L2300/02—Identification, exchange or storage of information
    • B01L2300/023—Sending and receiving of information, e.g. using bluetooth
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00—Additional constructional details
    • B01L2300/06—Auxiliary integrated devices, integrated components
    • B01L2300/0627—Sensor or part of a sensor is integrated
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00—Additional constructional details
    • B01L2300/08—Geometry, shape and general structure
    • B01L2300/0809—Geometry, shape and general structure rectangular shaped
    • B01L2300/0829—Multi-well plates; Microtitration plates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2535/00—Reactions characterised by the assay type for determining the identity of a nucleotide base or a sequence of oligonucleotides
    • C12Q2535/101—Sanger sequencing method, i.e. oligonucleotide sequencing using primer elongation and dideoxynucleotides as chain terminators
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/149—Particles, e.g. beads
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/159—Microreactors, e.g. emulsion PCR or sequencing, droplet PCR, microcapsules, i.e. non-liquid containers with a range of different permeability's for different reaction components
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/185—Nucleic acid dedicated to use as a hidden marker/bar code, e.g. inclusion of nucleic acids to mark art objects or animals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Clinical Laboratory Science (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Hematology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The disclosure provides for methods, compositions, and kits for multiplex nucleic acid analysis of single cells. The methods, compositions and systems may be used for massively parallel single cell sequencing. The methods, compositions and systems may be used to analyze thousands of cells concurrently. The thousands of cells may comprise a mixed population of cells (e.g., cells of different types or subtypes, different sizes).

Description

Extensive parallel single cell analysis
Cross reference
This application claims the U.S. Provisional Application number 62/012 submitted on June 13rd, 2014,237, the U.S. Provisional Application number 61/952 submitted on March 12nd, 2014,036 and on August 28th, 2013 submit to U.S. Provisional Application number 61/871, the rights and interests of 232, each section in these being applied for is combined in this with its full content by reference。
Background
Many cells group's (such as tissue and tumor) can include foreign cell environment。The cellular environment of these complexity generally can show multiple phenotype, and these phenotypes may indicate that Multi-genotype。Refining unicellular transmutability from many cells complexity is understand the importance that many cells are heterogeneous。It can be important in the therapeutic scheme with the genotypic disease of multiple resistance that this understanding is used for resisting in exploitation。
Summary of the invention
The aspect provided is a kind of method, and the method includes obtaining the sample comprising multiple cell；Use following item to the first cell from the plurality of cell and two or more polynucleotide molecules of the second cell from the plurality of cell, its complement or from its product carry out labelling at least partially: this first cell is had specific first-phase with cell marking with to this second cell and there is the same cell marking of specific second-phase；And these two or more polynucleotide molecules, its complement or the product from it are each had specific molecular marker, wherein from these two or more polynucleotide molecules of this first cell, its complement or each molecular marker from its product be relative to each other unique, and wherein from these two or more polynucleotide molecules of the second cell, its complement or each molecular marker from its product be relative to each other unique。In certain embodiments, the method farther includes at least one part order-checking to two or more polynucleotide molecules, its complement or the product from it。In certain embodiments, the method farther includes to analyze the sequence data from this order-checking, identifies with multiple individual moleculars of these polynucleotide in the specific cells to these cells。In certain embodiments, these cells are cancerous cell。In certain embodiments, these cell infection viral polynucleotide。In certain embodiments, these cells are antibacterial or fungus。In certain embodiments, this order-checking includes checking order with the reading length of at least 100 bases。In certain embodiments, this order-checking includes checking order with the reading length of at least 500 bases。In certain embodiments, these polynucleotide molecules are mRNA or Microrna, and its complement and product thereof are the complements of these mRNA or Microrna and from its product。In certain embodiments, these molecular markers are on pearl。In certain embodiments, individual cells having specific labelling is on pearl。In certain embodiments, individual cells is had specific labelling and these molecular markers are on pearl。In certain embodiments, the method carries out at least in part in emulsion。In certain embodiments, the method carries out at least in part in the hole of array or micropore。In certain embodiments, the existence of the polynucleotide relevant to disease or disease is detected。In certain embodiments, this disease or disease are cancers。In certain embodiments, Microrna, its complement or product at least some of from it are detected。In certain embodiments, this disease or disease are viral infection。In certain embodiments, this viral infection is from enveloped virus。In certain embodiments, this viral infection is from nonenveloped virus。In certain embodiments, this virus viral DNA containing double-strand。In certain embodiments, this virus viral DNA containing strand。In certain embodiments, this virus is selected from lower group, and this group is made up of the following: poxvirus, herpesvirus, varicella zoster virus, cytomegalovirus, Epstein-Barr virus, hepadnavirus, papovavirus, polyoma virus and any combination thereof。In certain embodiments, the first cell is from not suffering from the people of disease or disease and the second cell from the people suffering from this disease or disease。In certain embodiments, these people are different。In certain embodiments, these people are identical, but cell takes in different time points。In certain embodiments, the first cell is from suffering from the people of this disease or disease and the second cell from same people。In certain embodiments, the cell in this sample includes coming the cell of self-organizing or organ。In certain embodiments, the cell in this sample includes the cell from following item: thymus, leukocyte, erythrocyte, hepatocyte, splenocyte, pneumonocyte, heart cell, brain cell, Skin Cell, pancreatic cell, gastric cells, the cell from oral cavity, the cell from nasal cavity, colon cell, small intestine cells, nephrocyte, from the cell of body of gland, brain cell, neurocyte, neurogliocyte, eye cell, reproductive organ cells, bladder cells, gametid, human cell, fetal cell, amnion cell or its any combination。
The aspect provided is a kind of solid support, this solid support includes multiple oligonucleotide, it each includes cell marking and molecular marker, and wherein each cell marking of the plurality of oligonucleotide is identical, and each molecular marker of the plurality of oligonucleotide is different；And wherein this solid support is pearl, this solid support is had specificity by this cell marking, and this solid support its oligonucleotide when being placed on the center of three Cartesian coordinates extends at least seven of eight octants, or its any combination。In certain embodiments, the plurality of oligonucleotide farther includes at least one in the following: sample labelling；Common tags；And target nucleic acid land。In certain embodiments, this solid support includes this target nucleic acid land, and wherein this target nucleic acid land includes the sequence selected from lower group, and this group is made up of the following: gene specific sequence, oligomerization-dT sequence, random polymer and any combination thereof。In certain embodiments, this solid support farther includes target nucleic acid or its complement。In certain embodiments, this solid support includes multiple target nucleic acid or its complement, the plurality of target nucleic acid or its complement include the transcript from about 0.01% to about 100% or its complement of organism transcript profile, or the genomic gene from about 0.01% to about 100% of organism or its complement。In certain embodiments, the cell marking of the plurality of oligonucleotide includes utilizing the first random sequence that the first labelling catenation sequence and the second random sequence connect；And the molecular marker of the plurality of oligonucleotide includes random sequence。In certain embodiments, this solid support is selected from lower group, and this group is made up of the following: polydimethylsiloxane (PDMS) solid support, polystyrene solid support, glass solid support, polypropylene solid holder, agarose solid support, gelatin solid support, magnetic retention holder, pluronic (pluronic) solid support and any combination thereof。In certain embodiments, the plurality of oligonucleotide includes the joint comprising joint functional group, and this solid support includes solid support functional group；Wherein this solid support functional group and joint functional group are connected to each other。In certain embodiments, this joint functional group and this solid support functional group are individually selected from lower group, and this group is made up of the following: C6, biotin, Streptavidin, one or more primary amine, one or more aldehyde, one or more ketone and any combination thereof。In certain embodiments, the molecular marker of the plurality of oligonucleotide includes at least 15 nucleotide。
The aspect provided is a kind of test kit, and this test kit includes any one in solid support described here and operation instructions。In certain embodiments, this test kit farther includes hole。In certain embodiments, this hole is involved in an array。In certain embodiments, this hole is micropore。In certain embodiments, this test kit farther includes buffer。In certain embodiments, this test kit is comprised in packaging。In certain embodiments, this packaging is box。In certain embodiments, the volume of this packaging or box is 2 cubic feet or less。In certain embodiments, the volume of this packaging or box is 1 cubic feet or less。
The aspect provided is a kind of emulsion, and this emulsion includes any one in solid support described here。
The aspect provided is a kind of compositions, and said composition includes any one in hole and solid support described here。
The aspect provided is a kind of compositions, and said composition includes any one in cell and solid support described here。
In certain embodiments, this emulsion or compositions farther include cell。In certain embodiments, this cell is unicellular。In certain embodiments, this hole is micropore。In certain embodiments, the volume range of this micropore is from about 1,000 μm3To about 120,000 μm3。
The aspect provided is a kind of method, and the method includes making sample and any solid support into contact disclosed here, makes the target nucleic acid from this sample and the oligonucleotide hybridization in the plurality of oligonucleotide。In certain embodiments, the method farther includes amplification target nucleic acid or its complement。In certain embodiments, the method farther includes target nucleic acid or its complement are checked order, and wherein this order-checking includes the molecular marker of the oligonucleotide being combined with target nucleic acid or its complement is checked order。In certain embodiments, the method further comprises determining that the amount of target nucleic acid or its complement, and wherein this determines the level including quantifying target nucleic acid or its complement；To the multiple sequence count comprising same molecular labelling；Or its combination。In certain embodiments, the method does not include any identical molecular marker of comparison or any identical cell marking。In certain embodiments, this amplification includes reverse transcription target nucleic acid。In certain embodiments, this amplification utilizes the method selected from lower group, and this group is made up of the following: PCR, nest-type PRC, quantitative PCR, real-time PCR, digital pcr and any combination thereof。In certain embodiments, this amplification is made directly on solid support；The template transcribed from this solid support carries out；Or its combination。In certain embodiments, this sample includes cell。In certain embodiments, this cell is unicellular。In certain embodiments, this contact occurs in hole。In certain embodiments, this hole is micropore and is comprised in microwell array。
The aspect provided is a kind of device, and this device includes multiple micropore, and wherein the volume range of each micropore in the plurality of micropore is from about 1,000 μm3To about 120,000 μm3。In certain embodiments, the volume of each micropore in the plurality of micropore is about 20,000 μm3。In certain embodiments, the plurality of micropore includes from about 96 to about 200,000 micropores。In certain embodiments, these micropores are comprised in material layer。In certain embodiments, at least about the micropore of 10% farther includes cell。In certain embodiments, this device further includes at any one in the solid support of this description。
The aspect provided is a kind of equipment, and this equipment includes any one in device described here and liquid processor。In certain embodiments, liquid processor in about one second by liquid delivery to the plurality of micropore。In certain embodiments, liquid is delivered to the plurality of micropore from single input port by liquid processor。In certain embodiments, this equipment farther includes magnet。In certain embodiments, this equipment farther includes at least one in following item: entrance, outlet, pump, valve, passage, reservoir, sample collection room, Temperature-controlled appliance or its any combination。In certain embodiments, this equipment includes sample collection room, and wherein sample collection room can be removed from this equipment。In certain embodiments, this equipment farther includes optical imaging instrument。In certain embodiments, optical imaging instrument produces the output signal for controlling liquid processor。In certain embodiments, the thermal circulation mechanism that the polymerase chain reaction (PCR) that this equipment farther includes to be configured to carry out oligonucleotide expands。
The aspect provided is a kind of method producing clinical diagnosis test result, and the method includes producing this clinical diagnosis test result with following item: any device described here or equipment；Any solid support described here；Any method described here；Or its any combination。In certain embodiments, clinical diagnosis test result is transmitted via communication medium。
The aspect provided is a kind of method of any one manufacture in solid support described here, and the method includes following item is attached to solid support: the first polynucleotide, and it comprises the Part I of cell marking and the first joint；And contact the second polynucleotide, sequence that its Part II comprising cell marking and the first joint are complementary and molecular marker。In certain embodiments, the 3rd polynucleotide farther include target nucleic acid land。
In certain embodiments, emulsion, micropore or hole contain only a cell。In certain embodiments, from 1 to 2,000,000 emulsion, micropore or hole each contain only a cell。In certain embodiments, the method includes being assigned in each emulsion, micropore or hole at most cell。In certain embodiments, by single solid support with unicellular be assigned in emulsion, micropore or hole。In certain embodiments, from 1 to 2,000,000 emulsion, micropore or hole have each been assigned with a cell and a solid support wherein。In certain embodiments, the method includes distribution at most solid support/emulsion, micropore or hole。In certain embodiments, the method includes to from 1 to 2, each one one solid support of distribution and the cell in 000,000 kind of micropore, emulsion or hole。In certain embodiments, cell distribution is random or nonrandom。In certain embodiments, cell distribution is random。In certain embodiments, cell is distributed by cell sorter。In certain embodiments, distribute cell by making one or more hole, micropore or emulsion contact with the dilute solution through diluting cells, so make an at most cell be assigned in these one or more holes, micropore or emulsion。
In certain embodiments, these target-specific districts, the target-specific district of the plurality of oligonucleotide or the target-specific district of these two or more polynucleotide molecules include the sequence complementary with two or more targets in target surface plate。In certain embodiments, two or more targets in this target surface plate are biomarkers。In certain embodiments, these biomarkers are the biomarkers of disease or disease。In certain embodiments, this disease or disease are cancer, infection, viral infection, inflammatory diseases, neurodegenerative diseases, fungal disease, antibacterial infection or its any combination。In certain embodiments, this panel includes from 2-50, and 000,2-40,000,2-30,000,2-20,000,2-10,000,2-9000,2-8,000,2-7,000,2-6,000,2-5,000,2-1,000,2-800,2-700,2-600,2-500,2-400,2-300,2-200,2-100,2-75,2-50,2-40,2-30,2-20,2-10 or 2-5 kind biomarker。
It is incorporated by reference
All publications, the patents and patent applications mentioned in this specification are all incorporated herein by reference, and specifically and individually indicate such as each independent publication, patent or patent application and are incorporated herein by reference。
Brief Description Of Drawings
The novel feature of the present invention is specifically explained in the appended claims。By reference illustrative embodiment is illustrated described further below, being best understood from the features and advantages of the present invention will be obtained, make use of principles of the invention in these embodiments, and in the drawings:
Fig. 1 depicts the exemplary solid holder puted together with exemplary oligonucleotide。
Fig. 2 A-C depicts for using separation-poly-pond to synthesize the exemplary operation flow process that (split-poolsynthesis) carrys out the pearl of synthesis of coupling oligonucleotide。
Fig. 3 depicts the exemplary pearl of coupling oligonucleotide。
Fig. 4 describes the exemplary embodiment of microwell array。
Fig. 5 depicts solid support exemplary distribution in microwell array。
Fig. 6 A-C illustrates exemplary allocations of communication resources cell on microwell array。Fig. 6 A illustrates the distribution of K562 cell (maxicell size)。Fig. 6 B illustrates the distribution of this (Ramos) cell (minicell size) of Rameau。Fig. 6 C illustrates the pearl distributing this cell of Rameau and coupling oligonucleotide on microwell array, points to this cell of Rameau and the pearl of dotted arrow sensing coupling oligonucleotide with solid arrow。
Fig. 7 illustrates micro pore volume, solid support volume and the exemplary statistics from the amount cracking the biomaterial obtained。
Fig. 8 A-C describes the exemplary embodiment that pearl cap seals。Fig. 8 A-B illustrates the image in microarray hole, and wherein cell and oligonucleotide integument are assigned in the hole in microarray hole and bigger cross-linking dextran pearl is for sealing this some holes。Dotted arrows points to cell, and dotted arrow points to pearl and the solid arrow sensing cross-linking dextran pearl of coupling oligonucleotide。Fig. 8 C depicts the cell being deposited in hole and the schematic diagram of oligonucleotide pearl (such as, oligomerization pearl), and wherein cross-linking dextran pearl is used for sealing this hole。
Fig. 9 depicts the bar diagram compared from micropore and the amplification efficiency of GAPDH and the RPL19 of pipe amplification。Lath represents the data from micropore。Informal voucher represents the data from pipe。
Figure 10 depicts the agarose gel comparing three different genes directly specific amplification on solid support。
Figure 11 A-I illustrates that the figure of sequencing result represents。
Figure 12 A-C illustrates the sequencing result rectangular histogram respectively for only this sample of K562 sample, only Rameau and K562+ this blend sample of Rameau。
Figure 12 D-E illustrates and is respectively directed to only this sample of Rameau and only K562 sample, the figure of the copy number of the gene listed in table 3。
Figure 12 F-I illustrates the copy number of individual gene。
Figure 12 J-M illustrates the pearl for having 100 uniqueness bar code combinations, the figure of uniqueness molecule amount/gene (y-axle)。
Figure 12 N-O illustrates the enlarged drawing of two kinds of pearls, the aggregate model of the gene expression profile of its description both cell type。
Figure 12 P illustrates the scatterplot of the result of the principal component analysis of the gene expression profile based on 768 pearls, wherein has from each pearl of K562+ this blend sample of Rameau > 30 molecules。
Figure 12 Q-R illustrates and is respectively directed to K562 like cell (pearl on the left side of first principal component based on Figure 12 P) and this like cell of Rameau (pearl on the right of first principal component based on Figure 12 P), the rectangular histogram of copy number/amplicon/pearl。
Figure 12 S-T illustrate the independent gene copy number/pearl being respectively directed to K562 like cell (pearl on the left side of first principal component based on Figure 12 P) and this like cell of Rameau (pearl on the right of first principal component based on Figure 12 P) or/unicellular。
Figure 13 A depicts mouse cell and the overall gene expression pattern of this cell of Rameau。
Figure 13 B-C illustrates the scatterplot of the result of the principal component analysis of the gene expression profile being based respectively on high density sample and low-density sample。
Figure 13 D-E depict be respectively directed to from this like cell of Rameau of high density sample and mice like cell with figure below: reading/bar code (bc) combination (y-axle) comparison combines (x-axle) with the uniqueness bar code of molecule total number/bc compounding separation。
Figure 13 F-G depict be respectively directed to from this like cell of Rameau of high density sample and mice like cell with figure below: molecule amount/bar code (bc) combination (y-axle) comparison combines (x-axle) with the uniqueness bar code of molecule total number/bc compounding separation。
Figure 13 H-I depict be respectively directed to from this like cell of Rameau of low-density sample and mice like cell with figure below: reading/bar code (bc) combination (y-axle) comparison combines (x-axle) with the uniqueness bar code of molecule total number/bar code compounding separation。
Figure 13 J-K depict be respectively directed to from this like cell of Rameau of low-density sample and mice like cell with figure below: molecule amount/bar code combination (y-axle) comparison combines (x-axle) with the uniqueness bar code of molecule total number/bar code compounding separation。
Figure 14 illustrates the figure of the log10 of gene and the number of readings per taken being depicted on X-axle。
Figure 15 A illustrates the scattergram of the gene detected of each three part cell markings (such as, cell bar code)。Figure 15 B illustrates the scattergram of the uniqueness molecule detected of every pearl (expressing gene panel)。
Figure 16 depicts the cell cluster based on the gene relevant to cell bar code。
Figure 17 A-D illustrates the analysis of mononuclear cell Specific marker。Figure 17 E illustrates the cell cluster described in Figure 16。
Figure 18 A-B illustrates the analysis of T cell Specific marker。Figure 18 C illustrates the cell cluster described in Figure 16。
Figure 19 A-B illustrates the analysis of CD8+T cell specific markers。Figure 19 C illustrates the cell cluster described in Figure 16。
Figure 20 A illustrates the analysis of CD4+T cell specific markers。Figure 20 B illustrates the cell cluster described in Figure 16。
Figure 21 A-D illustrates the analysis of natural killer cell (NK) cell specific markers。Figure 20 E illustrates the cell cluster described in Figure 16。
Figure 22 A-E illustrates the analysis of B cell Specific marker。Figure 22 F illustrates the cell cluster described in Figure 16。
Figure 23 A-F illustrates the analysis of Toll-like receptor。Toll-like receptor is mainly expressed by mononuclear cell and some B cell。Figure 23 G illustrates the cell cluster described in Figure 16。
Figure 24 depicts the figure of gene comparison number of readings per taken log10。
Figure 25 A-D illustrates for two genes, the figure of molecular bar code comparison number of readings per taken or number of readings per taken log10。
Figure 26 A illustrates the number gene in the panel of expression/cell bar code comparison uniqueness cell number of barcodes/single celled figure。Figure 26 B illustrates the rectangular histogram of the uniqueness cell bar code of the uniqueness molecule amount/pearl comparison cell number frequency/load given number molecule of detection。Figure 26 C illustrates the rectangular histogram of the uniqueness cell bar code of the uniqueness GAPDH molecule amount/pearl comparison cell number frequency/load given number molecule of detection。
Figure 27 illustrates the scatterplot of 856 cells。
Figure 28 illustrates the thermal map of the expression of front 100 (for the sums of the molecule of detection)。
Figure 29 illustrates the workflow of example 12。
Figure 30 illustrates the workflow of example 13。
Figure 31 A-C。Unicellular clustering in the controlled mixture containing two kinds of different cell types。A. by the principal component analysis of 12 gene expressions, clustering of the 1:1 mixture of K562 and this cell of Rameau。Biplot illustrates two differences bunch, and one of them bunch expresses this specific gene of Rameau and another bunch of expressing K 562 specific gene。B. the principal component analysis of the mixture of this cell of Rameau under the background from the primary B cell of healthy individuals containing little percentage ratio of the panel with 111 genes is used。The sum of the uniqueness transcript molecule that the color instruction of each data point detects in whole gene panel。One group 18 cells (drawing a circle) in 1198 cells show different gene expression profiles and transcriptional level is much higher。C. illustrate the thermal map of each gene expression in front 100 cells of the sample of Figure 31 B, utilize the sum of the transcript molecule detected in gene panel to carry out ranking。Gene order is made via the hierarchical cluster for dependency。Front 18 cells (are indicated) one group of known gene relevant to follicular lymphoma of preferential expression by the red bar of level, as by indicated by vertical red bar。
Figure 31 D。The PCA of primary B cell analyzes, and has this cell of Rameau and mixes。The logarithm of the number of the transcript molecule for specific gene that the color each cell of instruction of each data point (unicellular) carries。Front 7 row: preferential by the gene of 18 lymphocyte subgroups being probably this cell of Rameau。The gene (from left to right) of the first row includes GAPDH, TCL1A, MKI67 and BCL6。The gene (from left to right) of the second row includes MYC, CCND3, CD81 and GNAI2。The gene (from left to right) of the third line includes IGBP1, CD20, BLNK and DOCK8。The gene (from left to right) of fourth line includes IRF4, CD22, IGHM and AURKB。The gene (from left to right) of fifth line includes CD38, CD10, LEF1 and AICDA。The gene (from left to right) of the 6th row includes CD40, CD27, IL4R and PRKCD。The gene (from left to right) of the 7th row includes RGS1, MCL1, CD79a and HLA-DRA。Last column: preferably by primary B cell Expression of Subsets still non-specific enrichment gene in those 18 cells。The gene (from left to right) of last column includes IL6, Cd23a, CCR7 and CXCR5。
The expression of Figure 32 GAPDH。The natural logrithm of the uniqueness transcript molecule amount that the color every cell observation of instruction arrives。
Figure 33 A-F illustrates the principal component analysis (PCA) of mononuclear cell related gene。Figure 33 A illustrates the PCA of CD16。Figure 33 B illustrates the PCA of CCRvarA。Figure 33 C illustrates the PCA of CD14。Figure 33 D illustrates the PCA of S100A12。Figure 33 E illustrates the PCA of CD209。Figure 33 F illustrates the PCA of IFNGR1。
Figure 34 A-B illustrates the principal component analysis (PCA) of general T cell mark (CD3)。Figure 34 A illustrates that PCA and Figure 34 B of CD3D illustrates the PCA of CD3E。
Figure 35 A-E illustrates the principal component analysis (PCA) of cd8 t cell related gene。Figure 35 A illustrates the PCA of CD8A。Figure 35 B illustrates the PCA of EOMES。Figure 35 C illustrates the PCA of CD8B。Figure 35 D illustrates the PCA of PRF1。Figure 35 E illustrates the PCA of RUNX3。
Figure 36 A-C illustrates the principal component analysis (PCA) of cd4 t cell related gene。Figure 36 A illustrates the PCA of CD4。Figure 36 B illustrates the PCA of CCR7。Figure 36 C illustrates the PCA of CD62L。
Figure 37 A-F illustrates the principal component analysis (PCA) of B cell related gene。Figure 37 A illustrates the PCA of CD20。Figure 37 B illustrates the PCA of IGHD。Figure 37 C illustrates the PCA of PAX5。Figure 37 D illustrates the PCA of TCL1A。Figure 37 E illustrates the PCA of IGHM。Figure 37 F illustrates the PCA of CD24。
Figure 38 A-C illustrates the principal component analysis (PCA) of natural killer cell related gene。Figure 38 A illustrates the PCA of KIR2DS5。Figure 38 B illustrates the PCA of CD16。Figure 38 C illustrates the PCA of CD62L。
The PCA of the Figure 39 81 genes by being measured by plug holder cell (CytoSeqCells) analyzes and identifies major cell types in mankind's PBMC sample (632 cells) simultaneously, and wherein the cell express spectra of height correlation is encoded by similar color。
The correlation analysis of the unicellular gene expression profile of Figure 40 A-BPBMC sample。40A. the matrix of the correlation coefficient between two across 632 cells illustrated in sample。Being sorted by these cells, those of gene expression profile so making to have height correlation are grouped together。40B. illustrate each cell thermal map to the expression of each gene。These cells (row) are sorted by the mode identical with above correlation matrix。These genes (OK) are sorted, so makes the gene across cell with highly similar expression pattern be grouped together。The cell type of this each cell cluster of group gene identification of cell coexpression can be passed through。In each main cell bunch, for gene expression, there is the heterogeneity of substantial extent。
Figure 41 data representation is from the data of 731 cells repeating experiment of the PBMC sample of same donor。Will have like the cell of gene expression profile (hierarchical cluster based on using correlation coefficient) to draw by similar color。
Figure 42 illustrates the thermal map of the dependency of the gene expression profile proved between gene。
The description of Figure 43 CytoSeq。The experimental arrangement of A.CytoSeq。B. the structure of the oligonucleotide of pearl it is attached to。
Figure 44 dissects the subgroup of CD3+T cell。A. the PCA of the non-stimulated samples of donor 1 discloses two Main Branches of cell。The expression (log of uniqueness transcript molecule) of each intracellular specific gene indicates by color。Helper T cell relevant cell factor and effector are enriched in the cell of relatively lower, and cytotoxic T cell related gene is enriched in the cell of relatively upper。Herein show representative gene。The first row illustrates helper T cell related gene and includes (from left to right) CD4, SELL and CCR7。Second row illustrates cytotoxic T cell related gene and includes (from left to right) CD8A, NKG2D and EOMES。B. the PCA of the anti-CD28 stimulated samples of the anti-CD3/ of donor 1, it is shown that specifies gene expresses the enrichment to one of two Main Branches representing helper T cell and cytotoxic T cell。These genes are present in non-stimulated samples with low amounts。Front two row illustrate the known gene relevant to the T cell of activation and include (from left to right) IRF4, CD69 and MYC in the first row and include (from left to right) GAPDH, TNF and IFNG in a second row。The third line illustrates the known gene relevant to the helper T cell of activation and includes (from left to right) IL2, LTA and CD40LG。Fourth line illustrates the known gene relevant to the cytotoxic T cell of activation and includes (from left to right) CCL4, CCL3 and GZMB。C. facilitating the cell number of the overall expression level of following gene, these genes show big multiple change when comparison stimulus and non-stimulated samples in cohersive and integrated data。For some cytokines (red arrow), the big general gene that the contribution from the cell of only peanut is responsible in whole colony expresses change。
Figure 45. the PCA having been subjected to the T cell sample with the stimulation of anti-CD28/ anti-CD3 pearl and corresponding non-stimulated samples in two donors draws, it is important that the expression of following gene, these genes appear clearly from the preferential expression in auxiliary or cytotoxicity subgroup in non-stimulated samples。The color of each data point (unicellular) indicates every cell for the log (number of uniqueness transcript molecule) specifying gene。In each donor every pair stimulated and does not stimulate figure, color gamut being adjusted to identical。A. the known gene related with helper T cell and cytotoxic T cell。B. the known gene relevant to cytotoxic T cell。C. the known gene relevant to helper T cell。
Figure 46 A-D has been subjected to the PCA of the T cell sample with the stimulation of anti-CD28/ anti-CD3 pearl and corresponding non-stimulated samples in two donors and draws, it is important that the expression of following gene, these gene expressions are in the sample stimulated but with low horizontal expression of maybe can not surveying in the sample not stimulated。The color of each data point (unicellular) indicates every cell for the log (number of uniqueness transcript molecule) specifying gene。In each donor every pair stimulated and does not stimulate figure, color gamut being adjusted to identical。The gene expressed by the cell of Liang Ge branch after 46A and 46D. activation。46B. the gene being preferentially expressed in after activation in a relatively upper cell。These genes known are relevant to the cytotoxic T cell of activation。46C. be preferentially expressed in the gene in a relatively lower cell after activation。These genes known are relevant to the helper T cell of activation。
Figure 47 cluster, from the data of the CD3+T cell not stimulated of donor 1, the separation illustrating CD4 and cd8 cell and one group express granzyme K and granzyme A but express the cell of CD8 hardly。Top: illustrate the thermal map of dependency between every pair of cell。The cell of height correlation is grouped together。Bottom: illustrate the thermal map of the expression of each gene of each cell。Cluster via two-way stratification and make cell and gene order。
Figure 48. it is similar to Figure 47, but illustrates the data of the CD3+T cell sample of the anti-CD28 stimulation of anti-CD3/ from donor 1。Top: illustrate the thermal map of dependency between every pair of cell。The cell of height correlation is grouped together。Bottom: illustrate the thermal map of the expression of each gene of each cell。Cluster via two-way stratification and make cell and gene order。
Figure 49 A-C is in donor 1, compared with non-stimulated samples, observes the big overall multiple change of different cytokines in the sample that anti-CD28/ AntiCD3 McAb stimulates。A-B: the big multiple change of these cytokines is only facilitated by several unicellular (points closed with square or circle) to a great extent。These cytokines many are facilitated by the cell of identical peanut。C: for Th2 and the Th17 subgroup of helper T cell, the coexpression pattern of these cytokines is consistent with characteristic cell combinations of factors。
Figure 50 A-B. dissects the subgroup of CD8+T cell。The gene that two main group one the group expression center memory/initial cell defining CD8+ cell that clusters of A.CytoSeq data has, and the gene that another group expression effect memory cell/effector lymphocyte has。Herein show the data of the sample not stimulated of donor 2。Top: illustrate the thermal map of dependency between every pair of cell。Bottom: illustrate the thermal map of the expression of each gene in each cell。Cluster via two-way stratification and make cell and gene order。B. private antigen specific T-cells is being identified by IFN-γ (IFNG) after stimulating with CMV peptide pond from the expression in the CD8+T cell of two donors。Each cell is spatially drawn in 2D main constituent。The cell (drawing a circle) expressing IFNG generally falls into the row of following person, and they have in the panel always detects transcript (being indicated by color) at most。In donor 2, the highest express cell (square) does not produce IFNG but express cell factor IL6 and IL1B。It is close to the numeral instruction ranking with the total uniqueness transcript molecule amount sequentially arrived that successively decreases of each circle for this cell detection。
Figure 51. it is similar to Figure 50 A, except the data of data representation donor 2CMV stimulated samples herein。The gene that two main group one the group expression center memory/initial cell defining CD8+ cell that clusters of A.CytoSeq data has, and the gene that another group expression effect memory cell/effector lymphocyte has。Herein show the data of the sample not stimulated of donor 2。Top: illustrate the thermal map of dependency between every pair of cell。Bottom: illustrate the thermal map of the expression of each gene in each cell。Cluster via two-way stratification and make cell and gene order。
Figure 52. in main constituent space, draw data。The log (number of the uniqueness transcript molecule detected) of color instruction specific gene。A. after stimulating with CMV peptide pond, it appears the gene expressed by the cell of greater proportion。B. the gene in the cell of a branch it is enriched in。It is known that these genes remember CD8+T cell to initial and center relevant。C. the gene in the cell of another branch it is enriched in。It is relevant that these genes known remember CD8+T cell to effect and effect。D. the cell expressing granzyme K spatially occupies the region between initially/center memory cell and effect/effect memory cell at PC。E. the special subgroup of the cellularity of expression of HLA-DR A。F. the gene in the cell of Liang Ge branch it is expressed in。
Figure 53. identical with Figure 50 B, except the data of the comparison not stimulated except data representation。Cell in the sample of donor 1 does not express IFNG, and a cell in the sample of donor 2 expresses IFNG, but expresses relatively low (ranking 1069) across the overall of whole gene panel。Colour scale is adjusted to the colour scale with the corresponding diagram of the sample stimulated match。
Figure 54. the thermal map of the heterogeneous expression of the gene panel illustrated in the cell of expression IFN-γ (IFNG) in the CMV of the donor 1 and 2 CD8+T cell stimulated。Also show the cell carrying the total at most transcript detected in donor 2。This specific cells does not express IFNG but strong expression IL6, IL1B and CCL4。Based on dependency, clustered as these cells and gene order by two-way stratification。Cell ID refers to the ranking in the sum of the transcript detected of gene panel, and is indicated in the PCA drawing of Figure 50。
Figure 55. amplification scheme。Oneth PCR uses gene-specific primer and the primer amplification for general hundred million sensible (Illumina) sequencing primer 1 sequence to be attached to the molecule of pearl。2nd PCR uses the flank nested gene-specific primer in hundred million sensible sequencing primer 2 sequences and primer amplification the first PCR primer for general hundred million sensible sequencing primer 1 sequences。3rd PCR adds P5 and P7 and sample index, in order to make PCR primer enter hundred million sensible sequencing libraries。150bpx2 order-checking discloses the sample index on the cell marking on reading 1 and the gene on molecular marker, reading 2 and index 1 reading。
Figure 56 depicts the schematic diagram of the workflow for analyzing the molecule from sample。
Figure 57 depicts the schematic diagram of the workflow for analyzing the molecule from sample。
Figure 58 A-B depicts the agarose gel of PCR primer。
Figure 59 depicts the drawing of the order-checking reading of multiple gene。
Figure 60 A-D depicts that to be respectively directed to Lys, Phe, Thr and Dap doped in contrast, it was observed that the drawing of labelling (RPLD) of reading/detection。Figure 60 E depicts the read-around ratio drawing to input。
Figure 61 depicts for different genes, it was observed that the drawing of labelling (RPLD) of reading/detection。
Figure 62 depicts for different genes, it was observed that the drawing of labelling (RPLD) of reading/detection。
Figure 63 depicts the drawing of total indicator reading (labelling) the comparison rpld for different genes。
Figure 64 depicts the drawing of the RPKM for the gene not detected。
Figure 65 depicts the schematic diagram for synthetic molecules bar code。
Figure 66 A-C depicts the schematic diagram for synthetic molecules bar code。
Figure 67 illustrates the schematic diagram of the workflow for labeling nucleic acid randomly。
Figure 68 is the schematic diagram of the workflow for labeling nucleic acid randomly。
Figure 69 describes mechanical fastener, and microwell array substrate can be clamped in wherein, is consequently formed reative cell or hole, it is possible to pipette sample and reagent wherein with pipet, is used for carrying out random labelling multiple, unicellular/molecule index experiment。Upper: to illustrate the top and the bottom of holder and for forming the exploded view of the elastic washer of leakproof seal with microwell array substrate。Under: the decomposition side view of holder。
Figure 70 describes mechanical fastener, and when microwell array substrate is clamped in this holder, it produces two reative cells or hole。
Figure 71 describes two examples for elasticity (such as, the polydimethylsiloxane) packing ring used together with the mechanical fastener illustrated in Figure 69 and 70。These elastic washers provide leakproof seal together with microwell array substrate, to produce reagent wells around microwell array。These packing rings can contain one (on), two (under) or more opening, be used for producing reagent wells。
Figure 72 depicts an embodiment of the packaged cylinder within it of microwell array。Left: the exploded view of cylinder, describe (from bottom to top) microwell array substrate, limit flow cell or the packing ring of array room, reagent and/or refuse memory component (be used for limit septal area contain prestrain measure reagent or store used reagent) and lid (for sealed reagent and refuse reservoir and limit entrance and exit)。Right: the assembled view of an embodiment of cylinder design, describe for making outer magnet and microwell array embossment closely。
Figure 73 depicts the embodiment measuring reagent and the cylinder of the microwell array of packaging being designed to include on plate。
Figure 74 provides schematically illustrating of the instrument system for carrying out random labelling multiple, unicellular/molecule index mensuration。This instrument system can provide various control and analysis ability, and can be packaged as independent module or be packaged as fully-integrated system。Microwell array can be integrated with fixing parts or the removable flow cell as system, or may be packaged in removable cylinder, and the mensuration reagent reservoir that this cylinder farther includes prestrain is functional with other。
Figure 75 describes the embodiment needed by indexing the processing step that the automated system of mensuration carries out for carrying out random labelling multiple, unicellular/molecule。
Figure 76 describes for providing the computer system of instrument controlling and data analysis capabilities or an embodiment of processor for presently disclosed mensuration system。
Figure 77 illustrates a block diagram, describes the example that can be combined the computer system architecture used with the exemplary embodiment of the mensuration system of present disclosure。
Figure 78 depicts a chart, it is shown that have the network of multiple computer system, mobile phone, personal digital assistant and Network Attached (NAS), and it can use together with the exemplary embodiment of the mensuration system of present disclosure。
Figure 79 depicts the block diagram of multiprocessor computer system, and this system can use together with the exemplary embodiment of the mensuration system of present disclosure。
Figure 80 depicts the analysis of test sample and the chart communicated of the test result obtained via communication medium from this test sample。
Detailed description
There is disclosed herein for analyzing the method for the molecule in multiple sample, test kit and compositions。Generally, these methods, test kit and compositions include (a) with the molecule in molecular bar code two or more samples of labelling randomly, to produce labeled molecule；And (b) detect these labeled molecules。These molecular bar codes can include one or more target-specific district, mark zone, sample index area, general PCR sector, aptamer, joint or its combination。These labeled molecules can include a) molecular regime；B) sample index area；And c) mark zone。Molecular regime can include at least some of of molecular bar code molecule attached at first。Molecular regime can include the fragment of molecular bar code molecule attached at first。Sample index area is determined for the source of molecular regime。Sample index area is determined for which sample molecular regime derives from。Sample index area may be used for distinguishing the molecular regime from two or more different samples。Mark zone may be used for deriving from the same molecular district in same source and gives uniqueness identity。Mark zone may be used for deriving from the same molecular district of same sample and gives uniqueness identity。
Method for analyzing the molecule in multiple sample may include that a) by following generation multiple sample labeling nucleic acid: the first sample i) making to include multiple nucleic acid contacts with multiple first sample labels, to produce multiple first sample labeling nucleic acid；And ii) making the second sample including multiple nucleic acid contact with multiple second sample labels, to produce multiple second sample labeling nucleic acid, wherein the plurality of second sample label is different from these the first sample labels；B) the plurality of sample labeling nucleic acid is made to contact with multiple Molecular Identification substance markers, to produce multiple labeled nucleic acid；And c) detect at least some of of these labeled nucleic acid, thereby determine that the counting of multiple nucleic acid in multiple samples。The plurality of sample can include unicellular。
Alternately, the method for analyzing the molecule in multiple sample may include that and a) produces multiple labeled nucleic acid, and including i) making the first sample and more than first sample label contact, wherein this more than first sample label includes identical nucleotide sequence；Ii) this first sample and more than first Molecular Identification substance markers contact are made, these Molecular Identification substance markers can include different nucleotide sequences, more than first sample label of this first sample and this or this more than first Molecular Identification substance markers is wherein made to contact and occur simultaneously or sequentially, to produce multiple first labeled nucleic acid；Iii) making the second sample and more than second sample label contact, wherein this more than second sample label can include identical nucleotide sequence；Iv) this second sample and more than second Molecular Identification substance markers contact are made, these Molecular Identification substance markers can include different nucleotide sequences, more than second sample label of this second sample and this or this more than second Molecular Identification substance markers is wherein made to contact and occur simultaneously or sequentially, to produce multiple second labeled nucleic acid, wherein the plurality of labeled nucleic acid can include the plurality of first labeled nucleic acid and these the second labeled nucleic acid；And b) determine multiple different labeled nucleic acid, thereby determine that the counting of multiple nucleic acid in multiple samples。
Method for analyzing the molecule in multiple sample may include that and a) makes multiple sample contact with multiple sample labels and multiple Molecular Identification substance markers, these samples can include the nucleic acid that two or more are different, to produce multiple labeled nucleic acid, wherein: i) the plurality of labeled nucleic acid can include being attached to two or more nucleic acid of two or more sample labels and two or more Molecular Identification substance markers；Ii) the sample label being attached to the nucleic acid of the first sample from the plurality of sample is different from the sample label of the nucleic acid molecules being attached to the second sample from the plurality of sample；And iii) nucleic acid that two or more in same sample are identical is attached to the Molecular Identification substance markers that two or more are different；And b) detect at least some of of these labeled nucleic acid, thereby determine that the counting of two or more different nucleic acid in the plurality of sample。
Figure 56 depicts the exemplary operation flow process for the RNA molecule in quantitative sample。As shown in the step 1 of Figure 56, by making territory, the poly-A tail region randomer hybridization of one group of Molecular Identification substance markers (115) and RNA molecule, these RNA molecule (110) can be reversed record, to produce cDNA molecule (105)。These Molecular Identification substance markers (115) can include oligomerization dT region (120), mark zone (125) and general PCR sector (130)。This group Molecular Identification substance markers can comprise 960 different types of mark zones。As shown in the step 2 of Figure 56, it is possible to cDNA molecule (170) purification labeled by these, to remove excessive Molecular Identification substance markers (115)。Purification can include Ampure pearl purification。As shown in the step 3 of Figure 56, it is possible to expand these labeled cDNA molecules (170), to produce labeled amplicon (180)。Amplification can include multiplexed PCR amplification。Amplification can include the multiplexed PCR amplification carried out in single reaction volume with 96 kinds of multi-primerses。Amplification can include customization primer (135) and universal primer (140)。Customization primer (135) can with the area hybridization in cDNA (105) part of labeled cDNA molecule (170)。Universal primer (140) can be hybridized with the general PCR sector (130) of labeled cDNA molecule (170)。As shown in step 4, it is possible to expanded these labeled amplicons (180) further by nest-type PRC。Nest-type PRC can include the multiplex PCR carried out in single reaction volume with 96 kinds of multi-primerses。Nest-type PRC can include customization primer (145) and universal primer (140)。Customization primer (135) can with the area hybridization in cDNA (105) part of labeled amplicon (180)。Universal primer (140) can be hybridized with the general PCR sector (130) of labeled amplicon (180)。As shown in step 5, one or more aptamers (150,155) can be attached to labeled amplicon (180), to produce to be adapted the amplicon (190) of sub-labelling。These one or more aptamers can be attached to labeled amplicon (180) via connection。As illustrated in step 6, these one or more aptamers (150,155) may be used for carrying out one or more other mensuration on the amplicon (190) being adapted sub-labelling。These one or more aptamers (150,155) can be hybridized with one or more primers (160,165)。These one or more primers (160,165) can be pcr amplification primer。These one or more primers (160,165) can be sequencing primer。These one or more aptamers (150,155) may be used for amplification further and are adapted the amplicon of sub-labelling。The amplicon that these one or more aptamers (150,155) may be used for being adapted sub-labelling checks order。
Figure 57 depicts the illustrative diagram of the workflow for analyzing the nucleic acid from two or more samples。As shown in Figure 57, the method for analyzing the nucleic acid from two or more samples can include selecting two or more genes for analyzing and customizing primer (210) based on selected gene design。The method may further include supplementary one or more sample comprising nucleic acid (such as, RNA) and doped compares (220) with one or more。Molecular bar code (or sample label or Molecular Identification substance markers) and customization primer can be used by the nucleic acid (230) in this sample of multiplex RT-PCR amplification, to produce labeled amplicon。Labeled amplicon can be processed further, to produce to be adapted the amplicon (240) of sub-labelling with one or more order-checking aptamers。The amplicon (250) being adapted sub-labelling can be analyzed。As shown in Figure 57, analyze that labeled amplicon (250) can include in following item one or more: (1) detection universal PC R primer sequence, poly-A and/or molecular bar code (or sample label, Molecular Identification substance markers)；(2) to being not attached to aptamer and/or bar code (such as, molecular bar code, sample label, Molecular Identification substance markers) the end of the amplicon (such as, 96 genes and doped comparison) being adapted sub-labelling carry out collection of illustrative plates reading；And (3) count and/or summarize the number of the different amplicons being adapted sub-labelling。
Figure 67 illustrates the schematic diagram for the workflow with molecular bar code (1220) labeling nucleic acid randomly。As shown in the step 1 of Figure 67, it is possible to one group of molecular bar code (1220) labeled rna molecule randomly。Molecular bar code (1220) can include target land (1221), mark zone (1222), sample index area (1223) and general PCR sector (1224)。In some cases, target land includes and the oligomerization dT sequence of the poly-A sequence hybridization in RNA molecule。Mark zone (1222) can include the uniqueness sequence that may be used for distinguishing two or more different molecular bar codes。When molecular bar code and RNA molecule hybridization, mark zone may be used for identical RNA molecule and gives uniqueness identity。For one group of molecular bar code, sample index area (1223) can be identical。Sample index area (1223) may be used for distinguishing the labeled nucleic acid from different samples。General PCR sector (1224) may serve as the primer binding site of the labeled molecule of amplification。Once RNA molecule is used molecular bar code labelling, these RNA molecule just can be reversed record, copies the labeled cDNA molecule (1230) of (1210) and molecular bar code (1220) with the cDNA produced containing RNA molecule。
As shown in the step 2 of Figure 67, it is possible to remove excessive oligonucleotide (such as, molecular bar code) by Ampure pearl purification。As shown in the step 3 of Figure 67, it is possible to by the cDNA molecule that multiplexed PCR amplification is labeled。The multiplex PCR using first group of forward primer (F1 in Figure 67,1235) and universal primer (1240) to carry out labeled cDNA molecule in single reaction volume can be passed through, to produce labeled amplicon (1245)。As shown in the step 4 of Figure 67, it is possible to use nested primer carries out, by multiplex PCR, the amplicon that amplification is labeled。The nested primer amplification using second group of forward primer (F2 in Figure 67,1250) and universal primer (1240) to carry out labeled amplicon in single reaction volume can be passed through, to produce labeled nested PCR amplification。In some cases, F2 primer (1250) is containing aptamer (1251) and target land (1252)。The target land (1252) of F2 primer can with labeled amplicon hybridization and the amplification that can cause labeled amplicon。The aptamer (1251) of nested PCR amplification and general PCR sector (1224) are usable in the order-checking of labeled nested PCR amplification。MiSeq can be passed through amplicon is checked order。Alternately, it is possible to by HiSeq, amplicon is checked order。
Figure 68 illustrates the schematic diagram of the workflow for labeling nucleic acid randomly。As shown in the step 1 of Figure 68, it is possible to one group of molecular bar code (1320) labeled rna molecule (1305) randomly。Molecular bar code can include target land (1321), mark zone (1322) and general PCR sector (1323)。Once molecular bar code is attached to RNA molecule, these RNA molecule (1305) just can be reversed record, to produce the labeled cDNA molecule (1325) of cDNA copy (1310) and the molecular bar code (1320) comprising RNA molecule。As shown in the step 2 of Figure 68, it is possible to carry out, by Ampure pearl purification, the cDNA molecule that purification is labeled, to remove excessive oligonucleotide (such as, molecular bar code)。As shown in the step 3 of Figure 68, it is possible to by the amplicon that multiplexed PCR amplification is labeled。The multiplex PCR using first group of forward primer (F1 in Figure 68,1330) and universal primer (1335) to carry out labeled cDNA molecule in single reaction volume can be passed through, to produce labeled amplicon (1360)。As shown in the step 4 of Figure 67, it is possible to use nested primer carries out, by multiplex PCR, the amplicon that amplification is labeled。The nested primer amplification using second group of forward primer (F2 in Figure 68,1340) and sample index primer (1350) to carry out labeled amplicon in single reaction volume can be passed through, to produce labeled nested PCR amplification。In some cases, F2 primer (1340) is containing aptamer (1341) and target land (1342)。The target land (1342) of F2 primer can with labeled amplicon hybridization and the amplification that can cause labeled amplicon。Sample index primer (1350) can include universal primer district (1351), sample index area (1352) and aptamer district (1353)。As shown in the step 4 of Figure 68, the universal primer district (1351) of sample index primer can hybridize with the general PCR sector of labeled amplicon。The sample index area (1352) of sample index primer may be used for distinguishing two or more samples。Aptamer district (1341,1353) may be used for labeled nested PCR amplification order-checking。MiSeq can be passed through amplicon is checked order。Alternately, it is possible to by HiSeq, amplicon is checked order。
The method producing one or more libraries is further disclosed at this。These one or more libraries can include multiple labeled molecule。These one or more libraries can include multiple labeled amplicon。These one or more libraries can include the molecule or derivatives thereof (such as, labeled molecule, labeled amplicon) of multiple enrichment。Generally, the method producing one or more library includes (a) labelling randomly multiple molecules from two or more samples, and to produce multiple labeled molecule, wherein these labeled molecules include molecular regime, sample index area and mark zone；And (b) produce one or more libraries from the plurality of labeled molecule, wherein (i) these one or more libraries include two or more different labeled molecules, and the labeled molecule that (ii) these two or more is different is distinctive in that molecular regime, sample index area, mark zone or its combination。
Method for producing one or more library may include that a) by following generation multiple sample labeling nucleic acid: the first sample i) making to include multiple nucleic acid contacts with multiple first sample labels, to produce multiple first sample labeling nucleic acid；And ii) making the second sample including multiple nucleic acid contact with multiple second sample labels, to produce multiple second sample labeling nucleic acid, wherein the plurality of first sample label is different from these the second sample labels；And b) make the plurality of sample labeling nucleic acid contact with multiple Molecular Identification substance markers, to produce multiple labeled nucleic acid, thus produce labeled nucleic acid library。
It can be random or nonrandom for contacting with sample。Such as, sample can be random or nonrandom contact with contacting of sample label。In certain embodiments, sample and sample label random contact are made。In certain embodiments, make that sample is nonrandom with sample label to be contacted。It can be random or nonrandom for contacting with multiple nucleic acid。Such as, multiple nucleic acid can be random or nonrandom contact with contacting of sample label。In certain embodiments, the plurality of nucleic acid and sample label random contact are made。In certain embodiments, make that the plurality of nucleic acid is nonrandom with sample label to be contacted。
The method producing one or more groups labeled pearl is further disclosed at this。The method producing one or more groups labeled pearl can include one or more nucleic acid are attached to one or more pearl, thus produces one or more groups labeled pearl。These one or more nucleic acid can include one or more molecular bar code。These one or more nucleic acid can include one or more sample label。These one or more nucleic acid can include one or more Molecular Identification substance markers。These one or more nucleic acid can include a) guiding region；B) sample index area；And c) joint or aptamer district。These one or more nucleic acid can include a) guiding region；B) mark zone；And c) joint or aptamer district。These one or more nucleic acid can include a) sample index area；And b) mark zone。These one or more nucleic acid may further include guiding region。These one or more nucleic acid may further include target-specific district。These one or more nucleic acid may further include joint area。These one or more nucleic acid may further include aptamer district。These one or more nucleic acid may further include sample index area。These one or more nucleic acid may further include mark zone。
The method for selecting one or more customization primer is further disclosed at this。The method selecting the customization primer for analyzing the molecule in multiple sample may include that a) first pass, and the primer wherein selected may include that i) no more than three continuous guanines, no more than three continuous cytosine, no more than four continuous adenine and no more than four continuous thymus pyrimidines；Ii) as guanine or at least the 3 of cytosine, 4,5 or 6 nucleotide；And iii) it is not easy to be formed the sequence of hairpin structure；B) second time, including: i) first round selects multiple sequences that the height with all transcripies covers；And ii) taking turns or taking turns more subsequently, selecting following sequence, this sequence has the highest covering of residue transcript and the complementary score of the sequence with other selections of no more than 4；And c) add sequence to the group selected, until cover sum that is saturated or that customize primer less than or equal to about 96。
The test kit for analyzing two or more molecules from two or more samples is further disclosed at this。This test kit can include (a) first container, and this container includes first group of molecular bar code, and wherein the molecular bar code of (i) first group of molecular bar code includes sample index area and mark zone；(ii) the sample index area of two or more bar codes of first group of molecular bar code is identical；And (iii) mark zone of two or more bar codes of first group of molecular bar code is different；And (b) second container, this container includes the sub-bar code of second component, and wherein the molecular bar code of the sub-bar code of (i) second component includes sample index area and mark zone；(ii) the sample index area of two or more bar codes of the sub-bar code of second component is identical；(iii) mark zone of two or more bar codes of the sub-bar code of second component is different；(iv) the sample index area of the bar code of the sub-bar code of second component is different from the sample index area of the bar code of first group of molecular bar code；And (v) mark zone of two or more bar codes of the mark zone of two or more bar codes of the sub-bar code of second component and first group of molecular bar code is identical。
Alternately, this test kit includes: a) multiple pearls, wherein one or more pearls of the plurality of pearl can include at least one in multiple nucleic acid, at least one in plurality of nucleic acid may include that i) at least one primer sequence, and wherein the primer sequence of at least one in the plurality of nucleic acid is identical for the plurality of pearl；Ii) pearl specific sequence, wherein the pearl specific sequence of any one nucleic acid in the plurality of nucleic acid is identical, and wherein pearl specific sequence is different for any one pearl in the plurality of pearl；And iii) random sequence, wherein random sequence is different for any one nucleic acid in the plurality of nucleic acid；B) primer, this primer can include the sequence complementary with primer sequence；And c) one or more are suitable to the amplification agent of nucleic acid amplification。
Alternately, this test kit includes: a) the first container, and this container includes first group of sample label, and wherein the sample label of (i) first group of sample label includes sample index area；And (ii) the sample index area of the sample label of first group of sample label is at least about 80% identical；And b) second container, this container includes first group of Molecular Identification substance markers, and wherein the Molecular Identification substance markers of (i) first group of Molecular Identification substance markers includes mark zone；And (ii) total Molecular Identification substance markers of first group of Molecular Identification substance markers at least about 30% mark zone be different
Before being more fully described the inventive method, test kit and compositions, it should be understood that the invention is not restricted to the concrete grammar, test kit or the compositions that describe, because these are it is of course possible to change。It will also be appreciated that term is only for the purpose describing specific embodiment as used herein, it is no intended to be restrictive, because the scope of the present invention will be limited only by the appended claims。Example is proposed to provide the full disclosure and the description that how to manufacture and use the present invention for those of ordinary skill in the art, being not intended to limit ladies and gentlemen inventor and be considered as their scope of invention, they are not intended to represent following experiment is by all or only experiment。The numeral (such as, amount, temperature etc.) just used, has endeavoured to ensure its degree of accuracy, but still should be taken into account some experimental erroies and deviation。Except as otherwise noted, number is weight portion, and molecular weight is weight average molecular weight, and temperature is degree Celsius, and pressure is or close to atmospheric pressure。
Provide the method for nucleic acid in the nucleic acid preparation for the multiple sample of random labelling or complexity, test kit and compositions。These methods, test kit and compositions can be used for illustrating the mechanism of cell response, differentiation or signal transduction and carrying out diversified clinical measurement。By reading the method for the present invention as will be described further below, test kit and compositions, these and other purposes of the present invention, advantage and feature will become clear from for those of ordinary skills。
Method disclosed here includes one or more molecular bar codes, sample label and/or Molecular Identification substance markers are attached to two or more molecules from two or more samples。These molecular bar codes, sample label and/or Molecular Identification substance markers can include one or more oligonucleotide。In some cases, molecular bar code, sample label and/or Molecular Identification substance markers are attached to molecule and include these molecules of labelling randomly。Method for labelling molecule randomly is found in such as United States serial 12/969,581 and 13/327,526。Generally, random labelling method includes multiple labels and labeled oligonucleotide are attached to one or more molecule at random。Relative to there being one or more molecules to be marked, excessively provide molecular bar code, sample label and/or Molecular Identification substance markers。In random labelling, each have individual molecule to be marked to have the independent probability being attached to the plurality of molecular bar code, sample label and/or Molecular Identification substance markers。Each probability having individual molecule to be marked to be attached to specific molecular bar code, sample label and/or Molecular Identification substance markers can have individual molecule to be marked roughly the same with any other。Therefore, in some cases, it is assumed that it is equal that any molecule in sample runs into the probability of any label and labelling, and this hypothesis can be used in mathematical calculation, to estimate the molecule amount in this sample。In some cases, it is possible to such as by selecting the label with the different qualities of the joint efficiency by improving or reduce those molecular bar codes, sample label and/or Molecular Identification substance markers and individual molecule and labelling to control attachment probability。These labels and be marked on number also alterable, run into the probability of binding partners changing specific molecular bar code, sample label and/or Molecular Identification substance markers in random labelling process。Such as, one is marked in labelling pond to be existed in a large number, thus improves a large amount of labelling existed and runs into the probability of at least one binding partners。
Method disclosed here may further include two or more samples of combination。Method disclosed here may further include and combines the one or more molecules from two or more samples。Such as, method disclosed here includes combination the first sample and the second sample。This two or more samples can be combined after carrying out one or more random labelling program。This two or more samples can be combined being attached to by one or more groups molecular bar code after two or more molecules of these two or more samples。This two or more samples can be combined being attached to by one or more groups sample label after two or more molecules of these two or more samples。This two or more samples can be combined being attached to by one or more groups Molecular Identification substance markers after two or more molecules of these two or more samples。Such as, before contacting with the plurality of Molecular Identification substance markers, the first and second samples are combined。
Alternately, it is possible to before carrying out one or more random labelling program, combine these two or more samples。This two or more samples can be combined being attached to by one or more groups molecular bar code before two or more molecules of these two or more samples。This two or more samples can be combined being attached to by one or more groups sample label before two or more molecules of these two or more samples。This two or more samples can be combined being attached to by one or more groups Molecular Identification substance markers before two or more molecules of these two or more samples。
This two or more samples can be combined after two or more molecule or derivatives thereofs (such as, labeled molecule, amplicon) from these two or more samples are carried out one or more mensuration。These one or more mensuration can include one or more amplified reaction。These one or more mensuration can include one or more gathering and measuring。These one or more mensuration can include one or more detection assay。Such as, after the nucleic acid that detection is labeled, the first and second samples are combined。
This two or more samples can be combined before two or more molecule or derivatives thereofs (such as, labeled molecule, amplicon) from these two or more samples are carried out one or more mensuration。These one or more mensuration can include one or more amplified reaction。These one or more mensuration can include one or more gathering and measuring。These one or more mensuration can include one or more detection assay。Such as, before the nucleic acid that detection is labeled, the first and second samples are combined。
Holder
Present disclosure includes for the unicellular compositions carrying out Multiple Alignment Analysis and method。The method and composition of present disclosure provides the purposes of solid support。In some cases, method disclosed here, test kit and compositions include holder。
Term " holder ", " solid support " " semi-solid support " and " substrate " are used interchangeably, and refer to the material with one or more rigidity or semi-rigid surface or one group of material。Holder can refer to any surface, and it can be transferred to solution from solution or form the structure for carrying out the mensuration based on oligonucleotide。Holder or substrate can be solid supports。Alternately, holder is non-solid support。Holder can refer to insoluble, half dissolubility or insoluble material。When holder includes joint, support, construction unit or is attached to other reactive parts thereon, it can be referred to as " functionalized ", and when solid support lacks and is attached to such a reactive part thereon, it can be referred to as " nonfunctionalized "。Holder can utilize in the solution unfetteredly, as with microtiter well form；With circulating form, as in post；Or in test strips (dipstick)。
Holder or substrate can include film, paper, plastics, the surface of coating, plane surface, glass, microscope slide, chip or its any combination。In many examples, at least one surface of holder can be substantially flat, but in certain embodiments, for different compounds, in some applications it may be desirable to physically separate synthesis regions such as such as hole, elevated regions, pin, etching grooves。According to other embodiments, one or more solid supports can adopt the form of resin, gel, microsphere or other geometric configurations。Alternately, one or more solid supports include silica chip, microgranule, nanoparticle, flat board and array。Solid support can include pearl (such as, silica gel, controlled pore glass, magnetic bead, Dynabead, king (Wang) resin；Merifield (Merrifield) resin, cross-linking dextran/sepharose 4B, cellulose bead, polystyrene bead etc.), capillary tube, flat holder such as glass fiber filter, glass surface, metal surface (steel, gold, silver, aluminum, silicon and copper), glass support, plastic supports, silicon holder, chip, filter, film, microwell plate, microscope slide or the like, plastic material includes porous plate or film (such as, by polyethylene, polypropylene, polyamide, polyvinylidene fluoride is formed), wafer, rake (comb), pin or syringe needle are (such as, be suitable to the pin array of combinatorial compound or analysis) or plane surface is (such as wafer (such as, silicon wafer), wafer with having or do not have filter bottom depression) depression or receive liter hole array in pearl。
Method and technology suitable in the synthesis of polymer (including protein) array have been described in U.S. Patent Publication No. 20050074787, WO00/58516, U.S. Patent number 5, 143, 854, 5, 242, 974, 5, 252, 743, 5, 324, 633, 5, 384, 261, 5, 405, 783, 5, 424, 186, 5, 451, 683, 5, 482, 867, 5, 491, 074, 5, 527, 681, 5, 550, 215, 5, 571, 639, 5, 578, 832, 5, 593, 839, 5, 599, 695, 5, 624, 711, 5, 631, 734, 5, 795, 716, 5, 831, 070, 5, 837, 832, 5, 856, 101, 5, 858, 659, 5, 936, 324, 5, 968, 740, 5, 974, 164, 5, 981, 185, 5, 981, 956, 6, 025, 601, 6, 033, 860, 6, 040, 193, 6, 090, 555, 6, 136, 269, 6, 269, 846 and 6, 428, 752, in PCT Publication WO99/36760 and WO01/58593, for all purposes it is combined in this all through quoting with its full content。The patent describing the synthetic technology in specific embodiment includes U.S. Patent number 5,412,087,6,147,205,6,262,216,6,310,189,5,889,165 and 5,959,098。Nucleic acid array is described in many above-mentioned patents, but many constructed can apply to polypeptide array。Other exemplary substrate is disclosed in U.S. Patent number 5,744,305 and U.S. Patent Publication No. 20090149340 and 20080038559。
Labeled nucleic acid is attached to holder and can include amine-mercaptan crosslinking, maleimide crosslinking, N-hydroxy-succinamide or N-hydroxy thiosuccinimide, pool agriculture (Zenon) or site click (SiteClick)。Labeled nucleic acid is attached to holder can include biotin being attached to the plurality of labeled nucleic acid and being coated with this one or more pearls with Streptavidin。
In some cases, solid support can include molecular scaffold。Example molecule support can include antibody, antigen, affinity reagent, polypeptide, nucleic acid, organelle and the like。Molecular scaffold can be joined together (molecular scaffold that such as, solid support can include multiple connection)。Molecular scaffold can pass through Amino acid linker, nucleic acid linker, little molecule connects (such as, biotin and Avidin) and/or substrate connects (such as, PEG or glycerol) and links together。Connection can be non-covalent。Connection can be covalency。In some cases, molecular scaffold can not be connected。Multiple independent molecular scaffold may be used in the method for present disclosure。
In some cases, support can include nanoparticle。Nanoparticle can be nickel, gold, silver, carbon, copper, silicate, platinum cobalt, zinc oxide, silica crystalline and/or Nano silver grain。Alternatively or additionally, nanoparticle can be the golden nanometer particle being embedded in porous manganese oxide。Nanoparticle can be Fe nanometer particles。Nanoparticle can be nanometer tetrapod (nanotetrapod) studding with carbon nano-particles。
Holder can include polymer。Holder can include substrate。Substrate may further include one or more pearl。Polymer can include PEG, glycerol, polysaccharide or its combination。Polymer can be plastics, rubber, nylon, silicone, neoprene and/or polystyrene。Polymer can be natural polymer。The example of natural polymer includes but not limited to Lac, succinum, Pilus Caprae seu Ovis, silkworm silk, cellulose and natural rubber。Polymer can be synthetic polymer。The example of synthetic polymer includes but not limited to synthetic rubber, phenolic resin (or Bakelite), neoprene, nylon, polrvinyl chloride (PVC or vinyl (vinyl)), polystyrene, polyethylene, polypropylene, polyacrylonitrile, PVB and silicone。
Holder can be semi-solid support。Holder can include gel (such as, hydrogel)。Term " hydrogel ", " gel " etc. are used interchangeably at this, and refer to such a material, this material be not readily to flowing liquid neither solid but gel, this gel is by by weight from 0.5% or more and be preferably less than 40% become gel solute material and form from 95% or less and preferably greater than 55% water。Can pass through to use preferably as synthesis solute (but can be natural solute, such as be used for forming gelatin) solute formed the present invention gel, described solute forms interconnecting unit, described interconnecting unit combines to water, falls into and catch water, absorb water and/or otherwise water conservation, and be thus combined generation gel with water, wherein water includes Bound moisture and unbound water。This gel can be the basic structure of the hydrogel patch of the present invention, and described hydrogel patch also includes other component (such as enzyme and salt) except becoming gel solute material and water, will further describe these components at this。Gel can be polymer gel。
Solid support can include structured nano scale structure。Such as, structured nano scale structure can include container for capturing (such as, miniature honeycomb), and it can include the oligonucleotide for catching cell and/or cellular content。In some cases, structured nano scale structure can add exogenous agents。
In some cases, holder includes pearl。Pearl can include any kind of solid or hollow ball, ball, bearing, cylinder or other similar configuration, and it is made up of plastics, pottery, metal or polymeric material, can fixed nucleic acid (such as, covalently or noncovalently) on it。Pearl can include one or more nylon wire。The shape of pearl can be spherical。The shape of pearl can be aspheric。Pearl can be unpolished, if or polished, then polishing pearl can be roughened processing before (such as, with alkylating agent)。Pearl can include can being spherical (such as, microsphere) or have erose discrete particle。Pearl can include multiple material, includes but not limited to paramagnetic material, pottery, plastics, glass, polystyrene, methyl styrene, acrylate copolymer, titanium, latex, agarose, cellulose, nylon and the like。Pearl can be attached to or be embedded in one or more holder。Pearl can be attached to gel or hydrogel。Pearl can be embedded in gel or hydrogel。Pearl can be attached to substrate。Pearl can be embedded in substrate。Pearl can be attached to polymer。Pearl can be embedded in the polymer。The oligonucleotide being used as location address existed on pearl can be used to identify this pearl locus in holder (such as, gel, substrate, support or polymer)。The example of pearl include but not limited to Streptavidin pearl, sepharose 4B, magnetic bead,Microballon, conjugation of antibodies pearl (such as, anti-immunoglobulin microballon), put together the pearl of A albumen, put together the pearl of G-protein, put together the pearl of A/G albumen, put together the pearl of L albumen, put together the pearl of oligomerization dT, silica beads, silicon dioxide sample pearl, Anti-Biotin MicroBeads, anti-fluorescent dye microballon and BcMagTMThe magnetic bead of carboxy blocking。The diameter of pearl can be about 5 μm, 10 μm, 20 μm, 25 μm, 30 μm, 35 μm, 40 μm, 45 μm or 50 μm。Pearl can refer to can for the fixing any three dimensional structure providing the surface area increased of biologic grain and macromole (such as DNA and RNA)。
Holder can be porous。Holder can be permeability or semi-permeable。Holder can be solid。Holder can be semisolid。Holder can be tool ductility。Holder can be that tool is elastic。In some cases, holder can be molded into definite shape。For example, it is possible to holder is placed on object and this holder can be this object shape。In some cases, holder is placed on organ and in the shape of this organ。In some cases, generation holder is printed by 3D。
The diameter of holder (such as, pearl, nanoparticle) can be at least about 0.1,0.5,1,2,3,4,5,6,7,8,9,10,20,30,100,500,1000 or 2000 or bigger micron。The diameter of solid support (such as, pearl) can be up to about 0.1,0.5,1,2,3,4,5,6,7,8,9,10,20,30,100,500,1000 or 2000 or bigger microns。The diameter of pearl can be about 20 microns。
In some cases, solid support includes dendrimers。Dendrimers can be less than pearl。Dendrimers can be subcellular。The diameter of dendrimers can less than 1,0.9,0.8,0.7,0.6,0.5,0.4,0.3,0.2 or 0.1 micron。The diameter of dendrimers can less than 0.09,0.08,0.07,0.06,0.05,0.04,0.03 or 0.01 micron。Dendrimers can include three major parts: core, inner shell and shell。Dendrimers can be synthesized into have in each one of these parts different functional。The different functionalities of these parts of dendrimers can control the characteristic of compound, such as dissolubility, heat stability and attachment, for application-specific。Dendrimers can process synthetically。Dendrimers can be synthesized by diversity。Diversity synthesis can include assembling dendrimers from multifunctional core, this core is stretched out by series reaction。Disperse synthesis and can include a series of Michael (Michael) reaction。Alternately, dendrimers can be synthesized by the property collected。The property collected synthesis can include from the little molecule construction dendrimers terminated at spherome surface, and react and can inwardly carry out and finally be attached to core。Dendrimers can also click on chemical preparation。Click chemistry can include diels-Alder (Diels-Alder) reaction, the reaction of mercaptan-alkyne reaction, azide-alkyne or its combination。The example of dendrimers includes but not limited to gather (amido amine) (PAMAM) dendrimers, PEG-kernel tree shaped polymer, phosphorous dendrimers, PPI dendrimers and polylysine dendrimers。Dendrimers can be chirality dendrimers。Alternately, dendrimers can be achirality dendrimers。
Solid support can include a part for dendrimers。This part of dendrimers can include tree-shaped prominent (dendron)。Tree-shaped dashing forward can include having the monodispersity wedge shape dendrimers section of multiple end group and single reaction function in focal spot。It is tree-shaped prominent that solid support can include polyester。Tree-shaped prominent example include but not limited to tree-shaped prominent, the double; two-MPA of polyester-8-hydroxyl-1-carboxyl of tree-shaped prominent, the double; two-MPA of polyester-32-hydroxyl-1-acetylene of tree-shaped prominent, the double; two-MPA of polyester-16-hydroxyl-1-acetylene of the double; two-MPA of polyester-8-hydroxyl-1-acetylene tree-shaped prominent, the double; two-MPA of polyester-16-hydroxyl-1-carboxyl is tree-shaped prominent and double; two-the MPA of polyester-32-hydroxyl-1-carboxyl is tree-shaped prominent。
Solid support can include dissaving polymer。Dissaving polymer can include the polydispersity dendrimer with dendrimers sample characteristic。Generally, dissaving polymer is prepared with single synthesized polymer step。Dissaving polymer can based on double; two (hydroxymethyl) propanoic acid (double; two-MPA) monomer of 2,2-。The example of dissaving polymer includes but not limited to hyperbranched double; two-MPA polyester-16-hydroxyl, hyperbranched double; two-MPA polyester-32-hydroxyls and hyperbranched double; two-MPA polyester-64-hydroxyl。
Solid support can be array or microarray。Solid support can include zone of dispersion。Solid support can be addressable array。In some cases, this array includes fixing multiple probes on a solid surface。The plurality of probe allows the hybridization of labeled molecule and/or labeled amplicon and the surface of solids。The plurality of probe includes at least some of complementary sequence of the amplicon with labeled molecule and/or labelling。In some cases, the plurality of probe includes at least some of complementary sequence with sample label, Molecular Identification substance markers, nucleic acid or its combination。In other cases, the plurality of probe includes the sequence complementary with the junction being attached to nucleic acid by sample label or Molecular Identification substance markers and being formed。
Array can include one or more probe。These probes may be at various ways。Array can include following probe, and this probe includes at least some of complementary sequence with target nucleic acid and the uniqueness with sample label or Molecular Identification substance markers identifies the sequence that thing district is complementary, and wherein this sample label or Molecular Identification substance markers include oligonucleotide。This array can be attached to at least some of complementary sequence of target nucleic acid。Identify that with uniqueness the sequence of thing district complementation can be attached to this array。Array can include the first probe and the second probe, and this first probe includes at least some of complementary sequence with target nucleic acid, and this second probe and uniqueness identify that thing district is complementary。Through random labeled nucleic acid can differently with hybridization array。Such as, identify that the junction of thing district and target nucleic acid can with the probe hybridization on array through the uniqueness of random labeled nucleic acid。Can there is room in the region of random labeled nucleic acid, it can with the probe hybridization on array。Can with two or more probe hybridizations on array through the zones of different of random labeled nucleic acid。Therefore, array probe may be at many multi-form。Array probe can include identifying the sequence of thing district complementation and the sequence of complementary target or its combination with uniqueness。Can carry out in several ways through the hybridization of random labeled nucleic acid Yu array。Such as, can with the one or more probe hybridizations on array through two or more nucleotide of random labeled nucleic acid。Can be continuous print nucleotide, discrete nucleotide or its combination with two or more nucleotide through random labeled nucleic acid of probe hybridization。Can by any method known in the art detection with probe hybridization through random labeled nucleic acid。For example, it is possible to directly detection is through random labeled nucleic acid。Directly detection can include detection fluorogen, hapten or detectable label through random labeled nucleic acid。Can indirect detection through random labeled molecule。Connection method or other enzyme process or non-enzyme process can be included through the indirect detection of random labeled nucleic acid。
This array may be at various ways。Such as, this array may be at 16-, 32-, 48-, 64-, 80-, 96-, 112-, 128-, 144-, 160-, 176-, 192-, 208-, 224-, 240-, 256-, 272-, 288-, 304-, 320-, 336-, 352-, 368-, 384-or 400-form。Alternately, this array is in 8x60K, 4x180K, 2x400K, 1x1M form。In other cases, this array is in 8x15K, 4x44K, 2x105K, 1x244K form。
This array can include single array。Single array can in single substrate。Alternately, this array is in multiple substrates。This array can include various ways。This array can include multiple array。The plurality of array can include two or more arrays。Such as, the plurality of array can include at least about 2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,25,30,35,40,45,50,55,60,65,70,75,80,85,90,95 or 100 arrays。In some cases, at least two array in the plurality of array is identical。Alternately, at least two array in the plurality of array is different。
In some cases, this array includes the compartment district of symmetry。Such as, this array includes 0.5x0.5 millimeter (mm), 1x1mm, 1.5x1.5mm, 2x2mm, 2.5x2.5mm, 3x3mm, 3.5x3.5mm, 4x4mm, 4.5x4.5mm, 5x5mm, 5.5x5.5mm, 6x6mm, 6.5x6.5mm, 7x7mm, 7.5x7.5mm, 8x8mm, 8.5x8.5mm, 9x9mm, 9.5x9.5mm, 10x10mm, 10.5x10.5mm, 11x11mm, 11.5x11.5mm, 12x12mm, 12.5x12.5mm, 13x13mm, 13.5x13.5mm, 14x14mm, 14.5x14.5mm, 15x15mm, 15.5x15.5mm, 16x16mm, 16.5x16.5mm, 17x17mm, 17.5x17.5mm, 18x18mm, 18.5x18.5mm, 19x19mm, 19.5x19.5mm or the compartment district of 20x20mm。In some cases, this array includes the compartment district of 6.5x6.5mm。Alternately, this array includes asymmetric compartment district。Such as, this array includes 6.5x0.5mm, 6.5x1mm, 6.5x1.5mm, 6.5x2mm, 6.5x2.5mm, 6.5x3mm, 6.5x3.5mm, 6.5x4mm, 6.5x4.5mm, 6.5x5mm, 6.5x5.5mm, 6.5x6mm, 6.5x6.5mm, 6.5x7mm, 6.5x7.5mm, 6.5x8mm, 6.5x8.5mm, 6.5x9mm, 6.5x9.5mm, 6.5x10mm, 6.5x10.5mm, 6.5x11mm, 6.5x11.5mm, 6.5x12mm, 6.5x12.5mm, 6.5x13mm, 6.5x13.5mm, 6.5x14mm, 6.5x14.5mm, 6.5x15mm, 6.5x15.5mm, 6.5x16mm, 6.5x16.5mm, 6.5x17mm, 6.5x17.5mm, 6.5x18mm, 6.5x18.5mm, 6.5x19mm, the compartment district of 6.5x19.5mm or 6.5x20mm。
This array can include at least about 1 micron (μm), 2 μm, 3 μm, 4 μm, 5 μm, 6 μm, 7 μm, 8 μm, 9 μm, 10 μm, 15 μm, 20 μm, 25 μm, 30 μm, 35 μm, 40 μm, 45 μm, 50 μm, 55 μm, 60 μm, 65 μm, 70 μm, 75 μm, 80 μm, 85 μm, 90 μm, 95 μm, 100 μm, 125 μm, 150 μm, 175 μm, 200 μm, 225 μm, 250 μm, 275 μm, 300 μm, 325 μm, 350 μm, 375 μm, 400 μm, 425 μm, 450 μm, the point of 475 μm or 500 μm。In some cases, this array includes the point of 70 μm。
This array can include at least about 1 μm, 2 μm, 3 μm, 4 μm, 5 μm, 6 μm, 7 μm, 8 μm, 9 μm, 10 μm, 15 μm, 20 μm, 25 μm, 30 μm, 35 μm, 40 μm, 45 μm, 50 μm, 55 μm, 60 μm, 65 μm, 70 μm, 75 μm, 80 μm, 85 μm, 90 μm, 95 μm, 100 μm, 125 μm, 150 μm, 175 μm, 200 μm, 225 μm, 250 μm, 275 μm, 300 μm, 325 μm, 350 μm, 375 μm, 400 μm, 425 μm, 450 μm, 475 μm, 500 μm, 525 μm, 550 μm, 575 μm, 600 μm, 625 μm, 650 μm, 675 μm, 700 μm, 725 μm, 750 μm, 775 μm, 800 μm, 825 μm, 850 μm, 875 μm, 900 μm, 925 μm, 950 μm, 975 μm, the feature pitch of 1000 μm。In some cases, this array includes the feature pitch of 161 μm。
This array can include one or more probe。In some cases, this array includes at least about 5,10,15,20,25,30,40,50,60,70,80,90 or 100 probes。Alternately, this array includes at least about 200,300,400,500,600,700,800,900,1000,1100,1200,1300,1400,1500,1600,1700,1800,1900,2000,2100,2200,2300,2400,2500,2600,2700,2800,2900 or 3000 probes。This array can include at least about 3500,4000,4500,5000,5500,6000,6500,7000,7500,8000,8500,9000,9500 or 10000 probes。In some cases, this array includes at least about 960 probes。Alternately, this array includes at least about 2780 probes。The plurality of label oligonucleotide can be had specificity by these probes。The plurality of label oligonucleotide can be had specificity by these probes at least partially。The sum of the plurality of label oligonucleotide at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97% or 100% can be had specificity by these probes。Alternately, the sum of the different label oligonucleotides of the plurality of label oligonucleotide at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97% or 100% is had specificity by these probes。These probes can be oligonucleotide。It is long that these oligonucleotide can be at least about 1,2,5,10,20,30,40,50,60,70,80,90,100 nucleotide。In other cases, these probes are non-specific probes。Such as, the detectable label being attached to labeled molecule can be had specificity by these probes。Probe can be Streptavidin。
Array can be the array printed。In some cases, the array of printing includes one or more oligonucleotide of being attached to substrate。Such as, the array of printing includes being attached to 5 ' amine-modified oligonucleotide of epoxy silane substrate。
Alternately, this array includes the microscope slide with one or more hole。This microscope slide can include at least about 2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,25,30,35,40,45,50,55,60,65,70,75,80,85,90,95 or 100 holes。Alternately, this microscope slide includes at least about 125,150,175,200,250,300,350,400,450,500,650,700,750,800,850,900,950 or 1000 holes。In some cases, this microscope slide includes 16 holes。Alternately, this microscope slide includes 96 holes。In other cases, this microscope slide includes at least about 80,160,240,320,400,480,560,640,720,800,880 or 960 holes。
In some cases, solid support is to hold high to fly (Affymetrix) 3K tag array, A Rui Ztel (Arrayjet) noncontact printing array or application microarray company (AppliedMicroarraysInc) (AMI) array。Alternately, holder includes contact printer, impact printer, dot matrix printer or impact printer。
The pearl of self assembly that solid support can include being used in micropore。Such as, solid support includes hundred million sensible pearl array techniques (BeadArrayTechnology)。Alternately, solid support includes the pearl array technique of branch and subsidiaries of Abbott Laboratories (AbbottMolecular) and the FlexiPlexTM system of application microarray company。
In other cases, solid support is flat board。The example of flat board includes but not limited to the many Array Plate of MSD, MSDFlat board, microwell plate, ProteOn microwell plate, Alpha's flat board (AlphaPlate), DELFIA flat board, Chinese mugwort search flat board (IsoPlate) and Shandong horse flat board (LumaPlate)。
The method may further include and at least one in multiple labeled nucleic acid is attached to holder。Holder can include multiple pearl。Holder can include array。Holder can include microscope slide。
This microscope slide can include one or more hole。One or more hole can be etched on microscope slide。These one or more holes can include at least 960 holes。This microscope slide can include one or more probe。These one or more probes can be printed on this microscope slide。These one or more holes may further include one or more probe。These one or more probes can be printed in these one or more holes。One or more probes can include 960 nucleic acid。
Method disclosed here and test kit may further include and multiple first sample labels, multiple second sample label, multiple Molecular Identification substance markers or its any combination be allocated in microwell plate。Method disclosed here and test kit may further include and be allocated in microwell plate by one or more pearls。Method disclosed here and test kit may further include and be allocated in multiple holes of microwell plate by multiple samples。One or more in the plurality of sample can include multiple cell。One or more in the plurality of sample can include multiple nucleic acid。The method may further include distributes one or less cell to multiple holes。The plurality of cell can be cracked in microwell plate。The method may further include synthesis cDNA in microwell plate。Synthesis cDNA can include the reverse transcription of mRNA。Microwell plate can include being manufactured by soft lithographic on PDMS, etch on silicon, on microscope slide etching, on microscope slide the microwell plate of photoresist patterned or its combination。Micropore can include the hole on microcapillary plate。Microwell plate can include water in oil emulsion。Microwell plate can include at least one or more hole。Microwell plate can include at least about 6 holes, 12 holes, 48 holes, 96 holes, 384 holes, 960 holes or 1000 holes。
These methods and test kit may further include chip。Microwell plate can be attached to chip。Chip can include at least about 6 holes, 12 holes, 48 holes, 96 holes, 384 holes, 960 holes, 1000 holes, 2000 holes, 3000 holes, 4000 holes, 5000 holes, 6000 holes, 7000 holes, 8000 holes, 9000 holes, 10,000 hole, 20,000 hole, 30,000 hole, 40,000 hole, 50,000 hole, 60,000 hole, 70,000 hole, 80,000 hole, 90,000 holes, 100,000 holes, 200,000 hole, 500,000 holes or 1,000,000 holes。Hole can include at least about 300 microns2, 400 microns2, 500 microns2, 600 microns2, 700 microns2, 800 microns2, 900 microns2, 1000 microns2, 1100 microns2, 1200 microns2, 1300 microns2, 1400 microns2, 1500 microns2Area。The method may further include the sample distributed on chip between about 10,000 and 30,000。
Functionalized surface and oligonucleotide
Pearl can include functionalized surface。Functionalized surface can refer to the surface comprising functional group of solid support。Functional group can be able to form, with another functional group, the group being attached。Such as, functional group can be biotin, and it can form attachment with another functional group's Streptavidin。Exemplary functional groups can include but not limited to aldehyde, ketone, carboxylic group, amino group, biotin, Streptavidin, nucleic acid, little molecule is (such as, for click chemistry), with difunctional and heterobifunctional agent (such as, N-succinimido (4-iodoacteyl) Aminobenzoate (SIAB), two maleimides, dithio-bis--nitrobenzoic acid (DTNB), N-succinimidyl-S-acetyl-thiacetate (SATA), N-succinimido-3-(2-pyridine radicals dithio) propionic ester (SPDP), succinimido 4-(N-maleimidomethyl)-hexamethylene-1-formic acid esters (SMCC) and 6-hydrazino-nicotinamide (hydrazinonicotimide) (HYNIC)) and antibody。In some cases, functional group is carboxylic group (such as, COOH)。
Oligonucleotide (such as, nucleic acid) can be attached to functionalized solid support。Fixing oligonucleotide on solid support or similar structures can serve as nucleic probe, and can carry out hybridization assays, wherein can detect specific target nucleic acid in complicated biological sample。
Can by functionalized for solid support (such as, pearl), for immobilized oligonucleotide。Oligonucleotide can be conjugated to this solid support by the covalency amido link formed between solid support and this oligonucleotide。
Holder can be conjugated at least about 10,20,30,40,50,60,70,80,90,100,200,300,400,500,600,700,800,900 or 1000 or more oligonucleotide。Holder can be conjugated at least about 100000,200000,300000,400000,500000,600000,700000,800000,900000,1000000,2000000,3000000,4000000,5000000,6000000,7000000,8000000,9000000 or 10000000,100000000,500000000,1000000000 or more oligonucleotide。Holder can be conjugated at least about 100000,200000,300000,400000,500000,600000,700000,800000,900000,1000000,2000000,3000000,4000000,5000000,6000000,7000000,8000000,9000000 or 10000000,100000000,500000000,1000000000 or more oligonucleotide。Holder can be conjugated at least one million oligonucleotide。Holder can be conjugated at least one ten million oligonucleotide。Holder can be conjugated at least two thousand five million oligonucleotide。Holder can be conjugated at least five thousand ten thousand oligonucleotide。Holder can be conjugated at least one hundred million oligonucleotide。Holder can be conjugated at least 2.5 hundred million oligonucleotide。Holder can be conjugated at least 5 hundred million oligonucleotide。Holder can be conjugated at least 7.5 hundred million oligonucleotide。Holder can be conjugated at least about 1,000,000,000,2,000,000,000,3,000,000,000,4,000,000,000,5,000,000,000,6,000,000,000,7,000,000,000,8,000,000,000,9,000,000,000,10,000,000,000,11,000,000,000,12,000,000,000,13,000,000,000,14,000,000,000 or 15,000,000,000 oligonucleotide。Holder can be conjugated at least ten hundred million oligonucleotide。Holder can be conjugated at least five ten hundred million oligonucleotide。
Oligonucleotide can via joint be attached to holder (such as, pearl, polymer, gel)。Put together and can include covalently or non-covalently being attached。Put together and can introduce variable interval thing between pearl and nucleic acid。Joint between holder and oligonucleotide be can cut (such as, light can cut connection, the unstable joint of acid, temperature-sensitive joint and can the joint of enzymatic cutting)。
For the cross-linking agent of molecular conjugate to holder be may be configured to the functional group that exists in solid support surface and with the reagent of functional group reactions that exists in molecule。Can have such reactive reagent and can include aldehyde, ketone, carboxylic group, amino group, biotin, Streptavidin, nucleic acid, little molecule is (such as, for click chemistry), with difunctional and heterobifunctional agent (such as, N-succinimido (4-iodoacteyl) Aminobenzoate (SIAB), two maleimides, dithio-bis--nitrobenzoic acid (DTNB), N-succinimidyl-S-acetyl-thiacetate (SATA), N-succinimido-3-(2-pyridine radicals dithio) propionic ester (SPDP), succinimido 4-(N-maleimidomethyl)-hexamethylene-1-formic acid esters (SMCC) and 6-hydrazino-nicotinamide (HYNIC))。
Pearl can and oligonucleotide functionalized by carboxyl functional group can be functionalized by amido functional group。
Holder can be smooth。Alternatively or additionally, holder can include recessed, ridge or hole。Holder can include microwell array。The functional group that microwell array can be contributed to the attachment of oligonucleotide is functionalized。Functional group on microwell array can be different for the diverse location on microwell array。Functional group on microwell array can be identical for all regions on microwell array。
Measure system unit
Microwell array
As above, microwell array is used to be trapped in the little reative cell with restriction volume unicellular and pearl (a pearl/cell)。Each pearl includes the whole complement for random labelling cell mRNA molecule and it is carried out the oligonucleotide probe library of digital counting, when these probes after lysis are released。In an embodiment of present disclosure, microwell array is the expendable parts of mensuration system。In other embodiments, microwell array can be reusable。In either case, they may be configured to the stand-alone device being used as being performed manually by mensuration, or they may be configured to include providing the removable or fixing parts of the automatic wholly or in part instrument of mensuration program。
The micropore of array can be manufactured into various shape and size, chooses to optimize to it and captures unicellular and pearl efficiency in each hole。Suitable hole geometry includes but not limited to cylinder, cone, hemispherical, rectangle or polyhedron are (such as, the three-dimensional geometry body being made up of some planes, for instance hexagon prism, octagonal column, triangular pyramid, rectangular pyramid, pentagonal pyramid, hexagonal vertebra or the truncated pyramid that falls)。Micropore can include the shape of two or more being combined with in these geometries。Such as, in one embodiment, it can be partial cylindrical shapes, and remainder has the shape of inverted cone。In another embodiment, it can include two cylinders arranged side by side, and the diameter of is more than another, and the two cylinder connects by extending the Vertical Channel (that is, being parallel to cylinder axis) of cylindrical total length (degree of depth)。Generally, the opening (or mouth) of each micropore is positioned on the upper surface of microwell array, but in certain embodiments, opening can be positioned on the lower surface of array。Generally, the blind end (or bottom) of micropore is flat, but curved surface (such as, protrude or cave in) is also possible。The shape (and size) of micropore is determined generally, based on the type of the cell needing to be trapped in micropore and/or pearl。
Pore size can be characterized for the diameter in hole and the degree of depth。As used herein, the diameter of micropore refers to the greatest circle in the planar cross section that can be inscribed within micropore solid。In an embodiment of present disclosure, the diameter range of micropore can be the diameter of cell and/or the pearl needing to be trapped in micropore from about 0.1 times to about 5 times。In other embodiments, micro-pore diameter is at least 0.1 times of diameter, at least 0.5 times, at least 1 times, at least 2 times, at least 3 times, at least 4 times or at least 5 times of cell and/or the pearl needing to be trapped in micropore。In still other embodiments, micro-pore diameter is the cell needing to be trapped in micropore and/or at most 5 times of diameter of pearl, at most 4 times, at most 3 times, at most 2 times, at most 1 times, at most 0.5 times or at most 0.1 times。In one embodiment, micro-pore diameter is about 2.5 times of the diameter of cell and/or the pearl needing to be trapped in micropore。It should be appreciated by those skilled in the art that, micro-pore diameter can fall in any scope limited by these values any (cell that such as, needs to be trapped in micropore and/or the diameter of pearl from about 0.2 times to about 3.5 times)。Alternately, it is possible to for absolute dimension, specify the diameter of micropore。In an embodiment of present disclosure, the diameter range of micropore can be from about 5 to about 50 microns。In other embodiments, micro-pore diameter is at least 5 microns, at least 10 microns, at least 15 microns, at least 20 microns, at least 25 microns, at least 30 microns, at least 35 microns, at least 40 microns, at least 45 microns or at least 50 microns。In still other embodiments, micro-pore diameter is up to 50 microns, at most 45 microns, at most 40 microns, at most 35 microns, at most 30 microns, at most 25 microns, at most 20 microns, at most 15 microns, at most 10 microns or at most 5 microns。In one embodiment, micro-pore diameter is about 30 microns。It should be appreciated by those skilled in the art that, micro-pore diameter can fall in any scope limited by these values any (such as, from about 28 microns to about 34 microns)。
Micropore depth is selected, in order to optimization cell and pearl capture efficiency also provide for the effective exchange measuring buffer and other reagent being included in hole simultaneously。In an embodiment of present disclosure, the depth bounds of micropore can be the diameter of cell and/or the pearl needing to be trapped in micropore from about 0.1 times to about 5 times。In other embodiments, micropore depth is at least 0.1 times of diameter, at least 0.5 times, at least 1 times, at least 2 times, at least 3 times, at least 4 times or at least 5 times of cell and/or the pearl needing to be trapped in micropore。In still other embodiments, micropore depth is the cell needing to be trapped in micropore and/or at most 5 times of diameter of pearl, at most 4 times, at most 3 times, at most 2 times, at most 1 times, at most 0.5 times or at most 0.1 times。In one embodiment, micropore depth is about 2.5 times of the diameter of cell and/or the pearl needing to be trapped in micropore。It should be appreciated by those skilled in the art that, micropore depth can fall in any scope limited by these values any (cell that such as, needs to be trapped in micropore and/or the diameter of pearl from about 0.2 times to about 3.5 times)。Alternately, it is possible to for absolute dimension, specify the diameter of micropore。In an embodiment of present disclosure, the depth bounds of micropore can be from about 10 to about 60 microns。In other embodiments, micropore depth is at least 10 microns, at least 20 microns, at least 25 microns, at least 30 microns, at least 35 microns, at least 40 microns, at least 50 microns or at least 60 microns。In still other embodiments, micropore depth is up to 60 microns, at most 50 microns, at most 40 microns, at most 35 microns, at most 30 microns, at most 25 microns, at most 20 microns or at most 10 microns。In one embodiment, micropore depth is about 30 microns。It should be appreciated by those skilled in the art that, micropore depth can fall in any scope limited by these values any (such as, from about 24 microns to about 36 microns)。
The hole of microwell array is arranged in one-dimensional, two-dimentional or cubical array, and wherein cubical array can such as be realized by accumulation two or more two-dimensional arraies a series of (that is, by piling up two or more substrates comprising microwell array)。Pattern between hole and interval are selected, in order to optimize in each hole, capture unicellular and pearl efficiency, and maximize the number of perforations of the per unit area of array。Hole can be spread according to multiple random or non-random pattern, for instance, they can be distributed to completely random on the surface of array substrate, or they can be arranged to square net, rectangular mesh or hexagonal gridding。In an embodiment of present disclosure, the centre-to-centre spacing (or interval) between hole can the change from about 15 microns to about 75 microns。In other embodiments, the interval between hole is at least 15 microns, at least 20 microns, at least 25 microns, at least 30 microns, at least 35 microns, at least 40 microns, at least 45 microns, at least 50 microns, at least 55 microns, at least 60 microns, at least 65 microns, at least 70 microns or at least 75 microns。In still other embodiments, micropore interval is up to 75 microns, at most 70 microns, at most 65 microns, at most 60 microns, at most 55 microns, at most 50 microns, at most 45 microns, at most 40 microns, at most 35 microns, at most 30 microns, at most 25 microns, at most 20 microns or at most 15 microns。In one embodiment, micropore interval is about 55 microns。It should be appreciated by those skilled in the art that, micropore depth can fall in any scope limited by these values any (such as, from about 18 microns to about 72 microns)。
Microwell array can include surface character between micropore, and it is designed to assist in guiding cell and pearl access aperture and/or preventing on they sedimentation surfaces between the holes。The example of surface character being suitable for include but not limited to wound hole and/or stride across surface between hole protuberance, in ridged or pointed surface character。
The total number in the hole in microwell array is determined by the pattern in hole and the overall size of interval and array。In an embodiment of present disclosure, the number cells purpose scope in array can be from about 96 to about 5,000,000 or higher。In other embodiments, the micropore number in array is at least 96, at least 384, at least 1,536, at least 5,000, at least 10,000, at least 25,000, at least 50,000, at least 75,000, at least 100,000, at least 500,000, at least 1,000,000 or at least 5,000,000。In still other embodiments, the micropore number in array is up to 5,000,000, at most 1,000,000, at most 75,000, at most 50,000, at most 25,000, at most 10,000, at most 5,000, at most 1,536, at most 384 or at most 96 holes。In one embodiment, the micropore number in array is about 96。In another embodiment, micropore number is about 150,000。It should be appreciated by those skilled in the art that, the micropore number in array can fall in any scope limited by these values any (such as, from about 100 to 325,000)。
Any one in multiple manufacturing technology known to persons of ordinary skill in the art can be used to manufacture microwell array。The example of operable manufacture method includes but not limited to bulk silicon micromachining technology, such as photoetching process and wet chemical etching, plasma etching or deep reactive ion etch；Micro-molding and micro-embossed；Laser microcomputer tool is processed；3D prints or uses other manufacturing process of writing direct of curable materials；And similar techniques。
Microwell array can be manufactured by any one in multiple base material known to persons of ordinary skill in the art, and wherein the selection of material typically depends on the selection of manufacturing technology, and vice versa。The example of material being suitable for include but not limited to silicon, fused silica, glass, polymer (such as, agarose, gelatin, hydrogel, polydimethylsiloxane (PDMS；Elastomer), polymethyl methacrylate (PMMA), Merlon (PC), polypropylene (PP), polyethylene (PE), high density polyethylene (HDPE) (HDPE), polyimides, cyclic olefin polymer (COP), cyclic olefine copolymer (COC), polyethylene terephthalate (PET) and epoxy resin), metal or metal film (such as, aluminum, rustless steel, copper, nickel, chromium and titanium) and the like。Typically, water wetted material is make us desired (to strengthen wettability and to minimize cell and the non-specific binding of other biological material) for manufacturing microwell array, but can (such as, being processed by oxygen plasma, or the grafting on polyoxyethylene top layer) hydrophobic material that can process or be coated with also is operable。Using porous hydrophilic material to manufacture microwell array can be make us desired, in order to contribute to the capillary tube wicking/ventilation of the bubble retained in device。In certain embodiments, microwell array is manufactured with optical cement。In certain embodiments, microwell array is manufactured with the material through plasma or sided corona treatment。Use the material through plasma or sided corona treatment can make material hydrophilic。In certain embodiments, can be more more stable than untreated material through the material (such as water wetted material) of plasma or sided corona treatment。In certain embodiments, microwell array is manufactured by homogenous material。In other embodiments, microwell array can include two or more already in connection with together or be mechanically connected different materials。
Kinds of surface processes and process for modifying surface may be used for changing the characteristic on microwell array surface。Example include but not limited to oxygen plasma be processed so that hydrophobic material surface is more hydrophilic, use wet or dry etching technology so that glass and silicon face smooth (or coarse), by polyoxyethylene or or other polymeric layers absorption and/or be grafted to substrate surface so that they are more hydrophilic and be less prone to the non-specific adsorption of biomolecule and cell, use silane reaction so that chemical reactivity functional group to be grafted to other inertia silicon and glass surface etc.。Light deprotection technology may be used for optionally activating the chemical reactivity functional group of the specific location in array structure; such as, the chemical reactivity functional group (such as primary amine or carboxylic group) on the inwall of selectivity interpolation or activation micropore may be used for oligonucleotide probe, peptide, protein or other biological molecule covalent are coupled to micro-pore wall。Generally, the type of desired surface characteristic and the type of the material making microwell array are depended in the surface treatment of utilization or the selection of surface modification。
In some embodiments, it may be desirable to the opening of micropore is sealed in such as cell lysis procedure process, to prevent the target nucleic acid between adjacent cells from carrying out crisscrossing。Cap (such as solid support or pearl) can be used to seal micropore, and wherein the diameter of pearl is more than the diameter of micropore。Such as, can than the diameter of micropore big at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% as the pearl of cap。Alternately, cap can than the diameter of micropore big at most about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%。
Pearl as cap can include cross-linking dextran pearl (such as, cross-linking dextran (Sephadex))。The scope of cross-linking dextran can be from about 10 microns to about 80 microns。The cross-linking dextran of pearl cap can be from 20 microns to about 50 microns。Cap can include such as inorganic nano pore membrane (such as, aluminium oxide), dialyzer, microscope slide, coverslip and/or hydrophilic plastic thin film (such as, with the thin film with the agarose thin film coated of lysis buffer hydration)。
In certain embodiments, cap can allow buffer through turnover micropore, stops macromole (such as, nucleic acid) to migrate out from hole simultaneously。By cap can stop at least about 1,2,3,4,5,6,7,8,9,10,12,13,14,15,16,17,18,19 or 20 or the macromole of more nucleotide migrate into or leave micropore。By cap can stop at most about 1,2,3,4,5,6,7,8,9,10,12,13,14,15,16,17,18,19 or 20 or the macromole of more nucleotide migrate into or leave micropore。
In certain embodiments, the microwell array of sealing can include the monolayer of beads at micropore top。In certain embodiments, the microwell array of sealing can include the multilamellar pearl at micropore top。The microwell array sealed can include about 1,2,3,4,5 or 6 or more multi-layered pearl。
Mechanical fastener
When being performed manually by random labelling multiple, unicellular/molecule index and measuring, it is expedient to microwell array is arranged in mechanical fastener, in order to produce reative cell and contribute to pipetting or be distributed to (Figure 69 and 70) on array by cell suspending liquid and mensuration reagent pipet。In Figure 69 example illustrated, holder accepts the microwell array manufactured in substrate thick for 1mm, and the mechanical support in silicone gasket form is provided, to be limited in measuring reagent in the deep reative cell of the 16mm width x35mm about 4mm of long x, consequently allow for using the cell suspending liquid of 800 microlitres to 1 milliliter and pearl suspension (comprising the oligonucleotide marker based on pearl) to be measured。
Holder is by the top board of the machining of rigidity and base plate (such as, aluminum) and for producing compressible (such as, silicone, dimethyl siloxane) the packing ring composition in locular wall or hole。Design feature includes: (i) for rotating in and out chamfering aperture edge and the gap (for checking microwell array under different amplification) of appropriate location as required by microscope objective。(ii) the controlled compression of silicone gasket, to guarantee repeatably to be formed uniformly leakproof seal with microwell array substrate。(iii) for the captive fastener of convenient operation。(iv) for the positioning and clamping mechanism of firmly and repeatably oriented array。V () for removing the convenient dismounting of array in rinse step process。
Top board and base plate can use multiple material (such as, aluminum, anodised aluminium, rustless steel, Teflon, polymethyl methacrylate (PMMA), Merlon (PC) or similar rigid polymer material) use any one (such as, regular machinery processing, CNC machine processing, injection moulding, 3D printing etc.) in multiple technologies to manufacture。
Silicone (polydimethylsiloxane；PDMS) packing ring may be configured to produce multiple room (referring to Figure 71), in order to runs comparison and experiment (or repeating experiment or multiple independent experiment) abreast。Packing ring uses Teflon mould to be molded by PDMS or similar elastomeric material, and described mould includes the drafting angle for vertical packing ring to provide good release characteristic。Alternately, mould by aluminum or other materials (such as, black Delrin (delrin), Polyetherimide (ultem) etc.) machining, and if necessary can be coated with the release characteristic good coated with offer with Teflon。Gasket mould design is reverse, namely, so make moulded parts top surface (namely with in casting process for covering mould, the surface at microscope slide or silicon wafer interface cohesion place) in use become the surface for producing sealing with microwell array substrate, thus avoid the potential problems of mold surface roughness and surface contamination in producing smooth washer face (to guarantee to form leakproof seal with array substrate), and by using microwell array substrate to additionally provide selecting flexibly and pre-assembled right to choose of base material as base portion in casting process。Gasket mould design can also include the poly-power ridge (forcefocusingridge) of porose area boundary, namely one or more central authorities' table top (mesa) (it forms one or more holes) in mould have the ridge of projection in the position of the circumference becoming these one or more holes, so making the lid being placed on die top after filling rest on the small area of contact of accurate location, the edge contour good in described accurate location is crucial in use forming leakproof seal between packing ring and substrate。
Instrument system
Present disclosure also includes instrument system and the consumable goods of the automatization for supporting random labelling multiple, unicellular/molecule index to measure。This type of system can include the expendable cylinder being incorporated to the microwell array integrated with flow cell, together with being used for providing instrument and equipment necessary to control and analysis functionality, described functional be such as (i) jet vectoring, (ii) temperature control, (iii) cell and/or pearl distribution and collecting mechanism, (iv) lysis mechanism, (v) imaging capability and (vi) image procossing。In certain embodiments, the input of system includes cell sample and output includes comprising the pearl suspension of the pearl of the oligonucleotide with attachment, and described oligonucleotide comprises sample label, cell label and molecule index tab。In other embodiments, system can include other functional, as being used for carrying out the thermal cycling capability of pcr amplification, the input of system includes cell sample and output includes the oligonucleotide library that produced by the amplification of oligonucleotide in this case, and described oligonucleotide comprises the sample label, cell label and the molecule index tab that are attached at first on pearl。In still other embodiments, system can also include order-checking ability, need or need not expand by oligonucleotide, in this case, the input of system is cell sample and output includes data set, and described data set farther includes the sequence of all samples label relevant to target sequence interested, cell label and molecule index tab。
Microwell array flow cell
In many embodiments of automatic assay system, microwell array substrate is packaged in flow cell, described flow cell provides and the facilitating interface cohesion and contribute to being delivered to the exchange of fluid (such as, cell and pearl suspension, lysis buffer, wash buffer etc.) of microwell array of the remainder of fluid handling system。Design feature may include that (i) one or more entrance for introducing cell sample, pearl suspension and/or other mensuration reagent, (ii) one or more it is designed to provide uniform filling and effective fluid communication minimizes the microwell array room in same whirlpool or dead band and (iii) one or more outlet for fluid is delivered to sample collection point and/or refuse reservoir simultaneously。In certain embodiments, the design of flow cell can include the multiple microwell array rooms with multiple microwell array interface cohesion, so allows to the one or more cell sample of parallel processing。In certain embodiments, the design of flow cell may further include the feature producing uniform flow velocity profile (i.e. " piston flow ") for the width across array room, to provide cell and pearl to the evenly delivery of micropore, such as, by using the porous barrier being positioned near chamber inlet with microwell array upstream as " flowing bubbler (flowdiffuser) ", or by each array room is divided into some segmentations, these segmentations collectively cover identical total array area, but are flowed abreast by they entrance liquid stream separately。In certain embodiments, flow cell can around or be incorporated to more than one microwell array substrate。In certain embodiments, the microwell array/flow cell assemblies of integration may be constructed the fixing parts of system。In certain embodiments, microwell array/flow cell can be removed from instrument。
Generally, fluid passage and the one or more array room size in flow cell designs will be optimized, in order to (i) provides cell and pearl to the uniform delivery of microwell array, and (ii) minimizes sample and reagent consumption。In certain embodiments, the width of fluid passage will between 50 microns and 20mm。In other embodiments, the width of fluid passage can be at least 50 microns, at least 100 microns, at least 200 microns, at least 300 microns, at least 400 microns, at least 500 microns, at least 750 microns, at least 1mm, at least 2.5mm, at least 5mm, at least 10mm or at least 20mm。In still other embodiments, the width of fluid passage can be up to 20mm, at most 10mm, at most 5mm, at most 2.5mm, at most 1mm, at most 750 microns, at most 500 microns, at most 400 microns, at most 300 microns, at most 200 microns, at most 100 microns or at most 50 microns。In one embodiment, the width of fluid passage is about 2mm。It should be appreciated by those skilled in the art that, the width of fluid passage can fall in any scope limited by these values any (such as, from about 250 microns to about 3mm)。
In certain embodiments, the degree of depth of fluid passage will between 50 microns and 10mm。In other embodiments, the degree of depth of fluid passage can be at least 50 microns, at least 100 microns, at least 200 microns, at least 300 microns, at least 400 microns, at least 500 microns, at least 750 microns, at least 1mm, at least 1.25mm, at least 1.5mm, at least 1.75mm, at least 2mm, at least 2.5mm, at least 3mm, at least 3.5mm, at least 4mm, at least 4.5mm, at least 5mm, at least 5.5mm, at least 6mm, at least 6.5mm, at least 7mm, at least 7.5mm, at least 8mm, at least 8.5mm, at least 9mm or at least 9.5mm。In other embodiments, the degree of depth of fluid passage can be up to 10mm, at most 9.5mm, at most 9mm, at most 8.5mm, at most 8mm, at most 7.5mm, at most 7mm, at most 6.5mm, at most 6mm, at most 5.5mm, at most 5mm, at most 4.5mm, at most 4mm, at most 3.5mm, at most 3mm, at most 2mm, at most 1.75mm, at most 1.5mm, at most 1.25mm, at most 1mm, at most 750 microns, at most 500 microns, at most 400 microns, at most 300 microns, at most 200 microns, at most 100 microns or at most 50 microns。In one embodiment, the degree of depth of fluid passage is about 1mm。It should be appreciated by those skilled in the art that, the degree of depth of fluid passage can fall in any scope limited by these values any (such as, from about 800 microns to about 1mm)。
Flow cell can use multiple technologies known to persons of ordinary skill in the art and material manufacture。Generally, flow cell is manufactured to independent part and subsequently by mechanically clamping or be permanently attached in microwell array substrate。The example of the manufacturing technology being suitable for includes any one in regular machinery processing, CNC machine processing, injection moulding, 3D printing, alignment laminating layer or multilamellar cut or die-cut thin polymer film or multiple micro-fabrication technology, such as photoetching process and wet chemical etching, dry ecthing, deep reactive ion etch or the processing of laser microcomputer tool。Once flow cell part is produced, then it can mechanically be attached to microwell array substrate, such as by it is clamped (use or do not use packing ring) against microwell array substrate, or any one (depending on the selection of the material used) in multiple technologies known to persons of ordinary skill in the art can be used to make it be bonded directly in microwell array substrate, such as by using anode linkage, thermal bonding, any one in ultrasonic bonding or multiple binding agent or adhesive film, including based on epoxy resin, based on acrylic acid, based on silicone, UV-curable, based on polyurethane or binding agent based on cyanoacrylate。
Flow cell can use multiple material manufacture known to persons of ordinary skill in the art。The example of the material being suitable for includes but not limited to any one (such as, the polydimethylsiloxane (PDMS in silicon, fused silica, glass, multiple polymers；Elastomer), polymethyl methacrylate (PMMA), Merlon (PC), polypropylene (PP), polyethylene (PE), high density polyethylene (HDPE) (HDPE), polyimides, cyclic olefin polymer (COP), cyclic olefine copolymer (COC), polyethylene terephthalate (PET), epoxy resin), the combination of metal (such as, aluminum, rustless steel, copper, nickel, chromium and titanium) or these materials。
Cylinder
In many embodiments of automatic assay system, microwell array (has or does not have attachment flow cell) and will be packaged in expendable cylinder, described cylinder and instrument system interface cohesion and can be incorporated to other functional。The design feature of cylinder can include (i) one or more entrance, fluidly connects for being formed with instrument and/or cell sample, pearl suspension and/or other mensuration reagent is manually introduced in cylinder；(ii) one or more bypass channels, namely for self-measuring cell sample and pearl suspension, to avoid spill-over and/or backflow；(iii) microwell array/flow cell assemblies of one or more integration or one or more room, its inner position has one or more microarray substrate；(iv) micropump integrated or other fluid-actuated mechanisms, be used for controlling fluid flow through device；V miniature valve that () is integrated, is used for prestrain reagent septal area and/or controls fluid flow through device；(vi) for providing the passage of escape paths for capture air；(vii) one or more samples and reagent refuse reservoir；(viii) one or more outlets, for forming, with instrument, the sample collection point fluidly connecting and/or providing treated；(ix) mechanical interface feature, for the expendable cylinder removable relative to instrument system repeatability location, and is used for providing entrance, so makes the outer magnet can with microwell array closely；X temperature control unit that () is integrated and/or hot interface, thermally contact with the good of instrument system for providing；And (xi) optical interface feature, for instance transparency window, for microwell array is carried out optical interrogation。In certain embodiments, cylinder is designed to process more than one sample abreast。In some embodiments of device, cylinder may further include the one or more removable sample collection room be suitable to stand alone type PCR thermal cycler and/or sequenator interface cohesion。In some embodiments of device, cylinder self is suitable to and stand alone type PCR thermal cycler and/or sequenator interface cohesion。
In some embodiments of device, cylinder may further include parts, described parts are designed to generation and prevent the physically and/or chemically barrier of solid tumor (or increasing its path and diffusion time), in order to minimize the cross-contamination between micropore。The example of this type of barrier includes but not limited to a set of serpentine channel for cell and pearl are delivered to microwell array, through pressing the scalable pressing plate or deformable film contacted with microwell array substrate surface in cracking or incubation step process, use bigger pearl (such as cross-linked glucose pearl as above) to carry out blocking microporous opening, or make immiscible hydrophobic fluid discharge to efficiently separate from the reservoir in cylinder in cracking or incubation step process and each micropore in septal area array。Any or all these barriers or not there is the embodiment of this type of barrier can with the viscosity combinations of the solution of that increase in micropore and contiguous micropore, for instance by interpolation solution component such as glycerol or Polyethylene Glycol。
Generally, fluid passage and one or more array room size in cylinder design will be optimized, in order to (i) provides cell and pearl to the uniform delivery of microwell array, and (ii) minimizes sample and reagent consumption。In certain embodiments, the width of fluid passage will between 50 microns and 20mm。In other embodiments, the width of fluid passage can be at least 50 microns, at least 100 microns, at least 200 microns, at least 300 microns, at least 400 microns, at least 500 microns, at least 750 microns, at least 1mm, at least 2.5mm, at least 5mm, at least 10mm or at least 20mm。In still other embodiments, the width of fluid passage can be up to 20mm, at most 10mm, at most 5mm, at most 2.5mm, at most 1mm, at most 750 microns, at most 500 microns, at most 400 microns, at most 300 microns, at most 200 microns, at most 100 microns or at most 50 microns。In one embodiment, the width of fluid passage is about 2mm。It should be appreciated by those skilled in the art that, the width of fluid passage can fall in any scope limited by these values any (such as, from about 250 microns to about 3mm)。
In certain embodiments, the fluid passage degree of depth in cylinder design will between 50 microns and 10mm。In other embodiments, the degree of depth of fluid passage can be at least 50 microns, at least 100 microns, at least 200 microns, at least 300 microns, at least 400 microns, at least 500 microns, at least 750 microns, at least 1mm, at least 1.25mm, at least 1.5mm, at least 1.75mm, at least 2mm, at least 2.5mm, at least 3mm, at least 3.5mm, at least 4mm, at least 4.5mm, at least 5mm, at least 5.5mm, at least 6mm, at least 6.5mm, at least 7mm, at least 7.5mm, at least 8mm, at least 8.5mm, at least 9mm or at least 9.5mm。In still other embodiments, the degree of depth of fluid passage can be up to 10mm, at most 9.5mm, at most 9mm, at most 8.5mm, at most 8mm, at most 7.5mm, at most 7mm, at most 6.5mm, at most 6mm, at most 5.5mm, at most 5mm, at most 4.5mm, at most 4mm, at most 3.5mm, at most 3mm, at most 2mm, at most 1.75mm, at most 1.5mm, at most 1.25mm, at most 1mm, at most 750 microns, at most 500 microns, at most 400 microns, at most 300 microns, at most 200 microns, at most 100 microns or at most 50 microns。In one embodiment, the degree of depth of fluid passage is about 1mm。It should be appreciated by those skilled in the art that, the degree of depth of fluid passage can fall in any scope limited by these values any (such as, from about 800 microns to about 1mm)。
Cylinder can use multiple technologies known to persons of ordinary skill in the art and material manufacture。Generally, any one in multiple mechanical package or combination technology is used cylinder to be fabricated to a series of independent parts (Figure 72) and is subsequently assembled (Figure 72 and 73)。The example of the manufacturing technology being suitable for includes but not limited to that regular machinery processing, CNC machine processing, injection moulding, hot forming and 3D print。Once cylinder component is produced, can use screw, clip etc. that they are carried out mechanical package, or any one (the depending on the selection of the material used) in use multiple technologies makes them forever combine, such as by using any one in heat or ultrasonic bonding/welding or multiple binding agent or adhesive film, including based on epoxy resin, based on acrylic acid, based on silicone, UV-curable, based on polyurethane or binding agent based on cyanoacrylate。
Cylinder component can use any one in multiple applicable material to manufacture, and includes but not limited to any one (such as, the polydimethylsiloxane (PDMS in silicon, fused silica, glass, multiple polymers；Elastomer), polymethyl methacrylate (PMMA), Merlon (PC), polypropylene (PP), polyethylene (PE), high density polyethylene (HDPE) (HDPE), polyimides, cyclic olefin polymer (COP), cyclic olefine copolymer (COC), polyethylene terephthalate (PET), epoxy resin) or metal (such as, aluminum, rustless steel, copper, nickel, chromium and titanium)。
As above, the entrance and exit feature of cylinder can be designed to provide fluidly connecting of the convenience with instrument and leakproof, or can serve as open reservoir, for manually sample and reagent are pipetted turnover cylinder with pipet。The example facilitating Machine Design of entrance and exit adapter includes but not limited to screw thread coupling, die forging adapter, Luer lock adapter, Rule sliding lock (Luerslip) or " sliding-type (sliptip) " adapter, press-in mating connector and the like。In certain embodiments, the entrance and exit of cylinder may further include cap, spring loads lid or plug, phase-change material or polymeric film, when cylinder is positioned in the instrument, it is opened or punctures, and is storing the pollution of process middle column body inner surface and/or prevented fluid from overflowing when cylinder removes from instrument for preventing。As noted above, in certain embodiments, one or more outlets of cylinder may further include removable sample collection room, and it is suitable to and stand alone type PCR thermal cycler and/or sequenator interface cohesion。
As noted above, in certain embodiments, cylinder can include the micropump or other fluid-actuated mechanisms that integrate, is used for controlling fluid flow through device。The micropump being suitable for or the example of fluid-actuated mechanism include but not limited to dynamo-electric or pneumatically actuated microsyringe or plunger mechanism, chemical propellant, pneumatically or the film membrane pump, pneumatically actuated reagent pouch or the air bag that are activated by outer piston or electroosmotic pump。
As above, in certain embodiments, cylinder can include miniature valve, is used for prestrain reagent septal area and/or controls fluid flow through device。The example of the miniature valve being suitable for includes but not limited to disposable " valve " that the polymeric film using the wax that can be melted or dissolve or polymer plug maybe can be punctured manufactures；The pinch valve using deformable film structure and pneumatic, hydraulic pressure, magnetic, the electromagnetism that use deformable membrane structure or the check-valves that activates of electromechanics (solenoid) and the miniature family of power and influence。
As noted above, in certain embodiments, cylinder can include the passage for providing escape paths for capture air。Can constructing passage according to multiple technologies known to persons of ordinary skill in the art, for instance use the porous plug of polydimethylsiloxane (PDMS) or other hydrophobic materials, described material allows capillary core suck but stops by water penetration。Passage can also be configured to hole by hydrophobic barrier material, so makes will not occur under pressure used in operation the moistening of hole wall。
Generally, the mechanical interface feature of cylinder provides cylinder being easily removed but high precision and repeatably positioning relative to instrument system。The mechanical interface feature being suitable for includes but not limited to alignment pin, location guiding element, mechanical stopping piece and the like。In certain embodiments, mechanical design features will include convexo-concave characteristic, be used for making external equipment (such as, magnet or optics) and microwell array room closely (Figure 72)。
In certain embodiments, cylinder also includes temperature control unit or hot interface feature, coordinates for controlling module with external temperature。The example of the temperature control component being suitable for includes but not limited to the heating of stratie, miniature infrared emission light source, peltier (Peltier) or chiller, radiator, critesistor, thermocouple and the like。Hot interface feature typically will be made by the material (such as, copper, gold, silver, aluminum etc.) as good thermal conductor and will be typically comprised one or more plane surface that can produce with external heat block or cooling block and well thermally contact。
In many examples, cylinder will include optical interface feature, for microwell array being carried out optical imagery or spectroscopy is inquired after。Typically, cylinder will include optical clear window, for instance, microporous substrate itself or the flow cell relative with microwell array or the side of microarray chamber, described transparency window is made up of the material of the spectrum requirement met for the imaging or spectral technique detecting microwell array。The example of the optical window material being suitable for includes but not limited to glass, fused silica, polymethyl methacrylate (PMMA), Merlon (PC), cyclic olefin polymer (COP) or cyclic olefine copolymer (COC)。Typically, cylinder will include the second optical clear or translucent window or region, and it may be used for illuminating with horizontal, reflection or oblique illumination direction for microwell array。
Instrument
Present disclosure also includes for measuring, at random labelling multiple, unicellular/molecule index, the instrument used in automatization。As noted above, these instruments can provide control and analysis functionality, such as (i) jet vectoring, the control of (ii) temperature, (iii) cell and/or pearl distribution and collecting mechanism, (iv) lysis mechanism, the control of (v) magnetic field, (vi) imaging capability and (vii) image procossing。In certain embodiments, instrument system can include one or more module (the possible embodiment of one is illustrated schematically in Figure 74), and wherein each module provides one or more specific functional features collection for system。In other embodiments, instrument system can be packaged, so makes all system functionality be positioned at same packaging。Figure 75 provides schematically illustrating of the processing step that includes in an embodiment of automated system。As noted above, in certain embodiments, system can include other functional unit, as the integrated component of this system or as modular member, the Functional Capability of system is expanded to and includes pcr amplification (or other kinds of oligonucleotide amplification technique) and oligonucleotide sequencing by it。
Generally, instrument system will provide for jet ability, for sample and/or reagent being delivered to one or more microarray chamber in the one or more measuring column bodies being connected with this system or in flow cell。Measure reagent and buffer can be stored in bottle, reagent and buffer cartridge case or other fitted vessels being connected with cylinder entrance。System can also include refuse reservoir, and its residing form is bottle, refuse cartridge case or other are for collecting the applicable waste canister of the downstream fluid of one or more mensuration cylinder。The system of controlling fluid flow through will typically via using pump (or other fluid-actuated mechanisms) and valve to carry out。The example of the pump being suitable for includes but not limited to syringe pump, programmable infusion pump, peristaltic pump, membrane pump and the like。In certain embodiments, it is possible to by one or more porch of reagent and buffer container or the porch of one or more mensuration cylinders apply positive Pneumatic pressure control fluid flow through system。In certain embodiments, it is possible to by controlling fluid flow through system in one or more exits of refuse reservoir or at the exit evacuation of one or more mensuration cylinders。The example of valve being suitable for includes but not limited to check-valves, dynamo-electric two is logical or three-way valve, pneumatic two is logical and three-way valve and the like。In certain embodiments, it is possible to application pulsating flow in measuring washing/rinse step process, to contribute to exchanging completely and effectively of the fluid of one or more microwell array flow cell or indoor。
As noted above, in certain embodiments, instrument system can include for further helping in the mechanism of uniform distribution cell and pearl on microwell array。The example of this type of mechanism includes but not limited to that vibration, vibration, whirlpool, recirculation flow, low frequency stir (such as, use rocker or elastic (such as by pulse, silicone) film, described film formation chamber wall or near fluid passage) or high frequency stirring (such as, by use piezoelectric transducer)。In certain embodiments, by one or more in these mechanisms with the physical arrangement on the inwall of flow cell or array room or feature combination application, such as, interlayer/top cap structure, V shape thing (chevron) or ridge array, to contribute on array indoor cell mixing or pearl and/or to help to stop its poly-pond。Flow enhuancement rib on the upper surface of flow cell or array room or lower surface can be used to control flowing velocity spectrum and reduce the shearing force (that is, in order to prevent from cell or pearl being pulled out from micropore in reagent exchange and rinse step process) across pore openings。
In certain embodiments, instrument system can include machinery lytic capacity, as the replacement scheme using detergent or other reagent。Using high frequency piezo transducer to carry out sonication is the example being suitable for technology。
In certain embodiments, instrument system will include temp. control function, for contributing to the accuracy of measurement result and the purpose of repeatability, for instance, cooling microwell array flow cell or room can be advantageous for for minimizing the molecule diffusion between micropore。The example of the temperature control unit that can be merged in instrument system includes but not limited to the heating of stratie, infrared light supply, peltier or chiller, radiator, critesistor, thermocouple and the like。In some embodiments of this system, temperature controller can be provided in the Programmable Temperature change in predetermined time interval。
Pointed elsewhere as in present disclosure, many embodiments of disclosed method all utilize magnetic field to be removed from micropore by pearl after completing mensuration。In certain embodiments, instrument system may further include use magnetic field by pearl conveying turnover microwell array flow cell or room。For providing the example of applicable means that magnetic field controls to include but not limited to use electromagnet in one or more fixed positions relative to cylinder, or use the permanent magnet reorientated by machinery if desired。In some embodiments of instrument system, the intensity in one or more magnetic fields of applying will change by changing the magnitude of current applying extremely one or more electromagnets。In some embodiments of instrument system, the intensity in the magnetic field of applying is by by using the linear actuators of such as stepper motor driven linear actuators, driven by servomotor or camshaft mechanism to change the position of the one or more permanent magnets relative to the position of one or more microarray chamber and change。In some embodiments of instrument system, pulsed magnetic field is used to may be advantageous in that, for instance, to prevent magnetic bead bunch from collecting。In certain embodiments, closely the magnet of array or room can be moved one or many relative to microwell array between at least two positions。The motion of magnet may be used for stirring the pearl in micropore, to contribute to removing pearl from micropore, or to collect the magnetic bead of desired position。
As noted above, in many examples, instrument system will include optical imagery and/or other spectroscopic capabilities。Such functional can have for such as checking one or more microwell array, to determine whether this array uniformly and is best filled by cell and/or pearl。Any one in multiple imaging pattern can be applied, include but not limited to light field, details in a play not acted out on stage, but told through dialogues and fluorescence/luminescence imaging。The design that the selection of imaging pattern will affect microwell array, flow cell and cylinder room, because the array substrate of flow cell or array room and/or opposite wall need must be transparent or semitransparent in spectral region interested。In certain embodiments, it is possible to by whole for each microwell array imaging in single image。In certain embodiments, it is possible to by a series of images " tiling ", to produce the high-definition picture of whole array。In certain embodiments, the single image representing the sub-segmentation of array may be used for evaluating on the whole the characteristic of array (such as, cell or pearl distribution)。In certain embodiments, it is possible to carry out dual wavelength and excite and launch (or multi-wavelength excitation and/or transmitting) imaging。Any one in various light sources may be used to provide imaging and/or exciting light, includes but not limited to tungsten lamp, halogen tungsten lamp, arc light, laser instrument, light emitting diode (LED) or laser diode。Any one in multiple imageing sensor may be used to imaging purpose, includes but not limited to photodiode array, charge coupled device (CCD) video camera or cmos image sensor。Optical system will typically comprise multiple optics, for making the light beam through system turn to, shape, filter and/or focus on。The example of the optics being suitable for includes but not limited to lens, reflecting mirror, prism, diffraction grating, colored glass filter, spike interference filter, wide-band interference optical filter, dichroic reflector, optical fiber, optical waveguide and the like。In certain embodiments, instrument system can use optically transparent microarray substrate as waveguide, for exciting light is delivered to microwell array。The selection of imaging pattern can also allow for measuring and using, with random labelling/molecule index, the other kinds of mensuration needing to be run abreast, such as, use trypan blue living cells/dead cell to measure abreast with light field imaging, use the living cells based on fluorescence/dead cell mensuration etc. with fluorescence imaging abreast。The viability data of the individual cells in relevant micropore and the dependency of the cell label relevant to each pearl can analyze offer in the data of multiple, single cell measurements other distinguish standard。Alternately, may be used in the viability data of the statistical form of multiple cells strengthening the analysis ability measured and quality assurance。
In certain embodiments, system can include the non-imaged for detecting microwell array and/or non-optical ability。Include but not limited to measure light scattering, ultraviolet/visible/infrared absorption measurement (such as the non-imaged of the cell detecting the bubble captured, determining in array and/or pearl distribution etc. and/or the example of non-optical, technologies, use and mix dyed cell and/or the pearl of dyestuff), coherent Raman (raman) scattering and conductance measurement (such as, using the micro-manufacture electrod-array with microwell array registration)。
System processor and software
Generally, the instrument system being set as the automatization supporting random labelling multiple, unicellular/molecule index to measure will include processor or computer together with software, to provide that (i) instrument controlling is functional, (ii) image procossing and analysis ability and (iii) data store, analysis and display functionality。
In many examples, instrument system will include computer (or processor) and computer-readable medium, described medium includes for providing user interface together with the code of the manual, semi-automatic of all systemic-functions or Automatic Control, i.e. the control of fluidic system, temperature control system, cell and/or pearl distribution function, bead manipulation function and imaging system。The fluid that thered is provided by instrument control software controls opportunity that the example of function includes but not limited to that fluid volume flow, rate of flow of fluid, sample and pearl are added, reagent adds and persistent period and rinse step。The example of the temp. control function provided by instrument control software includes but not limited to the control specifying one or more temperature set-point and the opportunity of variations in temperature, persistent period and ramp rate。The cell provided by instrument control software and/or the example of pearl distribution function include but not limited to the control of mixing parametric, such as amplitude, frequency and persistent period。The example of the magnetic field function provided by instrument control software includes but not limited to opportunity and the persistent period in one or more magnetic fields of applying, and when electromagnet, also has magnetic field intensity。The imaging system provided by instrument control software controls the example of function and includes but not limited to auto-focusing ability, the control of illumination and/or exciting light open-assembly time and intensity, image acquisition rates, the control of open-assembly time and data the Save option。
In some embodiments of instrument system, this system will further comprise computer-readable medium, and it includes the code for providing image procossing and analysis ability。The image procossing provided by software and the example of analysis ability include but not limited to that hands moves, semi-automatic or full-automatic image exposure adjustment is (such as, white balance, contrast adjusts, signal averaging and other noise reduction capability etc.), automatization's objective identification (is namely used for cell and the pearl of identifying in image), automatization's statistical analysis is (namely for determining the number of cell that the per unit area of microwell array identifies and/or pearl, or for identifying the hole containing more than one cell or more than one pearl) and manual measurement ability is (such as, for measuring the distance etc. between target)。In certain embodiments, instrument controlling and image procossing/analysis software will be written as independent software module。In certain embodiments, instrument controlling and image procossing/analysis software will be merged in integral packaging。In certain embodiments, systems soft ware can provide real-time image analysis and the instrument controlling of integration, so makes cell and pearl sample load step can be extended or repeat, until reaching optimum cell/pearl distribution。
In some embodiments of instrument system, this system will include computer-readable medium, and it includes the code for providing sequence data to analyze。The example of the sequencing data analysis functionality that can be provided by data analysis software includes but not limited to (i) algorithm, for determining number of readings per taken/gene/cell and uniqueness transcript molecule amount/gene/cell based on by the data provided by running the order-checking of the oligonucleotide library that algoscopy produces；(ii) statistical analysis of sequencing data, for instance principal component analysis, for predicting the confidence interval etc. of the mensuration of transcript molecule amount/gene/cell；(iii) sequence alignment ability, for comparing gene sequence data and known reference sequence；(iv) decoding/demultiplexing of sample bar code, cell bar code and molecular bar code；And the automatization of (v) molecular marker clusters, to compensate amplification or sequencing error。
Generally, logical device can be further appreciated that including the computer in presently disclosed instrument system (as illustrated by Figure 76) or processor, it can read the instruction from medium 511 and/or the network port 505, and it can optionally be connected with the server 509 with mounting medium 512。System 500 (as shown in Figure 76) can include CPU501, disc driver 503, optional input equipment (such as keyboard 515 and/or mouse 516) and optional monitor 507。Data communication can be realized by the server reached in Local or Remote position from the communication media specified。Communication media can include any instrument sending and/or receiving data。Such as, communication media can be network connection, wireless connections or Internet connection。Such connection can provide the communication via WWW。It is contemplated that the data relevant with present disclosure can be transmitted by such network or connection, to be received by recipient 522 and/or to be checked, as illustrated by Figure 76。
Figure 77 is a block diagram, describes the first exemplary architecture that can be combined the computer system 100 used with the exemplary embodiment of present disclosure。As Figure 77 describe, exemplary computer system can include the processor 102 for processing instruction。The limiting examples of processor includes: the processor of Intel's XeonTM processor, AMDOpteronTM processor, 32 RISCARM1176JZ (F)-Sv1.0TM processors of Samsung, ARMCortex-A8 Samsung S5PC100TM processor, ARMCortex-A8 Fructus Mali pumilae A4TM processor, Marvell (Marvell) PXA930TM processor or function equivalent。Multiple execution threads may be used for parallel processing。In certain embodiments, multiprocessor can also be used or there is the processor of multiple core, no matter with single computer systems, in a cluster or be distributed by network cross-system, described network includes multiple computer, mobile phone and/or personal data assistant device。
As illustrated by Figure 77, it is possible to high-speed cache 104 is connected to or is incorporated in processor 102, in order to for recently by or the instruction that used by processor 102 continually or data high-speed memory is provided。By processor bus 108, processor 102 is connected with north bridge 106。North bridge 106 is connected with random access memory (RAM) 110 by storing bus 112 and manages the processor 102 access to RAM110。North bridge 106 is connected with south bridge 114 also by chipset bus 116。South bridge 114 and then be connected with peripheral bus 118。Peripheral bus can be such as PCI, PCI-X, PCIExpress or other peripheral bus。North bridge and south bridge are commonly called processor chipset and the data transmission managing between the external components on processor, RAM and peripheral bus 118。In some substituting frameworks, it is possible to functional by north bridge is incorporated in processor and replaces uses independent north bridge chips。
In certain embodiments, system 100 can include the accelerator card 122 that is attached to peripheral bus 118。Accelerator can include field programmable gate array (FPGA) or other are for accelerating the hardware of some process。Such as, accelerator may be used for adaptivity data reconstruction or for evaluating algebraic expression used during superset processes。
Software and data are stored in external memory storage 124 and can be loaded in RAM110 and/or buffer memory 104, for used by processor。System 100 includes the operating system for managing system resource；The limiting examples of operating system includes: Linux, WindowsTM、MACOSTM、BlackBerryOSTM、iOSTMWith the operating system of other function equivalents, and run on operating system for managing data storage and the application software optimized according to the exemplary embodiment of the present invention。
In this example, system 100 also includes the NIC (NIC) 120 and 121 being connected with peripheral bus, for providing network interface for external memory storage (such as Network Attached (NAS)) and other computer systems that may be used for distributed variable-frequencypump。
Figure 78 is a chart, it is shown that network 200, and it has multiple computer system 202a and 202b, multiple mobile phone and personal digital assistant 202c and Network Attached (NAS) 204a and 204b。In the exemplary embodiment, system 212a, 212b and 212c can manage data storage and for the data-optimized data access being stored in Network Attached (NAS) 214a and 214b。Mathematical model may be used for data and uses the distributed variable-frequencypump across computer system 212a and 212b and mobile phone and personal digital assistant system 212c to be evaluated。The adaptivity data reconstruction that computer system 212a and 212b and mobile phone and personal digital assistant system 212c can also be the data being stored in Network Attached (NAS) 214a and 214b provides parallel processing。Figure 78 only illustrates an example, and other computer architectures diversified and system can also be combined use with different embodiments of the invention。Such as, blade server can be used to provide parallel processing。Processor blade can be attached by base plate, to provide parallel processing。Memorizer can also pass through independent network interface and be connected with base plate or as Network Attached (NAS)。
In some exemplary embodiments, memory space that processor can be held apart at and by network interface, base plate or other adapters transmission data, for carrying out parallel processing by other processors。In other embodiments, some or all of processors can use shared virtual address memory space。
Figure 79 is the block diagram of the multiprocessor computer system 300 according to an exemplary embodiment, and described system uses the virtual address memory space shared。This system includes multiple processor 302a-f that can access shared storage subsystem 304。This system be incorporated with in storage subsystem 304 multiple can journey compile hardware store APU (MAP) 306a-f。MAP306a-f each can include memorizer 308a-f and one or more field programmable gate array (FPGA) 310a-f。MAP provides configurability functional unit and specific algorithm or algorithm part can be provided to FPGAs310a-f, for processing with corresponding processor close fit。Such as, MAP may be used for relative to data model to evaluate algebraic expression and for carrying out self-adaptation type data reconstruction in the exemplary embodiment。In this example, each MAP can by all processor global access, for these purposes。In one configures, each MAP can use direct memory access (DMA) to access relevant memorizer 308a-f, thus allowing it independent of corresponding microprocessor 302a-f and performing task with being different from step。In this configuration, MAP can by result directly to another MAP, for water operation and executed in parallel algorithm。
Above computer architecture and system are only example, and other computers diversified, mobile phone and personal digital assistant framework and system can be combined use with exemplary embodiment, including any combination of system using general processor, coprocessor, FPGA and other programmable logic devices, SOC(system on a chip) (SOC), special IC (ASIC) and other process and logic element。In certain embodiments, all or part of computer system can be implemented in software or hardware。Any kind of data storage medium can be combined use with exemplary embodiment, including random access memory, hard disk drive, flash memory, tape drive, disk array, Network Attached (NAS) and other local or Distributed Storage device and system。
In the exemplary embodiment, it is possible to use the software module how gone up or perform in other computer architectures and system in office implements the computer subsystem of present disclosure。In other embodiments, it is possible in following item, partially or even wholly realize the function of this system: firmware, programmable logic device (field programmable gate array (FPGA) as mentioned in Figure 79), SOC(system on a chip) (SOC), special IC (ASIC) or other process and logic element。For example, it is possible to by using hardware accelerator card (accelerator card 122 illustrated in Figure 77) to implement set processor and optimizer by hardware-accelerated。
Oligonucleotide (such as, molecular bar code)
Method disclosed here and test kit can include one or more oligonucleotide or its purposes。Oligonucleotide can be attached to solid support disclosed here。The attachment of oligonucleotide and solid support can be undertaken by the functional group on this solid support and this oligonucleotide。Oligonucleotide can be referred to as molecular bar code。Oligonucleotide can be referred to as labelling (such as, molecular marker, cell marking) or label (such as, sample label)。
Oligonucleotide can include common tags。Common tags can be identical for all oligonucleotide in sample。Common tags can be identical for the oligonucleotide in one group of oligonucleotide。Common tags can be identical for two or more groups oligonucleotide。Common tags can include can with the nucleotide sequence of sequencing primer hybridization。Sequencing primer may be used for the oligonucleotide sequencing comprising common tags。Sequencing primer (such as, universal sequencing primer thing) can include and the sequencing primer of high-flux sequence platform there system。Common tags can include can with the nucleotide sequence of PCR primer hybridization。Common tags can include the nucleotide sequence can hybridized with sequencing primer and PCR primer。Primer binding site can be referred to as with the nucleotide sequence of order-checking and/or the common tags of PCR primer hybridization。Common tags can include the sequence transcribed that can be used to cause oligonucleotide。Common tags can include the sequence that can be used to extend the region in oligonucleotide or oligonucleotide。The length of common tags can be at least about 1,2,3,4,5,10,15,20,25,30,35,40,45,50 or more nucleotide。Common tags can include at least about 10 nucleotide。The length of common tags can be up to about 1,2,3,4,5,10,15,20,25,30,35,40,45,50 or more nucleotide。
Oligonucleotide can include cell marking。Cell marking can include the nucleotide sequence that can provide information (such as, it is determined which nucleic acid source is in which cell) for the cell that oligonucleotide contacts。The oligonucleotide of at least 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99% or 100% on same solid support can include identical cell marking。The oligonucleotide of at least 60% on same solid support can include identical cell marking。The oligonucleotide of at least 95% on same solid support can include identical cell marking。All oligonucleotide on same solid support can include identical cell marking。The cell marking of the oligonucleotide on the first solid support can be differently configured from the cell marking of the oligonucleotide on the second solid support。
The length of cell marking can be at least about 1,2,3,4,5,10,15,20,25,30,35,40,45,50 or more nucleotide。The length of cell marking can be up to about 300,200,100,90,80,70,60,50,40,30,20,15,12,10,9,8,7,6,5,4 or less or more nucleotide。Cell marking can include the nucleotide between about 5 to about 200。Cell marking can include the nucleotide between about 10 to about 150。The length of cell marking can include the nucleotide between about 20 to about 125。
Oligonucleotide can include molecular marker。Molecular marker can include can for providing the nucleotide sequence of identification information with the specific nucleic acid kind of this oligonucleotide hybridization。Different molecular markers can be included from the oligonucleotide that same solid support is puted together。In this way, molecular marker can distinguish the type of the target nucleic acid (such as, gene) from different oligonucleotide hybridizations。The length of molecular marker can be at least about 1,2,3,4,5,10,15,20,25,30,35,40,45,50 or more nucleotide。The length of molecular marker can be up to about 300,200,100,90,80,70,60,50,40,30,20,15,12,10,9,8,7,6,5,4 or less nucleotide。
Oligonucleotide can include sample labelling (such as, sample index)。Sample labelling can include the nucleotide sequence that relevant target nucleic acid can be provided to originate from information where。Such as, the sample labelling on different solid supports used in different experiments can be different。The length of sample labelling can be at least about 1,2,3,4,5,10,15,20,25,30,35,40,45,50 or more nucleotide。The length of sample labelling can be up to about 300,200,100,90,80,70,60,50,40,30,20,15,12,10,9,8,7,6,5,4 or less nucleotide。
Oligonucleotide can include common tags, cell marking, molecular marker and sample labelling or its any combination。When combination, sample labelling may be used for distinguishing the target nucleic acid between sample, cell marking may be used for distinguishing the target nucleic acid from the different cells in sample, molecular marker may be used for the different target nucleic acids in differentiation cell (such as, the different copies of identical labeled target nucleic acid), and common tags may be used for amplification target nucleic acid and to its order-checking。
Common tags, molecular marker, cell marking, joint marker and/or sample labelling can include the random sequence of nucleotide。The random sequence of nucleotide can be that computer produces。The random sequence of nucleotide can not have relative pattern。Common tags, molecular marker, cell marking, joint marker and/or sample labelling can include the nonrandom sequences (such as, these nucleotide include certain pattern) of nucleotide。The sequence of common tags, molecular marker, cell marking, joint marker and/or sample labelling can be commercially available sequence。The sequence of common tags, molecular marker, cell marking, joint marker and/or sample labelling can be include random thing sequence。Random thing sequence can refer to by this random thing of given length the oligonucleotide sequence of likely Sequence composition。Alternatively or additionally, common tags, molecular marker, cell marking, joint marker and/or sample labelling can include the predetermined sequence of nucleotide。
Fig. 1 illustrates the exemplary oligonucleotide comprising common tags, cell marking and molecular marker of present disclosure。
Fig. 3 illustrates the solid support of exemplary coupling oligonucleotide, and it includes the solid support (301) with oligonucleotide (312) coupling。Oligonucleotide (312) includes chemical group (5 ' amine, 302), common tags (303), cell marking (311), molecular marker (molecule BC (MolecularBC), 311) and target land (oligomerization dT, 310)。In this schematic diagram, cell marking (311) includes the first cell marking (CL part 1,304), the first joint (joint 1,305), the second cell marking (CL part 2,306), the second joint (joint 2,307), the 3rd cell marking (CL part 3,308)。Cell marking (311) is total for each oligonucleotide on solid support。The cell marking (311) of two or more pearls can be different。The difference of the cell marking (311) of two or more pearls can be in that cell marking (such as, CL part 1 (304), CL part 2 (306), CL part 3 (308))。The difference of the cell marking (311) of two or more pearls can be in that the first cell marking (304), the second cell marking (306), the 3rd cell marking (308) or its combination。First and second joints (303,305) of cell marking (311) can be identical for the solid support of two or more coupling oligonucleotide。Common tags (303) can be identical for the solid support of two or more coupling oligonucleotide。Common tags (303) can be identical for two or more oligonucleotide on same solid support。Molecular marker (311) can be different at least two on solid support or more oligonucleotide。Solid support can include 100 or more oligonucleotide。Solid support can include 1000 or more oligonucleotide。Solid support can include 10000 or more oligonucleotide。Solid support can include 100000 or more oligonucleotide。
Except common tags, cell marking and molecular marker, oligonucleotide can include target land。Target land can include the nucleotide sequence that can combine with target nucleic acid (such as, having nucleus to be analyzed)。Target land can be gene specific sequence。Such as, target land can include being attached (such as, hybridization) nucleotide sequence to the ad-hoc location of particular target nucleic acid。Target land can include non-specific target nucleic acid sequence。Non-specific target nucleic acid sequence can refer to the sequence that the particular sequence independent of target nucleic acid can be combined with multiple target nucleic acids。Such as, target land can include random polymer sequences or oligomerization dT sequence (such as, one section of thymidine nucleotide can hybridized) with the polyadenylation tail on mRNA。Random polymer sequences can be the more high polymer sequence of such as random dimer, trimer, the tetramer, pentamer, six aggressiveness, heptamer, eight aggressiveness, nine aggressiveness, ten aggressiveness or any length。The length of target land can be at least about 5,10,15,20,25,30,35,40,45,50 or more nucleotide。The length of target land can be up to about 5,10,15,20,25,30,35,40,45,50 or more nucleotide。
Oligonucleotide can include multiple labelling。Such as, oligonucleotide can include at least about 1,2,3,4,5,6,7 or 8 or more common tags。Oligonucleotide can include at most about 1,2,3,4,5,6,7 or 8 or more common tags。Oligonucleotide can include at least about 1,2,3,4,5,6,7 or 8 or more cell marking。Oligonucleotide can include at most about 1,2,3,4,5,6,7 or 8 or more cell marking。Oligonucleotide can include at least about 1,2,3,4,5,6,7 or 8 or more molecular marker。Oligonucleotide can include at most about 1,2,3,4,5,6,7 or 8 or more molecular marker。Oligonucleotide can include at least about 1,2,3,4,5,6,7 or 8 or more sample labelling。Oligonucleotide can include at most about 1,2,3,4,5,6,7 or 8 or more sample labelling。Oligonucleotide can include at least about 1,2,3,4,5,6,7 or 8 or more target land。Oligonucleotide can include at most about 1,2,3,4,5,6,7 or 8 or more target land。
When oligonucleotide includes labelling (such as, more than one cell marking or more than one molecular marker) of more than one type, these labellings can be interspersed with joint marker sequence。The length of joint marker sequence can be at least about 5,10,15,20,25,30,35,40,45,50 or more nucleotide。The length of joint marker sequence can be up to about 5,10,15,20,25,30,35,40,45,50 or more nucleotide。In some cases, the length of joint marker sequence is 12 nucleotide。Joint marker sequence may be used for promoting the synthesis of oligonucleotide, as illustrated in Fig. 2 A。
The number being conjugated to the oligonucleotide of solid support can be the 1 of number of cell target nucleic acid, 2,3,4,5,6,7,8,9 or 10 times。In some cases, the oligonucleotide of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% is combined by target nucleic acid。In some cases, at most the oligonucleotide of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% is combined by target nucleic acid。In some cases, at least 1,2,3,4,5,6,7,8,9,10,20,30,40,50,60,70,80,90 or 100 or more different target nucleic acid caught by the oligonucleotide on solid support。In some cases, at most 1,2,3,4,5,6,7,8,9,10,20,30,40,50,60,70,80,90 or 100 or more different target nucleic acid caught by the oligonucleotide on solid support。
Polymer can include other solid support。Such as, polymer can be dotted with pearl。Pearl spatially can be positioned at the zones of different of polymer。The pearl of the oligonucleotide comprising present disclosure or holder can spatially address。Pearl or holder can include the bar code of the space address corresponding to polymer。Such as, each pearl or holder in multiple pearls or holder can include bar code, and this bar code is corresponding to the position on polymer, for instance the position on the specific micropore of array or multiple micropore。Space address can be decoded, to determine the position that pearl or holder position。Such as, space address (such as bar code) can by making oligonucleotide hybridize with this bar code or by the order-checking of this bar code is decoded。Alternately, pearl or holder can with other kinds of bar code, such as graphic feature, chemical group, color, fluorescence or its any combination, for decoding the purpose of space address。
Method disclosed here and test kit can include one or more groups molecular bar code。One or more molecular bar codes can include sample index area and mark zone。Two or more molecular bar codes in one group of molecular bar code can include identical sample index area and two or more different mark zones。Two or more molecular bar codes in two or more groups molecular bar code can include the sample index area that two or more are different。Two or more molecular bar codes from one group of molecular bar code can include different mark zones。Two or more molecular bar codes from two or more groups molecular bar code can include identical mark zone。Difference from the molecular bar code of two or more groups molecular bar code can be in that its sample index area。Based on its mark zone, the molecular bar code from two or more groups molecular bar code can be similar。
Molecular bar code may further include target-specific district, aptamer district, general PCR sector, target-specific district or its any combination。Molecular bar code can include general PCR sector and target-specific district。Molecular bar code can include one or more secondary structure。Molecular bar code can include hairpin structure。Molecular bar code can include target-specific district and can cut stem。
Method disclosed here and test kit can include one or more groups sample label。One or more sample labels can include sample index area。One or more sample labels can include sample index area。Two or more sample labels in one group of sample label can include identical sample index area。Two or more sample labels in two or more groups sample label can include two or more different sample index areas。
Sample label may further include target-specific district, aptamer district, general PCR sector, target-specific district or its any combination。Sample label can include general PCR sector and target-specific district。Sample label can include one or more secondary structure。Sample label can include hairpin structure。Sample label can include target-specific district and can cut stem。
Method disclosed here and test kit can include one or more groups Molecular Identification substance markers。One or more Molecular Identification substance markers can include mark zone。One or more Molecular Identification substance markers can include mark zone。Two or more Molecular Identification substance markers in one group of Molecular Identification substance markers can include two or more different mark zones。Two or more Molecular Identification substance markers in two or more groups Molecular Identification substance markers can include two or more identical mark zones。Molecular Identification substance markers may further include target-specific district, aptamer district, general PCR sector, target-specific district or its any combination。Molecular Identification substance markers can include general PCR sector and target-specific district。Molecular Identification substance markers can include one or more secondary structure。Molecular Identification substance markers can include hairpin structure。Molecular Identification substance markers can include target-specific district and can cut stem。
Molecular bar code, sample label or Molecular Identification substance markers can include at least about 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,30,40,50,60,70,80,90,100,200,300,400,500,600,700,800,900 or 1000 nucleotide or base pairs。In another example, sample label or Molecular Identification substance markers include at least about 1500,2,000；2500,3,000；3500,4,000；4500,5,000；5500,6,000；6500,7,000；7500,8,000；8500,9,000；9500 or 10,000 nucleotide or base pair。
Molecular bar code, sample label or Molecular Identification substance markers can be polymers, for instance random polymer。Polymer sequences can be such as nonrandom or random dimer, trimer, the tetramer, pentamer, six aggressiveness, heptamer, eight aggressiveness, nine aggressiveness, ten aggressiveness or any length more high polymer sequence。Label can be randomly generated by one group of mononucleotide。Label can by being incorporated to mononucleotide assembling at random。
Molecular bar code, sample label or Molecular Identification substance markers can also carry out nonrandom assembling, and to produce the library of the different labels of nonrandom generation, but this library includes the different labels of enough putting into practice the number of described method。
In certain embodiments, molecular bar code, sample label or Molecular Identification substance markers can include the abatement of target nucleic acid。Abatement can be the enzymic digestion of the one or both ends of such as target nucleic acid。Abatement can combine with the interpolation of the molecular bar code added, sample label (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker) and use。The label added can contain the information relevant to specific starting molecule with the combination of this abatement。By adding random abatement in molecular bar code, sample label or Molecular Identification substance markers, making when detection allows to determine oligonucleotide and this both abatement at random of interpolation, the less multiformity of the label added is for being probably necessity to the number of target nucleic acid counting。
Molecular bar code, sample label or Molecular Identification substance markers can include target-specific district。Target-specific district can include the sequence with complementary element。In some cases, molecule is the oligomerization dT sequence that mRNA molecule and target-specific district include the poly-A tail complementation with this mRNA molecule。The primer of DNA and/or RNA synthesis can also serve as in target-specific district。Such as, the oligomerization dT sequence in target-specific district can serve as the primer of the first chain synthesis of the cDNA copy of mRNA molecule。Alternately, target-specific district includes the sequence that any part with molecule is complementary。In other cases, include can with molecular hybridization or the random sequence being connected in target-specific district。Target-specific district can allow sample label or Molecular Identification substance markers to be attached to described molecule。The attachment of sample label or Molecular Identification substance markers can be undertaken by any method disclosed here (such as, hybridization, connection)。In some cases, target-specific district includes by the sequence of one or more restriction endonuclease identifications。Target-specific district can include at least about 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,30,40,50,60,70,80,90,100,200,300,400,500,600,700,800,900 or 1000 nucleotide or base pairs。In another example, target-specific district includes at least about 1500,2000,2500,3000,3500,4000,4500,5000,5500,6000,6500,7000,7500,8000,8500,9000,9500 or 10000 nucleotide or base pairs。Preferably, target-specific district includes at least about 5-10,10-15,10-20,10-30,15-30 or 20-30 nucleotide or base pair。
In some cases, specific gene or gene outcome are had specificity by target-specific district。Such as, target-specific district includes and the sequence of p53 gene or the regional complementarity of gene outcome。Therefore, sample label and Molecular Identification substance markers can only be attached to the molecule comprising p53 specific sequence。Alternately, multiple different genes or gene outcome are had specificity by target-specific district。Such as, target-specific district includes oligomerization dT sequence。Therefore, sample label and Molecular Identification substance markers can be attached to any molecule comprising poly-A sequence。In another example, target-specific district includes the random sequence complementary with multiple different genes or gene outcome。Therefore, sample label or Molecular Identification substance markers can be attached to any molecule with the sequence complementary with target-specific district。In other cases, target-specific district includes restriction site jag (such as, EcoRI cohesive end jag)。Sample label or Molecular Identification substance markers can be connected to comprise any molecule of the sequence complementary with restriction site jag。
In some cases, specific Microrna or Microrna product are had specificity by target-specific district。Such as, target-specific district includes and the sequence of specific Microrna or the regional complementarity of Microrna product。Target-specific district includes the sequence of the regional complementarity of the Microrna product of the Microrna with particular panel or particular panel。Therefore, sample label and Molecular Identification substance markers can only be attached to the molecule comprising Microrna specific sequence。Alternately, multiple different Micrornas or Microrna product are had specificity by target-specific district。Such as, target-specific district includes and the sequence of the regional complementarity being included in two or more Micrornas, such as the Microrna panel containing consensus sequence。Therefore, sample label and Molecular Identification substance markers can be attached to any molecule comprising total microRNA seqeunce。In another example, target-specific district includes the random sequence complementary from multiple different Micrornas or Microrna product。Therefore, sample label or Molecular Identification substance markers can be attached to any microRNA molecules with the sequence complementary with target-specific district。In other cases, target-specific district includes restriction site jag (such as, EcoRI cohesive end jag)。Sample label or Molecular Identification substance markers can be connected to comprise any microRNA molecules of the sequence complementary with restriction site jag。
Molecular bar code disclosed here or Molecular Identification substance markers generally include mark zone。Mark zone may be used for uniquely determining the existence of targeted species, and thus with identifying that each kind is carried out labelling by thing, described qualification thing may be used for distinguishing two targets identical or almost identical in other respects。The mark zone of the plurality of sample label and Molecular Identification substance markers can include the set of following item: different semiconductor nanocrystals; metallic compound; peptide, oligonucleotide, antibody; little molecule; isotope, the granule with difformity, color, bar code or diffraction pattern associated therewith or embedded therein or structure, numeric string; the random fragment of protein or nucleic acid, different isotopes or its any combination。Mark zone can include degenerate sequence。Mark zone can include at least about 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,30,40,50,60,70,80,90,100,200,300,400,500,600,700,800,900 or 1000 nucleotide or base pairs。In another example, mark zone includes at least about 1500；2,000；2500,3,000；3500,4,000；4500,5,000；5500,6,000；6500,7,000；7500,8,000；8500,9,000；9500 or 10,000 nucleotide or base pair。Preferably, mark zone includes at least about 10-30,15-40 or 20-50 nucleotide or base pair。
In some cases, molecular bar code, sample label or Molecular Identification substance markers include universal primer binding site。Universal primer binding site allows to be attached to universal primer labeled molecule and/or labeled amplicon。Universal primer is well-known in the art, and include but not limited to-47F (M13F), α MF, AOX3 ', AOX5 ', BGH_r, CMV_-30, CMV_-50, CVM_f, LACrmt, λ gt10F, λ (lambda) gt10R, λ gt11F, λ gt11R, M13rev, M13 forward (-20), M13 is reverse, male, p10SEQP_pQE, pA_-120, pet_4, pGAP forward, pGL_RVpr3, pGLpr2_R, pKLAC1_4, pQE_FS, pQE_RS, puc_U1, puc_U2, revers_A, seq_IRES_tam, seq_IRES_zpet, seq_ori, seq_PCR, seq_pIRES-, seq_pIRES+, seq_pSecTag, seq_pSecTag+, seq_retro+PSI, SP6, T3-prom, T7-prom and T7-term_Inv。The attachment of universal primer and universal primer binding site may be used for labeled molecule and/or labeled amplicon are expanded, detect and/or checked order。Universal primer binding site can include at least about 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,30,40,50,60,70,80,90,100,200,300,400,500,600,700,800,900 or 1000 nucleotide or base pairs。In another example, universal primer binding site includes at least about 1500；2,000；2500,3,000；3500,4,000；4500,5,000；5500,6,000；6500,7,000；7500,8,000；8500,9,000；9500 or 10,000 nucleotide or base pair。Preferably, universal primer binding site includes 10-30 nucleotide or base pair。
Molecular bar code, sample label or Molecular Identification substance markers can include aptamer district。Aptamer district can allow the hybridization of one or more probe。Aptamer district can allow the hybridization of one or more HCR probe。
Molecular bar code, sample label or Molecular Identification substance markers can include one or more detectable label。
Molecular bar code, sample label and Molecular Identification substance markers can serve as the releaser of hybridization chain reaction (HCR)。The releaser of HCR can serve as in the aptamer district of sample label or Molecular Identification substance markers。Universal primer binding site can serve as the releaser of HCR。
In some cases, molecular bar code, sample label or Molecular Identification substance markers are strands。In other cases, molecular bar code, sample label or Molecular Identification substance markers are double-strands。Molecular bar code, sample label or Molecular Identification substance markers can be straight chains。Alternately, molecular bar code, sample label or Molecular Identification substance markers include secondary structure。As used herein, " secondary structure " includes three grades, level Four etc.. structure。In some cases, secondary structure is hair clip, loop-stem structure, internal ring, bulge loop, branched structure or pseudoknot, many loop-stem structures, four leaf structures or any three dimensional structure。In some cases, secondary structure is hair clip。Hair clip can include jag sequence。The jag sequence of hair clip can serve as the primer of polymerase chain reaction and/or reverse transcription reaction。Jag sequence includes and the sequence of the complementary element attached by sample label or Molecular Identification substance markers, and jag sequence and this molecular hybridization。Jag sequence can be connected with this molecule and serve as the template of polymerase chain reaction and/or reverse transcription reaction。In certain embodiments, molecular bar code, sample label or Molecular Identification substance markers include the nucleic acid of nucleic acid and/or synthesis and/or the nucleic acid of modification。
In some cases, the plurality of molecular bar code, sample label are (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker) include at least about that 2,3,4,5,6,7,8,9,10,15,20,25,30,35,40,45,50,55,60,65,70,75,80,85,90,95 or 100 different molecular bar codes, sample labels are (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker)。In other cases, the plurality of molecular bar code, sample label (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker) include at least about 200；300；400；500；600；700；800；900；1,000；2,000；3,000；4,000；5,000；6,000；7,000；8,000；9,000；Or 10000 different molecular bar codes, sample label (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker)。Alternately；The plurality of molecular bar code, sample label (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker) include at least about 20,000；30,000；40,000；50,000；60,000；70,000；80,000；90,000；Or 100,000 different molecular bar codes, sample label (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker)。
The plurality of molecular bar code, sample label are (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker) in molecular bar code, sample label (such as, sample index area, sample labelling), the number of cell marking and Molecular Identification substance markers (such as, molecular marker) is typically over needing the number of molecule that is labeled。In some cases, the plurality of molecular bar code, sample label are (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker) in molecular bar code, sample label (such as, sample index area, sample labelling), the number of cell marking and Molecular Identification substance markers (such as, molecular marker) be than needing many at least about 2,3,4,5,6,7,8,9,10,15,20,30,40,50,60,70,80,90 or 100 times of the number of molecule that is labeled。
The plurality of molecular bar code, sample label are (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker) in different molecular bar code, sample label (such as, sample index area, sample labelling), the number of cell marking and Molecular Identification substance markers (such as, molecular marker) is typically over needing the number of different molecular that is labeled。In some cases, the plurality of molecular bar code, sample label is (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers are (such as, molecular marker) in different molecular bar code, sample label is (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers are (such as, molecular marker) number be than needing the number of different molecular that is labeled many at least about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90 or 100 times。
In some cases, the random labelling carrying out molecule includes multiple molecular bar code, sample label is (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers are (such as, molecular marker), wherein the plurality of molecular bar code, sample label is (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers are (such as, molecular marker) in different molecular bar code, sample label is (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers are (such as, molecular marker) concentration be identical。In this case, the plurality of molecular bar code, sample label are (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker) include the molecular bar code every kind different of equal number, sample label or Molecular Identification substance markers。
In some cases, the random labelling carrying out molecule includes multiple molecular bar code, sample label is (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers are (such as, molecular marker), wherein the plurality of molecular bar code, sample label is (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers are (such as, molecular marker) in different molecular bar code, sample label is (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers are (such as, molecular marker) concentration be different。In this case, the plurality of molecular bar code, sample label are (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker) include different number of molecular bar code every kind different, sample label or Molecular Identification substance markers。
In some cases, at the plurality of molecular bar code, sample label (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker) in, some molecular bar codes, sample label are (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker) with higher than other molecular bar codes, sample label (such as, sample index area, sample labelling), the concentration of cell marking and Molecular Identification substance markers (such as, molecular marker) exists。In some cases, with the molecular bar code of variable concentrations, sample label (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker) carry out random labelling extension sample measurement dynamic range when not increasing the number of not isolabeling used。Such as, consider with the molecular bar code 10 kinds different being completely under equal concentrations, sample label (such as, sample index area, sample labelling), cell marking and 3 kinds of nucleic acid samples molecules of Molecular Identification substance markers (such as, molecular marker) random labelling。It is desirable that observe labelling 3 kinds different。Presently contemplate 30 kinds of nucleic acid molecules but not 3 kinds of nucleic acid molecules, it is desirable to observe all 10 kinds of labellings。By contrast, if we still use random labelling 10 kinds different and comparing of labelling are become 1:2:3:4 ... 10, then when with 3 kinds of nucleic acid molecules, it is desirable that the labelling observed between 1-3 kind, but when with 30 kinds of molecules, we will only expect to observe about 5 kinds of labellings, thus extending the scope with the measurement of equal number of random labelling。
The plurality of molecular bar code, sample label are (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker) in different molecular bar code, sample label (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker) to compare can be 1:X, wherein X is at least about 1,2,3,4,5,6,7,8,9,10,15,20,25,30,35,40,45,50,55,60,65,70,75,80,85,90,95 or 100。Alternately, the plurality of molecular bar code, sample label is (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers are (such as, molecular marker) in " n " plant different molecular bar code, sample label is (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers are (such as, molecular marker) to compare be 1:A:B:C: ... Zn, wherein A, B, C ... Zn is at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100。
In some cases, the plurality of molecular bar code, sample label are (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker) in two or more different molecular bar codes, sample label (such as, sample index area, sample labelling), the concentration of cell marking and Molecular Identification substance markers (such as, molecular marker) be identical。Different molecular bar code, sample label are planted (such as " n ", sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker), at least 2,3,4 ... molecular bar code that n kind is different, sample label are (such as, sample index area, sample labelling), the concentration of cell marking and Molecular Identification substance markers (such as, molecular marker) be identical。Alternately, the plurality of molecular bar code, sample label are (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker) in two or more different molecular bar codes, sample label (such as, sample index area, sample labelling), the concentration of cell marking and Molecular Identification substance markers (such as, molecular marker) be different。Different molecular bar code, sample label are planted (such as " n ", sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker), at least 2,3,4 ... molecular bar code that n kind is different, sample label are (such as, sample index area, sample labelling), the concentration of cell marking and Molecular Identification substance markers (such as, molecular marker) be different。In some cases, different molecular bar codes is planted for " n ", sample label is (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers are (such as, molecular marker), at least 2, 3, 4 ... the molecular bar code that n kind is different, sample label is (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers are (such as, molecular marker) concentration difference be at least about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.25, 1.5, 1.75, 2, 2.25, 2.5, 2.75, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 times。
In some cases, at the plurality of molecular bar code, sample label is (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers are (such as, molecular marker) in, at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, the different molecular bar code of 97% or 100%, sample label is (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers are (such as, molecular marker) there is identical concentration。Alternately, at the plurality of molecular bar code, sample label is (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers are (such as, molecular marker) in, at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, the different molecular bar code of 97% or 100%, sample label is (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers are (such as, molecular marker) there is different same concentration。
As shown in Figure 65, molecular bar code (1004) can be separately synthesized。Molecular bar code (1004) can include general PCR sector (1001), one or more qualification thing district (1002) and target-specific district。These one or more qualification thing districts can include sample index area, mark zone or its combination。These one or more qualification thing districts can be adjacent。These one or more qualification thing districts can be non-conterminous。Independent molecular bar code can be merged, to produce to comprise multiple different multiple molecular bar codes (1005) identifying thing district。Sample label can synthesize by such as Figure 65 similar fashion described, and wherein these one or more qualification thing districts include sample index area。Molecular Identification substance markers can synthesize by such as Figure 65 similar fashion described, and wherein these one or more qualification thing districts include mark zone。
Can be connected to target-specific district identify thing district, to produce the molecular bar code comprising target-specific district。Can 5 ' and 3 ' exonucleases be added in reaction, be not connected with product to remove。Molecular bar code can include universal primer binding site, mark zone and target-specific district and 5 ' and 3 ' exonucleases can be had resistance。As used herein, term " universal primer binding site " and " general PCR sector " can be interchangeably used and refer to the sequence that can be used for causing amplified reaction。3 ' phosphate groups can be removed from the qualification thing district connected, to be produced without the molecular bar code of 3 ' phosphate groups。Enzyme process can be passed through and remove 3 ' phosphate groups。Such as, T4 polynucleotide kinase may be used for removing 3 ' phosphate group。
The another kind of method of synthetic molecules bar code is depicted in Figure 66 A。As shown in Figure 66 A, it is possible to carry out synthetic molecules bar code (1128) by connecting two or more oligonucleotide fragments (1121 and 1127)。One oligonucleotide fragment (1121) can include universal primer binding site (1122), identify thing district (1123) and the first clamping plate district (1123)。Another oligonucleotide fragment (1128) can include the second clamping plate district (1125) and target-specific district (1126)。Ligase (such as, T4DNA ligase) may be used for connecting the two oligonucleotide fragment (1121 and 1127), to produce molecular bar code (1128)。The double-strand in the first clamping plate district (1124) and the second clamping plate district (1125) connects the molecular bar code (1128) that can produce have bridge joint clamping plate district (1129)。
It is depicted in Figure 66 B by connecting the alternative method of two oligonucleotide fragment synthetic molecules bar codes。As shown in Figure 66 B, by connecting two oligonucleotide fragment (1150 and 1158) synthetic molecules bar codes (1158)。One oligonucleotide fragment (1150) can include universal primer binding site (1151), one or more qualification thing district (1152) and catenation sequence (1153)。Another oligonucleotide fragment (1158) can include the complementary catenation sequence (1154) of catenation sequence (1153) with the first oligonucleotide fragment (1150), the complement of target-specific district (1155) and labelling (1156)。Oligonucleotide fragment (1159) can also include the 3 ' phosphoric acid preventing oligonucleotide fragment from extending。As shown in the step 1 of Figure 66 B, the catenation sequence (1153 and 1154) of two oligonucleotide fragments can be annealed and polymerase may be used for extending 3 ' ends of the first oligonucleotide fragment (1150), to produce molecular bar code (1158)。Molecular bar code (1158) can include universal primer binding site (1151), one or more qualification thing district (1152), catenation sequence (1153) and target-specific sequences (1157)。The target-specific sequences (1157) of molecular bar code (1158) can be the complement of the complement in the target-specific district (1155) of the second oligonucleotide fragment (1159)。The oligonucleotide fragment comprising labelling (1156) can be removed from molecular bar code (1158)。Such as, labelling (1156) can include biotin and can catch via Streptavidin and remove the oligonucleotide fragment (1159) comprising biotin labeling (1156)。In another example, labelling (1156) can include 5 ' phosphoric acid and can remove the oligonucleotide fragment (1159) comprising 5 ' phosphoric acid (1156) via exonuclease (such as, λ exonuclease)。
As Figure 66 C describe, comprise universal primer binding site (1171), one or more qualification thing district (1172), first oligonucleotide fragment (1170) of the first catenation sequence (1173) are annealed with second oligonucleotide fragment (1176) of the RNA complement (1175) comprising the second catenation sequence (1174) and target sequence。Step 1 can include making the first and second catenation sequences (1173 and 1174) anneal, the RNA complement (1175) of reverse transcription target sequence subsequently, to produce to comprise the molecular bar code (1177) of universal primer binding site (1171), one or more qualification thing district (1172), the first catenation sequence (1173) and target-specific district (1178)。The oligonucleotide fragment of the RNA complement that degradation selectivity comprises target sequence can be processed by RNase。
Molecular bar code, sample label can be optimized (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker) sequence, to minimize molecular bar code, sample label (such as, sample index area, sample labelling), the dimerization of cell marking and Molecular Identification substance markers (such as, molecular marker)。Can amplifier molecule bar code, sample label or Molecular Identification substance markers dimer and cause the formation of amplicon, described amplicon comprises two universal primer binding sites and target-specific district on it is often held and uniqueness identifies thing district。Because molecular bar code, sample label are (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker) concentration much larger than the number of DNA profiling, these molecular bar codes, sample label or Molecular Identification substance markers dimer can surpass labeled DNA molecular in amplified reaction。The DNA not expanded causes false negative, and the molecular bar code expanded, sample label or Molecular Identification substance markers dimer cause higher false positive。Therefore, molecular bar code, sample label can be optimized (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker), formed minimizing molecular bar code, sample label or Molecular Identification substance markers dimer。Alternately, abandon the molecular bar code of dimerization, sample label (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker), thus eliminate molecular bar code, sample label or Molecular Identification substance markers dimer and formed。
Alternately, it is possible to eliminate or reduce molecular bar code, sample label or the formation of Molecular Identification substance markers dimer by mixing one or more modifications in molecular bar code, sample label or Molecular Identification substance markers sequence。Comprise universal primer binding site, uniqueness identifies thing district and the molecular bar code in target-specific district (comprising uracil and 3 ' phosphate groups), sample label or Molecular Identification substance markers and target nucleic acid annealing。The fragment that target nucleic acid can be digested by restriction endonuclease。Recognition site can be identified by restriction endonuclease。Pcr amplification can include one or more forward primer and one or more reverse primer。Pcr amplification can include nest-type PRC, and it uses the universal primer binding site to molecular bar code, sample label or Molecular Identification substance markers to have specific forward primer and the target-specific district to molecular bar code, sample label or Molecular Identification substance markers has specific forward primer and target nucleic acid has specific reverse primer。Can using PfuDNA polymeric enzymatic amplification target nucleic acid, this polymerase cannot expand the template comprising one or more uracil。Therefore, the molecular bar code of any dimerization, sample label (such as, sample index area, sample labelling), cell marking and Molecular Identification substance markers (such as, molecular marker) all cannot pass through PfuDNA polymeric enzymatic amplification。
The method (such as, molecular bar code) of synthetic oligonucleotide
Can synthetic oligonucleotide。Can pass through such as the carboxyl of the 5 ' amino coupled (such as, by 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide) on oligonucleotide to functionalized solid support to be come synthetic oligonucleotide。
Can pass through repeatedly to clean the oligonucleotide removing non-coupling from this reactant mixture。These solid supports are segmented into multiple hole (such as, 96 holes)。Each solid support is segmented into different holes。Separation/poly-pond synthetic method can be used to carry out oligonucleotide synthesis。This separation/poly-pond method can utilize one to comprise the poly-pond of the reactive partly solid support of (oligonucleotide such as, to be synthesized)。This poly-pond can be divided into the individually poly-pond of solid support。Each poly-pond can be made to stand the first reaction, and this first reaction may result in the different modifying (such as, different nucleotide sequences being added into oligonucleotide) of solid support in each poly-pond。After the reaction, the poly-pond of these solid supports can merged, mixing and again separate。The poly-pond of each separation can be made to stand the second reaction or randomization, and this is different for each poly-pond again。This process can be performed continuously over the library until target compound and be formed。
Using and separate/poly-pond synthesis, the nucleotide sequence being added into oligonucleotide can be combined (such as, Ke Lienuo (Klenow) extends) by primer extension。The nucleotide sequence to be added to oligonucleotide is had to be properly termed as primer segments。Each primer segments for each individually poly-pond can comprise different sequences (such as, in cell marking, molecular marker, sample labelling or their any combination)。Primer segments can comprise can with the sequence (such as, being coupled to the oligonucleotide of solid support) of the joint marker sequence hybridization of oligonucleotide。Primer segments may further include the second cell marking and the second joint marker sequence。Can by primer extension for the second cell marking sequence and the second joint marker sequence being incorporated into the oligonucleotide (referring to Fig. 2 B) being coupled to solid support。After primer extension merges new sequence, it is possible to these solid supports are combined。The solid support of combination can be heated to making enzyme denaturation。The solid support of combination can be heated to destroying hybridization。The solid support of combination can be again broken down into multiple hole。This process can be repeated other sequence to be added into the oligonucleotide puting together solid support。
This separation/poly-pond process can result at least about 1000,10000,100000,500000 or 1000000 or more different oligonucleotide。This process can result at most about 1000,10000,100000,500000 or 1000000 or more different oligonucleotide。
Separate the synthesis of poly-pond and can include chemosynthesis。Can using DMT chemistry in single reaction on solid support, then poly-pond synthesizes different oligonucleotide in synthetic reaction。This separation/poly-pond process can be repeated 1,2,3,4,5,6,7,8,9,10 or more times。This separation/poly-pond process can be repeated 11,12,13,14,15,16,17,18,19,20,25,30,35,40,45,50,55,60,65,70,75,80,85,90,95,100 or more times。This separation/poly-pond process can be repeated 2 times or more times。This separation/poly-pond process can be repeated 3 times or more times。This separation/poly-pond process can be repeated 5 times or more times。This separation/poly-pond process can be repeated 10 times or more times。
What disclose further at this is the method for the labeled pearl (such as, puting together the pearl of oligonucleotide) producing one or more groups。The method producing the labeled pearl of one or more groups can include one or more nucleic acid are attached to one or more pearl, thus produces the labeled pearl of one or more groups。These one or more nucleic acid can include one or more molecular bar code。These one or more nucleic acid can include one or more sample label (such as, sample labelling, sample index area)。These one or more nucleic acid can include one or more cell marking。These one or more nucleic acid can include one or more Molecular Identification substance markers (such as, molecular marker)。These one or more nucleic acid can include a) guiding region；B) sample index area；And c) connector area or aptamer district。These one or more nucleic acid can include a) guiding region；B) mark zone (such as, molecular marker)；And c) connector area or aptamer district。These one or more nucleic acid can include a) sample index area (such as, sample label)；And b) mark zone (such as, molecular marker)。These one or more nucleic acid can include a) sample index area；And b) cell marking。These one or more nucleic acid can include a) cell marking；And b) molecular marker。These one or more nucleic acid can include a) sample index area；B) cell marking；And c) molecular marker。These one or more nucleic acid may further include guiding region。These one or more nucleic acid may further include target-specific district。These one or more nucleic acid may further include connector area。These one or more nucleic acid may further include aptamer district。These one or more nucleic acid may further include sample index area。These one or more nucleic acid may further include mark zone。
Alternately, the method includes: a) make multiple first nucleic acid be deposited in multiple hole, and wherein two or more different holes in the plurality of hole can include two or more different nucleic acid of the plurality of nucleic acid；B) making one or more Kong Yuyi or the contact of less pearl in the plurality of hole, to produce multiple single marker beads, single marker beads of plurality of first labeled pearl includes the pearl being attached to the nucleic acid of the plurality of first nucleic acid；C) the plurality of first labeled pearl is converged from the plurality of hole to produce the poly-pond of the first labeled pearl；D) by this poly-pond distribution of the first labeled pearl to multiple holes subsequently, wherein this includes two or more the different nucleic acid in multiple nucleic acid subsequently in two or more holes in multiple holes subsequently；And e) one or more nucleic acid of the plurality of nucleic acid subsequently are attached to one or more first labeled pearl, to produce multiple pearl through uniqueness labelling。
Library
Disclosed here is the method producing molecular library。The method may include that (a) carries out labelling to from two or more molecules in two or more samples randomly, to produce labeled molecule, wherein these labeled molecules include (i) based on or derived from the molecular regime of both or more kinds of molecule, (ii) is for distinguishing the sample index area of two or more molecules from two or more samples；And (iii) is for distinguishing the mark zone of two or more molecules from simple sample。Carry out labelling at random and can include using the molecular bar code of one or more groups。Carry out labelling at random and can include using the sample label of one or more groups。Carry out labelling at random and can include using the Molecular Identification substance markers of one or more groups。
Two or more molecules of labelling can include making two or more samples contact with multiple sample labels and multiple molecular specificity marker randomly, to produce multiple labeled nucleic acid。This contact can be random。The method may further include and one or more labeled molecules are expanded, thus producing the enriched populations of the labeled molecule in library。The method may further include and two or more molecules from two or more samples are carried out one or more mensuration。The method may further include and carries out one or more experiment (pull-downassay) of leaving behind。
Produce the method for labeled nucleic acid library to may further include one or more comparisons are added into two or more samples。Can the one or more comparison of labelling randomly to produce labeled comparison。These one or more comparisons may be used for measuring the efficiency producing labeled molecule。
Library disclosed here can be used in multiple application。For example, it is possible to this library is used for application of checking order。This library can be stored and repeatedly use, to generate the sample for analyzing。Some application include, for instance, Genotypingpolymorphism, research RNA processing and selection clone's representative are checked order。
Sample preparation and application
Can by oligonucleotide disclosed here (such as, molecular bar code, sample label, molecular marker, cell marking) in multiple method。These oligonucleotide can in the method for foranalysis of nucleic acids。Foranalysis of nucleic acids can include, but not limited to gene type, gene expression, copy number variation and numerator counts。
Present disclosure provides the method for multiplexed nucleic acid analysis。The method can include (a) makes the one or more oligonucleotide from cell contact with the one or more oligonucleotide being attached on holder, the one or more oligonucleotide being wherein attached on this holder include (i) cell marking district, and this region includes two or more the random thing sequences connected by nonrandom sequences；And (ii) molecular marker district。And the one or more oligonucleotide from this cell are carried out one or more mensuration by (b)。
Disclosed here further is the method producing unicellular nucleic acid library。The method can include (a) makes the one or more oligonucleotide from cell contact with the one or more oligonucleotide being attached on holder, the one or more oligonucleotide being wherein attached on this holder include (i) cell marking district, and this region includes two or more the random thing sequences connected by nonrandom sequences；And (ii) molecular marker district。And the one or more oligonucleotide from this cell are carried out one or more mensuration by (b)。
In some cases, the method includes being added on microwell array one or more cells。Can determine there is cell number to be added by counting。Buffer (such as, phosphate buffer, HEPES, Tris) can be used to wash away excessive or unconjugated cell。The number of the cell can caught by this some holes of microwell array can be relevant to the size of cell。Such as, depending on the design of micropore, bigger cell can be easier to be captured by smaller cell, as shown in Figure 6。Can be used for catching different cell type by different micropores (such as, different size)。
Method described herein allows to add sequence, and these sequences could be for the nucleic acid of order-checking or other analysis of molecules。These methods can allow detection Nucleic acid variant, mutant, polymorphism, inversion, disappearance, back mutation and other qualitative events found in RNA or DNA molecular colony。Such as, these methods can allow to identify target frequency (such as, gene expression or allelic distribution)。Such as, these methods also allow for identifying sudden change or the SNP in genome or transcript profile, for instance from ill or non-diseased experimenter。These methods also allow for determining to be polluted and the presence or absence infected in the Biosample of experimenter, such as adventive or virus, such as antibacterial or fungus。
By any method cell can be added in micropore。In certain embodiments, cell is added in micropore as the cell sample of dilution。In certain embodiments, cell it is added in micropore and allows by gravitational settling in micropore。In certain embodiments, cell is added in micropore and uses and be centrifuged these cell settlements in micropore。In certain embodiments, by will cell be added in micropore by one or more cells one or more micropores of injection。Such as, by will this unicellular be added in micropore by unicellular injection micropore。The injection of cell can be passed through to use any device or method, for instance by using micro-manipulator。In certain embodiments, it is possible to use cell is added in micropore by magnet。Such as, cell can be coated with magnetic-particle (such as magnetic particle or magnetic nanoparticle) over their surface and use magnet or magnetic field to be added in micropore。
The solid support (such as, pearl) wrapping celliferous microwell array and put together oligonucleotide can be contacted。The solid support (such as, washing away) puting together oligonucleotide do not caught can be removed with buffer。Fig. 5 depicts the microwell array with the solid support caught。Micropore can include at least one solid support。Micropore can include at least two solid support。Micropore can include an at most solid support。Micropore can include at most two solid supports。Micropore can include at least about 1,2,3,4,5,6,7,8,9 or 10 or more solid support。Micropore can include at most about 1,2,3,4,5,6,7,8,9 or 10 or more solid support。Some micropores of microwell array can include some micropores of 1 solid support and microwell array can include two or more solid supports, as shown in Figure 5。For any method of present disclosure, can without covering this micropore。In other words, can without sealing this micropore in the process of the method。When micropore uncovered (such as, seal), this some holes, to be spaced apart, so makes the content of a micropore will not diffuse to another micropore。
Alternately, or additionally, it is possible to caught and/or purifying cells before contacting with the holder puting together oligonucleotide。For catching and/or the method for purifying cells can include using antibody, molecular scaffold and/or pearl。Flow cytometry purifying cells can be passed through。Can be used for catching or purifying cells by commercially available test kit。For example, it is possible to be used for separating cell by Dynabeads (R)。Magnetic Isolation can be used for purifying cells。Centrifugal purification cell can be passed through。
By producing to include cell and the suspension of holder, cell can be contacted with the holder puting together oligonucleotide。Suspension can include gel。Can before contacting with the holder puting together oligonucleotide by fixing for cell on the support or in the solution。Alternately, it is possible to cell is added into the suspension of the holder including puting together oligonucleotide。For example, it is possible to cell to be added into the hydrogel being embedded with the holder puting together oligonucleotide。
Can by unicellular and coupling list oligonucleotide solid support into contact。Can by solid support into contact that is unicellular and that put together multiple oligonucleotide。Multiple cells and the solid support puting together single oligonucleotide interact。Multiple cells and the solid support puting together multiple oligonucleotide interact。These solid supports puting together oligonucleotide can be cell type-specific。Alternately, the holder puting together oligonucleotide can interact by cell types different from two or more。
Cracking
Can by the lysis in micropore。Can be cracked by mechanical lysis, thermal cracking, optics cracking and/or chemical cracking。Chemical cracking can include using digestive enzymes, such as E.C. 3.4.21.64, pepsin and trypsin。Can crack by lysis buffer is added in micropore。Lysis buffer can include TrisHCl。Lysis buffer can comprise at least about 0.01,0.05,0.1,0.5 or 1M or more TrisHCl。Lysis buffer can contain up to about 0.01,0.05,0.1,0.5 or 1M or more TrisHCL。Lysis buffer can comprise about 0.1MTrisHCl。The pH of lysis buffer can be at least about 1,2,3,4,5,6,7,8,9 or 10 or more。The pH of lysis buffer can be at most about 1,2,3,4,5,6,7,8,9 or 10 or more。In some cases, the pH of lysis buffer is about 7.5。Lysis buffer can comprise salt (such as, LiCl)。In lysis buffer, the concentration of salt can be at least about 0.1,0.5 or 1M or more。In lysis buffer, the concentration of salt can be at most about 0.1,0.5 or 1M or more。In some cases, in lysis buffer, the concentration of salt is about 0.5M。Lysis buffer can comprise detergent (such as, SDS, lithium dodecyl sulfate, triton X, tween, NP-40)。In lysis buffer, the concentration of detergent can be at least about 0.0001%, 0.0005%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6% or 7% or more。In lysis buffer, the concentration of detergent can be at most about 0.0001%, 0.0005%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6% or 7% or more。In some cases, in lysis buffer, the concentration of detergent can be about 1% lithium dodecyl sulfate (Lidodecylsulfate)。In this cleavage method, the time used may rely on the amount of detergent used。In some cases, detergent used is more many, and cracking required time is more short。Lysis buffer can comprise chelating (such as, EDTA, EGTA)。In lysis buffer, the concentration of chelating can be at least about 1mM, 5mM, 10mM, 15mM, 20mM, 25mM or 30mM or more。In lysis buffer, the concentration of chelating can be at most about 1mM, 5mM, 10mM, 15mM, 20mM, 25mM or 30mM or more。In some cases, in lysis buffer, the concentration of chelating is about 10mM。Lysis buffer can comprise reducing agent (such as, beta-mercaptoethanol, DTT)。In lysis buffer, the concentration of reducing agent can be at least about 1mM, 5mM, 10mM, 15mM or 20mM or more。In lysis buffer, the concentration of reducing agent can be at most about 1mM, 5mM, 10mM, 15mM or 20mM or more。In some cases, in lysis buffer, the concentration of reducing agent is about 5mM。In some cases, lysis buffer can comprise about 0.1MTrisHCl, about pH7.5, about 0.5MLiCl, about 1% lithium dodecyl sulfate, about 10mMEDTA and about 5mMDTT。
Can about 4,10,15,20,25 or 30C temperature under crack。Cracking can carry out about 1,5,10,15 or 20 or more minutes。The cell of cracking can comprise at least about 100000,200000,300000,400000,500000,600000 or 700000 or more target nucleic acid molecule。The cell of cracking can contain up to about 100000,200000,300000,400000,500000,600000 or 700000 or more target nucleic acid molecule。Fig. 7 illustrates the exemplary statistics of the concentration about the target nucleic acid (i.e. mRNA) that can obtain from cracking。Seal
The micropore of microwell array can be sealed in cracking process。Seal and may be used for preventing the crisscrossing of target nucleic acid between adjacent cells。Can use if the cap as shown in Fig. 8 A and 8B is to seal micropore。Cap can be solid support。Cap can include pearl。The diameter of pearl can more than the diameter of micropore。Such as, cap can at least about than the diameter of micropore 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%。Such as, cap can at most about than the diameter of micropore 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%。
Cap can include cross-linking dextran pearl (such as, Sephadex)。Cross-linking dextran can in the scope of about 10 microns to about 80 microns。The cross-linking dextran of cap can be from 20 microns to about 50 microns。Cap can include such as anopore inoranic membrane (such as, aluminium oxide), dialyzer, microscope slide, coverslip and/or hydrophilic plastic film (such as film, the thin film of the agarose of this film cladding and lysis buffer hydration)。
Cap can allow buffer to be passed into micropore, but macromole (such as, nucleic acid) can be stoped to migrate out from hole。By cap can stop at least about 1,2,3,4,5,6,7,8,9,10,12,13,14,15,16,17,18,19 or 20 or the macromole of more nucleotide migrate into or leave micropore。By cap can stop at most about 1,2,3,4,5,6,7,8,9,10,12,13,14,15,16,17,18,19 or 20 or the macromole of more nucleotide migrate into or leave micropore。
The microwell array sealed can include the pearl of the monolayer at micropore top。The microwell array sealed can include the pearl of the multilamellar at micropore top。The microwell array sealed can comprise about 1,2,3,4,5 or 6 or more multi-layered pearl。
It can be random or nonrandom for one pearl or multiple pearl being deposited on solid support (such as, microwell array)。Such as, making pearl contact with microwell array can be random or nonrandom contact。In certain embodiments, pearl and microwell array random contact are made。In certain embodiments, make that pearl and microwell array are nonrandom to be contacted。It can be random or nonrandom for being deposited to by multiple pearls on microwell array。Such as, making multiple pearl contact with microwell array can be random or nonrandom contact。In certain embodiments, multiple pearl and microwell array random contact are made。In certain embodiments, make that multiple pearl and microwell array are nonrandom to be contacted。
Random labelling to molecule
Wherein sample label or Molecular Identification substance markers are oligonucleotide, and oligonucleotide is attached to nucleic acid and can be occurred by multiple method, include, but not limited to oligonucleotide hybridization to nucleic acid。In some cases, oligonucleotide comprises target-specific district。Target-specific district can include at least some of complementary sequence with molecule to be marked。Target-specific district can with molecular hybridization, thus producing labeled nucleic acid。Oligonucleotide hybridization can be nucleic acid extension after nucleic acid。Nucleic acid extension can be reverse transcription。
Make multiple nucleic acid and sample label be attached (be alternatively referred to as and contact) and can include making that sample label is hybridized in the plurality of nucleic acid is one or more。Make multiple nucleic acid contact with sample label can include carrying out nucleic acid extension。Nucleic acid extension can be reverse transcription reaction。
Multiple nucleic acid is made to contact can include making Molecular Identification substance markers to be hybridized in the plurality of nucleic acid one or more with Molecular Identification substance markers。Make multiple nucleic acid contact with Molecular Identification substance markers can include carrying out nucleic acid extension。Nucleic acid extension can include reverse transcription。
Multiple nucleic acid is made to contact can include making sample label to be hybridized in the plurality of nucleic acid one or more with Molecular Identification substance markers。Make multiple nucleic acid contact with Molecular Identification substance markers can include making Molecular Identification substance markers be hybridized to sample label。
Multiple nucleic acid is made to contact can include making Molecular Identification substance markers to be hybridized in the plurality of nucleic acid one or more with sample label。Make multiple nucleic acid contact with sample label can include sample label is hybridized to Molecular Identification substance markers。
Sample label and/or Molecular Identification substance markers are attached to nucleic acid can be passed through to connect to occur。Make multiple nucleic acid contact with sample label can include label contact is connected to any one in the plurality of nucleic acid。Multiple nucleic acid is made to contact can include making Molecular Identification substance markers to be connected in the plurality of nucleic acid one or more with Molecular Identification substance markers。Make multiple nucleic acid contact with sample label can include making Molecular Identification substance markers be connected to one or more nucleic acid。Multiple nucleic acid is made to contact can include making sample label to be connected in these nucleic acid one or more with Molecular Identification substance markers。Interconnection technique includes flush end and connects and cohesive end connection。Coupled reaction can include DNA ligase, for instance DNA ligase I, DNA ligase III, DNA ligase IV and T4DNA ligase。Coupled reaction can include RNA ligase, for instance T4RNA ligase I and T4RNA ligase II。
Method of attachment draws Brooker (Sambrook) et al. at such as Sa. (2001) and New England's biology laboratory (NewEnglandbiolab) catalogue (these two sections of documents each through be incorporated herein by reference and for all purposes) is described。Method includes using T4DNA ligase, forms phosphodiester bond between 5 ' phosphoric acid and 3 ' C-terminals that its catalysis is arranged side by side in duplex DNA or RNA have flush end and cohesive end；Use TaqDNA ligase, between 5 ' phosphoric acid and 3 ' C-terminals that its catalysis is arranged side by side in two adjacent oligonucleotides of complementary target DNA hybridization, form phosphodiester bond；Using e. coli dna ligase, its catalysis forms phosphodiester bond in the duplex DNA containing sticky end between 5 '-phosphoric acid arranged side by side and 3 '-C-terminal；And using T4RNA ligase, the nucleic acid donor that its catalysis makes end be 5 ' phosphoryls by formation 3 ' → 5 ' phosphodiester bond is connected with the nucleic acid receptor that end is 3 ' hydroxyls, and substrate includes single stranded RNA and DNA and dinucleotide pyrophosphoric acid；Or any other method described in the art。Before being connected with one or two end by aptamer, the DNA of one or more enzymes such as endonuclease ferment treatment fragmentation can be adopted, be beneficial to the connection undertaken by producing the end that is adapted to。
In some cases, two ends of oligonucleotide are attached to molecule。Such as, two ends of oligonucleotide can hybridize with one or more ends of molecule and/or be connected。In some cases, two ends of oligonucleotide and the attachment of two ends of molecule cause the formation of the labeled nucleic acid of annular。Two ends of oligonucleotide also can be attached to the same end of molecule。Such as, 5 ' ends of oligonucleotide are connected with 3 ' ends of molecule, and 3 ' ends hybridization of 3 ' ends of oligonucleotide and molecule, thus producing the labeled nucleic acid at an end with hairpin structure。In some cases, oligonucleotide is attached to the middle part of molecule。
In some cases, oligonucleotide is attached to nucleic acid and includes one or more oligonucleotide joints are attached to multiple nucleic acid。Method may further include the nucleic acid that one or more oligonucleotide joints are attached to sample labeling。Method may further include and one or more oligonucleotide joints are attached to labeled nucleic acid。One or more oligonucleotide joints are attached to nucleic acid, sample label or Molecular Identification substance markers and can include being connected to one or more oligonucleotide joints nucleic acid, sample label or Molecular Identification substance markers。One or more joints can include at least about 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,25,30,35,40,45,50,55,60,70,80,90,100 nucleotide。In some cases, joint can include at least about 1000 nucleotide。
In some cases, molecular bar code includes using one or more aptamer with the attachment of molecule。As used herein, term " aptamer " and " aptamer district " can be used interchangeably。Aptamer can comprise the target-specific district allowing aptamer with attaching molecules, and allows the oligonucleotide specific regions of molecular bar code and aptamer attachment。Aptamer may further include universal primer。Aptamer may further include general PCR sector。Can pass through to include but not limited to that aptamer is attached to molecule and/or molecular bar code by hybridization and/or the method connected。
It is well-known for connecting the method for aptamer and nucleic acid fragment。Aptamer can be double-strand, strand or part strand。In some respects, aptamer is formed by two oligonucleotide with complementarity (such as, about 10 to 30 bases, or the complete complementary of about 15 to 40 bases) region, so that when two oligonucleotide hybridizations together time, they form double-stranded region。Optionally, one or two in the two oligonucleotide can have the region not complementary with another oligonucleotide, thus at one or two end formation single-stranded overhang of this aptamer。Single-stranded overhang can highlight about 1 to about 8 base or about 2 to about 4 bases。Jag can be complementary with the jag passing through to adopt restricted enzyme cutting generation, is beneficial to " cohesive end " and connects。Aptamer can comprise other features, for instance primer binding site and restriction site。In some respects, restriction site can for IIS type restriction endonuclease or carry out the another kind of enzyme cut beyond its recognition sequence, such as EcoP151 (referring to, Mu Ke (Mucke) et al., J. Mol. BioL (JMolBiol) 2001,312 (4): 687-698, and US5,710,000, these documents are incorporated herein by reference in their entirety)。
In some cases, the copy number of the multiple nucleic acids in samples of random counter includes detection aptamer, the complement of aptamer, the reverse mutual complement of aptamer or their part, to determine the number of different labeled nucleic acid。Detection aptamer, the complement of aptamer, the reverse mutual complement of aptamer or their part can include aptamer, the complement of aptamer, the reverse mutual complement of aptamer or their part are checked order。
Molecular bar code can be attached to any region of molecule。Such as, molecular bar code can be attached to 5 ' ends or the 3 ' ends of polynucleotide (such as, DNA, RNA)。Such as, the target-specific district of molecular bar code comprises and the sequence of the complementary in 5th ' district of molecule。The target-specific district of molecular bar code also can comprise and the sequence of the complementary in 3rd ' district of molecule。In some cases, molecular bar code is attached to the region in gene or gene outcome。Such as, genomic DNA is by fragmentation, and sample label or Molecular Identification substance markers are attached to the DNA of this fragmentation。In other cases, RNA molecule is by optionally montage, and molecular bar code is attached to the variant of this alternative splicing。In another example, polynucleotide are digested, and molecular bar code is attached to digested polynucleotide。In another example, the target-specific district of molecular bar code comprises and the sequence of intramolecular complementary。
Comprise the molecular bar code of hair clip, sample label (such as, sample indexes), cell marking or Molecular Identification substance markers (such as, molecular marker) probe for cross chain reaction (HCR) can be served as, and therefore can be referred to as HCR probe。HCR probe can include molecular bar code, and this molecular bar code comprises hairpin structure。HCR probe can include sample label, and this sample label comprises hairpin structure。HCR probe can include Molecular Identification substance markers, and this Molecular Identification substance markers comprises hairpin structure。There is further disclosed herein based on random labeled cross chain reaction (HCR) method, the method includes: adopt the HCR probe one or more nucleic acid molecules of labelling randomly, wherein HCR probe includes molecular bar code, this molecular bar code comprises hair clip, and these one or more nucleic acid molecules serve as the releaser of cross chain reaction。There is further disclosed herein based on random labeled cross chain reaction (HCR) method, the method includes: adopt the HCR probe one or more nucleic acid molecules of labelling randomly, wherein HCR probe includes sample label, this sample label comprises hair clip, and these one or more nucleic acid molecules serve as the releaser of cross chain reaction。There is further disclosed herein based on random labeled cross chain reaction (HCR) method, the method includes: adopt the HCR probe one or more nucleic acid molecules of labelling randomly, wherein HCR probe includes Molecular Identification substance markers, this Molecular Identification substance markers comprises hair clip, and these one or more nucleic acid molecules serve as the releaser of cross chain reaction。
HCR probe can include the hair clip with jag region。The jag region of hair clip can comprise target-specific district。Jag region can comprise few dT sequence。The sample comprising one or more nucleic acid molecules can use one or more restriction nuclease enzymes to process before carrying out random labelling。Jag region can comprise restriction endonuclease recognition sequence。The sample comprising one or more nucleic acid molecules can contact with one or more aptamers before carrying out random labelling, to produce aptamer-nucleic acid molecules heterozygote。Jag region and stem can be complementary with one or more aptamers。HCR probe can include the hair clip with ring。The ring of HCR probe can include mark zone and/or sample index area。
The hybridization of the oneth HCR probe and nucleic acid molecules may result in the formation of labeled nucleic acid, wherein makes a HCR probe linearisation, to produce the first linearisation HCR probe。First linearisation HCR probe of labeled nucleic acid may act as the releaser of the 2nd HCR probe and labeled nucleic acid hybridization, to produce the labeled nucleic acid with two linearisation HCR probes。Second linearisation HCR probe may act as the releaser of another hybridization。This process is repeatable repeatedly, to produce the labeled nucleic acid with multiple linearisation HCR probe。Detectable label on HCR probe can enable to the nucleic acid that detection is labeled。Detectable label can be any kind of labelling (such as, fluorogen, chromophore, little molecule, nanoparticle, hapten, enzyme, antibody, magnet)。Detectable label can comprise the fragment of single marking。When detectable label in close proximity to time, they can produce detectable signal。When HCR probe is hair clip, detectable label is likely to be due to from too far away and cannot produce detectable signal。When HCR probe is linearized and multiple linearizing HCR probe hybridization together time, detectable label can be sufficiently close together, to produce detectable signal。Such as, HCR probe can comprise two pyrene parts as detectable label。Alternately, detectable label can be nanoparticle。Multiple hair clip HCR probe can being enable to be attached to labeled nucleic acid based on random labeled HCR method, this may result in signal and amplifies。The detection of nucleic acid molecules, analysis and/or quantitative sensitivity can be improved based on random labeled HCR。The detection of one or more nucleic acid molecules, analysis and/or quantitative accuracy can be improved based on random labeled HCR。
After cracking, the target nucleic acid of cell can be hybridized to be conjugated to the oligonucleotide of solid support。Target nucleic acid can be hybridized to the target land of oligonucleotide。Nucleic acid can be hybridized to any region of oligonucleotide。
In some cases, not all oligonucleotide can be combined with target nucleic acid。This is because in some cases, the number of oligonucleotide is more than the number of target nucleic acid。The number being conjugated to the oligonucleotide of solid support can be the 1 of number of cell target nucleic acid, 2,3,4,5,6,7,8,9 or 10 times。The oligonucleotide of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% can be combined with target nucleic acid。At most the oligonucleotide of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% can be combined with target nucleic acid。In some cases, at least 1,2,3,4,5,6,7,8,9,10,20,30,40,50,60,70,80,90 or 100 or more different target nucleic acid can be caught by the oligonucleotide on solid support。In some cases, at most 1,2,3,4,5,6,7,8,9,10,20,30,40,50,60,70,80,90 or 100 or more different target nucleic acid can be caught by the oligonucleotide on solid support。
In some cases, at least about 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% the combining to the oligonucleotide on solid support of the copy number of target nucleic acid。In some cases, at most about 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% the combining to the oligonucleotide on solid support of the copy number of target nucleic acid。
Regain
After cracking, it is possible to solid support is regained。Can by using magnet to carry out the withdrawal of solid support。The withdrawal of solid support can be carried out by melted microwell array and/or supersound process。The withdrawal of solid support can include being centrifuged。The withdrawal of solid support can include size exclusion。In some cases, the solid support of at least about 50%, 60%, 70%, 80%, 90%, 95% or 100% is reclaimed from micropore。In some cases, the solid support of many about 50%, 60%, 70%, 80%, 90%, 95% or 100% it is recycled to from micropore。
Reverse transcription
Method disclosed herein can farther include the RNA molecule to labelling and carry out reverse transcription, to produce labeled cDNA molecule。In some cases, the primer serving as reverse transcription reaction at least partially of oligonucleotide。The few dT part of oligonucleotide can serve as the primer of the first chain synthesis of cDNA molecule。
In some cases, the cDNA molecule of labelling can be used as the molecule of new random labelling reaction。The cDNA of labelling can have before reverse transcription to be attached to the first label or the set of tags of RNA, and is attached to the second label or the set of tags of cDNA molecule。The reaction of these multiple labellings can be used for, for instance, it is determined that the efficiency of event between the attachment of the first label and the second label (such as optional amplified reaction or reverse transcription reaction)。
In another example, oligonucleotide is attached to 5 ' ends of RNA molecule, to produce the RNA molecule of labelling。The reverse transcription of the RNA molecule of labelling can be undertaken by adding reverse transcriptase primer。In some cases, reverse transcriptase primer is oligo dT primer, random Hexanucleotide primer or target-specific oligonucleotide primer。Generally, the length of oligo dT primer is 12-18 nucleotide, and combines poly-(the A)+afterbody of endogenous to the 3 ' ends at mammal mRNA。Random Hexanucleotide primer can combine to mRNA in multiple complementary sites。Target-specific oligonucleotide primer typically selectively causes mRNA interested。
In some cases, the method includes the RNA molecule of labelling is repeatedly performed reverse transcription, to produce multiple labeled cDNA molecule。Method disclosed herein can include carrying out at least about 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19 or 20 reverse transcription reactions。The method can include carrying out at least about 25,30,35,40,45,50,55,60,65,70,75,80,85,90,95 or 100 reverse transcription reactions。
Nucleic acid synthesis (such as, cDNA synthesis) can carry out on the solid support regained。Nucleic acid synthesis can carry out keeping solid support to suspend in pipe and/or on rotor。The nucleic acid that gained synthesizes can be used in nucleic acid amplification subsequently and/or sequencing technologies。Nucleic acid synthesis can include producing cDNA copy on the RNA of the oligonucleotide being attached on solid support。Produce cDNA copy can include using the reverse transcriptase (RT) with RT activity or archaeal dna polymerase。This can cause the generation of single-stranded cDNA molecule。After nucleic acid synthesizes, it is possible to untapped oligonucleotide is removed from solid support。Exonuclease ferment treatment (such as, passing through ExoI) can be passed through and carry out the removal of oligonucleotide。
In certain embodiments, it is possible to use nucleic acid is removed by chemical cleavage from solid support。For example, it is possible to the chemical group that will be present in nucleic acid or modified base are for promoting to remove it from solid support。Such as, enzyme may be used for removal nucleic acid from solid support。For example, it is possible to nucleic acid is removed from solid support by restricting property endonuclease digestion。Such as, process the nucleic acid containing dUTP or ddUTP with uracil-d-glycosylase (UDG) and may be used for removal nucleic acid from solid support。It is, for example possible to use nucleic acid is removed by the enzyme carrying out nucleotide excision (such as, base-excision repair enzymes (such as, depurination/de-pyrimidine (AP) Cobra venom endonuclease)) from solid support。In certain embodiments, it is possible to use nucleic acid is removed by photo-fission (photocleavable) group and light from solid support。In certain embodiments, removal nucleic acid from solid support can be may be used for by cutting joint。Such as, at least one in the following can be included by cutting joint: biotin/avidin, biotin/streptavidin, biotin/neutravidin, Ig protein A, photo-labile joint, acid or alkali unstability linking group or fit。
In certain embodiments, nucleic acid does not expand。In certain embodiments, before nucleic acid sequencing, nucleic acid does not expand。In certain embodiments, the nucleic acid being not attached to solid support can without expanding direct Sequencing in advance。In certain embodiments, when being not attached to solid support, nucleic acid can without carrying out expanding and direct Sequencing, for instance, be attached to solid support nucleic acid can while being attached to solid support direct Sequencing。In certain embodiments, the nucleic acid removed from solid support can direct Sequencing。Such as, the nucleic acid removed from solid support can without carrying out expanding and direct Sequencing。Any order-checking platform being conducive to carrying out checking order without amplification may be used for carrying out this order-checking。
Amplification
After nucleic acid synthesizes (such as, reverse transcription), it is possible to expanded。Amplification can carry out by multi-channel approach, and plurality of target nucleic acid sequence expands simultaneously。Order-checking aptamer can be added into nucleic acid by amplification。Amplification can be passed through polymerase chain reaction (PCR) and carry out。PCR can refer to the reaction for being made specific DNA sequences amplification in vitro by primer extension while the complementary strand of DNA。PCR can contain the subform of this reaction, includes but not limited to, RT-PCR, real-time PCR, nest-type PRC, quantitative PCR, multiplex PCR, digital pcr, and assembles PCR。
The method may further include and carries out one or more amplified reaction to produce labeled nucleic acid amplicon。These labeled nucleic acid can be expanded before the nucleic acid that detection is labeled。The present invention further includes at before carrying out one or more amplified reaction and combines the first and second samples。
Amplified reaction can include expanding at least some of sample label。Amplified reaction can include expanding at least some of labelling。Amplified reaction can include expanding at least some of sample label, labelling, nucleic acid or their combination。Amplified reaction can include expanding at least the 1% of multiple nucleic acid, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97% or 100%。The method may further include and carries out one or more cDNA synthetic reaction, to produce the nucleic acid of sample labeling or one or more cDNA copy of the nucleic acid through Molecular Identification substance markers。
The amplification of labeled nucleic acid can be included the method for PCR-based or is not based on the method for PCR。The amplification of labeled nucleic acid can be included the exponential amplification to labeled nucleic acid。The amplification of labeled nucleic acid can be included the linear amplification to labeled nucleic acid。
In some cases, the method including being not based on PCR to the amplification of labeled nucleic acid。The example of the method being not based on PCR includes but not limited to, multiple displacement amplification (MDA), transcriptive intermediate amplification (TMA), based on the amplification (NASBA) of nucleotide sequence, strand displacement amplification (SDA), real-time SDA, rolling circle amplification or ring to circle amplification (circle-to-circleamplification)。Other amplification methods being not based on PCR include rna transcription amplification that DNA dependent rna polymerase drives or the DNA synthesis that RNA instructs and the Multiple Cycle transcribed with DNA amplification or RNA target mark (WO89/01050；WO88/10315；And U.S. Patent number 5,130,238；5,409,818；5,466,586；5,514,545；5,554,517；5,888,779；6,063,603；And 6, 197, 554), ligase chain reaction (LCR), Q β replicative enzyme (Q β) method, as being described in U.S. Patent number 4, 786, 600, the use of palindrome probe, strand displacement amplification, use the amplification that the oligonucleotide of restriction endonuclease drives, a kind of amplification method, wherein by primer hybridization to nucleotide sequence and by the cutting before extension and amplification of gained duplex, use the strand displacement amplification (U.S. Patent number 6 of the nucleic acid polymerase of shortage 5 ' exonuclease activity, 214, 587), rolling circle amplification, and branch extends amplification (RAM) (U.S. Patent number 5, 942, 391)。
The amplification of labeled nucleic acid can be included method based on cross chain reaction (HCR) (De Kesi (Dirks) and Pierre Si (Pierce), PNAS, 2004；Open (Zhang) et al., analytical chemistry (AnalChem), 2012)。Method based on HCR can include the HCR based on DNA。The probe of one or more labelling can be included based on the method for HCR。The probe of these one or more labellings can include one or more sample label disclosed herein or Molecular Identification substance markers or its complement。
In some cases, method disclosed herein farther include to labeled nucleic acid (such as, the RNA of labelling, the DNA of labelling, labelling cDNA) carry out polymerase chain reaction, to produce labeled amplicon。Labeled amplicon can be duplex molecule。This duplex molecule can include double stranded rna molecule, double chain DNA molecule or the RNA molecule with DNA molecule hybridize。One of duplex molecule or two chains can comprise sample label or Molecular Identification substance markers。Alternately, labeled amplicon is single chain molecule。This single chain molecule can include DNA, RNA or their combination。Nucleic acid that is that the nucleic acid of the present invention can include synthesis or that change。
Polymerase chain reaction can be carried out by the method for such as PCR, HD-PCR, next generation PC R, numeral RTA or its combination in any。Other PCR method includes but not limited to, linear (LATE)-PCR (linear-after-the-exponential (LATE)-PCR), long PCR, multiplex PCR, nest-type PRC, heminested PCR, quantitative PCR, RT-PCR, real-time PCR, singe-cell PCR and the PCR that falls progressively (touchdownPCR) or their combination after ApoE gene, AluPCR, assembling PCR, asymmetric PCR, microdroplet PCR, emulsion-based PCR, the amplification HDA of dependence unwindase, heat start PCR, inverse PCR, index。
Multi-PRC reaction can include nido PRC reaction。The method can include primer pair, wherein the first primer annealing any one 3 ' at least about 300 to 400 nucleotide held from the plurality of nucleic acid of any one to multiple nucleic acid, and the second primer annealing is any one 3 ' at least about 200 to 300 nucleotide held from the plurality of nucleic acid of any one to multiple nucleic acid, wherein this first primer and the second primer 3 ' ends of any one in the plurality of nucleic acid produce complementary DNA synthesis。
In some cases, carry out polymerase chain reaction to include the first target specific primer and labeled Nucleic acids anneal。Alternatively or additionally, carrying out polymerase chain reaction to farther include the universal primer binding site regional annealing of universal primer with sample label or Molecular Identification substance markers, wherein this sample label or Molecular Identification substance markers are on labeled nucleic acid or labeled amplicon。Method disclosed herein can farther include to anneal the second target specific primer with labeled nucleic acid and/or labeled amplicon。
In some cases, the method includes the labeled nucleic acid of repeated amplification to produce multiple labeled amplicon。Method disclosed herein can include carrying out at least about 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19 or 20 amplified reactions。Alternately, the method includes carrying out at least about 25,30,35,40,45,50,55,60,65,70,75,80,85,90,95 or 100 amplified reactions。
Other amplification methods being suitable for include ligase chain reaction (LCR) (such as, Wu (Wu) and Wallace (Wallace), genomics (Genomics), 4:560 (1989), Lan Degelun (Landegren) et al., science (Science), people's gene (Gene) 89:117 (1990) such as 241:1077 (1988) and Bahrain outstanding (Barringer)), transcription amplification (Guo (Kwoh) et al., PNAS (Proc.Natl.Acad.Sci.USA), 86:1173 (1989) and W088/10315), self-sustained sequence replicates (melon spy profit (Guatelli) et al., PNAS (Proc.Nat.Acad.Sci.87, 1874 (1990) and WO90/06995), selective amplification (the U.S. Patent number 6 of target polynucleotide sequence, 410, 276), consensus sequence primer polymerase chain reaction (CP-PCR) (U.S. Patent number 4, 437, 975), arbitrarily primed PCR (AP-PCR) (U.S. Patent number 5, 413, 909, 5, 861, 245), rolling circle amplification (RCA) is (such as, Fu Aier (Fire) and Xu (Xu), PNAS92:4641 (1995) and Liu (Liu) et al., JACS (J.Am.Chem.Soc.118:1587 (1996)) and U.S. Patent number 5, 648, 245), strand displacement amplification is (referring to seeing Lan Siken (Lasken) and Ai Gehuomu (Egholm), biotechnology trend (TrendsBiotechnol.) 200321 (12): 531-5；Bark (Barker) et al., genome research (GenomeRes.) in May, 2004；14 (5): 901-7；Dien (Dean) et al., institute of American Academy of Sciences report (ProcNatlAcadSciUSA.) 2002；99 (8): 5261-6；Wo Ke (Walker) et al., 1992, nucleic acids research (NucleicAcidsRes.) 20 (7): 1691-6,1992 and handkerchief hereby (Paez) et al., nucleic acids research (NucleicAcidsRes.) 2004；32 (9): e71), Qbeta replicative enzyme (is described in PCT Patent application number PCT/US87/00880) and based on the sequence amplification (NABSA) of nucleic acid (referring to U.S. Patent number 5,409,818,5,554,517 and 6,063,603, wherein each patent is each through being incorporated herein by reference)。Other spendable amplification methods are described in U.S. Patent number 6,582,938,5,242,794,5,494,810,4,988,617 and US publication 20030143599, and wherein each patent is incorporated herein by。DNA is also by multiple gene seat specific PCR or uses aptamer connection and single primer PCR (referring to Jin Sile (Kinzler) and Wo Geersitan (Vogelstein), NAR (1989) 17:3645-53) to expand。It is used as other available amplification methods, such as balance PCR (Makrigiorgos et al., (2002), Nature Biotechnol (NatBiotechnol), the 20th volume, 936-9 page)。
Molecular inversion probes (" MIP ") can also be used for selected target is expanded。MIP can be generated so that the end of probe (pre-circleprobe) and the regional complementarity being positioned at region to be amplified flank before ring。Breach can be made to close by extension probes end, so that the complement of target connects at end is previously incorporated MIP forming closed loop。This closed loop can expand by checking order or hybridizing and detect, as previously at Hardenbol et al., genome research (GenomeRes.) 15:269-275 (2005) and at U.S. Patent number 6,858,412) in disclosed。
Amplification can farther include to be added in one or more sample including multiple nucleic acid one or more comparison nucleic acid。Amplification can farther include to be added in multiple nucleic acid one or more comparison nucleic acid。Comparison nucleic acid can include contrasting marking。
Amplification can include using one or more non-natural nucleotides。Non-natural nucleotides can include photo-labile and/or the nucleotide that can trigger。The example of non-natural nucleotides includes, but not limited to peptide nucleic acid(PNA) (PNA), morpholino and lock nucleic acid (LNA) and glycol nucleic acid (GNA) and threose nucleic acid (TNA)。Non-natural nucleotides can be added in one or more circulations of amplified reaction。Add non-natural nucleotides to can be used for differentiating the product of particular cycle or time point in amplified reaction。
Carry out one or more amplified reaction can include using one or more primer。These one or more primers can include one or more oligonucleotide。These one or more oligonucleotide can include at least about 7-9 nucleotide。These one or more oligonucleotide can include less than 12-15 nucleotide。These one or more primers can be annealed at least some of of multiple labeled nucleic acid。These one or more primers can be annealed to 3 ' ends and/or the 5 ' ends of multiple labeled nucleic acid。These one or more primers can be annealed to the inner area of multiple labeled nucleic acid。Inner area can be hold from the 3 ' of the plurality of labeled nucleic acid at least about 50, 100, 150, 200, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 650, 700, 750, 800, 850, 900 or 1000 nucleotide。These one or more primers can include the primer panel fixed。These one or more primers can include at least one or more customization primer。These one or more primers can include at least one or more comparison primer。These one or more primers can include at least one or more house-keeping gene primer。These one or more oligonucleotide can include the sequence being selected from lower group, and this group is made up of the sequence in table 23。These one or more primers can include universal primer。Universal primer can be annealed to universal primer binding site。These one or more customization primers can be annealed to the first sample label, the second sample label, Molecular Identification substance markers, nucleic acid or their product。These one or more primers can include universal primer and customization primer。This customization primer can be designed to expand one or more target nucleic acid。These target nucleic acids can include the subgroup of total nucleic acid in one or more sample。These target nucleic acids can include the subgroup of labeled nucleic acid total in one or more sample。These one or more primers can include at least 96 or more customization primer。These one or more primers can include at least 960 or more customization primer。These one or more primers can include at least 9600 or more customization primer。These one or more customization primers can be annealed to two or more different labeled nucleic acid。These two or more different labeled nucleic acid can correspond to one or more gene。
Disclosed here is the method selecting customization primer, the method includes: a) first pass, the primer wherein selected may include that i) no more than three continuous print guanines, no more than three continuous print cytosine, no more than four continuous print adenine, and no more than four continuous print thymus pyrimidines；Ii) for guanine or at least the 3 of cytosine, 4,5 or 6 nucleotide；And iii) it is not easy to be formed the sequence of hairpin structure；B) second time, including: the i) first round, select the high multiple sequences covered with all transcripies；And ii) one or more wheels subsequently, select to have the residue the highest covering of transcript and be not more than the sequence of complementary score of the sequence with other selections of 4；And c) add sequence to the group selected, until cover the sum of saturated or client's primer less than or equal to about 96。
The method selecting customization primer may further include at least one universal primer of selection, its based on one or more mRNA transcripies, include structure RNA non-coding transcripts, transcribe pseudogene, the model mRNA that provided by genome annotation process, corresponding to the sequence of genome contig or their any combination。
The method selecting customization primer may further include Primer selection method, and the method is enriched with the nucleic acid of one or more subgroups。These one or more subgroups can include low abundance mRNA。
The method selecting customization primer may further include computational algorithm。The primer used in the method can use Primer3 (a kind of computer program advising primer sequence based on user-defined list entries) to be designed。It is used as other design of primers, or under there is no computer program auxiliary, primer can be selected with eyes。There are many available options in this procedure so that design of primers is suitable for great majority application。Primer3 can consider many factors, include but not limited to, the melting temperature of oligonucleotide, length, G/C content, 3 ' terminal stabilization, the secondary structure of estimation and less desirable sequence anneals or the probability (such as interspersed repeat sequence) that it is expanded and between two copies of same primer, form the probability of primer dimer。When designing primer pair, difference that Primer3 can consider to be formed between the melting temperature of the probability of primer dimer, primer between product size and melting temperature, two primers in primer pair and primer are relative to the position of the specific target areas that will avoid。
Method disclosed here, compositions and test kit can include the one or more primers being disclosed in table 23-24。
Order-checking
In some respects, it is determined that the number of different labeled nucleic acid can include determining that labeled nucleic acid or the sequence of its any product (such as, labeled amplicon, labeled cDNA molecule)。In some cases, the target nucleic acid of amplification can stand order-checking。Determine at least one of, its complement, its reverse mutual complement of at least one of, the labeled nucleic acid that the sequence of labeled nucleic acid or its any product can include carrying out sequencing reaction to determine sample label, Molecular Identification substance markers or the sequence of their combination in any。In some cases, only a part for sample label or sample label is checked order。In some cases, only a part for Molecular Identification substance markers or Molecular Identification substance markers is checked order。
Determine that the sequence of labeled nucleic acid or its any product can be undertaken by such as following sequence measurement: HelioscopeTMThe order-checking of single-molecule sequencing, nanopore DNA, extensive parallel signature order-checking (MPSS), 454 Manganic pyrophosphate complex initiation of LynxTherapeutics, unimolecule (RNAP) order-checking in real time, Illumina (Solexa) order-checking, SOLiD order-checking, IonTorrentTM, ionic semiconductor order-checking, unimolecule SMRT (TM) order-checking, polonies order-checking (Polonysequencing), the order-checking of DNA nanosphere and the method for VisiGen biotechnology (and VisiGenBiotechnologies)。Alternately, determine that the sequence of labeled nucleic acid or its any product can use order-checking platform, including but not limited to: gene element analyzer (GenomeAnalyzer) IIx, HiSeq and the MiSeq that Illumina provides, unimolecule is (SMRT in real timeTM) technology, the PacBioRS system such as provided by Pacific Ocean Biological Science Co., Ltd (PacificBiosciences) (California (California)) and Solexa sequenator, real single-molecule sequencing (tSMSTM) technology, for instance the HeliScope provided by HelicosInc (Cambridge (Cambridge), Massachusetts (MA))TMSequenator。
In certain embodiments, labeled nucleic acid include represent from organism genomic gene about 0.01% to organism genomic gene about 100% nucleic acid。It is, for example possible to use include multiple polymeric target-complementary region, by catching the gene containing complementary series from sample, the organism genomic gene of the organism genomic gene to about 0.01% to about 100% checks order。In certain embodiments, labeled nucleic acid includes the nucleic acid representing the organism transcript profile transcript of the organism transcript profile transcript to about 100% from about 0.01%。It is, for example possible to use include the target-complementary region of poly-T tail, by catching mRNA from sample, the organism transcript profile transcript of the organism transcript profile transcript to about 0.501% to about 100% checks order。
In some cases, it is determined that the sequence of labeled nucleic acid or its any product includes paired end sequencing, nano-pore order-checking, high-flux sequence, shotgun sequencing, dye terminator order-checking, the step shifting of multi-primers DNA sequencing, primer, sanger dideoxy sequencing, Maxim-Gilbert order-checking, Manganic pyrophosphate complex initiation, real single-molecule sequencing or their combination in any。Alternately, it is possible to determine labeled nucleic acid or the sequence of its any product by electron-microscopic analysis method or chemical sensitive field effect transistor (chemFET) array。
Multiple sequence measurement can be used to be determined the sequence of nucleic acid (such as, nucleic acid through amplification, labeled nucleic acid, the cDNA copy etc. of labeled nucleic acid), these methods include but not limited to: sequencing by hybridization (SBH), connection method order-checking (SBL), quantify the additional order-checking of increment fluorescent nucleotide (quantitativeincrementalfluorescentnucleotideadditionsequ encing) (QIFNAS), segmentation connects and fracture, FRET (fluorescence resonance energy transfer) (FRET), molecular beacon, TaqMan reporter probe digests, Manganic pyrophosphate complex initiation, fluorescent in situ sequencing (FISSEQ), FISSEQ beadlet, swing order-checking (wobblesequencing), multiple order-checking, polymerization cluster (polymerizedcolony) (POLONY) order-checking；Nanometer lattice roll ring order-checking (nanogridrollingcirclesequencing) (ROLONY), allele specific oligonucleotide connects inspection (allele-specificoligoligationassay) (such as, oligonucleotide connect inspection (OLA), use the linear probe connected and rolling circle amplification (RCA) to read, single template molecule (singletemplatemolecule) OLA holding lock probe that connects and/or use the annular connected to hold lock probe and single template molecule OLA that rolling circle amplification (RCA) reads) etc.。High-flux sequence method can also be used, as used the circular array order-checking of platform (such as Roche454, IlluminaSolexa, ABI-SOLiD, IONTorrents, complete genome (CompleteGenomics), Pacific Ocean bioscience (PacificBioscience), spiral (Helicos), Polonator platform)。Order-checking can include MiSeq order-checking。Order-checking can include HiSeq order-checking。Order-checking can read the gene on cell marking, molecular marker and/or original oligonucleotide。
In another example, it is determined that the sequence of labeled nucleic acid or its any product includes RNA-Seq or Microrna order-checking。Alternatively, it is determined that the sequence of labeled nucleic acid or its any product includes protein sequencing technology, for instance edman degradation, peptide masses fingerprint analysis, mass spectrography or protease digestion。
In certain embodiments, sequencing reaction can occur in solid phase or semi-solid support, in gel, in emulsion, from the teeth outwards, on beadlet, in drop, in stream continuously, in diluent or in one or more physically separated volumes。
Order-checking can include at least about 10,20,30,40,50,60,70,80,90,100 or more nucleotide to labeled nucleic acid or base pair checks order。In some cases, order-checking includes at least about 200,300,400,500,600,700,800,900,1000 or more nucleotide to labeled nucleic acid or base pair checks order。In other cases, order-checking includes to labeled nucleic acid at least about 1500；2,000；3,000；4,000；5,000；6,000；7,000；8,000；9,000；Or 10,000 or more nucleotide or base pair check order。
Order-checking can include at least about 200,300,400,500,600,700,800,900,1000 or more order-checking reading/operation。In some cases, order-checking includes order-checking at least about 1500；2,000；3,000；4,000；5,000；6,000；7,000；8,000；9,000；Or 10,000 or more order-checking reading/operation。Order-checking can include less than or equal to about 1,600,000,000 order-checking reading/operations。Order-checking can include less than or equal to about 200,000,000 reading/operations。
Determine that the number of different labeled nucleic acid can include one or more array。
Determine that the number of different labeled nucleic acid can include making labeled nucleic acid contact with one or more probes。
Probe as described in this can comprise at least some of complementary sequence with labeled nucleic acid or labeled amplicon。The plurality of probe can be arranged in the discrete regions on solid support, and wherein the discrete regions on solid support comprises and has identical or close to identical sequence probe。In some cases, two or more discrete regions on solid support comprise probe two kinds different, and these probes comprise the sequence that two different uniqueness from label oligonucleotide identify the complementary of object area。
In some cases, the plurality of probe and hybridization array。The plurality of probe can make labeled molecule and hybridization array。The plurality of probe can comprise the sequence complementary with random labelling widow dT。Alternately, or additionally, the plurality of probe comprises the sequence with this complementary element。
Determine that the number of different labeled nucleic acid can include the array contact making labeled nucleic acid with multiple probes。Determine that the number of different labeled nucleic acid can include making labeled nucleic acid contact with the microscope slide of multiple probes。
Determine that the number of different labeled nucleic acid can include labeled probe hybridization, target-specific amplification, target-specific order-checking, carry out checking order for the labeled nucleotide of the little nucleotide polymorphisms of target with specificity, carry out checking order for the labeled nucleotide of digestion with restriction enzyme pattern with specificity, carry out checking order for the labeled nucleotide of sudden change with specificity or their combination。
Determine that the number of different labeled nucleic acid can include the selected by flow cytometry apoptosis of sequence-specific labelling。Determine that the number of different labeled nucleic acid can include detecting the labeled nucleic acid being attached to pearl。Detection is attached to the labeled nucleic acid of pearl can include fluoroscopic examination。
Determine that the number of different labeled nucleic acid can include, by the FRET (fluorescence resonance energy transfer) (FRET) between target-specific probe and labeled nucleic acid or the labeled label probe of target-specific, multiple labeled nucleic acid being counted。
The detection of labeled nucleic acid
Method disclosed herein may further include the detection to labeled nucleic acid and/or labeled amplicon。The detection of labeled nucleic acid and/or labeled amplicon can be included the hybridization of labeled nucleic acid and surface such as solid support。The method may further include the immunoprecipitation of target sequence and nucleic acid binding protein。The detection of labeled nucleic acid and/or labeled amplicon can make it possible to or assist the number determining different labeled nucleic acid。
In some cases, the method farther includes to contact labeled nucleic acid and/or labeled amplicon with detectable label, to produce the labeled nucleic acid with detectable label coupling。Method disclosed herein may further include the labeled nucleic acid of detection and detectable label coupling。The detection of labeled nucleic acid or its any product (the labeled nucleic acid of such as, labeled amplicon and detectable label coupling) can be included at least one of detection to sample label or Molecular Identification substance markers, molecule, detectable label, sample label or the complement of Molecular Identification substance markers, the complement of molecule or their combination in any。
The detection of labeled nucleic acid or its any product can be included Emulsion or drop。Such as, labeled nucleic acid or its any product can in Emulsions or drop。Drop can be the first liquid of small size, and this first liquid is encapsulated by immiscible second liquid, for instance the continuous phase (and/or by bigger drop) of Emulsion。The volume of drop, and/or the average external volume of drop in Emulsion, it is possible to such as less than approximately 1 microlitre (or between about 1 microlitre and 1 are received and risen or between about 1 microlitre and 1 picoliters), less than approximately 1 receiving liter (or receive about 1 rise between 1 picoliters) or less than approximately 1 picoliters (or between about 1 picoliters and 1 are ascended to heaven) etc.。Drop (or drop of Emulsion) can have the diameter (or average diameter) less than approximately 1000,100 or 10 microns or about 1000 to 10 microns etc.。Drop can be spherical or aspheric。Can produce to have average diameter be about, less than approximately or more than about 0.001, the drop of 0.01,0.05,0.1,1,5,10,20,30,40,50,60,70,80,100,120,130,140,150,160,180,200,300,400 or 500 microns。Drop can have the average diameter for about 0.001 to about 500, about 0.01 to about 500, about 0.1 to about 500, about 0.1 to about 100, about 0.01 to about 100 or about 1 to about 100 micron。Drop can be simple drop or compound drop。As used herein, term Emulsion can refer to the mixture (such as oil and water) of immiscible liquid。Oil phase and/or water in oil emulsion allow the compartmentation of reactant mixture in aqueous drop。These Emulsions can include the aqueous drop in oil-continuous phase。Can being oil in water emulsion at this Emulsion provided, wherein these drops be the oil droplets in continuous aqueous phase。When be used for Emulsion or drop separating (such as, being spatially separated) unicellular time, it is possible to do not use solid support。Therefore, needing the nucleic acid of labeling and analysis can not be incorporated in solid support, and in such cases；When by labeling, cell marking can correspond to the unicellular or cell colony being present in Emulsion or drop。Therefore, Emulsion or drop can may be used for identifying the nucleic acid from unicellular or multiple cells by unicellular or multiple cell separation labeling or marking step and cell marking effectively。In certain embodiments, it is possible to drop is applied in micropore, for instance, it is similar to and pearl is applied in microwell array。
Alternately, the detection of labeled nucleic acid or its any product is included one or more solution。In other cases, the detection of labeled nucleic acid is included one or more container。
Can include detecting each labeled nucleic acid or its product to the detection of labeled nucleic acid or its any product (the labeled nucleic acid of such as, labeled amplicon and detectable label coupling)。Such as, method disclosed herein includes checking order at least partially to each labeled nucleic acid, thus detecting each labeled nucleic acid。
In some cases, the detection of labeled nucleic acid and/or labeled amplicon is included electrophoresis, spectrographic method, microscopy, chemoluminescence method, chemiluminescence method, fluorescence method, immunofluorescence, colorimetry or Electrochemiluminescince。Such as, the method includes the detection to fluorescent dye。The detection of labeled nucleic acid or its any product can be included colorimetry。Such as, colorimetry includes using tintometer or color reader。The non-limiting list of tintometer and color reader include Sen Suoweixunshi colorimetric array image-forming reader (Sensovation ' sColorimetricArrayImagingReader, CLAIR), ESEQuant current immunity detecting reader (LateralFlowImmunoassayReader), SpectraMax340PC38, SpectraMaxPlus384, SpectraMax190, VersaMax, VMax and EMax。
It is used alone or combines, with the additive method for detecting labeled nucleic acid and/or amplicon, the other method used and can include using array detector, fluorescence reader, non-fluorescence detector, CR reader, luminometer or scanner。In some cases, detect labeled nucleic acid and/or labeled amplicon includes using array detector。The example of array detector includes but not limited to, diode array detector, photodiode array detector, HLPC photodiode array detector, array detector, germanium array detector, CMOS and CCD array detector, gate linear CCD array detector, InGaAs photodiode array system and TE cooling CCD system。This array detector can be microarray detector。The limiting examples of microarray detector includes microelectrode array detector, optical dna microarray detection platform, DNA microarray detector, RNA microarray detector and protein microarray detector。
In some cases, fluorescence reader is for detecting labeled nucleic acid and/or labeled amplicon。This fluorescence reader can read 1 on biochip, on microscope slide or in microwell plate, 2,3,4, the fluorescent microarray of 5 kind or more colors or other structures。In some cases, this fluorescence reader is Sen Suoweixun fluorescence array image-forming reader (SensovationFluorescenceArrayimagingReader, FLAIR)。Alternately, this fluorescence reader is fluorescence microplate reader, for instance GeminiXPS fluorescence microplate reader, GeminiEm fluorescence microplate reader, based onThe fluorescence microplate reader of Fluoroskan wave filter, PHERAstar microplate reader, FIUOstar microplate reader, POLARstarOmega microplate reader, FLUOstarOPTIMA multi-mode microplate reader and POLARstarOPTIMA multi-mode microplate reader。The other example of fluorescence reader includes PharosFXTM and PharosFXPlus system。
In some cases, include the detection of labeled nucleic acid and/or labeled amplicon using microplate reader。In some cases, this microplate reader be xMarkTM microwell plate absorbance spectrophotometer, iMark microwell plate absorbance reader,Multi-mode microplate reader, EnVision multiple labeling microplate reader, VICTORX multiple labeling microplate reader, FlexStation, SpectraMaxParadigm, SpectraMaxM5e, SpectraMaxM5, SpectraMaxM4, SpectraMaxM3, SpectraMaxM2-M2e, FilterMaxF series, FluoroskanAscentFL microplate fluorometers and luminometer, FluoroskanAscent microplate fluorometers, LuminoskanAscent microwell plate luminometer, MultiskanEX microplate luminometer, MuliskanFC microplate luminometer and MuliskanGO microplate luminometer。In some cases, microplate reader detection absorbance, fluorescence, luminescence, time-resolved fluorescence, light scattering or its combination in any。In certain embodiments, microplate reader detection dynamic light scattering。In some cases, microplate reader can detect static light scattering。In some cases, include the detection of labeled nucleic acid and/or labeled amplicon using microwell plate imager。In some cases, microwell plate imager includes ViewLuxuHTS microwell plate imager and BioRad microwell plate imaging system。
Can include using luminometer to the detection of labeled nucleic acid and/or its product。The example of luminometer includes but not limited to, SpectraMaxL,-96 microwell plate luminometers,-20/20 single hose luminometer, with InstinctTM software-Multi+、-MultiJr single hose multi-mode reader, LUMIstarOPTIMA, LEADERHC+ luminometer, LEADER450i luminometer and LEADER50i luminometer。
In some cases, include the detection of labeled nucleic acid and/or labeled amplicon using scanner。Scanner includes flat bed scanner, for instance the scanner provided by Canon (Cannon), Epson (Epson), HP, Fujitsu (Fujitsu) and Xerox (Xerox)。The other example of flat bed scanner includesFluorescent imaging scanner is (such as,II, III and IIIPlus system)。Scanner can include microplate instrument, for instance ArrayitArrayPixTM microarray microplate instrument。In some cases, scanner is personalized Molecular Imager (PersonalMolecularImager) TM (PMI) system provided by Bole company (Bio-rad)。
The detection of labeled nucleic acid can be included the analytical technology that the mass-to-charge ratio of charged particle is measured in use, for instance mass spectral analysis。In certain embodiments, the mass-to-charge ratio of charged particle is measured in conjunction with chromatographic separation technology。In certain embodiments, sequencing reaction is combined use with the measurement of charged particle mass-to-charge ratio。In certain embodiments, label includes isotope。In certain embodiments, isotopic type or ratio are controlled in tag library or handle。
Include using little particle and/or light scattering to the detection of labeled nucleic acid or its any product。Such as, the molecule (such as, labeled amplicon) of amplification is attached to hapten or is attached directly to little particle and hybridization array。The size of little particle can nanometer in the scope of micron。When light is when particle surface generation scattering, it is possible to particle is detected。
Colorimetric method can be used when little particle is coloured, or can use colorimetric assay system that hapten is dyeed。In some cases, flat bed scanner may be used for detecting the development of light or colored materials from KPT Scatter。Method disclosed herein may further include use light absorbing material。Light absorbing material may be used for blocking unwanted light scattering or reflection。Light absorbing material can be food coloring or other materials。In some cases, include the detection of labeled nucleic acid or its any product making labeled nucleic acid contact with off-axis white light。
In certain embodiments, it is possible to detect from the different types of biomaterial of two or more in sample simultaneously。For example, it is possible to simultaneously detection selected from lower group from the different types of biomaterial of two or more in sample, this group is made up of the following: DNA, RNA (such as, microRNA, mRNA etc.), nucleotide, albumen and saccharide。It is, for example possible to use method described here detects DNA and the RNA from sample simultaneously。
Data analysis
Sequencing data can be used for the number of counting cells target nucleic acid molecule。Such as, multiple copies of cell target nucleic acid can in conjunction with to oligonucleotide different on solid support。When multiple target nucleic acids are expanded and checked order, they can include different molecular markers。The number of the molecular marker of same target nucleic acid be may indicate that the number of the copy of cell target nucleic acid。When determining the concentration of cell target nucleic acid, it is determined that the copy number of target nucleic acid may be used for removing amplification bias。
Sequencing data may be used for receptor gene's typing。By target nucleic acid is compared from different cell markings, it may be determined that the copy number change of target nucleic acid and/or concentration。By the concentration of target nucleic acid being compared from different cell markings, sequencing data may be used to determine cell genotype heterogeneity。Such as, the first cell of sample can include the target nucleic acid of high concentration, and the second cell of sample can not include target nucleic acid, maybe can include the target nucleic acid of low concentration, thus the heterogeneity of indicator cells sample。
Determine cell genotype heterogeneity can be used for diagnosing, prognosis and determine course for the treatment of of disease。Such as, if the first cell of sample includes target nucleic acid, but the second cell of sample does not include this target nucleic acid, but including the second target nucleic acid, so can include the genotypic reagent of targeting first (such as, medicine) and the genotypic reagent of targeting second (such as, medicine) course for the treatment of。
In certain embodiments, some sequence type can close and be coupled to DNA or RNA collection of illustrative plates。Such as, φt cell receptor and/or B-cell receptor sequence can be connected to the genome mutation collection of illustrative plates of transcripting spectrum, Microrna collection of illustrative plates or sample (as unicellular)。In certain embodiments, some sequence type can close and be coupled to antigenicity or protein expression profiles。Such as, by by antibodies to surface (such as, comprise the surface of albumen (such as, including the target protein of φt cell receptor and/or the antibody of B-cell receptor sequence)), φt cell receptor and/or B-cell receptor sequence can be closed and be coupled to antigenicity or protein expression profiles。
In certain embodiments, presence or absence sequence (such as, virus sequence) can be closed and is coupled to DNA or RNA collection of illustrative plates。Such as, presence or absence sequence (such as, virus sequence) can close the genome mutation collection of illustrative plates being coupled to transcripting spectrum, Microrna collection of illustrative plates or sample (such as individual cells)。
Test kit
Present disclosure provides the test kit for implementing present disclosure method。It is one or more that test kit can include in the following: microwell array, oligonucleotide and solid support。Test kit can include the reagent for reconstructing and/or dilute oligonucleotide and/or solid support。Test kit can include the reagent for oligonucleotide is conjugated to solid support。Test kit may further include the reagent that one or more are other, and wherein these other reagent can be selected from: lavation buffer solution；Contrast agents, it is used for expanding the amplifing reagent of (such as, carrying out cDNA synthesis and PCR) target nucleic acid and for oligonucleotide being conjugated to the conjugation reagents of solid support。Multiple components of theme test kit in container separately, maybe can be able to be combined in single container。
Test kit can include for using the component of test kit to put into practice the description of these subject methods。Description for practical matter method can record at applicable record media。Such as, description can be printed in substrate (such as paper or plastics etc.)。So, description can be present in test kit as package insert, is present in test kit or (that is, pretends pass with packaging or subpackage) in the label of the container of its component。In certain embodiments, description can be present in suitable computer-readable recording medium (such as, CD-ROM, disk, flash disk etc.) as Electronic saving data file。In certain embodiments, practical illustration book can be not present in test kit, but there is provided the means obtaining description from remote source (such as, via the Internet)。Such as, test kit can include network address, it is possible to checks description and/or can from this website, download description in this network address。As description, the means for obtaining description also record in applicable substrate。
Disclosed here further is test kit for analyzing two or more molecules from two or more samples。Test kit disclosed here can include multiple pearl, primer and enough process the amplification agent of at least about 384 samples。Any one in these samples can include unicellular。Nucleic acid amplification can cause measuring about 1,2,5,10,15,20,25,30,35,40,45,50,55,60,65,70,75,80,85,90,95,100,200,300,400,500,600,700,800,900 or 1000 target nucleic acids in the sample。Nucleic acid amplification can cause measuring about 1000 target nucleic acids in the sample。Nucleic acid amplification can cause measuring about 100 target nucleic acids in the sample。Nucleic acid amplification can cause the total nucleic acid in unicellular middle measurement about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%。Nucleic acid amplification can cause the overall measurement in unicellular to all nucleotide sequences。Nucleic acid amplification can cause by checking order at unicellular middle measurement target nucleic acid sequence。Nucleic acid amplification can cause by array at unicellular middle measurement target nucleic acid sequence。
Amplification agent can include the primer panel fixed。Amplification agent can include at least one pair of customization primer。Amplification agent can include at least one pair of comparison primer。Amplification agent can include at least one pair of house-keeping gene primer。Suitable amplification agent can include PCR premix。Test kit may further include the description for design of primers and optimization。Test kit may further include microwell plate, and wherein this microwell plate can include at least one hole, and wherein distribution has a no more than pearl。Test kit may further include one or more other container。These one or more other containers can include one or more other multiple sample labels。One or more other multiple sample labels in one or more other containers are different from more than first sample label in the first container。These one or more other containers can include one or more other Molecular Identification substance markers。The one or more other Molecular Identification substance markers of the one or more other Molecular Identification substance markers of these one or more other containers and second container is identical。
Method disclosed here and test kit can include using one or more suction pipette head and/or container (such as, pipe, bottle, porous plate, microwell plate, Eppendorf tube, microscope slide, pearl)。In some cases, these suction pipette heads are low associativity suction pipette heads。Alternately, or additionally, these containers can be low associativity container。Low associativity suction pipette head can have the leaching relevant to based on the suction nozzle of silicones and non-low associativity container and/or the subsequent sample degraded of reduction with low associativity container。Compared with non-low associativity suction pipette head and container, low associativity suction pipette head and low associativity container can have the sample of reduction and combine。The example of low associativity suction nozzle includes but not limited to,DeckWorksTM low associativity suction nozzle and the low associativity of AvantPremium suction nozzle with a scale。The non-limiting list of low associativity container includesLow associativity microcentrifugal tube and the low associativity PCR pipe of Cosmobrand and microcentrifugal tube。
Any test kit disclosed here may further include software。Such as, test kit can include the software for analytical sequence (such as bar code or target sequence)。Such as, test kit can include the software for analytical sequence (such as bar code or target sequence), to count uniqueness target molecule (such as, from single celled uniqueness target molecule)。Such as, test kit can include the software for analytical sequence (such as bar code or target sequence), to count uniqueness target molecule (such as, from the uniqueness target molecule of gene (such as, from single celled gene))。
Micropore and microwell array
In some cases, the method for present disclosure provides for making to include the solid support of oligonucleotide and the cells contacting puted together。Contact procedure can carry out from the teeth outwards。Example surface can include micropore, pipe, flask and chip。In some cases, surface includes micropore。In some cases, micropore is a part for microwell array。
The micropore of microwell array can have the size and shape enabling each micropore to comprise at least 1,2,3,4,5,6,7,8,9 or 10 or more cell。Micropore can have the size and shape enabling each micropore to comprise up to 1,2,3,4,5,6,7,8,9 or 10 or more cell。The micropore of microwell array can have the size and shape enabling each micropore to comprise at least 1,2,3,4,5,6,7,8,9 or 10 or more solid support。Micropore can have the size and shape enabling each micropore to comprise up to 1,2,3,4,5,6,7,8,9 or 10 or more solid support。Micropore can include at most a cell and a solid support。Micropore can include at most a cell and two solid supports。Micropore can include at least one cell and an at most solid support。Micropore can include at least one cell and at most two solid supports。
Micropore in microwell array can be horizontally disposed。Micropore can be vertically arranged。Micropore can equidistant or close be equally spaced。Microwell array can have the mark relevant to one or more micropores。Such as, the micropore of microwell array can be divided into multiple groups, and each group is made up of the micropore of defined amount。These groups can be provided on the major surfaces of substrate。The position of each group mark can be provided, so that can be determined。Mark can be detected by naked eyes。Mark can be need the visible mark of optics (such as, fluorescent labeling, designation of emission, UV indicate)。
Microwell array can comprise at least about 96,384,1000,5000,10000,15000,100000,150000,500000,1000000 or 5000000 or more micropore。Microwell array can contain up to about 96,384,1000,5000,10000,15000,100000,150000,500000,1000000 or 5000000 or more micropore。
The shape of micropore can be cylindrical。The shape of micropore can be non-cylindrical, as the polyhedron (such as, parallelepiped, hexagon prism or octagonal column) constituted by multiple, inverted cone, reverse pyramid (fall triangular pyramid, fall quadrangular pyramid, fall pentagonal pyramid, the cone of falling hexagonal or there are many pyramids at seven or more angle)。Micropore can include the shape of two or more combining in these shapes。Such as, it can be partial cylindrical shapes, and remainder has the shape of inverted cone。The shape of micropore can be the shape of the part cutting inverted cone or reverse pyramid top。The mouth of micropore can in the bottom at the top of micropore or micropore。The bottom of micropore can be flat, but curved surface (such as, protrude or cave in) is also possible。Can consider to have to be stored in the cell type in micropore and/or solid substrate (such as, shape, size) to determine the shape and size of micropore。
The diameter of micropore can refer to maximum circle, this maximum circle can inscribe in the flat shape of micropore。The diameter of micropore can be at least about 0.1,0.5,1,2 or 3 times or the more times of the diameter of cell and/or the solid support needing to be included in micropore。The diameter of micropore can be at most about 0.1,0.5,1,2 or 3 times or the more times of the diameter of cell and/or the solid support needing to be included in micropore。The diameter of micropore can be at least about 10%, 20%, 30%, 40% or the 50% or more of the diameter of solid support。The diameter of micropore can be at most about 10%, 20%, 30%, 40% or the 50% or more of the diameter of solid support。The diameter of micropore can be at least about 5,10,15,20,25,30,35,40,45 or 50 microns or more micron。The diameter of micropore can be up to about 5,10,15,20,25,30,35,40,45 or 50 microns or more micron。The diameter of micropore is about 25 microns。In some cases, the diameter of micropore is about 30 microns。In some cases, the diameter of micropore is about 28 microns。
Difference between micro pore volume and solid support volume can be at least about 1x10(-14)m3、1.5x10(-14)m3、1.7x10(-14)m3、2.0x10(-14)m3、2.5x10(-14)m3, or 3.0x10(-14)m3Or it is more。Difference between micro pore volume and solid support volume can be at most about 1x10(-14)m3、1.5x10(-14)m3、1.7x10(-14)m3、2.0x10(-14)m3、2.5x10(-14)m3, or 3.0x10(-14)m3Or it is more。Difference between micro pore volume and solid support volume can be at least about 1x10(-11)L、1.5x10(-11)L、1.7x10(-11)L、2.0x10(-11)L、2.5x10(-11)L or 3.0x10(-11)L or more。Difference between micro pore volume and solid support volume can be at most about 1x10(-11)L、1.5x10(-11)L、1.7x10(-11)L、2.0x10(-11)L、2.5x10(-11)L or 3.0x10(-11)L or more。Fig. 7 illustrates the volume about micropore, solid support and the exemplary statistics of difference between micropore and solid support volume。
The degree of depth of micropore can be at least about 0.1,0.5,1,2,3,4 or 5 times or the more times of the diameter of cell and/or the solid support needing to be included in micropore。The degree of depth of micropore can be at most about 0.1,0.5,1,2,3,4 or 5 times or the more times of the diameter of cell and/or the solid support needing to be included in micropore。The degree of depth of micropore can be at least about 10%, 20%, 30%, 40% or the 50% or more of the degree of depth of solid support。The degree of depth of micropore can be at most about 10%, 20%, 30%, 40% or the 50% or more of the degree of depth of solid support。The degree of depth of micropore can be at least about 5,10,15,20,25,30,35,40,45 or 50 microns or more micron。The degree of depth of micropore can be up to about 5,10,15,20,25,30,35,40,45 or 50 microns or more micron。The degree of depth of micropore can be about 30 microns。The degree of depth of micropore can be about 28 microns。Micropore can be flat or substantially flat。
Microwell array can include the spacing between this some holes。Spacing between this some holes can be at least about 5,10,25,20,25,30,35,40,45 or 50 microns or more micron。Spacing between this some holes can be up to about 5,10,25,20,25,30,35,40,45 or 50 microns or more micron。Spacing between this some holes can be about 15 microns。Spacing between this some holes can be about 25 microns。
Can any position of micropore inwall recessed and protuberance height in there are differences。By forming recessed and protuberance in a part for hole inwall, this hole is treated smooth, it is possible to degree of functionality be added in hole。Micropore inner wall smooth can be made by etching。The vacuum in Etaching device, the type of etching gas, etching step etc. can be properly selected。For example, it is possible to by wet etching or by making micropore inwall become smooth with oxide-film etching combination step of thermal oxidation。Can by functionalized for the inwall of micropore (such as, being functionalized with oligonucleotide, reactive group, functional group)。
Microwell array can be made up of the following: silicon, metal is (such as, aluminum, rustless steel, copper, nickel, chromium, and titanium), PDMS (elastomer), glass, polypropylene, agarose, gelatin, general stream Buddhist nun gram (pluoronic) is (such as, general stream Buddhist nun gram F127), plastics are (such as, the plastics (such as PMMA) of natural hydrophilic), plastics are (such as, PP, COP, COC) and hydrophobicity but hydrophilic elastomer can be treated as (such as, PDMS), hydrogel is (such as, polyacrylamide, alginate) or resin is (such as, polyimides, polyethylene, vinyl chloride, polypropylene, Merlon, acrylic acid and polyethylene terephthalate)。Microwell array can be made up of hydrophobic material。Microwell array can be become hydrophilic material made by hydrophobicity but coated (such as, being processed by oxygen plasma)。Microwell array can by hydrophilic but be applied and become hydrophobic material and make。
Microwell array can be assembled。Microwell array assembles can include obtaining has graphic silicon wafer (such as, the formation schematization post made with SU8 photoresist), and it is hatched with PDMS material, to generate the array in hole via soft lithographic (such as, continuing several hours under 80C)。Such as, uncured PDMS can be liquid。Uncured PDMS can gap between packed column。When being solidified by PDMS by heating, it can become solid, thus generates the array in hole。Optical adhesive (such as, NOA81/NOA63) can be applied to PDMS material (such as, use UV light), to generate the array (such as, multiple arrays) of post。Use and can carry out continuing at least about 1 second, 2 seconds, 3 seconds, 4 seconds, 5 seconds, 6 seconds, 7 seconds, 8 seconds, 9 seconds, 10 seconds or 1 minute, 2 minutes, 3 minutes, 4 minutes or 5 or more minutes。The layer comprising agarose can be applied to optical adhesive。Agarose layer can be at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10% or more agarose。Agarose layer can be up to about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10% or more agarose。Agarose layer can be about 5% agarose。Agarose layer can be arranged on poly-glued membrane (Gelbondfilm) or any hydrophilic substrates, and agarose can be attached to this substrate。It can be at least about 1,2,3,4,5,6,7,8,9,10 minutes or more minutes to hatching of agarose layer on optical surface。Hatching of agarose layer on optical surface can be up to about 1,2,3,4,5,6,7,8,9,10 minutes or more minutes。
In some cases, the method for present disclosure can use the surface not including micropore。Surface can be glass, plastics, metal。Solid support, extracellular matrix, polymer coated surfaces can be used。Surface can not include hole。Surface can include the solid support that spatial arrangement becomes restriction molecule to spread。Present disclosure can occur on a planar surface for the method catching cell and/or cell inclusion。Present disclosure can occur in suspension for the method catching cell and/or cell inclusion。
Cell and sample
The cell of present disclosure can be from animal (such as, the mankind, rat, pig, horse, cow, Canis familiaris L., mice) cell。In some cases, this cell is human cell。Cell can be human foetus's cell。Human foetus's cell can obtain from the mother nourishing fetus。Cell can be from the cell of pregnant mothers。Cell can be from the cell of vertebrates, invertebrates, fungus, archeobacteria or antibacterial。Cell can come from multicellular tissue (such as, organ (such as, brain, liver, lung, kidney, prostate, ovary, spleen, lymph node, thyroid, pancreas, the heart, skeletal muscle, intestinal, larynx, esophagus and stomach), blastocyst)。Cell can be from the cell of cell culture。Cell can be HeLa cell, K562 cell, Ramos cell, hybridoma, stem cell, undifferentiated cell, noble cells, circulating cells, Chinese hamster ovary celI, 3T3 cell, and the like。
In some cases, this cell is cancerous cells。The limiting examples of cancerous cell can include prostate gland cancer cell, breast cancer cell, colon cancer cell, lung carcinoma cell, brain cancer cell and ovarian cancer cell。In some cases, this cell is from cancer (such as, circulating tumor cell)。The limiting examples of cancer can include adenoma (adenoma), adenocarcinoma (adenocarcinoma), squamous cell carcinoma, basal cell carcinoma, small cell carcinoma, maxicell undifferentiated carcinoma, chondrosarcoma and fibrosarcoma。
In some cases, this cell is rare cell。Rare cell can be circulating tumor cell (CTC), circulation epithelial cell (CEC), circulating stem cell (CSC), stem cell, undifferentiated stem cell, cancer stem cell, medullary cell, CFU-GM, foam cell, fetal cell, mesenchymal cell, circulating endothelial cells, circulation endometrial cell, trophocyte, immune system cell (host or graft), connective tissue cell, antibacterial, fungus, or pathogen is (such as, antibacterial or protozoacide), microgranule, cell fragment, protein and nucleic acid, organelle, other cell component are (such as, mitochondrion and core), and virus。
In some cases, this cell is from tumor。In some cases, this tumor is optimum or pernicious。This tumor cell can include transfer cell。In some cases, this cell is from the solid tissue including multiple different cell type (such as, different genotype)。
This cell can include virus, antibacterial, fungus and parasite。Virus can include but not limited to: DNA or RNA animal virus (such as, pico+ribonucleic acid+virus section (such as, poliovirus)), Reoviridae (such as, rotavirus), Togaviridae (such as, encephalitis, yellow fever virus, rubella virus), orthomyxoviridae family (such as, influenza virus), Paramyxoviridae (such as, respiratory syncytial virus, Measles virus, mumps virus, parainfluenza virus), Rhabdoviridae (such as, rabies virus), coronaviridae, bunyaviridae, flaviviridae, filamentous virus section, Arenavirus section, this refined Viraceae and Retroviridae (such as, HTLV (HTLV), HIV (human immunodeficiency virus) (HIV), papovaviridae (such as, human papillomavirus), Adenoviridae (such as, adenovirus), herpetoviridae (such as, herpes simplex virus), and Poxviridae (such as, smallpox virus))。
May be used for the exemplary antibacterial in present disclosure method and can include Actinomedurae, actinomyces israelii, anthrax bacillus, Bacillus cereus, bacillus botulinus, clostridium difficile, bacillus perfringens, clostridium tetani, corynebacterium, enterococcus faecalis, Listeria monoeytogenes, Nocardia, propionibacterium acnes, staphylococcus aureus, staphylococcus epidermidis (Staphylococcusepiderm), Streptococcus mutans, streptococcus pneumoniae and the like。Gram negative bacteria is including, but not limited to cat A Feibo bacterium (Afipiafelis), bacteroid (Bacteriodes), shaft-like Bartonella, bordetella pertussis (Bortadellapertussis), Borrelia burgdoyferi, Borrelia recurrentis, brucella (Brucella), calymmatobacterium granulomatis, Campylobacter, escherichia coli, francisella tularensis, gardnerella vaginalis, bacterium aegyptiacum (Haemophiliusaegyptius), haemophilus ducreyi (Haemophiliusducreyi), hemophilus influenza (Haemophiliusinfluenziae), helicobacter pylori, legionella pneumophilia, leptospira interrogans, Neisseria meningitidis, porphyromonas gingivalis, Si Shi Providence bacterium (Providenciasturti), Pseudomonas aeruginosa, Salmonella enteritidis (Salmonellaenteridis), Salmonella typhi, serratia marcesens, Bo Yide shigella, Streptobacillus moniliformis, streptococcus pyogenes, treponema pallidum, vibrio cholera, Yersinia enterocolitica, Yersinia pestis, and the like。Other antibacterials can include Mycobacterium avium (Myobacteriumavium), Mycobacterium leprae (Myobacteriumleprae), mycobacterium tuberculosis (Myobacteriumtuberculosis), Bartonellahenseiae, chlamydia psittaci, chlamydia trachomatis, Coxiella burnetii, mycoplasma pneumoniae, dermacetor akari, Rickettsia prowazekii, rickettsia rickettsii, Rhizoma Zingiberis Recens parasitosis rickettsia, rickettsia typhi, carbamide decomposes urea substance, Diplococcus pneumoniae, Ehrlichia chaffeensis (Ehrlichiachafensis), enterococcus faecalis, meningococcus, and the like。
Can include but not limited to for the exemplary fungus in the method for present disclosure: aspergillus, mycocandida (Candidae), Candida albicans, Blastomyces coccidioides, cryptococcus (Cryptococci) and combination thereof。
Can include but not limited to for the exemplary parasite in the method for present disclosure: balantidium Coli, Cryptosporidum parvum, cyclospora cayatanesis (Cyclosporacayatanensis), encephalitis Nosema (Encephalitozoa), Entamoeba histolytica (Entamoebahistolytica), Bi Shi intestinal spore worm (Enterocytozoonbieneusi), giardia lamblia, leishmania (Leishmaniae), plasmodium (Plasmodii), toxoplasma gondii, trypanosoma (Trypanosomae), trapezoidal ameba (trapezoidalamoeba), anthelmintic (worms) is (such as, anthelmintic (helminthes)), especially parasitic worm (includes but not limited to that Nematoda is (ascarid (such as, whipworm, ancylostome, pinworm, ascarid (ascarids), filaria (filarids) etc.))), Cestoda is (such as, cestode)。
The sample of present disclosure can be from animal (such as, the mankind, rat, pig, horse, cow, Canis familiaris L., mice) sample。In some cases, sample is human sample。Sample can be human foetus's sample。Human foetus's sample can obtain from the mother nourishing fetus。Sample can be from the sample of pregnant mothers。Sample can be from the sample of vertebrates, invertebrates, fungus, archeobacteria or antibacterial。Sample can come from multicellular tissue (such as, organ (such as, brain, liver, lung, kidney, prostate, ovary, spleen, lymph node, thyroid, pancreas, the heart, skeletal muscle, intestinal, larynx, esophagus and stomach), blastocyst)。Sample can be from the cell of cell culture。
Sample can include multiple cell。Sample can include multiple same kind of cell。Sample can include multiple different types of cell。Sample can include being in multiple cells of same point in cell cycle and/or differentiation path。Sample can include being in multiple cells at difference place in cell cycle and/or differentiation path。Sample can include multiple sample。
The plurality of sample can include at least 5,10,20,30,40,50,60,70,80,90 or 100 or more sample。The plurality of sample can include at least about 100,200,300,400,500,600,700,800,900 or 1000 or more sample。The plurality of sample can include at least about 1000,2000,3000,4000,5000,6000,7000,8000 samples, 9000 or 10,000 samples or 100,000 samples or 1,000,000 or more sample。The plurality of sample can include at least about 10,000 samples。
One or more nucleic acid in first sample can be differently configured from the one or more nucleic acid in the second sample。One or more nucleic acid in first sample can be differently configured from the one or more nucleic acid in multiple sample。These one or more nucleic acid can include being at least about 1 nucleotide, 2 nucleotide, 5 nucleotide, 10 nucleotide, 20 nucleotide, 50 nucleotide, 100 nucleotide, 200 nucleotide, 300 nucleotide, 500 nucleotide, 1000 nucleotide, 2000 nucleotide, 3000 nucleotide, 4000 nucleotide, 5000 nucleotide, 10,000 nucleotide, 100,000 nucleotide, 1, the length of 000,000 nucleotide。
First sample can include one or more cell and the second sample can include one or more cell。One or more cells of the first sample can have the cell type identical with one or more cells of the second sample。One or more cells of the first sample can have different cell types from the one or more different cells of the plurality of sample。Described cell type can be chondrocyte, osteoclast, lipocyte, sarcoplast, stem cell, endotheliocyte or smooth muscle cell。Described cell type can be immune cell type。Described immune cell type can be T cell, B cell, platelet, dendritic cell, neutrophilic granulocyte, macrophage or mononuclear cell。
The plurality of sample can include one or more malignant cells。These one or more malignant cells can derived from tumor, sarcoma or leukemia。
The plurality of sample can include at least one body fluid。This body fluid can include blood, urine, lymph fluid, saliva。The plurality of sample can include at least one blood sample。
The plurality of sample can include at least one cell from one or more biological tissues。One or more biological tissues described can be skeleton, heart, thymus, tremulous pulse, blood vessel, lung, muscle, stomach, intestinal, liver, pancreas, spleen, kidney, gallbladder, thyroid, adrenal gland, mammary gland, ovary, prostate, testis, skin, fat, eye or brain。
This biological tissue can include infected tissue, illing tissue, malignant tissue, calcified tissue or health tissues。
The plurality of sample can come from one or more source。The plurality of sample can come from two or more sources。The plurality of sample can come from one or more experimenter。The plurality of sample can come from two or more experimenters。The plurality of sample can come from same experimenter。This one or more experimenter can come from same species。This one or more experimenter can come from different plant species。This one or more experimenter can be healthy。This one or more experimenter can be subject to the impact of disease, obstacle or disease。The plurality of sample can include the cell being selected from lower group of source: mammal, antibacterial, virus, fungus or plant。These one or more samples can come from the mankind, horse, cow, chicken, pig, rat, mice, monkey, rabbit, Cavia porcellus, sheep, goat, Canis familiaris L., cat, bird, fish, the frog and fruit bat。
The plurality of sample can be obtained parallel。The plurality of sample can be obtained simultaneously。Can sequentially obtain the plurality of sample。Can schedule to last for many years obtaining one or more different samples, the process of 100 years, 10 years, 5 years, 4 years, 3 years, 2 years or 1 year obtains multiple sample。One or more sample can be obtained within about 1 year of the one or more different samples of acquisition。One or more sample can be obtained within obtaining one or more differences 12 months of sample, 11 months, 10 months, 9 months, 8 months, 7 months, 6 months, 4 months, 3 months, 2 months or 1 month。One or more sample can be obtained within 30 days, 28 days, 26 days, 24 days, 21 days, 20 days, 18 days, 17 days, 16 days, 15 days, 14 days, 13 days, 12 days, 11 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days or 1 day of the one or more different samples of acquisition。Obtaining about 24 hours, 22 hours, 20 hours, 18 hours, 16 hours, 14 hours, 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 2 hours of one or more different sample or one or more sample can be obtained within an hour。One or more sample can be obtained within about 60 seconds, 45 seconds, 30 seconds, 20 seconds, 10 seconds, 5 seconds, 2 seconds or 1 second of the one or more different samples of acquisition。Can obtain one or more different samples less than 1 second within obtain one or more sample。
Target molecule
Method disclosed herein and test kit can be used for molecule is carried out random labelling。This quasi-molecule includes but not limited to polynucleotide and polypeptide。As used herein, term " polynucleotide " and " nucleic acid molecules " refer to the polymerized form of the nucleotide of any length, this nucleotide can be ribonucleotide, deoxyribonucleotide, locked nucleic acid (LNA) or peptide nucleic acid(PNA) (PNA), it comprises purine and pyrimidine bases or other natural, chemical or biochemical modification, non-natural or derivative nucleotide bases。" polynucleotide " or " nucleic acid molecules " can be made up of single core thuja acid or base pair。Alternately, " polynucleotide " or " nucleic acid molecules " comprise two or more nucleotide or base pair。Such as, " polynucleotide " or " nucleic acid molecules " comprise at least about 2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,30,40,50,60,70,80,90,100,200,300,400,500,600,700,800,900 or 1000 nucleotide or base pairs。In another example, these polynucleotide comprise at least about 1500,2000,2500,3000,3500,4000,4500,5000,5500,6000,6500,7000,7500,8000,8500,9000,9500 or 10000 nucleotide or base pairs。The main chain of polynucleotide can comprise sugar and phosphate group (as generally can seen in RNA or DNA) or modified or replace sugar or phosphate group。Polynucleotide can comprise modified nucleotide, such as methylated nucleotide and nucleotide analog。The sequence of nucleotide can be interrupted by non-nucleotide components。Therefore, term " nucleoside ", " nucleotide ", " deoxynucleoside " and " Deoxydization nucleotide " generally includes analog, for instance those described herein analog。These analog are that those have the molecule of some common architectural features with naturally occurring nucleoside or nucleotide, so that when it is incorporated to nucleic acid or oligonucleotides sequence, they can with the naturally occurring nucleic acid array hybridizing in solution。Under normal circumstances, these analog obtain from naturally occurring nucleoside and nucleotide are derivative by base, ribose or phosphodiester moiety are replaced and/or are modified。Change can be customized, to make heterozygote form stable or destabilization or the specificity of enhancing and complementary nucleic acid sequences hybridization as required。In some cases, these molecules are DNA, RNA or DNA-RNA heterozygotes。These molecules can be strand or double-strand。In some cases, these molecules are RNA molecule, such as mRNA, rRNA, tRNA, ncRNA, lncRNA, siRNA, microRNA or miRNA。These RNA molecule can be polyadenylation。Alternately, these mRNA molecules are not polyadenylations。Alternately, these molecules are DNA moleculars。These DNA moleculars can be genomic DNA。These DNA moleculars can comprise exon, intron, untranslated region or its combination in any。In some cases, these molecules are the panels of molecule。
Method disclosed herein can be used for identical or almost identical molecule and/or the different molecular that labelling randomly individually occurs with test kit。In some cases, method disclosed herein can be used for the identical or almost identical molecule of labelling randomly (such as, molecule comprises identical or almost identical sequence) with test kit。Such as, molecule to be marked comprises the sequence identity of at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%。Almost identical molecule can differ less than about 100,90,80,70,60,50,40,30,25,20,25,10,9,8,7,6,5,4,3,2 or 1 nucleotide or base pairs。In multiple samples, the multiple nucleic acid in one or more samples can include two or more identical sequences。In multiple samples one or more at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97% or 100% total nucleic acid can include identical sequence。In multiple samples, the multiple nucleic acid in one or more samples can include at least two difference sequence。In multiple samples one or more at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% total nucleic acid can include at least two difference sequence。In some cases, molecule to be marked is variant each other。Such as, molecule to be marked can comprise single nucleotide polymorphism or other kinds of sudden change。In another example, molecule to be marked is splice variant。In some cases, at least one molecule of labelling randomly。In other circumstances, randomly labelling at least 2,3,4,5,6,7,8,9 or 10 identical or almost identical molecules。Alternately, randomly labelling at least 20,30,40,50,60,70,80,90,100,200,300,400,500,600,700,800,900 or 1000 identical or almost identical molecules。In other cases, labelling at least 1500 randomly；2,000；2500；3,000；3500；4,000；4500；5,000；6,000；7,000；8,000；9,000；Or 10000 identical or almost identical molecules。In other cases；Labelling at least 15,000 randomly；20,000；25,000；30,000；35,000；40,000；45,000；50,000；60,000；70,000；80,000；90,000；Or 100,000 identical or almost identical molecules。
In other circumstances, method disclosed herein can be used for the molecule that labelling randomly is different with test kit。Such as, molecule to be marked includes less than 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1% sequence identity。Different molecules can differ at least about 1,2,3,4,5,6,7,8,9,10,15,20,25,30,40,50,60,70,80,90,100 or more nucleotide or base pair。In some cases, at least one molecule of labelling randomly。In other circumstances, randomly labelling at least 2,3,4,5,6,7,8,9 or 10 different molecules。Alternately, randomly labelling at least 20,30,40,50,60,70,80,90,100,200,300,400,500,600,700,800,900 or 1000 different molecules。In other cases, labelling at least 1500 randomly；2,000；2500；3,000；3500；4,000；4500；5,000；6,000；7,000；8,000；9,000；Or 10000 different molecules。In other cases；Labelling at least 15,000 randomly；20,000；25,000；30,000；35,000；40,000；45,000；50,000；60,000；70,000；80,000；90,000；Or 100,000 different molecules。
Different molecular to be marked can be present in sample with variable concentrations or amount。Such as, in sample the concentration of a kind of molecule or amount more than the concentration of another kind of molecule or amount。In some cases, in sample, the concentration of at least one molecule or amount are at least about 1.5,2,3,4,5,6,7,8,9,10,11,12,13,14,15,20,25,30,35,40,45,50,60,70,80,90 or 100 times or the more timess of the concentration of at least another kind of molecule in this sample or amount。In some cases, in sample, the concentration of at least one molecule or amount are at least about 1000 times or the more timess of the concentration of at least another kind of molecule in this sample or amount。In another example, in sample the concentration of a kind of molecule or amount less than the concentration of another kind of molecule or amount。In sample the concentration of at least one molecule or amount can than in this sample the concentration of at least another kind of molecule or measure low at least about 1.5,2,3,4,5,6,7,8,9,10,11,12,13,14,15,20,25,30,35,40,45,50,60,70,80,90 or 100 times or more times。In sample the concentration of at least one molecule or amount can than in this sample the concentration of at least another kind of molecule or measure low at least about 1000 times or more times。
In some cases, molecule to be marked is in one or more sample。Molecule to be marked can be in two or more samples。These two or more individual sample can comprise not commensurability or concentration molecule to be marked。In some cases, in a sample, the concentration of a kind of molecule or amount can more than the concentration of same molecular in different samples or amounts。Such as, blood sample is likely to the specific molecular containing amount higher compared with urine samples。Alternately, a sample is divided into two or more subsamples。Subsample can contain not commensurability or concentration same molecule。In one sample, the concentration of at least one molecule or amount can be at least about 1.5,2,3,4,5,6,7,8,9,10,11,12,13,14,15,20,25,30,35,40,45,50,60,70,80,90 or 100 times or the more timess of the concentration of same molecular in another sample or amount。Alternately, in a sample, the concentration of a kind of molecule or amount are smaller than concentration or the amount of same molecular in different sample。Such as, heart tissue sample is likely to the specific molecular containing amount higher compared with lung tissue sample。In one sample, the concentration of at least one molecule or amount can than the concentration of same molecular in another sample or measure low at least about 1.5,2,3,4,5,6,7,8,9,10,11,12,13,14,15,20,25,30,35,40,45,50,60,70,80,90 or 100 times or more times。In some cases, the variable concentrations of two or more different sample Middle molecule or amount are referred to as sample variation。
Method disclosed here and test kit may be used for analyzing two or more molecules from two or more samples。Two or more molecules can include two or more peptide species。The method can include determining that the identity of two or more labeled polypeptide。Determine that the identity of two or more labeled polypeptide can include mass spectrography。The method may further include the labeled polypeptides in combination of the labeled polypeptide of the first sample and the second sample。Labeled polypeptide can be combined before determining the number of different labeled polypeptide。The method may further include the first sample labeling polypeptide and the second sample labeling polypeptides in combination。The first sample labeling polypeptide and the second sample labeling polypeptide can be combined with the plurality of Molecular Identification substance markers before contacting。Determine that the number of different labeled polypeptide can include at least some of of the labeled polypeptide of detection。That detects labeled polypeptide can include at least some of of detection sample label, Molecular Identification substance markers, polypeptide or their combination at least partially。
As it is used herein, term " polypeptide " refers to the molecule comprising at least one peptide。In some cases, this polypeptide is made up of single peptide。Alternately, this polypeptide comprises two or more peptides。Such as, this polypeptide comprises at least about 2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,30,40,50,60,70,80,90,100,200,300,400,500,600,700,800,900 or 1000 peptides。The example of polypeptide includes but not limited to, aminoacid, protein, peptide, hormone, oligosaccharide, lipid, glycolipid, phospholipid, antibody, enzyme, kinases, receptor, transcription factor and part。
Experimenter
Method disclosed here and test kit can include using the cell from one or more experimenters or sample。Experimenter can be the mankind or nonhuman subjects。Experimenter can be alive。Experimenter can be dead。Experimenter can be the mankind looked after by nursing staff (such as, medical profession)。Experimenter doubtful can suffer from disease。Experimenter can suffer from disease。Experimenter can have the symptom of disease。Experimenter can be to provide the experimenter of one or more sample。Experimenter can be mammal, reptile, Amphibian and/or bird。Experimenter can be non-human primate。
Enzyme
Method disclosed here and test kit can include one or more enzymes。The example of enzyme includes but not limited to ligase, reverse transcriptase, polymerase and restriction nuclease enzyme。In some cases, label oligonucleotide includes using one or more ligases with the attachment of molecule。The example of ligase includes but not limited to DNA ligase (such as DNA ligase I, DNA ligase III, DNA ligase IV and T4DNA ligase) and RNA ligase (such as T4RNA ligase I and T4RNA ligase II)。
Method disclosed here and test kit may further include one or more reverse transcriptases of use。In some cases, this reverse transcriptase is HIV1-RT, M-MLV reverse transcriptase, AMV reverse transcriptase and reverse transcriptase of telomere。In some cases, this reverse transcriptase is M-MLV reverse transcriptase。
In some cases, method disclosed herein and test kit include using one or more polymerases。The example of polymerase includes but not limited to archaeal dna polymerase and RNA polymerase。In some cases, this archaeal dna polymerase is DNA polymerase i, DNA polymerase i I, DNA polymerase i II holoenzyme and DNA polymerase i V。Commercially available archaeal dna polymerase includes but not limited to: Bst2.0DNA polymerase, Bst2.0WarmStartTMArchaeal dna polymerase, BstDNA polymerase, sulfolobus solfataricus DNA polymerase i V, Taq DNA polymerase, 9 ° of NTMMDNA polymerase, DeepVentRTM(exo-) archaeal dna polymerase, DeepVentRTMArchaeal dna polymerase, HemoKlenTaqTM、Taq DNA polymerase,Archaeal dna polymerase,Archaeal dna polymerase, Q5TMHigh fidelity archaeal dna polymerase, TherminatorTMγ archaeal dna polymerase, TherminatorTMArchaeal dna polymerase, TherminatorTMIIDNA polymerase, TherminatorTMIIIDNA polymerase,Archaeal dna polymerase,(exo-) archaeal dna polymerase, BsuDNA polymerase, phi29DNA polymerase, T4DNA polymerase, T7DNA polymerase, terminal transferase,Taq polymerase, KAPATaqDNA polymerase and KAPATaq thermal starting archaeal dna polymerase。
Alternately, this polymerase is RNA polymerase, for instance rna plymerase i, rna plymerase ii, rna plymerase iii, poly-(A) polymerase of escherichia coli, phi6RNA polymerase (RdRP), Poly (U) polymerase, SP6RNA polymerase and t7 rna polymerase。
In some cases, method disclosed herein and test kit comprise one or more restriction endonucleases。This restriction endonuclease includes I type, II type, type III and IV type restriction endonuclease。In some cases, I type enzyme is compound, many subunits, the associativity restricted and modified enzyme at the random cutting DNA in position away from its recognition sequence。Generally, II type enzyme is near its recognition sequence or the defined location cutting DNA in its recognition sequence。They can produce discrete restriction fragment and unique gel banding pattern pattern。Type III enzyme is also restricted and modified enzyme big, associativity。They generally cut beyond its recognition sequence, and are likely to need two sections of these type of sequences in the opposite direction in same DNA molecular to complete cutting；They seldom carry out catapepsis。In some cases, IV type enzyme identification modified, be generally methylated DNA, and can be illustrated by colibacillary McrBC and Mrr system。
Other reagent
Method disclosed here and test kit can include using one or more reagent。The example of this reagent includes but not limited to PCR reagent, connects reagent, reverse transcription reagents, enzyme reagent, hybridizing reagent, sample preparation reagents and the reagent for nucleic acid purification and/or separation。
Method disclosed here and test kit can include using one or more buffer。The example of buffer includes but not limited to lavation buffer solution, connects buffer, hybridization buffer, amplification buffer and RT Buffer。In some cases, hybridization buffer is commercially available buffer, such as TMACHyb solution, SSPE hybridization solution and ECONOTM hybridization buffer。Buffer disclosed herein can comprise one or more detergents。
Method disclosed here and test kit can include using one or more carriers。Carrier can improve or improve the efficiency of one or more reactions (such as, coupled reaction, reverse transcription, amplification, hybridization) disclosed herein。Carrier can reduce or prevent molecule or the non-specific loss of its any product (such as, labeled molecule, labeled cDNA molecule, labeled amplicon)。Such as, described carrier can reduce the non-specific loss that labeled molecule causes by being adsorbed to surface。Described carrier can reduce molecule, labeled molecule or its any product to surface or substrate (such as, container, Eppendorf tube (eppendorftube), pipette tip) affinity。Alternately, described carrier can increase molecule or its any product to surface or substrate (such as, beadlet, array, glass, microscope slide, chip) affinity。Carrier can protect molecule or its any product not to degrade。Such as, carrier can protect RNA molecule or its any product not by ribonuclease degradation。Alternately, carrier can protect DNA molecular or its any product not to be degraded by DNase。The example of carrier includes but not limited to nucleic acid molecules (such as DNA and/or RNA) or polypeptide。The example of DNA vector includes DNA and the DNA oligonucleotide of plasmid, carrier (vector), polyadenylation。The example of RNA carrier includes the RNA of polyadenylation, phage rna, MS2 phage rna, e. coli rna, yeast rna, yeast tRNA, mammalian rna, mammal tRNA, the synthetic kernel ribotide of short polyadenylation and RNA oligonucleotide。RNA carrier can be the RNA of polyadenylation。Alternately, RNA carrier can be the RNA of non-polyadenylation。In some cases, this carrier is from antibacterial, yeast or virus。Such as, this carrier can be derived from nucleic acid molecules or the polypeptide of antibacterial, yeast or virus。Such as, this carrier originates from the protein of bacillus subtilis。In another example, this carrier originates from colibacillary nucleic acid molecules。Or, this carrier originates from nucleic acid molecules or the peptide of mammal (such as, people, mice, goat, rat, cattle, sheep, pig, Canis familiaris L. or rabbit), birds, Amphibian or reptile。
Method disclosed here and test kit can include using one or more placebies。Placebo can include control oligonucleotide, inactive enzyme, non-specific competitors。Alternately, placebo includes clear hybridization, the comparison of clear probe, comparison nucleic acid-templated, doped, pcr amplification comparison。Pcr amplification comparison can be positive control。In other cases, pcr amplification comparison is negative control。Nucleic acid-templated comparison can have known concentration。Placebo can comprise one or more labelling。
Doped comparison can be incorporated into the template in reaction or sample。Such as, doped template can be joined in amplified reaction。In any time after first amplification cycles, doped template can be joined in amplified reaction。In some cases, after the 2nd, the 3rd, the 4th, the 5th, the 6th, the 7th, the 8th, the 9th, the 10th, the 11st, the 12nd, the 13rd, the 14th, the 15th, the 20th, the 25th, the 30th, the 35th, the 40th, the 45th or the 50th amplification cycles, doped template is joined in amplified reaction。Can in the end doped template be joined in amplified reaction by any time before an amplification cycles。Doped template can comprise one or more nucleotide or nucleic acid base pair。Doped template can comprise DNA, RNA or its combination in any。Doped template can comprise one or more labelling。
Detectable label
Method disclosed herein, test kit and compositions can comprise detectable label further。Term " detectable label ", " label " or " labelling " can be used interchangeably and refer to any chemical part being attached to molecule (such as, nucleotide, nucleotide polymer or nucleic acid binding factor, molecular bar code)。Chemical part can covalently be attached to molecule。Chemical part can noncovalently be attached to molecule。Molecular bar code, sample label and Molecular Identification substance markers may further include detectable label, label or tag。Preferably, this labelling is detectable, and to make nucleotide or nucleotide polymer be detectable for the implementer of the present invention。The detectable label used can be combined include with method disclosed herein, for instance, fluorescent labeling, chemiluminescent labeling, quencher, radioactive label, biotin, pyrene part, gold or their combination。The limiting examples of detectable label includes light emitting molecule, fluorescent dye, fluorescence quenching, coloured molecule, radiosiotope or scintillator。
In some cases, method disclosed herein farther includes one or more detectable labels are attached to molecular bar code, Molecular Identification substance markers, sample label, labeled nucleic acid or its any product (such as, labeled amplicon)。The method can include that two or more are planted detectable label and be attached to molecular bar code, Molecular Identification substance markers, sample label or labeled nucleic acid。Alternately, the method includes at least about 3,4,5,6,7,8,9 or 10 kind of detectable label are attached to molecular bar code, Molecular Identification substance markers, sample label or labeled nucleic acid。In some cases, detectable label is CyTM labelling。This CyTM labelling is Cy3 labelling。Alternately, or additionally, detectable label is biotin。In certain embodiments, detectable label being attached to probe, this probe combines to molecular bar code, Molecular Identification substance markers, sample label or labeled nucleic acid。This can such as occur after by nucleic acid or labeled nucleic acid and hybridization array。In an example, nucleic acid or labeled nucleic acid are combined with its gametophyte on array。After the coupling, be combined in combinations with the probe of this labeled nucleic acid molecule on array。Multiple probe and labelling can be used to repeat this process, to reduce the probability producing signal due to the non-specific binding of labelling and array or the non-specific binding of molecule and array。
Donor Acceptor pair can serve as detectable label。Donor or receptor can be attached to the probe of bind nucleic acid。This probe is it may be that for example, it is possible to the nucleic probe being combined with nucleic acid or labeled nucleic acid。Corresponding donor or receptor can be added to produce signal。
In some cases, detectable label be free dyestuff (Freedomdye), Dyestuff (AlexaDye), CyTM dyestuff, fluorescein(e) dye or LI-CORIn some cases, free dyestuff (Freedomdye) is fluorescein (6-FAMTM, 6-CF 5(6)-Carboxyfluorescein), MAX (NHS ester), TYETM563, TEX615, TYETM665, TYE705。Detectable label can be A Likesa fluorescent dye。 The example of dyestuff includes488 (NHS esters), 532 (NHS esters),546 (NHS esters),594 (NHS esters),647 (NHS esters),660 (NHS esters) or750 (NHS esters)。Alternately, detectable label is CyTM dyestuff。The example of CyTM dyestuff includes but not limited to Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5 and Cy7。In some cases, detectable label is fluorescein(e) dye。The limiting examples of fluorescein(e) dye includes 6-FAMTM (azide), 6-FAMTM (NHS ester), fluorescein dT, JOE (NHS ester), TETTM and HEXTM。In some cases, detectable label is LI-CORSuch as 5 '700、5’800 or800CW (NHS ester)。In some cases, detectable label is TYETM563。Alternately, detectable label is Cy3。
Detectable label can be rhodamine (Rhodamine) dyestuff。The example of rhodamine includes but not limited to, Rhodamine G reenTM-X (NHS ester), TAMRATM, TAMRATM (NHS ester), rhodamine RedTM-X (NHS ester), ROXTM (NHS ester) and 5 ' TAMRATM (azide)。In other cases, detectable label is Wei Erruide (WellRED) dyestuff。Wei Erruide dyestuff includes but not limited to, Wei Erruide D4 dyestuff, Wei Erruide D3 dyestuff and Wei Erruide D2 dyestuff。In some cases, detectable label is -X(Texas-X) (NHS ester),640(640) (NHS ester) or Dy750 (NHS ester)。
In some cases, detectable label includes linkers。The example of linkers includes but not limited to, biotin, Avidin, Streptavidin, HRP, protein A, Protein G, antibody or its fragment, Grb2, polyhistidine, Ni2+, FLAG label, myc label。Alternately, detectable label includes heavy metal, electron donor/receptor, acridinium ester, dyestuff and calorimetric substrate。In other cases, detectable label include enzyme, such as alkali phosphatase, peroxidase and luciferase。
The change of quality is considered a kind of detectable label, as the situation of surface plasma body resonant vibration detection。Those skilled in the art will easily confirm the NM useful detectable label of this paper that can use in the operation of the present invention。
In some cases, detectable label uses together with primer。Such as, universal primer adopts detectable label to carry out labelling (such as, the universal primer of the universal primer of Cy3 labelling, fluorogen labelling)。Alternately, target specific primer adopts detectable label to carry out labelling (such as, the target specificity primer of TYE563 labelling)。In other cases, detectable label uses together with sample label or Molecular Identification substance markers。Such as, label oligonucleotide adopts detectable label to carry out labelling (such as, biotin labeled label oligonucleotide)。In other cases, detectable label uses together with nucleic acid template molecules。Detectable label may be used for detecting labeled molecule or labeled amplicon。Alternately, detectable label is used for detecting nucleic acid template molecules。
In some cases, detectable label is attached to the nucleic acid of primer, molecular bar code, sample label, Molecular Identification substance markers, labeled molecule, labeled amplicon, probe, HCR probe and/or un-marked。Method for detectable label is attached to the nucleic acid of primer, label oligonucleotide, labeled molecule, labeled amplicon and/or un-marked includes but not limited to chemical labeling method and enzyme labelling method。In some cases, detectable label is attached by chemical labeling method。In certain embodiments, chemical labeling techniques comprises chemically reactive group。The limiting examples of reactive group includes amine reactivity succinimide ester (such as NHS-fluorescein or NHS-rhodamine), amine reactivity isocyanate derivative (including FITC) and sulfydryl reactivity maleimide activation fluorescent agent (such as fluorescein-5-maleimide)。In certain embodiments, the reaction of any of above chemically-reactive dyes and another molecule causes being formed stable covalent bond between fluorogen and joint and/or reagent。In certain embodiments, reactive group is isothiocyanate。In certain embodiments, by the primary amine of lysine side-chain, labelling is attached to reagent。In certain embodiments, chemical labeling method includes NHS-ester chemical method。
Alternately, detectable label is attached by enzyme labelling method。Enzyme labelling method can include but not limited to, biotin acceptor peptide/biotin ligase (AP/BirA), acyl carrier protein/phosphopantetheine transferring enzyme (ACP/PPTase), people O6-alkylguanine transferring enzyme (hAGT), Q-label/T-5398 (TGase), aldehyde label/formylglycine generate enzyme, the protokaryon dehalogenase (HaloTagTM) of sudden change and farnesylation motif/protein act farnesyl transferase enzyme (PFTase) method。Affinity labelling can include but not limited to, uses non-covalent approach and the metal-process for sequestration of the Phe36Val mutant (FKBP12 (F36V)) of dihydrofolate reductase (DHFR) and FKBP12。
Cross-linking reagent can be used for being attached to detectable label the nucleic acid of primer, label oligonucleotide, labeled molecule, labeled amplicon and/or un-marked。In some cases, cross-linking reagent is glutaraldehyde。Glutaraldehyde can react with amine groups, to form crosslinking by several approach。Such as, under the reducing conditions, the aldehyde at glutaraldehyde two ends with amine coupling thus forming secondary amine and being connected。
In some cases, detectable label includes periodate activation and follow-up reduction amination with the attachment of the nucleic acid of primer, label oligonucleotide, labeled molecule, labeled amplicon and/or un-marked。In some cases, sulfo group-SMCC or other allos bi-functional cross-linking agents are for the nucleic acid coupling by detectable label with primer, label oligonucleotide, labeled molecule, labeled amplicon and/or un-marked。Such as, sulfo group-SMCC is for by enzyme and drug coupling。In certain embodiments, carry out enzyme in one step activating and purification, then in the second step with drug coupling。In certain embodiments, the directivity of crosslinking is defined to a specific direction (sulfydryl on such as, from the amine enzyme to antibody)。
Disease/disease
Disclosed herein is for the disease of experimenter or the state of disease or result are diagnosed, monitor and/or the method for prognosis, test kit and compositions。Generally, the method includes: two or more molecules from two or more samples are carried out random labelling by (a), to generate two or more labeled nucleic acid；(b) detection and/or quantitatively these two or more labeled nucleic acid；And (c) based on the detection of nucleic acid that two or more are labeled to this and/or quantitatively, the disease of experimenter or the state of disease or result are diagnosed, monitor and/or prognosis。The method may further include determines therapeutic scheme。These two or more samples can include the one or more samples from the experimenter suffering from disease or disease。These two or more samples can include the one or more samples from health volunteer。These two or more samples can include the one or more samples from comparison。
Monitoring of diseases or disease may further include and therapeutic scheme is monitored。Therapeutic scheme is monitored can include determining that the curative effect of therapeutic scheme。In some cases, it is monitored therapeutic scheme including using, terminates, adds or change therapeutic scheme。Change therapeutic scheme can include increasing or reducing the dosage of therapeutic scheme, administration frequency or administering mode。Therapeutic scheme can comprise one or more medicines。This medicine can be anticarcinogen, antiviral agents, antimicrobial drug, antipathogen medicine or their combination in any。
Cancer
In some cases, this disease or disease are cancers。Pending random labeled molecule can come from cancerous cell or tissue。In some cases, this cancer is sarcoma, cancer, lymphoma or leukemia。Sarcoma is the cancer of bone, cartilage, fat, muscle, blood vessel or other connective tissues or supportive tissue。Sarcoma includes but not limited to, osteocarcinoma, fibrosarcoma, chondrosarcoma, Ewing's sarcoma, malignant angioendothelioma, malignant schwannoma, bilateral vestibular schwannomas, osteosarcoma, soft tissue sarcoma is (such as, alveolar soft part sarcoma, angiosarcoma, cystosarcoma phylloides, dermatofibrosarcoma, fibroma durum, epithelioid sarcoma, the outer osteosarcoma of bone, fibrosarcoma, hemangiopericytoma, angiosarcoma, Kaposi sarcoma, leiomyosarcoma, liposarcoma, lymphangiosarcoma, lymphosarcoma, malignant fibrohistiocytoma, neurofibrosarcoma, rhabdomyosarcoma and synovial sarcoma)。
Epithelial cancer is to start with the cancer of epithelial cell (namely cover body surface, produce hormone and constitute the cell of body of gland)。As limiting examples, epithelial cancer cancer includes breast carcinoma, cancer of pancreas, pulmonary carcinoma, colon cancer, colorectal cancer, rectal cancer, renal carcinoma, bladder cancer, gastric cancer, carcinoma of prostate, hepatocarcinoma, ovarian cancer, the brain cancer, cancer of vagina, carcinoma vulvae, uterus carcinoma, mouth cancer, carcinoma of penis, carcinoma of testis, esophageal carcinoma, skin carcinoma, carcinoma of fallopian tube, head and neck cancer, gastro-intestinal stromal cancer, adenocarcinoma, skin or ophthalmic melanoma, anal field cancer, carcinoma of small intestine, endocrine system cancers, thyroid carcinoma, parathyroid carcinoma, adrenal carcinoma, carcinoma of urethra, carcinoma of renal pelvis, carcinoma of ureter, carcinoma of endometrium, cervical cancer, hypophysis cancer, central nervous system (CNS) tumor, primary central nervous system lymphoma, brain stem glioma and vertebra axle tumor。In some cases, this cancer is skin carcinoma, for instance basal cell carcinoma, squamous cell carcinoma, melanoma, non-black melanoma or actinicity (solar lentigines) keratosis。
In some cases, this cancer is pulmonary carcinoma。Pulmonary carcinoma can begin at air flue (trachea is diverged for the ballonet (alveolar) answering lung (bronchus) or lung by air flue)。Pulmonary carcinoma includes nonsmall-cell lung cancer (NSCLC), small cell lung cancer and mesothelioma。The example of NSCLC includes squamous cell carcinoma, adenocarcinoma and large cell carcinoma。Mesothelioma can be the cancerous tumour of the liner (peritoneum) in the liner (pleura) in lung and thoracic cavity or abdominal cavity。Mesothelioma is likely due to asbestos and exposes initiation。This cancer can be the brain cancer, for instance glioblastoma multiforme。
Alternately, this cancer can be central nervous system (CNS) tumor。Cns tumor can be classified as glioma or non-glioma。Glioma can be glioblastoma, high-grade glioma, dispersivity endogenous pons glioma。Gliomatous example includes astrocytoma, Oligodendroglioma (or mixing of Oligodendroglioma and astrocytoma composition) and ependymoma。Astrocytoma includes but not limited to, low astrocytoma, human anaplastic astrocytoma, glioblastoma multiforme, pilocytic astrocytoma, pleomorphic xanthoastrocytoma and subependymal giant cell astrocytoma。Oligodendroglioma includes low Oligodendroglioma (or few astrocytoma) and anaplastic Oligodendroglioma。Non-glioma includes meningioma, pituitary adenoma, primary central nervous system lymphoma and medulloblastoma。In some cases, this cancer is meningioma。
Leukemia can be acute lymphoblastic leukemia, acute myeloblastic leukemia, chronic lymphocytic leukemia or chronic myelocytic leukemia。Other kinds of leukemia include hairy cell leukemia, chronic myelomonocytic leukemia and childhood grain-monocytic leukemia。
Lymphoma is lymphocytic cancer, and can form from bone-marrow-derived lymphocyte or T lymphocyte development。Lymphadenomatous two kinds of main Types are Hodgkin lymphoma (being formerly referred to as Hodgkin) and non-Hodgkin lymphoma。The feature of Hodgkin lymphoma is the existence of Reed Sternberg cell (Reed-Sternbergcell)。Non-Hodgkin lymphoma is the lymphoma that all that is not belonging to Hodgkin lymphoma。Non-Hodgkin lymphoma can be indolent lymphoma and aggressive lymphomas。Non-Hodgkin lymphoma includes but not limited to, diffusivity large B cell lymphoid tumor, follicular lymphoma, lymphoma mucosa associated lymphoid tissue (MALT), minicell lymphocytic lymphoma, lymphoma mantle cell, Burkitt lymphoma, mediastinum large B cell lymphoid tumor, macroglobulinemia Waldenstron (Macroglobulinemia), nodal marginal district B cell lymphoma (NMZL), splenic marginal zone lymphoma (SMZL), extranodal marginal zone B cell lymphoma, intravascular large B cell lymphoma, lymphoma primary effusion and lymphomatoid granulomatosis。
Pathogenic infection
In some cases, this disease or disease are pathogenic infection。Pending random labeled molecule can come from pathogen。This pathogen can be virus, antibacterial, fungus or protozoacide。In some cases, this pathogen can be protozoacide, for instance Acanthamoeba (Acanthamoeba) (such as, Acanthamoeba astronyxis (A.astronyxis), Acanthamoeba castellanii (A.castellanii), Acanthamoeba culbertsoni (A.culbertsoni), A.hatchetti, Acanthamoeba polyphaga (A.polyphaga), A.rhysodes, A.healyi, A.divionensis), Brachiola (such as, B.connori, B.vesicularum), Cryptosporidium (Cryptosporidium) (such as, Cryptosporidum parvum (C.parvum)), Cyclospora belongs to (Cyclospora) (such as, cyclospora cayatanesis (C.cayetanensis)), encephalitis Nosema (Encephalitozoon) (such as, Encephalitozoon cuniculi (E.cuniculi), Helen's encephalitis microsporidian (E.hellem), intestinal encephalitis microsporidian (E.intestinalis)), Entamoeba (Entamoeba) (such as, Entamoeba histolytica (E.histolytica)), intestinal spore Eimeria ((Enterocytozoon) (such as, Bi Shi intestinal spore worm (E.bieneusi)), Giardia (Giardia) (such as, giardia lamblia (G.lamblia)), Isospora (Isospora) (such as, Isospora belli (I.belli)), Nosema (Microsporidium) (such as, Africa microsporidian (M.africanum), M.ceylonensis), Naegleria (Naegleria) (such as, Fu Shi Nai Geli protozoon (N.fowleri)), Nosema (Nosema) (such as, Sargassum microsporozoite (N.algerae), eye microparticle insect (N.ocularum)), Pleistophora (Pleistophora), trachea general spore Eimeria (Trachipleistophora) (such as, the general spore worm (T.anthropophthera) of victimization trachea, the general spore worm (T.hominis) of people's trachea) and cornea Nosema (Vittaforma) (such as, cornea microsporidian (V.corneae))。This pathogen can be fungus, such as mycocandida (Candida), aspergillus (Aspergillus), Cryptococcus (Cryptococcus), Histoplasma (Histoplasma), pneumocystis (Pneumocystis) and Stachybotrys (Stachybotrys)。
This pathogen can be antibacterial。The example of antibacterial includes but not limited to, Bordetella (Bordetella), Borrelia (Borrelia), Brucella (Brucella), campylobacter (Campylobacter), chlamydiaceae (Chlamydia), (Chlamydophila) is belonged to addicted to clothes body, fusobacterium (Clostridium), Corynebacterium (Corynebacterium), Enterococcus (Enterococcus), Escherichia (Escherichia), Francisella (Francisella), Haemophilus spp (Haemophilus), Helicobacterium (Helicobacter), Legionnella (Legionella), Leptospira (Leptospira), Listerial (Listeria), Mycobacterium (Mycobacterium), Mycoplasma (Mycoplasma), eisseria (Neisseria), false unicellular Pseudomonas (Pseudomonas), Dermacentroxenus (Rickettsia), Salmonella (Salmonella), Shigella (Shigella), staphylococcus (Staphylococcus), Streptococcus (Streptococcus), treponema (Treponema), vibrio (Vibrio) or Yersinia (Yersinia)。
This virus can be retrovirus。Retroviral example includes but not limited to single stranded RNA-RT (ssRNA-RT) virus and double-stranded DNA-RT (dsDNA-RT) virus。The limiting examples of ssRNA-RT virus includes retrovirus, α retrovirus, β retrovirus, γ retrovirus, δ retrovirus, ε retrovirus, slow virus, foamy virus (spumavirus), swivel base virus (metavirirus) and pseudovirus。The limiting examples of dsDNA-RT virus includes hepadnavirus (hepadenovirus) and cauliflower mosaic virus。This virus can be DNA viruses。This virus can be RNA viruses。DNA viruses can be double-stranded DNA (dsDNA) virus。In some cases, dsDNA virus is adenovirus, herpesvirus or poxvirus。The example of adenovirus includes but not limited to adenovirus and canine infectious hepatitis virus。The example of herpesvirus includes but not limited to, herpes simplex virus, varicella zoster virus, cytomegalovirus and Epstein-Barr virus。The non-limiting list of poxvirus includes smallpox virus, vaccinia virus, sheep pox virus, monkey pox virus and vaccinia virus。DNA viruses can be single stranded DNA (ssDNA) virus。SsDNA virus can be parvovirus。The example of parvovirus includes but not limited to, assays for parvovirus B 19, Canine Parvovirus, minute parvovirus of mice, pig parvoviral, feline infectious agranulocytosis virus and cats panleucopenia virus。
This virus can be RNA viruses。RNA viruses can be double-stranded RNA (dsRNA) virus, sense single stranded rna virus ((+) ssRNA virus) or antisense single strand RNA virus ((-) ssRNA virus)。The non-limiting catalogue of dsRNA virus includes reovirus, hepato-encephalomyelitis virus, cytoplasmic polyhedrosis virus, rotavirus, blue tongue virus and Phytoreovirus。The example of (+) ssRNA virus includes but not limited to picornavirus and togavirus。The example of picornavirus includes but not limited to, enterovirus, rhinovirus, hepatovirus, cardiovirus, foot and mouth disease virus, poliovirus, picornavirus, equine rhinoviruses, ridge Shen viral, prompt virus and Coxsackie virus。In some cases, togavirus is rubella virus, sindbis alphavirus, eastern equine encephalitis virus, western equine encephalitis virus, Venezuelan equine encephalitis virus, ross river virus, A Niang-Ni Ang virus, chikungunya disease (Chikungunya) or Semliki Forest virus。The non-limiting list of (-) ssRNA virus includes influenza virus and rhabdovirus。The example of influenza virus includes but not limited to influenza A virus, Influenza B virus, influenza virus C, Infectious salmon anaemia virus and thogoto virus。The example of rhabdovirus includes but not limited to matter type rhabdovirus, enlightening road rhabdovirus (dichorhabdovirus), ephemeral fever virus, rabies virus, the outer rhabdovirus of grain and Vesiculovirus。
Fetal abnormality
In some cases, this disease or disease are gestation。Method disclosed herein and test kit can include the fetal stress in the experimenter that diagnosis is conceived。Method disclosed herein and test kit can include differentiating fetus sudden change or genetic abnormality。Pending random labeled molecule can come from fetal cell or tissue。Alternately, or additionally, molecule to be marked can come from the experimenter of pregnancy。
Method disclosed herein and test kit may be used for diagnosis, prediction or monitoring autosome trisomy (such as, 13,15,16,18,21 or No. 22 Trisomy)。In some cases, trisomy can be associated (such as, 15,16 or No. 22 Trisomy) with the miscarriage probability increased。In other cases, the trisomy detected is life birth trisomy, this can be shown that baby will be born with birth defect (such as, No. 13 Trisomy (handkerchief tower syndrome), No. 18 chromosome trisomy (edwards syndrome) and No. 21 chromosome trisomy (mongolism))。Described exception is also likely to be sex chromosomal abnormality (such as, XXY (klinefelter syndrome), XYY (Chris Jacobs Cotard) or XXX (X trisomy))。One or more molecules to be marked may be located on following one or more chromosome: No. 13 chromosomes, No. 18 chromosomes, No. 21 chromosomes, X chromosome or Y chromosome。Such as, described molecule is positioned on No. 21 chromosomes and/or No. 18 chromosomes, and/or on No. 13 chromosomes。
Can include according to the other situation of the fetus that method disclosed herein and test kit are determined: one or more chromosomal monosomy (X chromosome monosomy, it is also referred to as Turner's syndrome), one or more chromosomal trisomy (13, 18, 21 and X chromosome), one or more chromosomal tetrasomy and five body constituents (are most commonly in sex chromosome in the mankind, such as XXXX, XXYY, XXXY, XYYY, XXXXX, XXXXY, XXXYY, XYYYY and XXYYY), haploidy, (every kind of chromosome has three to triploidy, such as, 69 chromosomes in the mankind), (every kind of chromosome has four to tetraploidy, such as, 92 chromosomes in the mankind), pentaploidy and polyploidy。
What disclose further at this is the method for forensic analysis, and the method includes any method described above。Forensic science man is usable in the nucleic acid in the various samples (such as, blood, seminal fluid, skin, saliva, hair) that scene of a crime finds, to differentiate the individuality (such as the offender) existence in spot。This process formally called after DNA analysis but it also may be called " genetic fingerprinting "。Such as, DNA analysis includes measuring and the length of the variable section of repetitive DNA in relatively different samples and people, such as Short tandem repeatSTR and moonlet。For the DNA sample from a people being mated with DNA in the sample found in scene of a crime, this method is technology typically extremely reliably。But, if scene is polluted by the DNA from some people, then discriminating is likely to very complicated。In this case, and in other forensic application, the nucleic acid obtaining absolute quantitation from unicellular or a small amount of cell can be advantageous for。
In some cases, this disease or disease are dysimmunities。Dysimmunity can be inflammatory diseases, autoimmune disorders, irritable bowel syndrome or ulcerative colitis。The example of autoimmune disease includes Crohn disease (Chrohn'sdisease), lupus and Graves' disease (Graves'disease)。
In some cases, this disease or obstacle are sacred disease or obstacle。Sacred disease or obstacle can be acquired epilepsy aphasia (AcquiredEpileptiformAphasia), acute disseminated encephalomyelitis (AcuteDisseminatedEncephalomyelitis), adrenoleukodystrophy (Adrenoleukodystrophy), agenesis of corpus callosum (Agenesisofthecorpuscallosum), agnosia (Agnosia), Ai Kaerdi syndrome (Aicardisyndrome), Alexandria disease (Alexanderdisease), Alpers (Alpers ' disease), alternating hemiplegia (Alternatinghemiplegia), Alzheimer (Alzheimer ' sdisease), amyotrophic lateral sclerosis (Amyotrophiclateralsclerosis) (see motor neuron (MotorNeuronDisease)), congenital anencephaly (Anencephaly), angel people's syndrome (Angelmansyndrome), angiomatosis (Angiomatosis), anoxia (Anoxia), aphasia (Aphasia), apraxia (Apraxia), arachnoid cyst (Arachnoidcysts), arachnoiditis (Arachnoiditis), Arnold-Chiari malformation (Arnold-Chiarimalformation), arteriovenous malformotion (Arteriovenousmalformation), A Si Burger syndrome (Asperger ' ssyndrome), ataxia-telangiectasia (AtaxiaTelangiectasia), attention deficit hyperactivity disorder (AttentionDeficitHyperactivityDisorder), autism (Autism), speech audition processes imbalance (Auditoryprocessingdisorder), dysautonomia (AutonomicDysfunction), backache (BackPain), Deng Shi disease (Battendisease), behcets disease (Behcet ' sdisease), bell's palsy (Bell ' spalsy), optimum Idiopathic blepharospasm (BenignEssentialBlepharospasm), optimum limitation muscular atrophy (BenignFocalAmyotrophy), benign Intracranial Hypertension (BenignIntracranialHypertension), bilateral E Ding district polymicrogyria (Bilateralfrontoparietalpolymicrogyria), subcortical arteriosclerotic encephalopathy (Binswanger ' sdisease), blepharospasm (Blepharospasm), bloch-Sulzberger syndrome (Bloch-Sulzbergersyndrome), brachia plexus injury (Brachialplexusinjury), brain abscess (Brainabscess), brain injury (Braindamage), cerebral trauma (Braininjury), the cerebral tumor (Braintumor), the half side cross-section syndrome (Brown-Sequardsyndrome) of spinal cord, canavan's disease (Canavandisease), wrist tunnel syndrome (Carpaltunnelsyndrome) (CTS), causalgia (Causalgia), central pain syndrome (Centralpainsyndrome), central pontine myelinolysis (Centralpontinemyelinolysis), central nucleus myopathy (Centronuclearmyopathy), head obstacle (Cephalicdisorder), cerebral aneurysm (Cerebralaneurysm), cerebral arteriosclerosis (Cerebralarteriosclerosis), cerebral atrophy (Cerebralatrophy), cerebral gigantism (Cerebralgigantism), middle cerebral artery aneurysm (Cerebralpalsy), charcot marie tooth (Charcot-Marie-Toothdisease), Arnold-Chiari malformation (Chiarimalformation), chorea (Chorea), chronic demyelinating neuritis (Chronicinflammatorydemyelinatingpolyneuropathy) (CIDP), chronic pain (Chronicpain), chronic regional pain syndrome (Chronicregionalpainsyndrome), syndrome (CoffinLowrysyndrome) in coffin-Lao, stupor (Coma) (including persistent vegetable state (PersistentVegetativeState)), composite I deficit syndrome (ComplexIdeficiencysyndrome), composite I deficit syndrome (ComplexIdeficiencysyndrome), Complex II deficit syndrome (ComplexIIdeficiencysyndrome), Complex II I deficit syndrome (ComplexIIIdeficiencysyndrome), complex IV/COX deficit syndrome (ComplexIV/COXdeficiencysyndrome), complex V deficit syndrome (ComplexVdeficiencysyndrome), congenital facial diplegia (Congenitalfacialdiplegia), corticobasal degeneration (Corticobasaldegeneration), cranial arteritis (Cranialarteritis), craniosynostosis (Craniosynostosis), gram refined Er Shi disease (Creutzfeldt-Jakobdisease), accumulation wound imbalance (Cumulativetraumadisorders), Cushing's syndrome (Cushing ' ssyndrome), giant cell inclusion disease (Cytomegalicinclusionbodydisease) (CIBD), cytomegalovirus infection (CytomegalovirusInfection), Dandy-Walker syndrome (Dandy-Walkersyndrome), the gloomy disease in road (Dawsondisease), mitochondrion nadh dehydrogenase component defect (DeficiencyofmitochondrialNADHdehydrogenasecomponentofCom plexI) of composite I, moral Cotard (DeMorsier ' ssyndrome), Dejerine-Klumpke paralysis (Dejerine-Klumpkepalsy), Dejerine Sottas disease (Dejerine-Sottasdisease), delayed sleep phase syndrome (Delayedsleepphasesyndrome), dull-witted (Dementia), dermatomyositis (Dermatomyositis), nerve dyspraxia (NeurologicalDyspraxia), diabetic neuropathy (Diabeticneuropathy), diffusivity scleroderma (Diffusesclerosis), dysautonomia (Dysautonomia), calculate obstacle (Dyscalculia), dysgraphia (Dysgraphia), reading disorder (Dyslexia), myodystonia (Dystonia), the epileptic encephalopathy of premature babies type (Earlyinfantileepilepticencephalopathy), empty sella syndrome (Emptysellasyndrome), encephalitis (Encephalitis), Naoning tablet (Encephalocele), encephalotrigeminal angiomatosis (Encephalotrigeminalangiomatosis), fecal incontinence (Encopresis), epilepsy (Epilepsy), ell Bu Shi paralysis (Erb ' spalsy), erythromelalgia (Erythromelalgia), essential tremor (Essentialtremor), fabry disease (Fabry ' sdisease), Fa Er Cotard (Fahr ' ssyndrome), faint (Fainting), familial spastic paralysis (Familialspasticparalysis), hyperpyrexia convulsion (Febrileseizures), fischer Cotard (Fishersyndrome), the ataxia of Freed Ritchie (Friedreich ' sataxia), FART syndrome (FARTSyndrome), Gao Xieer disease (Gaucher ' sdisease), lattice Stedman syndrome (Gerstmann ' ssyndrome), giant cell arteritis (Giantcellarteritis), giant cell inclusion disease (Giantcellinclusiondisease), sphaerocyst sample leukoencephalopathy (GloboidcellLeukodystrophy), Gray Matter Heterotopia (Graymatterheterotopia), Guillain Barre syndrome (Guillain-Barresyndrome), HTLV-1 type relevant cord sick (HTLV-1associatedmyelopathy), protein spheres pigment regression syndrome (Hallervorden-Spatzdisease), head injury (Headinjury), headache (Headache), hemifacial spasm (HemifacialSpasm), hereditary spastic paraplegia (HereditarySpasticParaplegia), heredopathia atactica polyneuritiformis (Heredopathiaatacticapolyneuritiformis), zoster oticus (Herpeszosteroticus), herpes zoster (Herpeszoster), Hirayamasyndrome, holoprosencephaly (Holoprosencephaly), Huntington's disease (Huntington ' sdisease), hydranencephaly (Hydranencephaly), hydrocephalus (Hydrocephalus), hypercortisolism (Hypercortisolism), histanoxia (Hypoxia), immune-mediated encephalomyelitis (Immune-Mediatedencephalomyelitis), inclusion body myositis (Inclusionbodymyositis), incontinentia pigmenti (Incontine。
Definition
When providing a series of value, it should be understood that each intermediate value, to the tenth unit (unless context clearly additionally indicates) of lower limit, also specifically disclose the value between the upper limit of this scope and lower limit。Between any other statement value or intermediate value in any statement value in stated ranges or intermediate value and this prescribed limit, each less scope is encompassed within the present invention。These small range of upper and lower bounds can be independently include in described scope or get rid of outside it, and each scope (one of two of which limit, neither one or include in described less scope) is also included within the present invention, obeys any limit value being particularly intended to exclude in described scope。When the scope stated includes one or two limit value, the scope of any one or both that eliminate those limit values being included is also included within the present invention。
Unless otherwise defined, whole technical term used herein has the identical meaning being generally understood with the those of ordinary skill within art of the present invention with scientific terminology。Although similar or be equivalent to any method of those methods described here and material and material can be used for practice or the test of the present invention, but presently describe some potential and preferred method and materials。All referred in this openly it is incorporated herein by reference, to disclose in conjunction with cited these are open and to describe these methods and/or material。It should be understood that present disclosure replaces the disclosure of any contradiction of the publication combined。
As being clear that for those skilled in the art, when reading present disclosure, each of the independent embodiment described at this and show has discrete ingredient and feature, and these ingredients and feature can be prone to the character separation with any other some embodiments or combination when not necessarily departing from the scope of the present invention or spirit。Can according to the order of the event described or logically go up method that any other order feasible carries out any narration。
It has to be noticed that unless the context clearly, otherwise as in this and claims institute use, singulative "/one (a/an) " and " being somebody's turn to do " include plural referents。Thus, for instance, include multiple/kind of this type of cell when mentioning " a/kind cell ", and when mentioning " described/this peptide ", include mentioning one or more peptide and known its equivalent (such as, polypeptide) of art technology, etc.。
As used herein, term " labelling " can refer to uniqueness oligonucleotide sequence, and this sequence can allow to identify corresponding nucleic acid base and/or nucleotide sequence。In certain embodiments, nucleic acid base and/or nucleotide sequence may be located at the specific location (polynucleotide such as, being attached on pearl) of more most nucleotide sequence。
As used herein, term " hybridization " can refer to such a process, and two of which single stranded polynucleotide noncovalently combines, to form stable double-stranded polynucleotide。Term " hybridization " can also refer to three chain hybridization。Gained (generally) double-stranded polynucleotide is " heterozygote " or " duplex "。
As used herein, " nucleoside " can include natural nucleus glycoside, such as 2 '-deoxidation and 2 '-OH-form。Can include the nucleoside of synthesis about " analog " of nucleoside, the nucleoside of these synthesis comprises modified base portion and/or modified sugar moieties etc.。Analog can be hybridized。Analog can include the nucleoside of synthesis, and the nucleoside of these synthesis is designed to strengthen binding characteristic, reduces complexity, increases specificity etc.。The analog of exemplary types can include oligonucleotide phosphoramidate (referred to here as " amidate "), peptide nucleic acid(PNA) (referred to here as " PNA "), oligosaccharide-2 '-O-alkylribose nucleotide, C-5 propinyl pyrimidine containing polynucleotide and lock nucleic acid (LNA)。
As used herein, term " nucleic acid molecules ", " nucleotide sequence ", " nucleic acid fragment, " oligonucleotide ", " oligonucleotide fragment " and " polynucleotide " can be used interchangeably and can be intended to include but not limited to; can have the polymer form of the nucleotide of different length, deoxyribonucleotide or ribonucleotide or its analog。Nucleic acid molecules can include single stranded DNA (ssDNA), double-stranded DNA (dsDNA), single stranded RNA (ssRNA) and double-stranded RNA (dsRNA)。Different IPs acid molecule can have different three dimensional structures, and can perform different functions。The limiting examples of nucleic acid molecules can include gene, genetic fragment, genome gap (genomicgap), exon, intron, intergenic DNA (includes, but be not limited to, heterochromatic dna), messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozyme, siRNA (siRNA), miRNA, small nucleolar RNA (snoRNA), cDNA, recombination of polynucleotide, branched polynucleotides, plasmid, carrier, the DNA of separation of sequence, the RNA of separation of sequence, nucleic probe and primer。
Oligonucleotide can refer to the linear polymer of the natural or modified nucleoside monomer connected by phosphodiester bond or its analog。" oligonucleotide fragment " refers to the oligonucleotide sequence being cut into two or more more small oligonucleotide sequences。Oligonucleotide can be natural or synthesis。Oligonucleotide can include dezyribonucleoside, ribonucleotide and non-natural analogs (such as its different capitiform formula, peptide nucleic acid(PNA) (PNA)) thereof etc.。It is specific binding to target gene group with the normal mode (base pairing etc. such as the base pairing of Wo Sen-Ke Like (Watson-Crick) type, base stacking, Huo Shi (Hoogsteen) or anti-Huo Shi (reversedHoogsteen) type) that monomer interacts that oligonucleotide can pass through monomer。Oligonucleotide and term " polynucleotide " can be interchangeably used herein。
Unless otherwise noted, when oligonucleotide is represented by a series of letters (such as " ATGCCTG "), it it should be understood that, nucleotide is the order with 5 ' to 3 ' from left to right, and " A " represents deoxyadenosine, and " C " represents deoxycytidine, " G " represents deoxyguanosine, " T " represents deoxyribosylthymine, and " U " represents ribonucleotide, uridnine。
Oligonucleotide can include the nucleotide of one or more non-standard nucleotide, one or more nucleotide analog and/or modification。The example of the nucleotide modified can include but not limited to: diaminopurine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetyl group cytosine, 5-(carboxy hydroxy methyl) uracil, 5-carboxymethyl group amino methyl-2-thio uridine, 5-carboxymethyl group amino methyl uracil, dihydrouracil, β-D-galactosyl pigtail glycosides, inosine, N6-isopentenyl gland purine, 1-methyl guanine, M1I, 2,2-dimethylguanine, 2-methyladenine, 2-methyl guanine, 3-methylcystein, 5-methylcytosine, N6-adenine, 7-methyl guanine, 5-Methylaminomethyl uracil, 5-Methoxyamino methyl-2-paper substrate, β-D-MANNOSE base pigtail glycosides, 5 '-methoxycarbonyloxymethyl uracil, 5-methoxyuracil, 2-methyl thio-D46-isopentenyl gland purine, uracil-5-ethoxyacetic acid (v), bosom fourth glycosides (wybutoxosine), pseudouracil, pigtail glycosides (queosine), 2-sulfo-cytosine, 5-methyl-2-paper substrate, 2-paper substrate, 4-paper substrate, methyl uracil, uracil-5-ethoxyacetic acid methyl ester, uracil-5-ethoxyacetic acid (v), 5-methyl-2-paper substrate, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3) w, oligonucleotide phosphoramidate (referred to here as " amidate "), peptide nucleic acid(PNA) (referred to here as " PNA "), few-2 '-O-alkylribose nucleotide, C-5 propinyl pyrimidine containing polynucleotide, lock nucleic acid (LNA), 2,6-diaminopurine and the like。Nucleic acid molecules can also be modified at base portion (such as, usually forming one or more atom places of hydrogen bond with complementary nucleotide and/or be generally not capable of and one or more atom places of complementary nucleotide formation hydrogen bond), sugar moieties or phosphate backbones place。
As used herein, " sample " can refer to unicellular perhaps many cells。Nucleic acid molecules can obtain from one or more samples。Sample can include the combination of single cell type or two or more cell types。Sample can include the set that can perform the cell (those as such as found in the tissue) of similar functions。Sample can include one or more tissues。The example of tissue can include but not limited to: epithelial tissue is (such as, skin, gland, intestinal, skin and organ are (such as liver, lung, kidney) liner), endothelium is (such as, blood vessel and vasculolymphatic liner), mesothelium is (such as, pleural space, the liner of peritoneal cavity and pericardial cavity), mesenchyme is (such as, fill organ and (include fat, muscle, skeleton, cartilage and Tenocyte cell) between the cell in space), hemocyte is (such as, erythrocyte, granulocyte, neutrophilic granulocyte, eosinophilic granulocyte, basophilic granulocyte, mononuclear cell, T lymphocyte (is also called T cell), bone-marrow-derived lymphocyte (is also called B cell), plasma cell, megalokaryocyte etc.), neurocyte, sexual cell is (such as, sperm, oocyte), amniocyte, Placenta Hominis, stem cell etc.。Sample can obtain one or more genomic samples unicellular, grand, embryonic stem cell, inductive pluripotent stem cells, cancer sample, tissue slice and biopsy or its combination in any in culture。
As used herein, term " organism " can include but not limited to: the mankind, non-human primate, cow, horse, sheep, goat, pig, Canis familiaris L., cat, rabbit, mice, rat, gerbil jird, the frog, Bufo siccus, fish are (such as, Brachydanio rerio (Daniorerio)), nematicide (such as, Caenorhabditis elegans (C.elegans)) and any transgenic species thereof。Term " organism " can also include but not limited to: yeast (such as, saccharomyces cerevisiae) cell, yeast tetrad, yeast colony, antibacterial, bacterial clump, virion, virion, virus-like particle and/or its culture etc.。
As used herein, term " attachment ", " puting together " and " coupling " can be used interchangeably and can refer to covalent interaction and noncovalent interaction。
Although have shown that and describe the preferred embodiments of the present invention at this, but those of ordinary skill in the art is it will be clear that be only used as citing and provide this type of embodiment。Those of ordinary skill in the art will appreciate that now numerous variant, change and substitutes, without departing from the present invention。It should be understood that the different replacement schemes of embodiments of the invention described herein may be used for implementing the present invention。It is contemplated that claims below defines the scope of the present invention and thus covers these claim and the method and structure in the scope of their equivalent。
Example
Example 1: enzyme process separates-gather pond synthesis
In this example, use enzyme process to separate-gather pond synthesis and produce the pearl of coupling oligonucleotide。As shown in fig. 2, one group of oligonucleotide is added in each hole of the first plate。Oligonucleotide in one group of oligonucleotide includes 5' amine, universal sequence, cell marking and joint。For often organizing oligonucleotide, this 5' amine, universal sequence and joint are identical。This universal sequence and joint are different from each other。But, for often organizing oligonucleotide, this cell marking is different。Therefore, each hole has different cell markings。
Separating-gather in the step 1 of pond synthesis at enzyme process, the pearl of coupling oligonucleotide by being added into each hole and carrying out the synthesis of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) coupling reaction by single pearl。These oligonucleotide pearls obtained from step 1 include the pearl of the multiple oligonucleotide of coupling。Oligonucleotide includes 5'-amine, universal sequence, cell marking 1 and joint 1 (referring to Fig. 2 A)。Oligonucleotide on same pearl is identical。But, the oligonucleotide on the first pearl is different from the oligonucleotide on the second pearl。
Separate-gather at enzyme process in the step 2 of pond synthesis, repeatedly wash to remove the oligonucleotide of non-coupling。Once remove the oligonucleotide of these non-couplings, by poly-for the pearl of coupling oligonucleotide pond (referring to Fig. 2 A)。The pearl of the coupling oligonucleotide obtained from step 2 includes the pearl of the multiple single stranded oligonucleotide of coupling。This single stranded oligonucleotide includes 5' amine, universal sequence, cell marking 1 and joint 1。Each oligonucleotide on pearl is identical。But, each pearl includes different oligonucleotide。The oligonucleotide being coupled on different pearl is distinctive in that cell marking 1 sequence。
As shown in fig. 2B, one group of oligonucleotide is added into each hole of the second plate。Oligonucleotide in one group of oligonucleotide includes the first joint, cell marking and the second joint。For often organizing oligonucleotide, this first joint and this second joint are identical。This first joint and this second joint are different from each other。But, for often organizing oligonucleotide, this cell marking is different。Therefore, each hole has different cell markings。
Separate-gather in the step 3 of pond synthesis at enzyme process, the pearl of the coupling oligonucleotide in poly-pond in step 2 is separated in the hole of the second plate。Because the first joint of the oligonucleotide in the hole of the second plate is complementary with the joint of the oligonucleotide being coupled on pearl, carry out the primer extension using Ke Lienuo (Klenow) large fragment to be coupled on the pearl of the coupling oligonucleotide of step 2 by the oligonucleotide from the second plate。The pearl of the coupling oligonucleotide obtained from step 3 includes the pearl of the multiple double chain oligonucleotide of coupling。This double chain oligonucleotide includes 5' amine, universal sequence, cell marking 1, joint 1, cell marking 2 and joint 2 (referring to Fig. 2 B)。
Separate-gather at enzyme process in the step 4 of pond synthesis, repeatedly wash to remove the oligonucleotide of non-coupling and Ke Lienuo klenow fragment。Second plate is heated so that Double stranded oligonucleotide Acid denaturation, and by poly-for the pearl of coupling oligonucleotide pond (referring to Fig. 2 B)。The pearl of the coupling oligonucleotide obtained from step 4 includes the pearl of the multiple single stranded oligonucleotide of coupling。This single stranded oligonucleotide includes 5' amine, universal sequence, cell marking 1, joint 1, cell marking 2 and joint 2。Each oligonucleotide on pearl is identical。But, each pearl includes different oligonucleotide。The oligonucleotide being coupled on different pearl is distinctive in that the cell marking sequence of combination。Such as, the first pearl can include following oligonucleotide, and these oligonucleotide comprise: first cell marking of cell marking A and second cell marking of cell marking C；And the second pearl can include following oligonucleotide, these oligonucleotide comprise: first cell marking of cell marking C and second cell marking of cell marking D。Therefore, this first pearl and this second pearl can include identical cell marking (in this case, for cell marking C), but, the cell marking sequence of the combination of this first pearl and this second pearl be different (such as, for the first pearl, the cell marking sequence of combination is cell marking A+ cell marking C；For the second pearl, the cell marking sequence of combination is cell marking C+ cell label A)。In other cases, two pearls can include the oligonucleotide containing different cell markings。Such as, the first pearl can include the oligonucleotide containing cell marking A and cell marking B, and the second pearl can include the oligonucleotide containing cell marking C and cell marking D。In this case, two kinds of cell markings of the first pearl are different from two kinds of cell markings of the second pearl。
As shown in fig. 2 c, one group of oligonucleotide is added into each hole of the 3rd plate。Oligonucleotide in one group of oligonucleotide includes joint, cell marking, molecular marker and few dT。For often organizing oligonucleotide, this joint and few dT sequence are identical。But, for often organizing oligonucleotide, this cell marking is different。Therefore, each hole has different cell markings。Additionally, for the oligonucleotide in a group, this molecular marker is different。Therefore, single hole comprises and has same cell labelling but multiple oligonucleotide of different molecular labelling。Oligonucleotide from different holes can comprise identical molecular marker。
Separate-gather in the step 5 of pond synthesis at enzyme process, the pearl of the coupling oligonucleotide in poly-pond in step 4 is separated in the hole of the 3rd plate。Because the joint of the oligonucleotide in the hole of the second plate is complementary with the second joint of the oligonucleotide being coupled on pearl, carry out the primer extension using Ke Lienuo (Klenow) large fragment to be coupled on the pearl of the coupling oligonucleotide of step 4 by the oligonucleotide from the 3rd plate。The pearl of the coupling oligonucleotide obtained from step 5 includes the pearl of the multiple double chain oligonucleotide of coupling。This double chain oligonucleotide includes 5' amine, universal sequence, cell marking 1, joint 1, cell marking 2, joint 2, cell marking 3, molecular marker and few dT (referring to Fig. 2 C)。
Separate-gather at enzyme process in the step 6 of pond synthesis, repeatedly wash to remove the oligonucleotide of non-coupling and Ke Lienuo klenow fragment。3rd plate is heated so that Double stranded oligonucleotide Acid denaturation, and by poly-for the pearl of coupling oligonucleotide pond (referring to Fig. 2 C)。The pearl of the coupling oligonucleotide obtained from step 4 includes the pearl of the multiple single stranded oligonucleotide of coupling。This single stranded oligonucleotide includes 5' amine, universal sequence, cell marking 1, joint 1, cell marking 2, joint 2, cell marking 3, molecular marker and few dT。Multiple single stranded oligonucleotides on single pearl can be distinguished by molecular marker。The cell marking part of the multiple oligonucleotide on single pearl is identical。Each pearl includes different oligonucleotide。The oligonucleotide being coupled on different pearl is distinctive in that cell marking sequence。Can be identical from the molecular marker on the oligonucleotide of different pearls。Can be different from the molecular marker on the oligonucleotide of different pearls。The difference of two or more pearls can be in that the cell marking sequence of combination。Such as, the first pearl can include the oligonucleotide containing cell marking A, cell marking B and cell marking C, and the second pearl can include the oligonucleotide containing cell marking B, cell marking D and cell marking A。In this case, this first pearl and the second pearl all contain cell marking B, but two kinds of other cell markings are different。Therefore, two or more pearls can include the oligonucleotide that is distinctive in that at least one cell marking。Two or more pearls can include the oligonucleotide being distinctive in that at least two cell marking。Two or more pearls can include the oligonucleotide being distinctive in that at least three kinds of cell markings。But, pearl can include the oligonucleotide containing two or more same cell labellings。Such as, pearl can include the oligonucleotide containing cell marking A, cell marking A and cell marking D。Pearl can include the oligonucleotide of the cell marking identical containing at least three kinds。Such as, pearl can include the oligonucleotide containing cell marking A, cell marking A and cell marking A。Pearl can include the oligonucleotide of the cell marking different containing three kinds。Such as, pearl can include the oligonucleotide containing cell marking A, cell marking D and cell label E。Pearl can include at least two oligonucleotide containing at least two different molecular labelling。Such as, pearl can include the first oligonucleotide containing molecular marker A and the second oligonucleotide containing molecular marker D。But, pearl can include multiple copies of the oligonucleotide containing the first molecular marker。Therefore, pearl can include at least two oligonucleotide containing same molecular labelling。Such as, pearl can include the first oligonucleotide containing molecular marker A and the second oligonucleotide containing molecular marker A。The oligonucleotide of at least 30% on pearl can include different molecular markers。The oligonucleotide of at least 40% on pearl can include different molecular markers。The oligonucleotide of at least 50% on pearl can include different molecular markers。The oligonucleotide of at least 60% on pearl can include different molecular markers。The oligonucleotide less than 30% on pearl can include identical molecular marker。The oligonucleotide less than 20% on pearl can include identical molecular marker。The oligonucleotide less than 15% on pearl can include identical molecular marker。The oligonucleotide less than 10% on pearl can include identical molecular marker。The oligonucleotide less than 5% on pearl can include identical molecular marker。
Enzyme process separates-gather pond synthetic technology can carry out on the plate in multiple plates or the hole with greater number, to produce the pearl of the coupling oligonucleotide of greater number。Three the independent cell marking parts used can increase the multiformity of the general cell mark part on these pearls。For each cell marking part, there are 96 different sequence selection, it is possible to produce 884,736 different cell markings combinations。
Example 2: the comparison of the amplification in pipe and micropore
Present disclosure provides a kind of method for catching cell。About 5,000 this cell of Rameaus (Ramoscell) are trapped on the microwell array comprising the micropore that diameter is about 30 microns。Some cells are at large to be obtained。Comparison for this experiment is the equal cell being trapped in pipe。Cell in pipe and the cell both of which in microwell array are cracked。Allow nucleic acid hybridization extremely a kind of pearl puted together。Carry out the real-time PCR of GAPDH and RPL19 gene。
Fig. 9 illustrates the result of real time PCR amplification。From the yield of micropore more than the yield from the nucleic acid in pipe, instruction in micropore the hybridization of this nucleic acid and this oligonucleotide than more effective (accordingly, the comparing grey bar and white bars) in pipe。
Example 3: the second synthesizes the amplification of chain and the comparison of the synthesis on pearl
Obtain as described in Example 1 and cell lysis。RPL19, TUBB and GAPDH are used universal primer, departs from solid support and expand from the second chain, or directly expand on solid support。Figure 10 illustrates that directly the amplification on solid support (Figure 10) produces less amplification of missing the target compared with the amplification directly not carried out from solid support。GAPDH and TUBB amplification produces the product of correct size, regardless of method, (every three left swimming lanes repeated add lysate corresponding to the solid support in form of tubes in Fig. 10, every three middle swimming lanes repeated are corresponding to the solid support from micropore, and every three right swimming lanes repeated add the nucleic acid of purification corresponding to solid support)。RPL19 product has the MIN amplified production that misses the target, but only produces a kind of strong product when the nucleic acid of purification uses together with solid support。These experiments show that, compared with the amplification using the second chain departing from solid support synthesis to carry out, directly the amplification on pearl produces less amplified production that misses the target。
Example 4: the multiple analysis of target nucleic acid
Obtain as described in Example 1 and cell lysis。Target nucleic acid is hybridized with the solid support comprising oligonucleotide。The target nucleic acid of multiple copies and the target land hybridization comprising few dT sequence。Use reverse transcriptase that the target nucleic acid of the plurality of copy is carried out reverse transcription。Multiple features of reverse transcription oligonucleotide binding, the copy of this target nucleic acid and the plurality of feature hybridization (such as, molecular marker, cell marking and common tags)。Use multiple copies of this target nucleic acid of pcr amplification。Target nucleic acid copy through amplification is checked order。Target nucleic acid through order-checking is counted to determine the copy number of this target nucleic acid in cell。Counting is by each of the identical sequence reading for target nucleic acid, the number of different molecular labelling is carried out counting and carries out。In this way, it is possible to reduce amplification deviation。
Example 5: assessment separates-poly-pond synthesis effect in order to produce following pearl, and these pearls have the cloned copies of a cell marking combination
In this example, have rated separation-poly-pond synthesis effect in order to produce following pearl, these pearls have the cloned copies of a cell marking combination。Separate-gather pond synthetic method, the pearl of synthesis of coupling oligonucleotide by the enzyme process described in such as example 1。From the total serum IgE of Rameau this cell purification 250ng, it is equivalent to the RNA from 25,000 cells。The pearl of this total serum IgE and 35,000 coupling oligonucleotide is contacted, causes that the pearl of mRNA and these coupling oligonucleotide hybridizes。The mRNA that pearl with these coupling oligonucleotide hybridizes carries out cDNA synthesis。Use the sample comprising 18,175 and 1750 pearls for further analysis。To the cDNA being combined with from the pearl of 18-, 175-and 1750-pearl sample, GAPDH-specific primer and IGJ-specific primer is used to carry out pcr amplification reaction。The cDNA molecule being attached on pearl is checked order。Figure 11 A-I illustrates that the figure of sequencing result represents。For Figure 11 A-C, respectively for 18-pearl, 175-pearl and 1750-pearl sample, number of readings per taken/pearl is to be drawn in y-axis, and uniqueness bar code (such as, cell marking combination) is to be drawn in x-axis。For Figure 11 D-F, respectively for 18-pearl, 175-pearl and 1750-pearl sample, uniqueness number of barcodes/pearl is to be drawn in y-axis, and uniqueness bar code (such as, cell marking combination) is to be drawn in x-axis。For Figure 11 G-I, respectively for 18-pearl, 175-pearl and 1750-pearl sample, uniqueness molecule amount/pearl is to be drawn in y-axis, and uniqueness bar code is to be drawn in x-axis。These results of Figure 11 G-I are the sum sortings by molecule。For different samples, uniqueness molecule amount intermediate value/pearl is shown in Table 1。The numerical value of sequencing result is shown in Table 2。For Figure 11 J-L, it is respectively directed to the cell marking 1 of 1750-pearl sample, cell marking 2 and cell marking 3, making the number that the uniqueness bar code (bc) of index of reference combines is be drawn in y-axis, and bar code (bc) segment index is to be drawn in x-axis。Bar code (bc) refers to cell marking (such as, bc section 1=cell marking part 1)。, as shown in Figure 11 J-L, the existence in almost all of 96 bar codes every section interior is by detection of checking order。These results demonstrate enzyme process and separate-gather pond synthetic method in order to produce the success of following pearl, and these pearls have the cloned copies of a cell marking combination。
Example 6. uses the pearl of coupling oligonucleotide to carry out unicellular RNA labelling
In this example, have rated the effect using the pearl of oligonucleoside coupling to carry out unicellular RNA labelling。Prepare three kinds of cell samples as follows:
The cell suspending liquid of sample is added to the top of micropore, and allows cell settlement in the hole of microwell array。The cell do not caught by microwell array is washed away in phosphate buffered saline (PBS) (PBS) is bathed。The pearl (as the enzyme process described in by example 1 separates-gather prepared by pond synthetic method) of coupling oligonucleotide is added into microwell array。The pearl of coupling oligonucleotide includes the magnetic bead with multiple oligonucleotide。Each oligonucleotide on pearl includes 5' amine, universal sequence, cell marking 1, joint 1, cell marking 2, joint 2, cell marking 3, molecular marker and few dT。For each oligonucleotide on identical pearl, the sequence of these oligonucleotide is identical except molecular marker。For the oligonucleotide on different pearls, cell marking 1,2 and 3 combination is different。In microwell array, add about 5-6 pearl/hole。In some cases, for every 10 holes, 50 pearls can be deposited on this array, and wherein 0-2 pearl is fallen in each hole。Allow pearl to be settled down in hole and wash away, in PBS bathes, the pearl not caught。Magnet is placed below this microwell array。By cell by adding Cold lysis buffer cracking。This array and magnet are placed on cold aluminium block and continue 5 minutes。Come the mRNA of the cell of autothermic cracking and the oligonucleotide hybridization being coupled on pearl。Carry out washing to remove unconjugated mRNA with excessive lysis buffer by this array。By magnet being placed on microwell array top, regain pearl from this some holes。The pearl of these withdrawals is washed。Use SuperscriptIII, at 50 DEG C on rotator, pearl carries out cDNA synthesis and continues 50 minutes。By processing 30 minutes with ExoI at 37 DEG C on rotator, remove the non-extended widow dT from the oligonucleotide on pearl。CDNA is carried out gene specific pcr amplification。The gene being selected for this gene specific PCR is cell type-specific, and is shown in Table 3。Pcr amplification product is checked order。Order-checking statistics is shown in Table 4。Figure 12 A-C illustrates the sequencing result rectangular histogram respectively for only this sample of K562 sample, only Rameau and K562+ this blend sample of Rameau。For Figure 12 A-C, uniqueness molecule/bar code is to be drawn in y-axis, and is drawn in x-axis with the uniqueness bc combined index of reading/bc sorting。
For single cell type sample (such as, only this sample of K562 sample, only Rameau), use unicellular labelling to determine copy number。Figure 12 D-E illustrates and is respectively directed to only this sample of Rameau and only K562 sample, the figure of the copy number of the gene listed in table 3。For Figure 12 D-E, molecule amount/bar code (bc) combination is to be drawn in y-axis, and the uniqueness bar code combination with molecule total number/bc compounding separation is to be drawn in x-axis。Result shown in Figure 12 D-E is based on the sequencing data from following pearl, and these pearls have > the uniqueness molecule of 30 sum。These results prove, the expection to this cell type of the molecular ratios coupling of the every amplicon of every pearl。For only K562 cell sample, the deflection of molecule amount more serious and it manifest HBG1 (highly enriching in this cell type) and there is variable copy number。But, it is constant that GAPDH copy number manifests, even if molecule sum/pearl is deflection。The copy number of independent gene is shown in Figure 12 F-I。For Figure 12 F-G, this copy number is expressed as being respectively directed to only this cell of Rameau and only every pearl of K562 cell or single celled copy。For Figure 12 H-I, this copy number is expressed as being respectively directed to only this cell of Rameau and only every pearl of K562 cell or single celled relative abundance。
Unicellular labelling is used to determine single celled cell type in this blend sample of K562+ Rameau。Sequencing result from 100 uniqueness bar code combinations with the abundantest molecule is analyzed, to evaluate unicellular labelling in order to determine effect of the single celled cell type in this blend sample of K562+ Rameau。Figure 12 J-M illustrates the pearl for having 100 uniqueness bar code combinations, the figure of uniqueness molecule amount/gene (y-axle)。Numeral on x-axle refers to gene (referring to table 3)。Figure 12 J-M clearly depict the general gene expression pattern of K562 cell and this cell of Rameau。Figure 12 N-O illustrates the enlarged drawing of two kinds of pearls of the general modfel of the gene expression profile describing both cell types。Figure 12 N illustrates the general modfel of the gene expression profile of K562 like cell, and Figure 12 O illustrates the general modfel of gene expression profile of this like cell of Rameau。Figure 12 P is illustrated based on the scatterplot of the result of the principal component analysis of the gene expression profile of 768 pearls, wherein has from this blend sample of K562+ Rameau > 30 molecule/pearls。Component 1, it is drawn in x-axis, by two cell types separately。Component 2, it is drawn in y-axis, is separated by the K562 cell with high HBG1 copy number and low HBG1 copy number。One uniqueness bar code combination of each expression on scatterplot, it is equivalent to a pearl or a cell。Based on this principal component analysis, 409 pearls are corresponding to K562 cell, and 347 pearls are corresponding to this cell of Rameau。For K562-like cell type and this like cell type of Rameau, it is determined that from the gene copy number of table 3。Figure 12 Q-R illustrates and is respectively directed to K562-like cell (pearl on the left side of the first major constituent based on Figure 12 P) and this like cell of Rameau (pearl on the right of the first major constituent based on Figure 12 P), the rectangular histogram of the copy number of the every amplicon of every pearl。The number corresponding for Figure 12 Q-R, each bc combination is on y-axle, and the uniqueness bar code combination with molecule sum/bc compounding separation is on x-axle。Figure 12 S-T illustrates the every pearl or single celled independent gene copy number that are respectively directed to K562-like cell (pearl on the left side of the first major constituent based on Figure 12 P) and this like cell of Rameau (pearl on the right of the first major constituent based on Figure 12 P)。Table 5 illustrates the average copy number/pearl for unicellular and blend sample。
Example 7. evaluates the reciprocal action between pearl
In this example, the reciprocal action between pearl is evaluated。The sample comprising mice EL4 cell and this cell of Rameau is carried out as follows preparation:
High density Low-density
Micropore number About 10000 About 10,000 92-->
Mice EL4 cell number 2500 1500
This cell number of Rameau 3750 1500
The cell suspending liquid of sample is added to the top of micropore, and allows cell settlement in the hole of microwell array。The cell do not caught by microwell array is washed away in phosphate buffered saline (PBS) (PBS) is bathed。The pearl (as the enzyme process described in by example 1 separates-gather prepared by pond synthetic method) of coupling oligonucleotide is added into microwell array。The pearl of coupling oligonucleotide includes the magnetic bead with multiple oligonucleotide。Each oligonucleotide on pearl includes 5' amine, universal sequence, cell marking 1, joint 1, cell marking 2, joint 2, cell marking 3, molecular marker and few dT。For each oligonucleotide on identical pearl, the sequence of these oligonucleotide is identical except molecular marker。For the oligonucleotide on different pearls, cell marking 1,2 and 3 combination is different。In microwell array, add about 5-6 pearl/hole。Allow pearl to be settled down in hole and wash away, in PBS bathes, the pearl not caught。Magnet is placed below this microwell array。By cell by adding Cold lysis buffer cracking。This array and magnet are placed on cold aluminium block and continue 5 minutes。Come the mRNA of the cell of autothermic cracking and the oligonucleotide hybridization being coupled on pearl。Carry out washing to remove unconjugated mRNA with excessive lysis buffer by this array。By magnet being placed on microwell array top, regain pearl from this some holes。The pearl of these withdrawals is washed。Use SuperscriptIII, at 50 DEG C on rotator, pearl carries out cDNA synthesis and continues 50 minutes。By processing 30 minutes with ExoI at 37 DEG C on rotator, remove the non-extended widow dT from the oligonucleotide on pearl。CDNA is carried out gene specific pcr amplification。The gene being selected for this gene specific PCR is cell type-specific, and is shown in Table 6。
Pcr amplification product is checked order。Order-checking statistics is shown in Table 7。
For high density and low-density sample, it is determined that for the gene expression profile of 100 uniqueness bar code combinations with the abundantest molecule。Gene expression profile is produced based on sequencing result。Figure 13 A illustrates for the gene expression spectrogram from 35 in 100 uniqueness bar code combinations of high density sample。For Figure 13 A, uniqueness molecule amount is on y-axle, and gene reference number is (about the gene corresponding to gene reference number, referring to table 6) on x-axle。Figure 13 A clearly depict the general gene expression pattern of mouse cell and this cell of Rameau。Figure 13 B-13C illustrates the scatterplot of the result of the principal component analysis of the gene expression profile being based respectively on high density sample and low-density sample。Component 1, it is drawn in x-axis, by two cell types separately。Component 2, it is drawn in y-axis, the gene expression transmutability in instruction this cell colony of Rameau。One uniqueness bar code combination of each expression on scatterplot, it is equivalent to a pearl or a cell。Based on the principal component analysis of this high density sample, 144 pearls correspond to this cell of Rameau corresponding to mouse cell and 132 pearls。Based on the principal component analysis of this low-density sample, 52 pearls correspond to this cell of Rameau corresponding to mouse cell and 27 pearls。
Once it is determined that cell type, then by the gene detected from the table 6 in different cell types, the reciprocal action between these pearls is estimated。Figure 13 D-E depict for respectively from this like cell of Rameau of high density sample and mice like cell with figure below: reading/bar code (bc) combination (y-axle) comparison combines (x-axle) with the uniqueness bar code of molecule total number/bc compounding separation。Figure 13 F-G depict for respectively from this like cell of Rameau of high density sample and mice like cell with figure below: (y-axle) comparison of molecule amount/bc combination combines (x-axle) with the uniqueness bar code of molecule total number/bc compounding separation。Figure 13 H-I depict for respectively from this like cell of Rameau of low-density sample and mice like cell with figure below: reading/bar code (bc) combination (y-axle) comparison combines (x-axle) with the uniqueness bar code of molecule total number/bc compounding separation。Figure 13 J-K depict for respectively from this like cell of Rameau of low-density sample and mice like cell with figure below: molecule amount/bc combines (y-axle) comparison and combines (x-axle) with the uniqueness bar code of molecule total number/bc compounding separation。Table 8 illustrates that the average fold for low-density and every uniqueness molecule of high density sample covers or reading redundancy。
Result in table 8 shows, in this cell of Rameau, compared with murine genes, the average fold for every uniqueness molecule of people's gene covers higher, and vice versa。
As comparison, the mixture of mice and people's cell is cracked in a pipe, go to and carry out cDNA synthesis with pearl, and cDNA is checked order。Fig. 4 XL illustrates that the figure of sequencing result represents。As expected, it was observed that substantial amounts of uniqueness bar code (bc) is combined, and mostly beads only has one or two copy of total。
These results prove there is minimum interaction effect between pearl, and this reciprocal action can be identified through bioinformatics。
Example 8. produces unicellular nucleic acid library
Can be used for producing unicellular nucleic acid library by the holder puting together oligonucleotide disclosed here。In this example, unicellular nucleic acid library is to produce by cell sample is added into the surface (such as, grid) with the holder puting together oligonucleotide。The holder puting together oligonucleotide includes being conjugated to multiple oligonucleotide of pearl。Oligonucleotide includes (a) cell marking district, and this district includes at least two zones of different connected by joint；And (b) molecular marker district。Two or more oligonucleotide on pearl include identical cell marking district。Two or more oligonucleotide on pearl include the molecular marker district that two or more are different。Two or more oligonucleotide on two or more different pearls include two or more different cell marking districts。Therefore, the cell that holder that is each and that put together oligonucleotide is associated has different cell marking districts。The concentration of the cell in cell sample is enough dilutions, so that one or less cell can be associated with a holder puting together oligonucleotide on a surface。Use lysis buffer by lysis。Oligonucleotide hybridization from mRNA and the holder puting together oligonucleotide of cell。Thus, all mRNA from cell are all marked with the oligonucleotide including same cell mark zone。Two or more mRNA from cell are marked with two or more oligonucleotide including two or more different molecular mark zones。Magnet is applied on this surface with the solid support from this surface purified conjugation oligonucleotide。Can individually from the solid support of this surface purified conjugation oligonucleotide。MRNA with the oligonucleotide hybridization on the solid support puting together oligonucleotide is carried out reverse transcription to produce labeled cDNA。Labeled cDNA includes the reverse complemental thing of this mRNA and the copy of this mRNA oligonucleotide hybridized。By labeled cDNA by pcr amplification to produce labeled amplicon。By restricting property enzymic digestion, labeled cDNA and/or labeled amplicon can be removed from pearl。Produce from this single celled nucleic acid library from labeled amplicon。
Alternately, the solid support of purified conjugation oligonucleotide together。The reverse transcription of mRNA can carry out on the solid support of oligonucleotide in puting together of combination。Because the mRNA from different cells is marked with the oligonucleotide including different cell marking districts, these cell marking districts are determined for labeled cDNA or which cell labeled amplicon derives from。Thus, it is possible to produce the nucleic acid library from multiple cells, wherein can be determined by cell marking district as the identity of the cell in the source of labeled amplicon。
Unicellular nucleic acid library can also produce by making these cells contact with reagent before cell lysis。This reagent can be antigen, medicine, cell, toxin, etc.。Therefore, it can produce the unicellular nucleic acid library of specialization。The analysis to nucleic acid library can be used to produce unicellular medicine express spectra。The signal transduction pathway individual cell level can also be determined from these nucleic acid library。These nucleic acid library can be also used for the effect determining antigen to specialized cells types。
Example 9. monocell expressing analysis of spectrum
The holder puting together oligonucleotide disclosed here can be used to determine single celled express spectra。In this example, the cell sample including cell mixture and multiple antibody contacts are made。Use flow cytometry purifying cells subgroup。This cell subsets is added into microwell array。Multiple holders puting together oligonucleotide are added into this microwell array。The holder puting together oligonucleotide includes being coupled to multiple oligonucleotide of nanoparticle。Oligonucleotide includes (a) cell marking district, and this district includes three the different sequences connected by two predetermined sequences；And (b) molecular marker district。Two or more oligonucleotide on nanoparticle include identical cell marking district。Two or more oligonucleotide on nanoparticle include the molecular marker district that two or more are different。Two or more oligonucleotide on two or more different nanoparticles include two or more different cell marking districts。Therefore, the cell that holder that is each and that put together oligonucleotide is associated has different cell marking districts。
Magnet is applied to microwell array, and the cell unconnected with the holder puting together oligonucleotide is washed away。The sponge including lysis buffer is placed on the top of this microwell array, thus cell lysis。
Come mRNA and the oligonucleotide hybridization on pearl of the cell of autothermic cracking。MRNA is carried out reverse transcription to produce labeled cDNA。Labeled cDNA includes the reverse complemental thing of this mRNA and the copy of this mRNA oligonucleotide hybridized。By labeled cDNA by pcr amplification to produce labeled amplicon。Labeled amplicon is checked order。Because each mRNA from cell is marked with identical cell marking, and it is marked with different cell markings from the mRNA of different cells, uses the sequence information of labeled amplicon to produce monocell expressing spectrum。
Example 10: carry out immunophenotyping by unicellular order-checking
Blood sample is collected from experimenter, and from this blood sample separating periphery blood monocytic cell (PMBC)。PMBC is cultivated in RPMI1640 culture medium, and is positioned in incubator overnight。PMBC is washed in PBS repeatedly to remove serum。About 7000 PMBC are deposited on the microwell array with 32,400 holes。Thus, the most aperture on microwell array does not comprise cell, and the some holes on microwell array only comprises 1 cell。The pearl puting together oligonucleotide is applied to this microwell array。Each pearl puting together oligonucleotide comprises about 1,000,000,000 oligonucleotide being attached to pearl。The each oligonucleotide being attached to pearl includes 5' amine, universal sequence, three part cell markings (three the cell marking sections such as, connected), molecular marker and few dT by two joints。Each pearl comprises uniqueness three-part cell marking, and this labelling is the result of the unique combinations of three cell marking sections。Whole oligonucleotide on single pearl comprise three identical part cell markings。Oligonucleotide from different pearls comprises three different part cell markings。Each hole comprises 1 or less pearl puting together oligonucleotide。Cell cracking agent is applied to this microwell array, causes the cracking of cell。The few dT sequence hybridization of the polyadenylic acid chemoattractant molecule (such as, mRNA) from cell and the oligonucleotide from the pearl puting together oligonucleotide。On rotator, the polyadenylic acid chemoattractant molecule SuperScriptII with the oligonucleotide hybridization from the pearl puting together oligonucleotide is carried out reverse transcription 90 minutes at 42 DEG C。By the oligonucleotide primer acting on the first chain cDNA synthesis from the pearl puting together oligonucleotide。SMART oligomer is mixed, so that the complement of SMART oligomer sequence can be added into the 3 ' ends of cDNA by superscriptII when it arrives end in cDNA synthesizes。CDNA synthetic reaction produces and does not extend oligonucleotide (such as, it is not attached to the oligonucleotide of the polyadenylic acid chemoattractant molecule from cell) and extend the pearl that oligonucleotide (oligonucleotide that is that such as, be attached to polyadenylic acid chemoattractant molecule and that include polyadenylic acid chemoattractant molecule/cDNA crossbred) is puted together。
Pearl is combined, and the oligonucleotide including polyadenylic acid chemoattractant molecule/cDNA crossbred is expanded。Carry out multiplex PCR and expand 98 genes (referring to table 9) of a panel from the cDNA pearl。Primer for multiplex PCR includes the first gene-specific primer (it is designed to be positioned at about 500 the base pair places of 3' end of distance mRNA) and nested gene-specific primer (it is designed to be positioned at about 300 base pair places of 3' end of distance mRNA)。Primer for multiplex PCR is designed to need the not significant complementarity of last 6 bases of primer in this panel。If be detected that the complementarity of multiple PCR primer, then manually change primer。Multi-PRC reaction comprises the steps of 1) the first gene specific PCR (KAPA multiplex mixture of 15 circulations, every kind of primer 50nM-first gene-specific primer and universal primer, this universal primer is complementary with the universal sequence of the pearl puting together oligonucleotide), Ampure purifies (0.7x pearl and template ratios), nested gene specific PCR (the KAPA multiplex mixture of 15 circulations, every kind of primer 50nM-nested gene-specific primer and universal primer, this universal primer is complementary with the universal sequence of the pearl puting together oligonucleotide), Ampure purifies (0.7x pearl and template ratios), the final PCR of 8 circulations is to add total length hundred million sensible (Illumina) aptamer (KAPAHiFiReadyMix), and Ampure purifies (1x pearl and template ratios)。
These amplified productions are checked order。Use Bowtie2, the complete mRNA sequence with 98 genes listed in the sequence reads of 150bp and table 9 is compared。The result (referring to table 10) of sequence alignment proves that this multi-PRC reaction produces high specific product。Figure 14 illustrates the figure of the log10 of gene and the number of readings per taken being depicted on X-axle。16 genes in 98 genes are non-existent。Being absent from of these genes is attributable to following facts: some gene targets can be not present in the rare cell in this blood sample。Generally speaking, detect from this 98 gene panel about 84% gene。
Table 11 illustrates the result of overall order-checking statistics。For reading 1, total indicator reading 1 mate standard-required and three part cell markings (such as cell bar code) Perfect Matchings and with at most 1 mispairing of joint。
Figure 15 A illustrates the scattergram of the gene detected of each three part cell markings (such as, cell bar code)。Figure 15 B illustrates the scattergram of the uniqueness molecule detected of every pearl (expressing this gene panel)。
Carry out cell clusters analysis to determine whether sequencing result may be used for analyzing the cell colony based on cell bar code。Use SPADE (minimal spanning tree algorithm for CyTOF data developed by Nolan's laboratory (Nolanlab)) come based on 17 genes in the presence/absence of to cell clusters。For thinking the gene existed, the average order-checking redundancy for this gene have to be larger than 5 times。After sequence filter, there are about 500 uniqueness cell bar code (such as cell marking) being associated with more than 20 uniqueness molecules。Each uniqueness cell bar code is corresponding to unicellular。Based on the gene being associated with uniqueness cell bar code, it is multiple cell type by cell clusters。Table 12 illustrates the list of genes that may be used for clear and definite identification of cell type。Thus, the cell bar code being associated with CD20, IGHM, TCL1A and CD24 is referred to as B-cell, and the cell bar code being associated with CD8A, CD3D, CD3E, CD4 and CD62L is referred to as T-cell。By from the residue gene shine of table 9 to cell cluster。Figure 16 depicts the cell cluster based on the gene being associated with cell bar code。Bunch size be proportional to the cell number being assigned to this bunch。The result being shown in Figure 16 proves, the combination of cell and molecular bar code may be used for uniquely that labelling is from the copy of single celled molecule, and this can enable to carry out immunophenotyping by unicellular order-checking。Except during PMBC is clustered major cell types by the gene listed in based on table 12, this 98 gene panel can be also used for identifying the hypotype of major cell types bunch。Table 13 illustrates the frequency of each major cell types by unicellular order-checking detection。, as shown in table 13, except CD8+T cell, the percentage ratio of each cell type corresponds to normal cell percentage range。PMBC sample is observed the CD8+T cell of slightly greater percentage ratio。Use the cell cluster based on Figure 16, use the express spectra from the other gene of this 98 gene panel to analyze these cell clusters further。
Figure 17 A-D illustrates the analysis of mononuclear cell Specific marker。Figure 17 E illustrates the cell cluster described in Figure 16。Figure 17 A illustrates the cell express spectra of CD14, and this CD14 is mononuclear cell Specific marker。" warm colour " (such as red) represents high gene and expresses, and " cool colour " (such as blue) represents low gene expression。, as shown in Figure 17 A, CD14 high expressed has to be low to moderate in monocyte population and in other cell types does not express。The cell express spectra of the known CD16 being present in mononuclear cell and NK is shown in Figure 17 B。As shown in Figure 17 B, these mononuclear cells and NK cell cluster have a high expressed of CD16, and other cell types have to be low to moderate and do not express。Known CCR2 and S100A12 high expressed is in mononuclear cell。CCR2 and S100A12 mononuclear cell-specific expressed is also confirmed in cell express spectra shown in Figure 17 C and D respectively。But, the expression of CCR2 and S100A12 is divided into monocytic Liang Ge branch。Other cell types show being low to moderate of CCR2 and S100A12 and do not express。
Figure 18 A-B illustrates the analysis of T cell Specific marker。Figure 18 C illustrates the cell cluster described in Figure 16。Figure 18 A illustrates the cell express spectra of the CD3D of the chain as CD3 molecule。CD3 is full T cell mark。Figure 18 A illustrates that CD3D high expressed is in the Liang Ge branch of CD8+T cell, and moderate is expressed in the 3rd branch of CD8+T cell。But, CD3D is not that high expressed is in CD4+T cell。Equally, other cell types have being low to moderate of CD3D and do not express。Figure 18 B illustrates the cell express spectra of the CD3E of the chain as CD3 molecule。Figure 18 B illustrates that CD3D high expressed is in CD4+T cell。The different branches of CD8+T cell show the height of CD3D and express to moderate。Other cell types being observed, CD3D's is few to not expressing。
Figure 19 A-B illustrates the analysis of CD8+T cell specific markers。Figure 19 C illustrates the cell cluster described in Figure 16。Figure 19 A illustrates the cell express spectra of the CD8A of the chain as CD8 molecule。As shown in figure 19, the different branches of CD8+T cell have the CD8A of varying level and express, and some of them branch has the high expressed of CD8A, and other branches have moderate and express, and a branch shows to be low to moderate and do not express。A branch of CD16+NK cell observes that high CD8A expresses。Report that the NK cell up to 80% expresses CD8 in the literature。Other cell types being observed, CD8A's is few to not expressing。Figure 19 B illustrates the cell express spectra of the CD8B of the chain as CD8 model。As shown in fig. 19b, the different branches of CD8+T cell have the CD8B of varying level and express, and one of them branch has the high expressed of CD8B, and some branches have moderate and express, and Liang Ge branch shows to be low to moderate and do not express。Also in a branch of CD16+NK cell, observe that high CD8B expresses。Other cell types are observed CD8B with little to not expressing。
Figure 20 A illustrates the analysis of CD4+T cell specific markers。Figure 20 B illustrates the cell cluster described in Figure 16。Figure 20 A illustrates the express spectra of CD4。One subgroup of the cell in CD4+T cell cluster being observed, the moderate of CD4 is expressed, and in a branch of mononuclear cell bunch, observes the high expressed of CD4。Previously record mononuclear cell in the literature and also express CD4。In the branch of CD8+T-cell with observe that in NK cell the moderate of CD4 is to low expression。Other cell types being observed, being low to moderate of CD4 is not expressed。
Figure 21 A-D illustrates the analysis of natural killer cell (NK) cell specific markers。Figure 20 E illustrates the cell cluster described in Figure 16。Figure 20 A illustrates the express spectra of KIR2DS2。All of cell type show KIR2DS2 with little to not expressing。Figure 20 B illustrates the express spectra of KIR2DS5。Known killing cell immunoglobulin receptor (KIR) is expressed in NK cell and T cell subgroup。2 branches of NK cell observe the high expressed of KIR2DS5, and in a branch of NK cell, observes the moderate extremely low expression of KIR2DS5。2 branches of CD8+T cell observing, the moderate of KIR2DS5 is to high expressed。Every other cell type being observed, being low to moderate of KIR2DS5 is not expressed。Known OSBPL5 and IGFBP7 high expressed is in NK cell。Figure 20 C illustrates the express spectra of OSBPL5。OSBPL5 high expressed is in a branch of NK cell。The branch of B cell observes the moderate extremely low expression of OSBPL5。Every other cell type being observed, being low to moderate of OSBPL5 is not expressed。Figure 20 D illustrates the express spectra of IGFPBP7。The Liang Ge branch and a monocytic branch of NK cell observe the high expressed of IGFPBP7。A branch of B cell observing, the moderate of IGFPBP7 is expressed。Every other cell type being observed, being low to moderate of IGFPBP7 is not expressed。
Figure 22 A-E illustrates the analysis of B cell Specific marker。Figure 22 F illustrates the cell cluster described in Figure 16。Figure 22 A illustrates the express spectra of IGHMCH4。IGHMCH4 high expressed is in a branch of B cell, and moderate is expressed in the second branch of B cell。Other cell types being observed, being low to moderate of IGHMCH4 is not expressed。Figure 22 B illustrates the express spectra of PAX5。PAX5 high expressed is in a branch of B cell。Every other cell type being observed, being low to moderate of PAX5 is not expressed。Figure 22 C illustrates the express spectra of CD20。CD20 high expressed is in a branch of B cell。Every other cell type being observed, being low to moderate of CD20 is not expressed。Figure 22 D illustrates the express spectra of TCL1A。Every other cell type being observed, being low to moderate of TCL1A is not expressed。Figure 22 E illustrates the express spectra of IGHDCH2。IGHDCH2 high expressed is in a branch of B cell。Every other cell type being observed, being low to moderate of IGHDCH2 is not expressed。
Figure 23 A-F illustrates the analysis of Toll-like receptor。Toll-like receptor is mainly expressed by mononuclear cell and some B cell。Figure 23 G illustrates the cell cluster described in Figure 16。Figure 23 A illustrates the express spectra of TLR1。A monocytic branch shows the high expressed of TLR1, and monocytic Liang Ge branch shows the moderate expression of TLR1。Every other cell type being observed, being low to moderate of TLR1 is not expressed。Figure 23 B illustrates the express spectra of TLR4。A monocytic branch shows the high expressed of TLR4。A branch of monocytic Liang Ge branch and NK cell observed the moderate of TLR4 express。Every other cell type being observed, being low to moderate of TLR4 is not expressed。Figure 23 C illustrates the express spectra of TLR7。A monocytic branch observed the high expressed of TLR7, and the moderate that observed TLR7 in a branch of NK cell is expressed。Every other cell type being observed, being low to moderate of TLR7 is not expressed。Figure 23 D illustrates the express spectra of TLR2。A branch of B cell observes the high expressed of TLR2。Every other cell type being observed, being low to moderate of TLR2 is not expressed。Figure 23 E illustrates the express spectra of TLR3。A branch of B cell observes the high expressed of TLR3。Every other cell type being observed, being low to moderate of TLR3 is not expressed。Figure 23 F illustrates the express spectra of TLR8。Monocytic three branches observe the high expressed of TLR8。A branch of monocytic Liang Ge branch and NK cell observed the extremely low expression of the moderate of TLR8。Every other cell type is observed being low to moderate of TLR8 do not express。
These results prove that the major cell types in PMBC can be successfully identified in extensive parallel unicellular order-checking。Sequencing result further defines does not have high mrna expression (such as, the CD56 of NK cell, the CD19 of B cell) for some cell sign things of identification of cell type in FAC。Additionally, the many genes in gene panel are expressed across various kinds of cell type。These express spectras may be used for the sub-types of cells (such as, versus's resting cell etc. of activation) in major cell types。Example 11: identify the rare cell in colony
In this experiment, extensive parallel unicellular order-checking is used to carry out identification of cancer cell from the mixture of cancerous cell and non-cancerous cells。This (Burkitt lymphoma) cell of Rameau is added into from the colony of the CD19+B cell of healthy individuals separation。The concentration of this cell of Rameau in population mixture is about 4%-5%。By about 7000 normal B cells and 300 these cell depositions of Rameau on the microwell array with 25,200 holes。Thus, the most aperture on microwell array does not comprise cell, and the some holes on microwell array only comprises 1 cell。The pearl puting together oligonucleotide is applied to this microwell array。Each pearl puting together oligonucleotide comprises about 1,000,000,000 oligonucleotide being attached to pearl。The each oligonucleotide being attached to pearl includes 5' amine, universal sequence, three part cell markings (three the cell marking sections such as, connected), molecular marker and few dT by two joints。Each pearl comprises uniqueness three-part cell marking, and this labelling is the result of the unique combinations of three cell marking sections。Whole oligonucleotide on single pearl comprise three identical part cell markings。Oligonucleotide from different pearls comprises three different part cell markings。Each hole comprises 1 or less pearl puting together oligonucleotide。Cell cracking agent is applied to this microwell array, causes the cracking of cell。The few dT sequence hybridization of the polyadenylic acid chemoattractant molecule (such as, mRNA) from cell and the oligonucleotide from the pearl puting together oligonucleotide。On rotator, the polyadenylic acid chemoattractant molecule SuperScriptII with the oligonucleotide hybridization from the pearl puting together oligonucleotide is carried out reverse transcription 90 minutes at 42 DEG C。By the oligonucleotide primer acting on the first chain cDNA synthesis from the pearl puting together oligonucleotide。SMART oligomer is mixed, so that the complement of SMART oligomer sequence can be added into the 3 ' ends of cDNA by superscriptII when it arrives end in cDNA synthesizes。CDNA synthetic reaction produces and does not extend oligonucleotide (such as, it is not attached to the oligonucleotide of the polyadenylic acid chemoattractant molecule from cell) and extend the pearl that oligonucleotide (oligonucleotide that is that such as, be attached to polyadenylic acid chemoattractant molecule and that include polyadenylic acid chemoattractant molecule/cDNA crossbred) is puted together。
Pearl is combined, and the oligonucleotide including polyadenylic acid chemoattractant molecule/cDNA crossbred is expanded。Carry out multiplex PCR and expand 111 genes of a panel from the cDNA pearl。These 111 genes represent the mark of the different subgroups of B cell。Primer for multiplex PCR includes the first gene-specific primer (it is designed to be positioned at about 500 the base pair places of 3' end of distance mRNA) and nested gene-specific primer (it is designed to be positioned at about 300 base pair places of 3' end of distance mRNA)。Primer for multiplex PCR is designed to need the not significant complementarity of last 6 bases of primer in this panel。If be detected that the complementarity of multiple PCR primer, then manually change primer。Multi-PRC reaction comprises the steps of 1) the first gene specific PCR (KAPA multiplex mixture of 15 circulations, every kind of primer 50nM-first gene-specific primer and universal primer, this universal primer is complementary with the universal sequence of the pearl puting together oligonucleotide), Ampure purifies (0.7x pearl and template ratios), nested gene specific PCR (the KAPA multiplex mixture of 15 circulations, every kind of primer 50nM-nested gene-specific primer and universal primer, this universal primer is complementary with the universal sequence of the pearl puting together oligonucleotide), Ampure purifies (0.7x pearl and template ratios), the final PCR of 8 circulations is to add total length hundred million sensible (Illumina) aptamer (KAPAHiFiReadyMix), and Ampure purifies (1x pearl and template ratios)。
These amplified productions are checked order。Use Bowtie2, the complete mRNA sequence of the sequence reads comprising 150bp Yu these 111 genes (table 17) is compared。The result (referring to table 14) of sequence alignment proves that this multi-PRC reaction produces high specific product。Figure 24 depicts the figure of the log10 of gene comparison number of readings per taken。24 in 111 genes is non-existent。At least two and RAG1 and RAG2 in these genes relate to VDJ restructuring and should only exist in pre B lymphocyte, and the two gene should be non-existent。The non-existent gene of minority be specificity for plasma cell, be saved in frozen cell very rarely。
Table 15 illustrates the result of overall order-checking statistics。For reading 1, total indicator reading 1 mate standard-required and three part cell markings (such as cell bar code) Perfect Matchings and with at most 1 mispairing of joint。
Figure 25 A-D illustrates for two genes, the molecular bar code figure to number of readings per taken or the log10 of number of readings per taken。Figure 25 A illustrates for CD79, and molecular bar code (sorts) figure to number of readings per taken by abundance。Figure 25 B illustrates for CD79, and molecular bar code (sorts) figure of the log10 to number of readings per taken by abundance。Figure 25 C illustrates for GAPDH, and molecular bar code (sorts) figure to number of readings per taken by abundance。Figure 25 D illustrates for GAPDH, and molecular bar code (sorts) figure of the log10 to number of readings per taken by abundance。
Retain 856 cells to be used for analyzing。Figure 26 A illustrates the number gene/cell bar code contrast uniqueness cell number of barcodes/single celled figure expressed in this panel。Figure 26 B illustrates the rectangular histogram of the uniqueness cell bar code of the uniqueness molecule amount/pearl contrast cell number frequency/load given number molecule of detection。One little subgroup of cell shows the mRNA molecule of considerably higher quantity and the number (circled regions referring to Figure 26 A-B) of the gene from the expression of this 111 gene panel。Figure 26 C illustrates the rectangular histogram of the uniqueness cell bar code of the uniqueness GAPDH molecule amount/pearl contrast cell number frequency/load given number molecule of detection。
Principal component analysis (PCA) is used to produce celliferous scatterplot。Figure 27 illustrates the scatterplot of 856 cells。PCA identifies the little subgroup of the cell compared with most cells with different genes express spectra。This subgroup of cell includes 18 cells, is about the 2% of the whole cells analyzed。This percentage ratio is similar to the percentage ratio of this cell of Rameau added in this colony。
Rameau this cell-derived break up mark CD20, CD22, CD19, CD10 and BCL6 from follicular B cell strong expression B cell。This cell of Rameau also expresses IgM and process LAN c-myc。Figure 28 illustrates the thermal map of the expression of front 100 (for the sums of the molecule of detection)。Express the subgroup (18 cells) of the cell of higher levels of mRNA go back strong expression as this cell of Rameau markers with known (such as, CD10, Bcl-6, CD22, C-my and IgM) gene。
These results prove that extensive parallel unicellular order-checking successfully identifies the little subgroup (being low to moderate 2%) of the abnormal cell type in cell suspending liquid。Extensive parallel unicellular order-checking can be used for cancer diagnosis (such as, biopsy/circulating tumor cell)。Because cancerous cell has bigger size and the more mRNA of load, they may be easy to break up from normal cell。
Example 12: use RESOLVE to carry out extensive parallel unicellular full-length genome and the multiplex amplification of gDNA target
Figure 29 illustrates the workflow of this example。As, shown in Figure 29, cell suspending liquid being applied to microwell array (2901)。The number of the cell in cell suspending liquid, less than the number in the hole in microwell array, so makes that this cell suspending liquid is applied to this microwell array and causes that a hole in microwell array comprises 1 or less cell。The pearl (2905) puting together oligonucleotide is applied to this microwell array。The pearl (2905) puting together oligonucleotide comprises the pearl (2910) being attached to oligonucleotide, and this oligonucleotide includes 5' amine (2915), universal primer sequence (2920), cell marking (2925), molecular marker (2930) and random thing (2935)。The pearl puting together oligonucleotide comprises about 1,000,000,000 oligonucleotide。Oligonucleotide comprises 5' amine, universal primer sequence, cell marking, molecular marker and random thing。Each oligonucleotide on single pearl comprises identical cell marking。But, two or more oligonucleotide on single pearl can comprise two or more different molecular markers。Pearl can comprise multiple copies of the oligonucleotide with same molecular labelling。
After the pearl puting together oligonucleotide is added into this microwell array, cell lysis buffer solution is applied to array surface。As shown in Figure 29, hybridize from the random thing sequence (2935) of the genomic DNA (2945) of cell with the pearl (2940) puting together oligonucleotide。Neutralization buffer is added into array surface。Archaeal dna polymerase (such as, Phi29) and dNTP are added into array surface。Random thing sequence (2935) serves as the primer for amplifying genom DNA, thus produces to put together the pearl (2555) of gDNA。The pearl (2955) puting together gDNA includes copying the oligonucleotide of (2955) containing 5' amine (2915), universal primer sequence (2920), cell marking (2925), molecular marker (2925), random thing (2935) and genomic DNA。Original gene group DNA (2945) and random thing (2935) genomic DNA copy (2955) hybridization。For single pearl, multiple different genomic DNA molecule is had to be attached to oligonucleotide。
As shown in Figure 29, the pearl (2950) puting together gDNA from hole is combined in Eppendorf tube (2960)。Genomic DNA on gDNAMDA mixture containing random thing, dNTP and archaeal dna polymerase (such as, Phi29) are added in the Eppendorf tube of the pearl puting together gDNA comprising combination。Labeled genomic DNA is expanded further the labeled amplicon (2965) producing in solution。Labeled amplicon (2965) includes universal primer sequence (2920), cell marking (2925), molecular marker (2930), random thing (2935) and genomic DNA copy (2955)。Labeled amplicon is sheared the relatively fractionlet into about 1kb or less。Alternately, labeled amplicon can pass through Tagmentation (Nextera) fragmentation。Labeled amplicon is sheared or fragmentation produces the fragment (2980) of labelling and unlabelled fragment (2985)。The fragment (2980) of labelling comprises universal primer sequence (2920), cell marking (2925), molecular marker (2930), random thing (2935) and genomic DNA copy (2955) fragment。Aptamer (2970,7975) is added in these fragments。This universal primer sequence can be used to select labeled fragment (2980) by hybridizing drop-down (hybridizationpulldown) or PCR (using this universal primer sequence and the primer for one of aptamer (2970,2975))。
Can to labeled sequencing fragment。The sequence reads that can use the sequence comprising cell marking, molecular marker and genomic fragment identifies the cell colony from cell suspending liquid。Principal component analysis can be used to produce cell scatterplot based on known cell sign thing。Alternately, or additionally, it is possible to use SPADE produces cell cluster figure。Computer software programs can be used to produce a list, and this list includes cell marking and molecular marker and the genomic fragment being associated with this cell marking。
Example 13: extensive parallel order-checking is to identify the cell in heterogeneous population
Experimental work flow process for this example is shown in Figure 30。As shown in Figure 30, the population mixture of cell is randomly dispersed within microwell array。In this example, the population mixture of cell includes the mixture of this cell of Rameau and K562 cell。Cell suspending liquid includes the cell of low concentration, so that each micropore in array comprises 1 or less cell。After cell is applied to this microwell array, multiple pearls puting together oligonucleotide are dispersed randomly on this microwell array。Oligonucleotide pearl comprises multiple containing 5' amine, universal primer sequence, the oligonucleotide of cell marking, molecular marker and few dT。Cell marking from multiple oligonucleotide of single pearl is identical。Single pearl can include the multiple oligonucleotide containing same molecular labelling。Additionally, single pearl can include the multiple oligonucleotide containing different molecular labelling。The cell marking of the oligonucleotide puted together with the first pearl is different from the cell marking of the oligonucleotide puted together with the second pearl。Therefore, cell marking may be used for distinguishing two or more pearls puting together oligonucleotide。By lysis, and the pearl puting together oligonucleotide that will be attached to from single celled RNA molecule in same holes。Figure 30 illustrates that the poly-A sequence of RNA is attached to the few dT sequence of oligonucleotide。After be attached to the pearl puting together oligonucleotide in same holes from the RNA molecule of separate cell, pearl is combined as simple sample。Pearl in this simple sample carries out cDNA synthetic reaction。Figure 30 illustrates that the cDNA product synthesized includes being attached to the pearl of oligonucleotide, and this oligonucleotide comprises 5' amine, universal primer sequence, cell marking, molecular marker, few dT and RNA molecule copy。For simplicity, an oligonucleotide is only described in fig. 30, but, in this example, each pearl puting together oligonucleotide includes about 1,000,000,000 oligonucleotide。As shown in Figure 30, use the universal primer with the hybridization of universal primer hybridization sequences and the gene-specific primer with RNA molecule copy hybridization, the pearl in simple sample is carried out multiplex PCR。Gene-specific primer is designed as and combines extremely from this specific gene of Rameau of the gene panel (genepanel) shown in table 16 or K562 specific gene。As comparison, also GAPDH gene-specific primer is used in this multi-PRC reaction。Finally, use new-generation sequencing that the product of amplification is checked order。Order-checking reading includes the information about cell marking, molecular marker and gene。Use principal component analysis, build the scatterplot of cell based on the sequence information about cell marking, molecular marker and gene。It is similar to and how to use FAC sorting cells and how the scatterplot based on surface marker be used for dividing cell, use cell marking to identify from single celled gene, and use molecular marker to determine the amount of this gene。Then this combined information is used to make gene expression profile relevant to separate cell。As shown in Figure 31 A, use cell to carry out unicellular extensive parallel order-checking with molecular marker and can successfully identify two cell colonys (K562 and this cell of Rameau) in the cell colony of mixing。
Example 14: extensive parallel unicellular order-checking and principal component analysis
In this example, abreast, the mRNA molecule from separate cell is carried out labelling randomly with the pearl puting together oligonucleotide。PBMC is isolatable from blood, and adds in FBS and DMSO freezing at-80 DEG C at RPMI1640。PMBC is thawed and washs three times with PBS。The PBMC sample including cell type (amounting to 4000 cells) mixture is applied at random to agarose microwell array。This agarose microwell array comprises 37,500 cells。Via the PDMS packing ring around microwell array, the mixture of 150,000 pearls puting together oligonucleotide is applied at random to microwell array。The pearl puting together oligonucleotide is described in FIG。For simplicity, the oligonucleotide being attached to pearl is only shown, but, the pearl puting together oligonucleotide comprises about 1,000,000,000 oligonucleotide。
Above continue 10 minutes by microwell array being positioned over cold piece and by lysis buffer is applied to array surface, make lysis。Once the lysis in hole, will be attached on the pearl puting together oligonucleotide from single celled mRNA molecule via few dT sequence。Magnet is applied to this array, and this array lavation buffer solution is washed twice。
The pearl with the mRNA molecule of attachment is combined in Eppendorf tube。Will be attached to the mRNA molecule of pearl and carry out reverse transcription to produce cDNA。Preparing of following cDNA synthetic mixture is as follows:
Component Volume (uL)
Water 8
dNTP(10mM) 2
5x the first chain buffer 4
MgCl2 2.4
SuperRase In 1 108 -->
SMART oligomer (50uM) 0.4
0.1M DTT 1
100x BSA 0.2
SSII 1
Amount to 20
CDNA synthetic mixture is added in the Eppendorf tube of the pearl comprising the mRNA molecule with attachment。On rotator, this Eppendorf tube is hatched 90 minutes at 40 DEG C。Pearl occurs cDNA synthetic reaction。After 90 minutes, magnet is applied to this pipe, and cDNA mixture is removed and replaces with following ExoI reactant mixture:
Component Volume (uL)
ExoI buffer 2
Water 17
ExoI 1
On rotator, pipe is hatched 30 minutes at 37 DEG C。Then pipe is transferred to thermal cycler and continues 15 minutes at 80 DEG C。After being hatched lasting 15 minutes at 80 DEG C by pipe, add the TE+ polysorbas20 of 70 microlitres to this pipe。Magnet is applied to this pipe and removes buffer。Then these pearls are resuspended in the TE+ polysorbas20 of 50 microlitres。
By real-time PCR, the amplification of following amplification mixture is used to be attached to the cDNA of pearl:
Component Volume (uL)
2x iTaq mixture 10
GAPDH ILMN(10uM) 0.6
ILR2(10uM) 0.6
Pearl 2
Water 6.8
Amount to 20
Check order labeled cDNA amplicon to detect cell marking, molecule index and gene。Order-checking reading is compared with cell marking, then gene and last molecular marker。Cell marking that is that join with 4 or more gene-correlation or that be associated with 10 or more uniqueness transcript molecule is assigned to cell, wherein each uniqueness transcript molecule is carried out order-checking more than once。The principal component analysis from the gene of table 9 for all detections is used to identify the gene sets that the change in data has maximum contribution。In this principal component analysis, use 632 is unicellular。Based on sequencing result, 98 genes there are 81 be detected。
Figure 32 illustrates for the GAPDH principal component analysis figure expressed。As shown in Figure 32, based on the position observation in main constituent space to two cell cluster。
Figure 33 A-F illustrates the principal component analysis (PCA) for mononuclear cell related gene。Figure 33 A illustrates the PCA of CD16。Figure 33 B illustrates the PCA of CCRvarA。Figure 33 C illustrates the PCA of CD14。Figure 33 D illustrates the PCA of S100A12。Figure 33 E illustrates the PCA of CD209。Figure 33 F illustrates the PCA of IFNGR1。
Figure 34 A-B illustrates the principal component analysis (PCA) for general T cell mark (CD3)。Figure 34 A illustrates that PCA and Figure 34 B of CD3D illustrates the PCA of CD3E。
Figure 35 A-E illustrates the principal component analysis (PCA) for cd8 t cell related gene。Figure 35 A illustrates the PCA of CD8A。Figure 35 B illustrates the PCA of EOMES。Figure 35 C illustrates the PCA of CD8B。Figure 35 D illustrates the PCA of PRF1。Figure 35 E illustrates the PCA of RUNX3。
Figure 36 A-C illustrates the principal component analysis (PCA) for cd4 t cell related gene。Figure 36 A illustrates the PCA of CD4。Figure 36 B illustrates the PCA of CCR7。Figure 36 C illustrates the PCA of CD62L。
Figure 37 A-F illustrates the principal component analysis (PCA) for B cell related gene。Figure 37 A illustrates the PCA of CD20。Figure 37 B illustrates the PCA of IGHD。Figure 37 C illustrates the PCA of IGHD。Figure 37 D illustrates the PCA of TCL1A。Figure 37 E illustrates the PCA of IGHM。Figure 37 F illustrates the PCA of CD24。[00573] Figure 38 A-C illustrates the principal component analysis (PCA) for natural killer cell related gene。Figure 38 A illustrates the PCA of KIR2DS5。Figure 38 B illustrates the PCA of CD16。Figure 38 C illustrates the PCA of CD62L。
On PC1, two different bunches are formed based on principal component analysis, mononuclear cell and lymphocyte。B, T and NK cell forms another bunch, give over to along PC2 bunch in continuum。Figure 39 illustrates that the GAPDH PCA expressed analyzes, and wherein has the annotation to cell type and cell subsets。Figure 40 depicts a thermal map, it is shown that the dependency in gene expression profile between cell。Along the diagonal started from the upper left corner, these cells are mononuclear cell, initial cd4 t cell, initial cd8 t cell, cytotoxicity cd8 t cell, NK cell and B cell。Figure 41 illustrates the thermal map of another form, it was demonstrated that dependency between gene expression and cell type。Figure 42 illustrates thermal map, it was demonstrated that the dependency of the gene expression profile aspect between gene。
Example 15: disclose cell by digital gene express cell counting method heterogeneous
Presenting the approach of a kind of gene expression cell counting, this approach is by new-generation sequencing and the combination of single celled random bar code。Some thousand of cells random deposition is to the array of about 150,000 micropores。Add the library of the pearl of carrying cell-and transcript-bar code capture probe, so that each cell is assigned to the pearl side with uniqueness cell bar code。After lysis, by mRNA and pearl hybridization, and poly-pond is for reverse transcription, amplification and order-checking。When the transcript with bar code is counted and is assigned to source cell, the digital gene express spectra of each cell is reconstructed。We apply this technology with by human hematopoietic's system analysis to cell subsets, and characterize the immunocyte heterogeneous response for stimulated in vitro。Additionally, the high sensitivity of the method is confirmed by the detection of rare cell (such as antigen-specific T cell and the tumor cell in the normal cell of high background)。
Introduce
Understand the cell diversity in the big collection of cell and function needs measurement specific gene or the albumen expressed by separate cell。Flow cytometry is well set up for measuring single celled protein expression, but mrna expression measurement is typically to carry out in bulk sample, has obscured independent cell contribution。Recently being in the news (1-5) although the micro flow chip using microtitration plate or business carries out the measurement of unicellular mrna expression, these approach are extremely low flux and are difficult to amplification scale。Due to these restrictions, current great majority research is limited in conditions number two aspect of the cell number inquired after and exploration。
Herein, we have developed a kind of height and can amplify the approach of scale, this approach makes it possible to unicellular carry out conventional numerical gene expression spectrum analysis across any number of gene pairs is thousands of。Use small-scale through engineering approaches and combinatorial chemistry with extensive parallel mode to use all mRNA molecules in uniqueness cell barcode label cell。Additionally, be marked with molecular bar code at intracellular each transcript copies, thus allowing absolute digital gene to express measure (6)。The mRNA molecule of the labelling from all cells is carried out poly-pond, amplification and checks order。Use the cell bar code in each sequence and molecular bar code that the digital gene express spectra of each cell is reconstructed。The technology that this height can amplify scale allows for gene expression cell counting, we term it CytoSeq。We are by the multiparameter genetic typing of this technology application to hemopoietic system, and confirm that it is for studying the heterogeneous purposes with the rare cell in detection colony of cell。
Result
CytoSeq
Figure 43 A summarises this program。First cell suspending liquid is loaded on the micro production surface with up to 150,000 micropores。The micropore of each 30 micron diameters has the volume of about 20 picoliters。Regulate cell number so that in 10 or more hole only about 1 receive a cell。Cell passes through gravitational settling in this some holes。
Magnetic bead is loaded into this microwell array to saturated, so that the top of pearl each cell of being positioned partially in hole or adjacent place。The size of pearl is chosen to each micropore can only hold a pearl。About 1,000,000,000 oligonucleotide templates with the structure drawn in Figure 43 B of each magnetic bead load。Each oligonucleotide show general priming site, subsequently for cell marking, molecular marker and widow (dT) catch sequence。All oligonucleotide on each pearl have identical cell marking but comprise various molecular marker。We have invented the separation of combination-poly-pond method, with synthesis, there are nearly 1,000,000 multifarious pearls。It is low (10 by two unicellular probability carrying out labelling by identical cell marking-4In magnitude) because only the hole of about 10% is occupied by unicellular。Similarly, the multiformity of the molecular marker on single pearl is 104In magnitude, and the probability that two of the homologous genes in same cell transcript molecules are carried out labeling by same molecular labelling is also low。
Lysis buffer is applied on the surface of microwell array, and is diffused in these micropores。From the mRNA molecule with poly-(dA) tail of cell release and widow (dT) hybridization on the 3' end of the oligonucleotide pearl。Because cell is adjacent to pearl, under the high salt conditions of lysis buffer and the high local concentrations (tens of nanomole) of mRNA, mRNA molecule is trapped on pearl。
After cracking and hybridization, magnet is used to be collected pipe from microwell array by all pearls。From now on, carry out being responded in single pipe。Conventional scheme (method) is used to carry out cDNA synthesis on pearl。The cDNA molecule covalent being derived from each cell is attached to its corresponding pearl, each on 5' end, is marked with cell marking and molecular marker。Carry out the gene (Figure 55) that Nest multiplex PCR amplification is interested。Because the mRNA from each cell copies on pearl as cDNA, it is possible to these pearls carry out repeated amplification and analysis, for instance, for the different sets of gene。
The order-checking of amplicon is disclosed cell marking, molecular marker and gene identity (Figure 55)。Reading based on cell marking is classified by computational analysis, and is narrowed down to by the reading with same molecular labelling and gene order in single entry to suppress any amplification bias。Use molecular marker to enable us to measure molecule absolute number/cell/gene, and thus allow for the biological sample directly across the different order-checking degree of depth can be experienced and compare cellular expression levels。
The qualification of cell type different in the cell mixture controlled
In order to measure the ability separated by two cell types of the method, the mixture of K562 and the about 1:1 of this cell of Rameau is loaded on the microwell array with 10,000 holes。Use about 1000 cells of about 6000 cell captures。Select the panel with 12 genes, and expand these genes from pearl。This panel is formed (table 18) for the gene of K562 (myelomatosis) cell, 6 specificitys for gene and the house-keeping gene GAPDH of this (follicular lymphoma) cell of Rameau by 5 specificitys。When about 1000 cells are trapped in and each have on 10, the 000-hole arrays of single pearl, only the pearl of 10% answers load mRNA, and should only observe the maximum of 1000 uniqueness cell markings in theory in sequencing data。It practice, (referring to filter criteria method) after data filtering, it has been found that 768 cell markings being associated with the reading of significant number。As a comparison, we carry out whole cell cracking in the microcentrifugal tube of the cell and pearl with similar numbers and mRNA catches, and observing substantial amounts of cell marking, wherein most of only one readings are associated with each cell marking。This demonstrate that microwell array is effective in restriction in the pearl hybridization in single celled mRNA and same holes。
Use principal component analysis (PCA), 768 each gene expression profiles single celled are clustered (Figure 31 A)。First principal component (PC) is clearly divided into two main bunch by unicellular based on cell type。The gene contributing to the front of first principal component is that the negative gene contributing to identical main constituent is for K562 those genes specific for these those genes specific of Rameau。It is negligible for polluting (if any) in this group that successfully clustered to by cell based on cell specific expression between display aperture。This Second principal component, is highlighted the highly variable at the intracellular fetal hemoglobin of K562 (HBG1), and it previously observes (7)。
In another experiment, this (Burkitt lymphoma) cell of Rameau is added in the Naive B cells of healthy individuals by we with several percentage ratios。The panel (table 22) with 111 genes is designed to represent the B cell of different conditions。1198 unicellular are analyzed。Find that a small group colony constituting 18 unicellular (about the 1.5% of colony) has the gene expression pattern (Figure 31 B) different with all the other。The known gene preferentially expressed by this group is associated with Burkitt lymphoma, for instance MYC and IgM and by follicular B cell (it is the B cell subgroup of Burkitt lymphoma origin) specific expressed B cell differentiation mark (CD10, CD20, CD22, BCL6) (Figure 31 C and 31D)。Additionally, this group higher levels of CCND3 and GAPDH of cell loading and overall higher mRNA content, as passed through to index, based on analyzing molecules, (Figure 31 B) that the total number of the uniqueness mRNA molecule detected is determined。This is the discovery that consistent with following facts, and lymphoma cell is bigger than the Naive B cells in healthy individuals physically, and their rapid multiplication produce more substantial transcript。
Identify while multiple cell types in human PBMC
Although the experiment controlled relates to the artificial mixture of two different cell types, but most of naturally occurring biological sample comprises the multiple colony with numerous cell type and state, has more fine distinction in gene expression profile。One prominent example is blood。We carry out an experiment, wherein our purpose is in that by measuring the express spectra each major cell types to the specific panel (table 19) with 98 genes, the simultaneously all of major cell types in surveyor's peripheral blood lymphocytes (PBMC), including mononuclear cell, NK cell and different T cell subgroups and B cell subgroup。Unlike the traditional immunization typing being limited to surface protein mark by majority, we include the Codocyte factor, transcription factor and the gene of the intracellular protein with various cell function also having except surface protein。We use 81 genes existed to analyze the digital gene express spectra (Figure 32-39) of 632 single PBMC with PCA。Mononuclear cell and lymphocyte are clearly divided into two orthogonal bunch by first principal component, such as CD16a, CD14, the expression of S100A12 and CCR2 and confirm in the expression of another bunch of medium-sized lymphocyte related gene in one bunch。Lymphocytic different subtype is in the continuum of Second principal component, wherein B cell (expressing IgM, IgD, TCL1A, CD20, CD24, PAX5) is at one end, T cells (expresses CD4, CCR7, CD62L) in centre, and cytotoxic T cell (expressing CD8A, CD8B, EOMES, PRF1) is at the other end。Express in the natural killer cell killing cell sample immunoglobulin receptor CD16a and perforin (PRF1) space between mononuclear cell and cytotoxic T cell。Further it is observed that cellular metabolism indicant GAPDH is expressed in mononuclear cell with top level and expresses minimum in B cell, thus it is speculated that most of B cell are in tranquillization。The correlation analysis of transcellular gene expression profile has reaffirmed the observed result with PCA, and discloses the additionally less subgroup (Figure 40 A-B) of cell in each major cell types。There is the repeating to test and create greatly similar separation and cell type frequency (Figure 41) of identical PBMC sample of 731 cells。
The research human T cells multiformity to the response of stimulated in vitro
When checking the gene expression pattern of bulk sample, it is made up of the cell of sample and the expression of each gene in each cell type or hypotype facilitates the pattern observed。The two effect can not be disclosed by unitary analysis, but only can disclose with extensive single cell analysis。In order to illustrate, we use our platform to study the human T cells transmutability to the response of stimulated in vitro。
We carry out purification CD3+T cell by carrying out Solid phase from blood donors, and stimulate them to continue 6 hours with the anti-CD3 pearl of anti-CD28/, and adopt the cell through stimulating and the independent aliquot without the cell stimulated to test。We devise the panel (table 20) with 93 genes, and this panel is contained by the different surface proteins of T cell Expression of Subsets, cytokine, chemotactic factor and effector molecule。It is respectively directed to unicellular for total 3517 and 1478 through stimulating and being analyzed without the sample stimulated。
In the sample not stimulated, PCA analyzes and discloses two main cell subsets。Closer to the CD8+ cell observing one subgroup representative expression CD8A of display, CD8B, NKG2D, GZMA, GZMH, GZMK and EOMES to the gene of enrichment in each subgroup, and another subgroup represents the CD4+ cell (Figure 44 A and Figure 45) expressing CD4, CCR7 and SELL。
In the sample through stimulating, the Liang Ge branch of cell is clear immediately to be shown on PCA figure (Figure 44 B and Figure 46 A-D)。This first principal component represent IFNG, TNF, CD69 and GAPDH expression varying level in the separate cell response degree to stimulant。The cell that CCL3, CCL4 and GZMB (they are the cytokine and effector molecule that are associated with cytotoxic T cell) and the expression of mark LAG3 being associated with tired cell are positioned in top set。IL2, LTA, CD40LG and CCL20 (they are the cytokines being associated with helper T cell) expression be positioned to inferior division。Other known activation T cell in raise gene (including ZBED2, IL4R, PRDM1, TBX21, MYC, FOSL1, CSF2, TNFRSF9, BCL2 and FASLG) to be expressed in the cell of smallest number in various degree (Figure 46 A-D)。Great majority in these cytokines, effector molecule and transcription factor are not expressed without the cell in the sample stimulated or are expressed with extremely low level。Although most cells of response are estimated as memory cell in the stimulation period that this is of short duration, but it is observed that small group cell produces the IL2 of reduced levels and does not have other cytokines and effector molecule, and initial cell (Figure 44 B, arrow) can be represented。
In order to understand the heterogeneity in response completely, we based on paired correlation coefficient to cell clusters。Although two main group of CD4 and cd8 cell be it will be evident that but for the combination of the gene of activation expressed and level, in each set, there is significant difference (Figure 47 and Figure 48)。
It is observed that there is several cytokine, i.e. IL4, IL5, IL13, IL17F, IL22, LIF, IL3 and IL21, with without stimulate compared with, in the sample through stimulating, they are raised hundred times or more times as entirety, but are only facilitated (Figure 44 C) by a few cell in sample。The subclass of these cytokines is expressed (Figure 49 A-C) by identical cell。Such as, the great majority of the counting of identical unicellular IL17F and the IL22 of the contributing to feature of Th17 cell (they be)。Other 7 cells express the various combinations of IL4, IL5, IL13 feature of Th2 cell (they be), and express their various combinations。This observed result highlights the importance of extensive single cell analysis, especially when the overall contribution expressing change is derived from rare subgroup。
We are repeated identical stimulation test by the T cell from the second blood donors, and analyze respectively through stimulating and without 669 and 595 single celled spectrograms in the sample stimulated。Although the integral level of activation relatively low (amplitude for just expressing change is less) (may indicate that transmutability between the individuality for stimulating) in this individuality, but it is observed that PCA analyze in same trend and at separate cell to the heterogeneity (Figure 48) in the response of stimulation。
Identify private antigen specific T-cells
We demonstrate our platform in order to use the model of the antigen-specific cellular in CD8+T cell colony to identify the practicality of rare cell。The fresh blood of two identical blood donors is exposed to CMVpp65 peptide pond by us, described donor to cytomegalovirus (CMV) in seropositivity。The independent untreated blood aliquot of each donor is used as negative control。We are subsequently isolated CD8+T cell, and analyze the response through stimulation and the cell without stimulation on our platform。2274,2337,581 and 253 cells the sample that we stimulate from the CMV of donor 2 respectively and do not stimulate and donor 1 CMV stimulates and do not stimulate obtain data。
In clustering analysis, the cell of obvious bunch is formed, main group of two of all the other sample showed cell all (Figure 50 A, 51 and 52) except the negative control of donor 1 produces relatively small number purpose。Cell in a group expresses initial cell and center memory cell Research of predicting markers SELL, CCR7 and CD27, and cell expression effect memory cell (CCL4, CX3CR1, CXCR3) in another group and effector lymphocyte's related gene (EOMES, GZMA, GZMB, GZMH, TBX21, ZNF683)。There is the space occupied between Liang Ge branch and express the different minicell subgroups of granzyme K (GZMK), together with another subgroup of the cell of expression of HLA-DR A。The differential expression of different types of granzyme previously reported (8)。Our result has repeated and has previously used the CyTOF of CD8+T cell those (9) that it was experimentally observed that。
Although significant percentage of cell seems there is response (Figure 52) by expression CD69 and MYC to being exposed to antigen, it has been found that only several cells express IFNG, the characteristic cell factor of the antigen-specific cellular namely activated。The row of those cells of maximum total detection transcript molecule (instruction competent cell state) that the cell of great majority expression IFNG is also in load gene panel, and belong to effect memory/effector lymphocyte bunch (Figure 50 B and 53)。We identify respectively 5 (0.86%) in 581 cells in donor 1 and 2 (0.09%) in 2274 cells in donor 2 express based on IFNG and overall transcryption level to be probably CMV specific。In those cells, for the effector molecule (such as granzyme) of expression and the combination of cytokine (such as IFNG, IL2, CCL3, CCL4, TNF, CSF2, IL4) and level, there is substantial amounts of heterogeneity (Figure 54)。Interested, donor 2 is expressed both monocell expressing IL6 and IL1B of maximum transcript but does not express IFNG。
Discuss
In this example, we present height can expand large-scale mRNA cell counting, and the method uses recurrence Poisson strategy to separate unicellular, uniquely Codocyte content and encode independent molecule, for quantitative analysis。We are it has been shown that the transcript molecule belonging to each cell can be identified and count in the sample comprise some thousand of cells by we simultaneously。Additionally, we have demonstrated that this technology of use to characterize separate cell based on cell express spectra in naturally occurring Heterogeneous systems, and in big background population, detect rare cell。
The flux of CytoSeq and simplicity present the much progress being better than existing approach, and described existing approach relates to microtitration plate or micro flow chip for the measurement based on order-checking to single celled gene expression。Because experimental arrangement is simple, and the reagent of each cell consumes low (within the scope of receiving liter), and it can make technical staff be prone to, across multiple condition, substantial amounts of cell is carried out single cell analysis。Only at this in research, we unicellular carry out gene expression spectrum analysis across 12 experiments to amounting to about 14,600, if this is undertaken being high cost and consuming time by existing approach。Can expanding scale further simply by the following manner by the CytoSeq cell number measured: increase the size of microwell array and have the library size of pearl of bar code, this is easy to be realized by combinatorial compound。Additionally, the uniformity of cell size is not limited, consequently allow for, when without any Pre-sorting, the complex sample comprising the cell (PBMC such as illustrated in this example) with various kinds of cell size and shape is carried out direct analysis。
CytoSeq data class is similar to the data of flow cytometry (FC), but has significant differences。First, CytoSeq provides the more multifunctionality in the number and type of the gene outcome studied。Being different from flow cytometry be mainly restricted to the surface protein of minority and need best combination antibody, CytoSeq allows to measure any mRNA transcribed via nucleic acid amplification technologies。Best design of primers and condition determination enable us to realize about 88% mapping rate (table 21) routinely via multiplex PCR for the optional panel with 100 or more gene。Additionally, each single celled complete transcriptional group in the sample can also be measured via the universal amplification of the cDNA that pearl combines, but technical staff must be noted that the relatively low efficiency of conventional universal amplification technology (7) and steps up the height order-checking degree of depth required for thousand whole transcript profile of cell measurement。
Secondly, compared to relying on the dynamic (dynamical) flow cytometry of antibodies, CytoSeq provides the numeric type absolute reading of gene expression dose by molecule index。It has the higher sensitivity to single rare cell event and specificity, realizes because rare cell is had specific many genes by coexpression by this detection。Therefore, with need a number of event with formed reliably for gate bunch flow cytometry compared with, it consumes lesser amount of sample。
Our data display importance of unicellular contrast unitary analysis。Such as, we show both in the sample as thousands of overall cells the gene of most high expressed is only by the situation of one or several cell contribution。The most important thing is, our experiment shows checks the importance of substantial amounts of cell and substantial amounts of gene in unicellular gene expression research, and this is an extremely restricted ability in existing approach。This can aid in for the unicellular availability to expressing the instrument carrying out general measure of thousands of in biological sample accelerates understanding and promoting the novel application in clinical diagnostics complex biological system, for instance circulating tumor cell assay and immunne response monitoring。It is contemplated that, our extensive parallel unicellular bar code scheme can be also used for measuring genome, together with measuring genome and transcript profile simultaneously, for studying the unicellular genomic instability in such as carcinobiology and neuroscience field。
The synthesis in pearl library
Pearl is to be used by Sai Lula research company (CellularResearch, Inc.) to separate-poly-pond combination approach manufacture。In short, will be assigned in 96 pipes comprising oligomer with 20 microns of carboxy-functionalized magnetic beads, these oligomers have 5' amine, subsequently for universal sequence, for the Part I of cell markings different for different Guan Eryan and joint sequence。By carbodiimide chemist, these oligomers are covalently coupled on these pearls。By poly-for pearl pond and be separated in second group of 96 pipe comprising oligomer, these oligomers have the second joint sequence on 5' end, subsequently for for the Part II of different cell markings different for Guan Eryan and the sequence complementary with the first joint。After hybridizing with the oligomer in solution via the first joint, the oligomer on pearl is extended by archaeal dna polymerase。By poly-for pearl pond and be separated in the 3rd group of 96 pipes comprising oligomer, these oligomers have the widow (dA) on 5' end, subsequently for serving as the random thing sequence of molecular marker, the Part III of cell marking and the sequence complementary with the second joint。After hybridizing with the oligomer in solution via the second joint, the oligomer on pearl is extended by archaeal dna polymerase。Final pearl library be sized to 96x96x96 (884,736) individual cell marking。
Make microwell array
Standard photolithography is used to make microwell array。Cylindrical array is patterned on the photoresist on silicon wafer。PDMS is poured on this wafer to produce the array of micropore。The copy of this wafer uses PDMS microwell array to make as template NOA63 optical adhesive。Before each experiment, agarose (5%, IX-A type, Sigma) microwell array is poured into a mould from NOA63 copy。
Sample preparation
K562 and this cell of Rameau are cultivated in the RPM1-1640 with 10%FBS and 1x Antibiotic-Antimycotic。Naive B cells from healthy donors is available from carefree bioscience (SanguineBiosciences)。PBMC from healthy donors is the fresh whole blood being isolatable from heparin sodium pipe, and it uses LSM solution (stem cell company (StemCell)) to gather from Stamford Blood Center。
T cell stimulates
The Heparinised whole blood of two CMV seropositivity blood donors is to obtain from Stamford Blood Center。CMV is stimulated, the whole blood of 1ml is carried out stimulating persistently 6 hours at 37 DEG C with being diluted in PBS (U.S.A sky Ni biotechnology (MiltenyiBiotec)) the CMVpp65 peptide storehouse of final concentration of 1.81 μ g/ml。The independent aliquot of the whole blood of each donor is hatched with the PBS as negative control。Use RosetteSep mixed liquor (StemCell) to be easily separated in CD8+T cell, and be subsequently deposited on microwell array。The anti-CD28 of anti-CD3/ is stimulated, uses RosetteSepT cell enrichment mixed liquor the T cell from identical two donors to be separated from whole blood, and be resuspended in the RPMI-1640 with 10%FBS and 1x Antibiotic-Antimycotic。With about 1:1 pearl to cells ratio, the cell from each donor aliquot is hatched 6 hours at 37 DEG C together with immunomagnetic beads mankind T-activator (DynabeadsHumanT-Activator) CD3/CD28 (Life Technologies, Inc. (LifeTechnologies))。The aliquot separately of the cell from each donor is positioned in incubator, it does not have stimulate and be used as negative control。
Unicellular catch
Pipetting on microwell array by single-cell suspension liquid pipet, density is about 1 cell/10 micropore。In washing, after removing the cell do not caught, magnetic bead is loaded with about 5 pearls of density/hole with this microwell array saturated。In washing, after removing excessive pearl, Cold lysis buffer (0.1MTris-HClpH7.5,0.5MLiCl, 1%LiSDS, 10mMEDTA, 5mMDTT) is pipetted on the surface of this microwell array with pipet。After magnet sheet being hatched 10 minutes, these pearls are regained from this microwell array。Pearl is collected in microcentrifugal tube, and wash twice with A lavation buffer solution (0.1MTris-HCl, 0.5MLiCl, 1mMEDTA), and wash once with B lavation buffer solution (20mMTris-HClpH7.5,50mMKCl, 3mMMgCl2)。From now on, carry out being responded in single pipe。
CDNA synthesizes
In hybridization case, the pearl of washing is resuspended in the 40 μ LRt mixture (1x the first chain buffer, 1 μ LSuperRase inhibitor, 1 μ LSuperScriptII or SuperScriptIII, MgCl2,1mMdNTP, 0.2ug/ μ LBSA other for 3mM) being placed in the microcentrifugal tube on rotator, continues 50 minutes (when using SuperScriptIII to be used for the earlier trials using K562 and this cell of Rameau) at 50 DEG C or continue 90 minutes (when using SuperscriptII for all the other experiments) at 42 DEG C。The 1 μ LExoI (NEB) being used in by pearl in the 1xExoI buffer of 20 μ L processes 30 minutes at 37 DEG C, and processes 15 minutes at 80 DEG C。
Multiplex PCR and order-checking
Each gene panel comprises by the Primer3 two groups of gene-specific primers designed。Write customization MATLAB script to select PCR primer so that there is minimum 3' end between the primer in group complementary。Primer in each panel is listed in table 21。Amplification scheme is shown in Figure 55。With the quick multiple reagent box (KAPAFastMultiplexKit) of KAPA, pearl is carried out PCR, wherein using each gene-specific primer in the first primer sets of 50nM and 400nM universal primer, volume is 100 μ L or 200 μ L, adopts following recycle scheme: 95 DEG C 3 minutes；15 circulations: 95 DEG C 15 seconds, 60 DEG C 60 seconds, 72 DEG C 90 seconds；72 DEG C 5 minutes。Magnetic bead is reclaimed, and PCR primer 0.7xAmpureXP is purified。The purified product of half is used for next round nest-type PRC, and this next round nest-type PRC adopts the second primer sets, uses identical KAPA test kit and recycle scheme。After purifying with 0.7xAmpureXP, by 1/10thProduct input final PCR reaction, the additional whereby total length hundred million sensible aptamer (P7 of P5,200nM of 1xKAPAHiFiReadyMix, 200nM。95 DEG C 5 minutes；8 circulations: 98 DEG C 15 seconds, 60 DEG C 30 seconds, 72 DEG C 30 seconds；72 DEG C of 5min)。
Data analysis
On hundred million sensible MiSeq instruments, using 150x2bp chemicals to carry out library order-checking, degree of depth intermediate value is 1,600,000 reading/samples。Order-checking discloses the cell marking of each reading, molecular marker and gene (Figure 55)。Comparison comparison software ' bowtie ' (reference) of the gene of each reading completes。Use customization MATLAB script that cell marking and the molecular marker of each reading are analyzed。Reading is first passed through cell marking, then passes through genetic marker and molecular marker is grouped。In order to calculate uniqueness molecule amount/gene/cell, the molecular marker of the reading with same cell labelling and gene comparison is clustered。It is considered as uniqueness bunch more than the editing distance of 1 base, and is thus uniqueness transcript molecule。The each row of the table-in the table building the digital gene expressing information comprising each cell for each sample represents uniqueness cell marking, and each column represents gene, and each entry in this table represents uniqueness numerator counts/cell marking in gene。This table is filtered allow to carry out only once the uniqueness molecule (i.e. redundancy=1) checked order be removed。Subsequently, the coexpression 4 in total for the uniqueness molecule cell less than 10 or panel or more oligogenic cell are removed。Then the table of filtration is used for clustering analysis。Adopt the built-in function in MATLAB to count (wherein adding the spurious counts of 1) for the transcript through Logarithm conversion and carry out principal component analysis and hierarchical cluster。
All these documents are combined in full by incorporated by reference document by reference in example 15 with it:
1.A.K. Sha Leke (Shalek) et al., single cell transcription group discloses the dimorphism (Single-celltranscriptomicsrevealsbimodalityinexpressiona ndsplicinginimmunecells) expressed in immunocyte and in montage. natural (Nature) 498,236 (on January 13rd, 2013)。
This Dorr of 2.S.C. (Bendall) et al., the a large amount of cell counting of single cell (Single-cellmasscytometryofdifferentialimmuneanddrugrespo nsesacrossahumanhematopoieticcontinuum) of diversity immunity and drug reaction in human hematopoietic's continuum. science (Science) 332,687 (on May 6th, 2011)。
3.A.R. Wu (Wu) et al., the qualitative assessment (Quantitativeassessmentofsingle-cellRNA-sequencingmethods) of single cell RNA-sequence measurement. natural method (Naturemethods) 11,41 (in January, 2014)。
4.B. Troit Lay is because of (Treutlein) et al., single cell RNA-seq is used to reconstruct the pedigree grade (Reconstructinglineagehierarchiesofthedistallungepitheliu musingsingle-cellRNA-seq) of far-end lung epithelial. natural (Nature) 509,371 (on May 15th, 2014)。
5.S. Islam (Islam) et al., by height multiple rna-seq, single cell is transcribed the sign (Characterizationofthesingle-celltranscriptionallandscape byhighlymultiplexRNA-seq) of view. genome research (Genomeresearch) 21,1160 (in July, 2011)。
6.G.K. pays (Fu), J. recklessly (Hu), P.H. king (Wang), S.P. good fortune Dorr (Fodor), by being attached not isolabeling at random, independent DNA molecular is counted (CountingindividualDNAmoleculesbythestochasticattachmento fdiverselabels). institute of NAS periodical (ProceedingsoftheNationalAcademyofSciencesoftheUnitedStat esofAmerica) 108,9026 (on May 31st, 2011)。
7.G.K. pays (Fu), J. Wilhelmy (Wilhelmy), D. Stern (Stern), H.C. model (Fan), S.P. good fortune Dorr (Fodor), the digital coding of cell mRNA makes it possible to carry out accurate and absolute gene expression by single numerator counts and measures (DigitalencodingofcellularmRNAsenablingpreciseandabsolute geneexpressionmeasurementbysingle-moleculecounting). analytical chemistry (Analyticalchemistry) 86,2867 (on March 18th, 2014)。
8.K. Bradley special gram (Bratke), M. Pei Er (Kuepper) is bent, B. Ahmedabad (Bade), J.C. Virchow (Virchow), Jr., W. Lv Teman (Luttmann), mankind's granzyme A during CD8+T cell differentiation in natural killer cell and in peripheral blood, B, differential expression (DifferentialexpressionofhumangranzymesA with K, B, andKinnaturalkillercellsandduringCD8+Tcelldifferentiatio ninperipheralblood). Europe Journal of Immunology (Europeanjournalofimmunology) 35, 2608 (in JIUYUE, 2005)。
9.E.W. knob ell (Newell), N. western jar (unit of capacitance) (Sigal), S.C. this Dorr (Bendall), G.P. Nolan (Nolan), M.M. Davis (Davis), combination cytokine-expressing in the continuum of CD8+T cell phenotype and virus-specific cellular position (Cytometrybytime-of-flightshowscombinatorialcytokineexpre ssionandvirus-specificcellnicheswithinacontinuumofCD8+Tc ellphenotypes) are shown by the cell counting of flight time. immunity (Immunity) 36, 142 (on January 27th, 2012)。
Example 16: the exploitation of unicellular quantitative scheme
Figure 56 depicts the general work flow process for the RNA molecule in quantitative sample。In this example, the total number of RNA molecule in the sample is equal to the total number of the RNA molecule in unicellular。As shown in the step 1 at Figure 56, by the territory, poly-A tail region of one group of Molecular Identification substance markers (115) randomer hybridization to RNA molecule, RNA molecule (110) is reversed record and produces cDNA molecule (105)。Molecular Identification substance markers (115) includes few dT district (120), mark zone (125) and general PCR sector (130)。This group Molecular Identification substance markers comprises 960 different types of mark zones。
The reverse transcription of part I.RNA molecule and labelling
RNA sample is prepared by mixing following item:
Gene RNA molecule number
Lys (doped comparison) 456
Phe (doped comparison) 912
Thr (doped comparison) 1824
Dap (doped comparison) 6840
Kan (doped comparison) 7352
Lymphocyte series RNA 10pg (1 cell equivalent)
MS2 carrier (not poly-A) 6x 1011
Labeled rna molecule is carried out by preparing following labelling mixture in Eppendorf tube:
Amount (μ L)
RNA sample 2
ms2RNA 1μg/μL 1
10mM dNTP 1
10 μMs of 960dT oligomer pond (No. 4 groups) 0.4
Water 9.1
Annotation: dT oligomer pond (No. 4 groups) refers to the set of Molecular Identification substance markers。
By hatching 5 minutes at 65 DEG C, Molecular Identification substance markers is hybridized with RNA molecule。Labelling mixture is stored on ice, continues at least 1 minute。
Reverse transcription is carried out by adding the Reverse transcription mix as described below RNA molecule to labelling:
Amount (μ L)
5X the first chain buffer 4
0.1M DTT 1
superase-in 20u/μL 0.5
superscript III RT 1
Once Reverse transcription mix be added in the Eppendorf tube comprising labelling mixture reaction, then by sample incubation is continued 5 minutes in 37 DEG C, is hatched at 50 DEG C and continued 30 minutes and last hatch at 75 DEG C continues to carry out reverse transcription reaction in 15 minutes subsequently。The reverse transcription of labeled RNA molecule creates labeled cDNA molecule (170)。
Once RNA molecule is reversed record and labelling, then by Ampure pearl purification, excessive oligomer is removed (step 2 of Fig. 1) from sample。Carry out Ampure pearl purification in the following manner: the ampure pearl of 20 μ L is added into containing through reverse transcription and labelling RNA molecule Eppendorf tube in, and by pipe incubated at room 5 minutes, by pearl by 70% washing with alcohol to remove excessive oligomer。Remove excessive oligomer upon washing with alcohol, then the 10mMTris of 20 μ L is added in the pipe comprising the labeled cDNA molecule that pearl combines。
As shown in the step 3 at Figure 56, by the cDNA molecule (170) that multiplexed PCR amplification is labeled。The customization amplification of labeled cDNA molecule is by using customization forward primer (in F1, Fig. 1 135) and general PCR primer (140) to carry out。96 different customization forward primers listed by table 23, and these primers are for expanding 96 different genes labeled amplicon (180) to produce in single reaction volume。
In order to optimize multi-PRC reaction, it is prepared for 3 multi-PRC reaction mixture。Multi-PRC reaction 1 is made by:
94 DEG C that the reaction condition of multi-PRC reaction is 1 circulation continue 2 minutes；25 circulations subsequently: 94 DEG C continue 30 seconds, 57 DEG C continue 60 seconds, and 68 DEG C continue 1 minute；Then 1 circulation 68 DEG C continue 7 minutes, and 14 DEG C maintenance circulate。
Multi-PRC reaction 2 and 3 is made by:
Multi-PRC reaction condition for reaction 2 and 3 is that 1 95 DEG C circulated continues 15 minutes；25 circulations subsequently: 94 DEG C continue 30 seconds, 57 DEG C continue 90 seconds, and 72 DEG C continue 1 minute；Then 1 circulation 68 DEG C continue 7 minutes, and 14 DEG C maintenance circulate。
F1 primer pond comprises following primer:
F1PCR primer Sequence 139-->
100611KanF2 CTGCCTCGGTGAGTTTTCTC
Lys_L_269 CTTCCCGTTACGGTTTTGAC
phe_L_177 AAAACCGGATTAGGCCATTA
thr_L_332 TCTCGTCATGACCGAAAAAG
dap_L_276 CAACGCCTACAAAAGCCAGT
Kan, Phe and Dap crt gene is optionally expanded by nest-type PRC。Nido
Pcr amplification reaction is made by:
Annotation: the multi-PRC reaction reacting 1,4 and 7 for PCR is multi-PRC reaction #1。The multi-PRC reaction reacting 2,5 and 8 for PCR is multi-PRC reaction #2。The multi-PRC reaction reacting 3,6 and 9 for PCR is multi-PRC reaction #3。
Primer for nest-type PRC discloses as follows:
It is that 1 94 DEG C circulated continues 2 minutes for reacting the pcr amplification reaction condition of 1-9；30 circulations: 94 DEG C continue 20 seconds, 55 DEG C continue 20 seconds, and 72 DEG C continue 20 seconds；Then 1 circulation 72 DEG C continue 4 minutes, and 14 DEG C maintenance circulate。
The 4 μ LPCR products of pcr amplification reaction 1-9 are run on agarose gel。, as shown in Figure 58 A, reaction 1-3 shows that the existence of Kan crt gene, reaction 4-6 show the existence of this Phe crt gene, and reacts the existence of 7-9 display Dap crt gene。
The PCR primer reacting 1-9 from PCR is prepared for hybridizing on application microarray company (AppliedMicroarrayInc., AMI) array。Hybridization mixture is made by:
μL
PCR primer 20
Washing A (6X SSPE+0.01% triton x-100) 55
Cy3 oligomer (760pM) 1
The corresponding hybridization mixture 1-9 of the mixture of PCR primer of 1-9 will be reacted 95 DEG C of degeneration 5 minutes with comprising from PCR respectively, and be then placed into 4 DEG C。Hybridization mixture is transferred on AMI array chip, and 37 DEG C of overnight incubation。
After Overnight hybridization, this AMI array chip is washed and then scans。Theoretical and actual measurement and percentage ratio accuracy are described as follows:
Annotation: theoretical measurement is based on the detection of the 100% of Kan, Phe and Dap crt gene。
By Ampure purification, the PCR primer carrying out autoreaction 2 is purified。Ampure purification is carried out as follows:
μL
F1PCR product from X01 sample 2 30
Ampure pearl 30
Ampure purification reaction is at room temperature hatched 5 minutes, and then wash in 70% ethanol。The PCR primer of purification is carried out eluting from the pearl 30 μ L water。The concentration of PCR primer is 6ng/ μ L, as determined by Nanodrop spectrogrph。
Part II: scheme is prepared in library
The PCR primer (referring to example 1) from X01 sample 2 purification is used to prepare DNA library。Mix following primer to create F2 primer pond:
F2PCR primer Sequence
Lys_L_269 CTTCCCGTTACGGTTTTGAC
phe_L_177 AAAACCGGATTAGGCCATTA
thr_L_332 TCTCGTCATGACCGAAAAAG 141 -->
dap_L_276 CAACGCCTACAAAAGCCAGT
Mix following item to prepare F2 primer mixture
F2 primer mixture is hatched and continues 3 minutes in 95 DEG C, and be then stored on ice。Following connection mixture is added to F2 primer mixture and connects mixture to produce F2 primer:
F2 primer is connected mixture hatch 1 hour at 37 DEG C, hatch 20 minutes at 65 DEG C subsequently。F2PCR primer is experienced ethanol precipitation, and is determined the concentration in primer pond by Nanodrop spectrophotometer。Resuspension F2 primer pond is to produce following ultimate density: and 1uM is each/and 100uM is total。
As shown in the step 4 at Figure 56, by the amplicon (180) that multiplexed PCR amplification is labeled。96 different customization forward primers (in F2, Fig. 1 145) and general PCR primer (140) is used to expand labeled amplicon (the X01 sample 2 from example 1) in single reaction volume。96 different customization forward primers listed by table 24。
Multi-PRC reaction is made by:
95 DEG C that multiplex PCR condition is 1 circulation continue 15 minutes；18 circulations subsequently: 94 DEG C continue 30 seconds, 57 DEG C continue 90 seconds, and 72 DEG C continue 1 minute；Then 1 circulation 68 DEG C continue 7 minutes, and 14 DEG C maintenance circulate。Multiplex amplification is purified by Ampure purification, and carries out eluting with the water of 50 μ L。By Nanodrop spectrophotometer, the concentration of amplicon is confirmed as 30ng/ μ L。The amplicon of 5 μ L is run (Figure 58 B) on agarose gel。
As shown in the step 5 of Figure 56, aptamer (150,155) is connected on labeled amplicon (180) to produce to be adapted the amplicon (190) of sub-labelling。The amplicon being adapted sub-labelling produces as follows:
Aptamer mixture is hatched 4 hours at 16 DEG C。This amplicon being adapted sub-labelling is purified by Ampure purification, and in the 10mMTris of 20 μ L eluting。
The amplicon being adapted sub-labelling of purification is carried out gap reparation, and carries out pcr amplification, as follows:
72 DEG C that PCR condition is 1 circulation continue 2 minutes, and 94 DEG C continue 1 minute subsequently；12 circulations: 94 DEG C continue 15 seconds, 60 DEG C continue 15 seconds, and 72 DEG C continue 30 seconds；1 circulation 72 DEG C continue 4 minutes, and 14 DEG C maintenance circulate。PCR primer is purified by Ampure purification, and carries out eluting with the TE of 30 μ L。The concentration of the PCR primer of purification is 22ng/ μ L (83nM), as determined by Nanodrop spectrographic method。The PCR purified product of 5 μ L is run (Figure 58 B) on 1% agarose gel
Checked order in the amplicon library being adapted sub-labelling by part III.
MiSeq sequenator is used to be checked order in the amplicon library being adapted sub-labelling。
Sequence map general introduction is shown below:
As shown in the general introduction of above sequence map, many readings are lost owing to strict poly-A mates standard。Figure 59 illustrates reading and the counting of the gene across all detections。
Also use the order-checking quantitative specific gene of reading。Figure 61-62 depicts for different genes, the figure of the labelling (RPLD) of the reading/detection of observation。Conventional rpkm value is also depicted in Figure 61-62 figure described。Figure 59 summarizes the comparison of RPLD and the RPKM for different genes。
Figure 63 depicts the figure to rpld of the total indicator reading (labelling) for different genes。
Also it is shown in Table 25 in digital form in Fig. 4, the data that represent in 7 and 8。
Figure 64 depicts the figure of the RPKM for the gene not detected。
The amount of the doped comparison in the amplicon library being adapted sub-labelling is to be checked order by MiSeq to determine。Illustrate in the following table from the result that doped comparison is carried out MiSeq order-checking。
In upper table, input N refers to the initial number of doped comparison；Reading refers to the total number of reading pair；And labelling (K) refers to the number of the not isolabeling by detection of checking order。It is doped in contrast that Figure 60 A-D describes to be respectively directed to Lys, Phe, Thr and Dap, the figure of the labelling (RPLD) of the reading/detection of observation。Figure 60 E depicts the read-around ratio drawing to input。
Although have shown that and describe the preferred embodiments of the present invention at this, but those of ordinary skill in the art is it will be clear that be only used as citing and provide this type of embodiment。Those of ordinary skill in the art will appreciate that now numerous variant, change and substitutes, without departing from the present invention。It should be understood that the different replacement schemes of embodiments of the invention described herein may be used for implementing the present invention。
Disclosure content before these submission dates being disclosed in the application being provided in only this discussion。It is not construed as admitting that the present invention haves no right because of existing invention at this open prior to these。It addition, the publication date provided is likely to different from actual publication date, actual publication date is likely to need to determine independently。
Embodiment
Disclosed here is method for analyzing the molecule in two or more samples。The method may include that a) by following generation multiple sample labeling nucleic acid: the first sample i) making to include multiple nucleic acid contacts with multiple first sample labels, to produce multiple first sample labeling nucleic acid；And ii) making the second sample including multiple nucleic acid contact with multiple second sample labels, to produce multiple second sample labeling nucleic acid, wherein the plurality of second sample label is different from these the first sample labels；B) the plurality of sample labeling nucleic acid is made to contact with multiple Molecular Identification substance markers, to produce multiple labeled nucleic acid；And c) detect at least one in these labeled nucleic acid, thereby determine that the counting of multiple nucleic acid in multiple samples。One or more in the plurality of sample can include unicellular or cell lysate。One or more in the plurality of sample can be made up of unicellular。Sample label can include cell marking, and this cell marking identifies the cell that labeled nucleic acid therefrom originates from。The plurality of be can come from one or more source by the unicellular sample formed。Sample label can include the sample index area identifying single celled source。Molecular Identification substance markers is properly termed as molecular marker。One or more in the plurality of sample can include less than 1,000,000 cells。One or more in the plurality of sample can include less than 100,000 cells。One or more in the plurality of sample can include less than 10,000 cells。One or more in the plurality of sample can include less than 1,000 cells。One or more in the plurality of sample can include less than 100 cells。One or more in the plurality of sample can include cell lysate。
Alternately, the method for analyzing the molecule in multiple sample may include that a) producing multiple labeled nucleic acid includes: i) making the first sample and more than first sample label contact, wherein this more than first sample label includes identical nucleic acid sequence；Ii) make more than the first sample and first the Molecular Identification substance markers including a different IPs acid sequence contact, thus produce multiple first labeled nucleic acid；Iii) making the second sample and more than second sample label contact, wherein this more than second sample label includes identical nucleic acid sequence；Iv) making more than the second sample and second the Molecular Identification substance markers including a different IPs acid sequence contact, thus produce multiple second labeled nucleic acid, wherein the plurality of labeled nucleic acid includes the plurality of first labeled nucleic acid and the second labeled nucleic acid；And b) determine multiple different labeled nucleic acid, thereby determine that the counting of multiple nucleic acid in multiple samples。Sample label can include cell marking, and this cell marking identifies the cell that labeled nucleic acid therefrom originates from。Sample label can include the sample index area identifying single celled source。Molecular Identification substance markers is properly termed as molecular marker。
Alternately, method for analyzing the molecule in multiple sample may include that and a) makes multiple sample including two or more different nucleic acid contact with multiple sample labels and multiple Molecular Identification substance markers, to produce multiple labeled nucleic acid, wherein: i) the plurality of labeled nucleic acid includes being attached to two or more nucleic acid of two or more sample labels and two or more Molecular Identification substance markers；Ii) the sample label being attached to the nucleic acid of the first sample from the plurality of sample is different from the sample label of the nucleic acid molecules being attached to the second sample from the plurality of sample；And iii) nucleic acid that two or more in same sample are identical is attached to the Molecular Identification substance markers that two or more are different；And b) detect at least some of of these labeled nucleic acid, thereby determine that the counting of two or more different nucleic acid in the plurality of sample。Sample label can include cell marking, and this cell marking identifies the cell that labeled nucleic acid therefrom originates from。Sample label can include the sample index area identifying single celled source。Molecular Identification substance markers is properly termed as molecular marker。
In this further disclosure is the method for analyzing the molecule in multiple sample, the method includes: a) make more than first molecule of the first sample from multiple samples and first group of molecular bar code contact, to produce more than first labeled molecules, wherein the molecular bar code of this more than first molecular bar code includes mark zone and sample index area；B) more than second molecule making the second sample from the plurality of sample contacts with the sub-bar code of second component, to produce more than second labeled molecules, wherein the molecular bar code of this more than second molecular bar code includes mark zone and sample index area, and wherein this more than first molecular bar code and this more than second molecular bar code are at least distinctive in that the sample index area of these molecular bar codes；And c) detect two or more molecules at least some of of these more than first labeled molecules, two or more molecules of the molecules labeled with these more than second at least some of, thereby determines that the counting of two or more molecules in the plurality of sample。This more than first molecule can include nucleic acid molecules。This more than second molecule can include nucleic acid molecules。Mark zone is properly termed as molecular marker。Molecular bar code may further include cell marking。The sample of the plurality of sample is by the unicellular example formed wherein, and this sample index area is properly termed as cell marking。
Disclosed here is the method selecting customization primer, the method includes: a) first pass, and the primer wherein selected includes: i) no more than three continuous print guanines, no more than three continuous print cytosine, no more than four continuous print adenine, and no more than four continuous print thymus pyrimidines；Ii) as guanine or at least the 3 of cytosine, 4,5 or 6 nucleotide；And iii) it is not easy to be formed the sequence of hairpin structure；B) second time, including: i) first round selects multiple sequences that the height with all transcripies covers；And ii) taking turns or taking turns more subsequently, selecting following sequence, this sequence has the highest covering of residue transcript and the complementary score of the sequence with other selections of no more than 4；And c) add sequence to the group selected, until cover sum that is saturated or that customize primer less than or equal to about 96。
In this further disclosure is the method for producing labeled molecular library, the method includes: a) by following generation multiple sample labeling nucleic acid: i) make the first sample including multiple nucleic acid contact with multiple first sample labels, to produce multiple first sample labeling nucleic acid；And ii) making the second sample including multiple nucleic acid contact with multiple second sample labels, to produce multiple second sample labeling nucleic acid, wherein the plurality of first sample label is different from these the second sample labels；And b) make the plurality of sample labeling nucleic acid contact with multiple Molecular Identification substance markers, to produce multiple labeled nucleic acid, thus produce labeled nucleic acid library。
Disclosed here is test kit for analyzing the molecule in multiple sample。This test kit may include that the molecular bar code of a) two or more groups, molecular bar code in the group of wherein one or more molecular bar codes includes sample index area and mark zone, and wherein the sample index area of the molecular bar code in (i) one group of molecular bar code is identical；And the sample index area of (ii) first group of molecular bar code is different from the sample index area of the sub-bar code of second component；And b) multiple pearls。The molecular bar code of two or more groups can be attached to the plurality of pearl。The molecular bar code of two or more groups can be conjugated to this pearl。Mark zone is properly termed as molecular marker。Molecular bar code may further include cell marking。Sample in the plurality of sample is by the unicellular example formed wherein, and this sample index area is properly termed as cell marking。
Test kit for analyzing the molecule in multiple sample may include that the first container a) including more than first molecular bar code, and wherein (i) molecular bar code includes sample index area and mark zone；(ii) in the sum of the molecular bar code of this more than first molecular bar code at least about 80% sample index area be identical；And the mark zone of two or more bar codes in (iii) this more than first molecular bar code is different；And (b) includes the second container of more than second molecular bar code, wherein (i) molecular bar code includes sample index area and mark zone；(ii) in the sum of the molecular bar code of this more than first molecular bar code at least about 80% sample index area be identical；And the mark zone of two or more bar codes in (iii) this more than first molecular bar code is different；Wherein the sample index area of this more than first molecular bar code is different from the sample index area of this more than second molecular bar code。Mark zone is properly termed as molecular marker。Molecular bar code may further include cell marking。The sample of the plurality of sample is by the unicellular example formed wherein, and this sample index area is properly termed as cell marking。
Alternately, the test kit for analyzing the molecule in multiple sample includes: a) including the first container of more than first sample label, wherein the plurality of sample label includes identical nucleic acid sequence；And b) include the second container of more than first Molecular Identification substance markers, wherein the plurality of Molecular Identification substance markers includes two or more different IPs acid sequences。Mark zone is properly termed as molecular marker。Sample in the plurality of sample is by the unicellular example formed wherein, and this sample label is properly termed as cell marking。This test kit may further include: includes the 3rd container of more than first cell marking, and wherein the plurality of cell marking includes two or more different IPs acid sequences。
Test kit disclosed here and method can include the molecular bar code of one or more groups。Test kit disclosed here and method can include one or more molecular bar code。Molecular bar code can include sample index area, molecular marker district, cell marking district or their combination。At least two molecular bar code in one group of molecular bar code can include two or more different mark zones。The mark zone of two or more molecular bar codes in the molecular bar code of two or more groups can be identical。The molecular bar code of two or more groups may include that the molecular bar code including same tag district。Sample in the plurality of sample is by the unicellular example formed wherein, and this sample label is properly termed as cell marking。
Molecular bar code disclosed here can include sample index area。The sample index area of the molecular bar code in the molecular bar code of two or more groups can be different。Sample index area can include one or more nucleotide。Two or more sequences of the sample index area of the molecular bar code of two or more different groups can less than approximately 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10% or 5% homology。Two or more sequences of the sample index area of the molecular bar code of two or more different groups can less than approximately 80% homology。Two or more sequences of the sample index area of the molecular bar code of two or more different groups can less than approximately 60% homology。Two or more sequences of the sample index area of the molecular bar code of two or more different groups can less than approximately 40% homology。Two or more sequences of the sample index area of the molecular bar code of two or more different groups can less than approximately 20% homology。
Molecular bar code disclosed here can include cell marking。The cell marking of the molecular bar code in the molecular bar code of two or more groups can be different。Cell marking can include one or more nucleotide。Two or more sequences of the cell marking of the molecular bar code of two or more different groups can less than approximately 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10% or 5% homology。Two or more sequences of the cell marking of the molecular bar code of two or more different groups can less than approximately 80% homology。Two or more sequences of the cell marking of the molecular bar code of two or more different groups can less than approximately 60% homology。Two or more sequences of the cell marking of the molecular bar code of two or more different groups can less than approximately 40% homology。Two or more sequences of the cell marking of the molecular bar code of two or more different groups can less than approximately 20% homology。
Molecular bar code disclosed here may further include general PCR sector。Molecular bar code may further include target-specific district。Molecular bar code can include one or more nucleotide。Mark zone can include one or more nucleotide。Sample index area can include one or more nucleotide。General PCR sector can include one or more nucleotide。Target-specific district can include one or more nucleotide。
Test kit disclosed here and method can include the sample label of one or more groups。Test kit disclosed here and method can include one or more sample label。Sample label can include sample index area。The sample index area of the sample label of the first sample set of tags can be differently configured from the sample index area of the sample label of the second sample set of tags。Sample index area can include one or more nucleotide。Two or more sequences of the sample index area of the sample label of two or more different groups can less than approximately 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10% or 5% homology。Two or more sequences of the sample index area of the sample label of two or more different groups can less than approximately 80% homology。Two or more sequences of the sample index area of the sample label of two or more different groups can less than approximately 60% homology。Two or more sequences of the sample index area of the sample label of two or more different groups can less than approximately 40% homology。Two or more sequences of the sample index area of the sample label of two or more different groups can less than approximately 20% homology。
Test kit disclosed here and method can include the Molecular Identification substance markers of one or more groups。Test kit disclosed here and method can include one or more Molecular Identification substance markers。Molecular Identification substance markers can include mark zone。The mark zone of two or more Molecular Identification substance markers in one group of Molecular Identification substance markers can be different。Mark zone can include one or more nucleotide。The sequence of the mark zone of two or more Molecular Identification substance markers in one group of Molecular Identification substance markers can less than approximately 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10% or 5% homology。The sequence of the mark zone of two or more Molecular Identification substance markers in one group of Molecular Identification substance markers can less than approximately 80% homology。The sequence of the mark zone of two or more Molecular Identification substance markers in one group of Molecular Identification substance markers can less than approximately 60% homology。The sequence of the mark zone of two or more Molecular Identification substance markers in one group of Molecular Identification substance markers can less than approximately 40% homology。The sequence of the mark zone of two or more Molecular Identification substance markers in one group of Molecular Identification substance markers can less than approximately 20% homology。Mark zone is properly termed as cell marking district。
Test kit disclosed here and method may further include one or more primer。These one or more primers can include the sequence complementary at least partly with general PCR sector。These one or more primers can include and the sequence of general PCR sector at least about 50% complementation。These one or more primers can include and the sequence of general PCR sector at least about 80% complementation。
Test kit disclosed here and method may further include one or more amplification agent。Amplification agent can include the primer panel fixed。Amplification agent can include one or more customization primer。Amplification agent can include one or more comparison primer。Amplification agent can include one or more house-keeping gene primer。Amplification agent can include one or more PCR reagent。These one or more PCR reagent can include polymerase, dideoxyribonucleotide triphosphate (dNTP), buffer or their combination。
Test kit disclosed here and method may further include one or more pearl。Molecular bar code can be attached to this one or more pearls。Sample label can be attached to this one or more pearls。Molecular Identification substance markers can be attached to this one or more pearls。
In this further disclosure is the method for producing the pearl of one or more groups。The method may include that and a) makes multiple first nucleic acid be deposited in multiple hole, and wherein two or more different holes in the plurality of hole can include two or more different nucleic acid of the plurality of nucleic acid；B) making one or more Kong Yuyi or the contact of less pearl in the plurality of hole, to produce multiple single marker beads, single marker beads of plurality of first labeled pearl includes the pearl being attached to the nucleic acid of the plurality of first nucleic acid；C) the plurality of first labeled pearl is converged from the plurality of hole to produce the poly-pond of the first labeled pearl；D) by this poly-pond distribution of the first labeled pearl to multiple holes subsequently, wherein this includes two or more the different nucleic acid in multiple nucleic acid subsequently in two or more holes in multiple holes subsequently；And e) one or more nucleic acid of the plurality of nucleic acid subsequently are attached to one or more first labeled pearl, to produce multiple pearl through uniqueness labelling。
Method disclosed here and test kit may be used for analyzing multiple nucleic acid。Method disclosed here and test kit may be used for analyzing less than about 100,000,000 nucleic acid。Method disclosed here and test kit may be used for analyzing less than about 10,000,000 nucleic acid。Method disclosed here and test kit may be used for analyzing less than about 1,000,000 nucleic acid。In this further disclosure is the method analyzing multiple albumen。The method may include that a) by following generation multiple sample labeling polypeptide: the first sample i) making to include multiple polypeptide contacts with multiple first sample labels, to produce multiple first sample labeling polypeptide；And ii) making the second sample including multiple polypeptide contact with multiple second sample labels, to produce multiple second sample labeling polypeptide, wherein the plurality of first sample label is different from the plurality of second sample label；B) the plurality of sample labeling polypeptide is made to contact with multiple Molecular Identification substance markers, to produce multiple labeled polypeptide；And c) detect at least some of of these labeled polypeptide, thereby determine that the counting of the plurality of polypeptide in the plurality of sample。
The method analyzing the polypeptide in multiple sample may further include the identity determining one or more labeled polypeptide。Determine that the identity of these one or more labeled polypeptide can include mass spectrography。The method may further include the labeled polypeptides in combination of the labeled polypeptide of the first sample and the second sample。Labeled polypeptide can be combined before determining the number of different labeled polypeptide。The method may further include the first sample labeling polypeptide and the second sample labeling polypeptides in combination。The first sample labeling polypeptide and the second sample labeling polypeptide can be combined with the plurality of Molecular Identification substance markers before contacting。Determine that the number of different labeled polypeptide can include detecting at least some of of the labeled polypeptide of labeling。At least some of labelling of the labeled polypeptide of detection labeling can include at least some of of detection sample label, molecular specificity label, polypeptide or their combination。
Method disclosed here can include making multiple sample contact with multiple sample labels and multiple Molecular Identification substance markers。The plurality of sample is made to contact can occur simultaneously with the plurality of sample label and the plurality of Molecular Identification substance markers。The plurality of sample is made to contact can occur parallel with the plurality of sample label and the plurality of Molecular Identification substance markers。The plurality of sample is made to contact can sequentially occur with the plurality of sample label and the plurality of Molecular Identification substance markers。Make the plurality of sample contact with the plurality of sample label can occur before making the plurality of sample contact with the plurality of Molecular Identification substance markers。Make the plurality of sample contact with the plurality of sample label can occur after making the plurality of sample contact with the plurality of Molecular Identification substance markers。
Method disclosed here can include making the first sample and more than first sample label and more than first Molecular Identification substance markers contact。Make the first sample and more than first sample label and more than first Molecular Identification substance markers contact to occur simultaneously。The first sample and more than first sample label and more than first Molecular Identification substance markers contact is made to occur parallel。The first sample and more than first sample label and more than first Molecular Identification substance markers contact is made sequentially to occur。Make the first sample and more than first sample label contact can occur before making the first sample and more than first Molecular Identification substance markers contact。Make the first sample and more than first sample label contact can occur after making the first sample and more than first Molecular Identification substance markers contact。
Method disclosed here can include making the second sample and more than second sample label and more than second Molecular Identification substance markers contact。Make the second sample and more than second sample label and more than second Molecular Identification substance markers contact to occur simultaneously。The second sample and more than second sample label and more than second Molecular Identification substance markers contact is made to occur parallel。The second sample and more than second sample label and more than second Molecular Identification substance markers contact is made sequentially to occur。Make the second sample and more than second sample label contact can occur before making the second sample and more than second Molecular Identification substance markers contact。Make the second sample and more than second sample label contact can occur after making the second sample and more than second Molecular Identification substance markers contact。
Method disclosed here and test kit may further include two or more samples of combination。Test kit disclosed here and method may further include combination the first sample and the second sample。The first and second samples can be combined before contacting with the plurality of Molecular Identification substance markers。The first and second samples can be combined before the nucleic acid that detection is labeled。The two or more sample can be combined before two or more molecules in two or more samples of labelling randomly。The two or more sample can be combined after two or more molecules in two or more samples of labelling randomly。The two or more sample can be combined before two or more molecules in detecting two or more samples。The two or more sample can be combined after two or more molecules in detecting two or more samples。The two or more sample can be combined before two or more molecules in analyzing two or more samples。The two or more sample can be combined after two or more molecules in analyzing two or more samples。The two or more sample can be combined before two or more molecules in two or more samples are carried out one or more mensuration。The two or more sample can be combined after two or more molecules in two or more samples are carried out one or more mensuration。
Method disclosed here and test kit can include two or more molecules in sample are carried out one or more mensuration。These one or more mensuration can include one or more amplified reaction。Method disclosed here and test kit may further include and carry out one or more amplified reaction to produce labeled nucleic acid amplicon。These labeled nucleic acid can be expanded before the nucleic acid that detection is labeled。The present invention further includes at before carrying out one or more amplified reaction and combines the first and second samples。
Amplified reaction can include expanding at least some of sample label。Amplified reaction can include expanding at least some of labelling。Amplified reaction can include expanding at least some of sample label, labelling, nucleic acid or their combination。Amplified reaction can include expanding at least about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or the 100% of the nucleic acid sum of multiple nucleic acid。Amplified reaction can include expanding at least about the 1% of the nucleic acid sum of multiple nucleic acid。Amplified reaction can include expanding at least about the 5% of the nucleic acid sum of multiple nucleic acid。Amplified reaction can include expanding at least about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or the 100% of the sum of the labeled nucleic acid of multiple labeled nucleic acid。Amplified reaction can include expanding at least about the 1% of the labeled nucleic acid of multiple labeled nucleic acid。Amplified reaction can include expanding the sum of the labeled nucleic acid of multiple labeled nucleic acid at least about 5% sum。Amplified reaction can include expanding at least about the 10% of the sum of the labeled nucleic acid of multiple labeled nucleic acid。Amplified reaction can include expanding the sum of the nucleic acid of multiple nucleic acid less than about 95%, 90%, 80%, 70%, 60% or 50%。Amplified reaction can include expanding the sum of the nucleic acid of multiple nucleic acid less than about 50%。Amplified reaction can include expanding the sum of the nucleic acid of multiple nucleic acid less than about 20%。Amplified reaction can include expanding the sum of the nucleic acid of multiple nucleic acid less than about 10%。Amplified reaction can include expanding the sum of the labeled nucleic acid of multiple labeled nucleic acid less than about 95%, 90%, 80%, 70%, 60% or 50%。Amplified reaction can include expanding the sum of the labeled nucleic acid of multiple labeled nucleic acid less than about 40%。Amplified reaction can include expanding the sum of the labeled nucleic acid of multiple labeled nucleic acid less than about 25%。Amplified reaction can include expanding the sum of the labeled nucleic acid of multiple labeled nucleic acid less than about 10%。
These one or more amplified reactions can cause the amplification of about 1,2,5,10,15,20,25,30,35,40,45,50,55,60,65,70,75,80,85,90,95,100,200,300,400,500,600,700,800,900 or 1000 labeled target nucleic acids in sample。These one or more amplified reactions can cause the amplification of about 2000 target nucleic acids in sample。These one or more amplified reactions can cause the amplification of about 1000 target nucleic acids in sample。These one or more amplified reactions can cause the amplification of about 2000 target molecules。These one or more amplified reactions can cause the amplification of about 100 target nucleic acids in sample。
Amplified reaction can include one or more polymerase chain reaction (PCR)。These one or more multiplex PCRs can include multiplex PCR, nest-type PRC, absolute PCR, HD-PCR, next generation PC R, numeral RTA or their any combination。These one or more polymerase chain reactions can include multiplex PCR。These one or more polymerase chain reactions can include nest-type PRC。
Carry out one or more amplified reaction can include using one or more primer。These one or more primers can include one or more oligonucleotide。These one or more oligonucleotide can include at least about 7-9 nucleotide。These one or more oligonucleotide can include less than 12-15 nucleotide。These one or more primers can be annealed at least some of of multiple labeled nucleic acid。These one or more primers can be annealed to 3 ' ends and/or the 5 ' ends of multiple labeled nucleic acid。These one or more primers can be annealed to the inner area of multiple labeled nucleic acid。Inner area can be hold from the 3 ' of the plurality of labeled nucleic acid at least about 50, 100, 150, 200, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 650, 700, 750, 800, 850, 900 or 1000 nucleotide。Inner area can be at least about 2000 nucleotide held from the 3 ' of the plurality of labeled nucleic acid。These one or more primers can include the primer panel fixed。These one or more primers can include at least one or more customization primer。These one or more primers can include at least one or more comparison primer。These one or more primers can include at least one or more house-keeping gene primer。These one or more oligonucleotide can include the sequence being selected from lower group, and this group is made up of the sequence in table 1。These one or more primers can include universal primer。Universal primer can be annealed to universal primer binding site。Universal primer can be annealed to general PCR sector。These one or more customization primers can be annealed at least some of of sample label。These one or more customization primers can be annealed at least some of of Molecular Identification substance markers。These one or more customization primers can be annealed at least some of of molecular bar code。These one or more customization primers can be annealed to the first sample label, the second sample label, Molecular Identification substance markers, nucleic acid or their product。These one or more primers can include universal primer and customization primer。These one or more primers can include at least about 96 or more customization primer。These one or more primers can include at least about 960 or more customization primer。These one or more primers can include at least about 9600 or more customization primer。These one or more customization primers can be annealed to two or more different labeled nucleic acid。These two or more different labeled nucleic acid can correspond to one or more gene。
Multi-PRC reaction can include nest-type PRC reaction。Nest-type PRC reaction may include that the pair of primers including the first primer and the second primer。The district of one or more nucleic acid that the first primer can be annealed in the plurality of nucleic acid。The district of these one or more nucleic acid can be 3 ' end at least about 300 to 400 nucleotide from these one or more nucleic acid。The district of one or more nucleic acid that the second primer can be annealed in the plurality of nucleic acid。The district of these one or more nucleic acid can be 3 ' at least 200 to 300 nucleotide of end from these one or more nucleic acid。
Method disclosed here and test kit may further include the one or more cDNA copy carrying out one or more cDNA synthetic reaction to produce these molecules or their derivant (such as labeled molecule)。These one or more cDNA synthetic reactions can include one or more reverse transcription reaction。
Method disclosed here and test kit can include one or more sample。Method disclosed here and test kit can include multiple sample。The plurality of sample can include at least about 2,3,4,5,10,20,30,40,50,60,70,80,90 or 100 or more sample。The plurality of sample can include at least about 100,200,300,400,500,600,700,800,900 or 1000 or more sample。The plurality of sample can include at least about 1000,2000,3000,4000,5000,6000,7000,8000 samples, 9000 or 10,000 samples or 100,000 samples or 1,000,000 or more sample。The plurality of sample can include at least about 10,000 samples。The plurality of sample can include at least about 2 samples。The plurality of sample can include at least about 5 samples。The plurality of sample can include at least about 10 samples。The plurality of sample can include at least about 50 samples。The plurality of sample can include at least about 100 samples。
Method disclosed here and test kit can include one or more sample, and these one or more samples include one or more cell。Method disclosed here and test kit can include two or more samples, these two or more include one or more cell。First sample can include one or more cell。Second sample can include one or more cell。One or more cells of the first sample can have the cell type identical with one or more cells of the second sample。
Method disclosed here and test kit can include multiple sample。The plurality of sample can come from one or more experimenter。The plurality of sample can come from two or more experimenters。The plurality of sample can come from same experimenter。These two or more experimenters can come from same species。These two or more experimenters can come from different plant species。The plurality of sample can come from one or more source。The plurality of sample can come from two or more sources。The plurality of sample can come from same experimenter。These two or more source can come from same species。These two or more source can come from different plant species。
The plurality of sample can be obtained parallel。Can sequentially obtain the plurality of sample。The plurality of sample can be obtained through two or more periods。These two or more periods can at a distance of one or more hours。These two or more periods can at a distance of one day or many days。These two or more periods can at a distance of one week or how all。These two or more periods can at a distance of one or more moons。These two or more periods can at a distance of 1 year or for many years。
The plurality of sample can come from one or more body fluid, tissue, cell, organ or muscle。The plurality of sample can include one or more blood sample。
Method disclosed here and test kit can include one or more sample, and these one or more samples include one or more nucleic acid。Two or more samples can include one or more nucleic acid。Two or more samples can include two or more nucleic acid。One or more nucleic acid of the first sample can be differently configured from one or more nucleic acid of the second sample。Nucleic acid in first sample can be at least about 50% identical with the nucleic acid in the second sample。Nucleic acid in first sample can be at least about 70% identical with the nucleic acid in the second sample。Nucleic acid in first sample can be at least about 80% identical with the nucleic acid in the second sample。
Multiple nucleic acid in these one or more samples can include two or more identical sequences。In these one or more samples at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% total nucleic acid can include identical sequence。Multiple nucleic acid in one or more samples can include at least two difference sequence。In these one or more samples at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% total nucleic acid can include different sequence。
The plurality of nucleic acid can include other nucleic acid content of RNA, DNA, cDNA, mRNA, genomic DNA, tiny RNA, non-coding RNA or cell。The plurality of nucleic acid can include mRNA。The plurality of nucleic acid can include RNA。The plurality of nucleic acid can include mRNA。The plurality of nucleic acid can include DNA。
Method disclosed here and test kit can include one or more sample label。Method disclosed here and test kit can include one or more multiple sample labels。These sample labels can include sample index area。The sample index area of more than first sample label can be differently configured from the sample index area of more than second sample label。These sample labels can include one or more nucleotide。
These sample labels can include at least about 5,10,15,20,25,30,35,40,45,50,55,60,65,70,75,80,85,90,95 or 100 nucleotide。These sample labels can include at least about 5 or more nucleotide。These sample labels can include at least about 10 or more nucleotide。These sample labels can include less than about 200 nucleotide。These sample labels can include less than about 100 nucleotide。These sample labels can include less than about 60 nucleotide。
These sample labels may further include universal primer binding site。These sample labels may further include general PCR sector。These sample labels may further include one or more aptamer district。These sample labels may further include one or more target-specific district。
Method disclosed here and test kit can include one or more Molecular Identification substance markers。Method disclosed here and test kit can include one or more multiple Molecular Identification substance markers。These one or more multiple Molecular Identification substance markers can include two or more different moleculars and identify substance markers。These one or more multiple Molecular Identification substance markers can include 50 or more different molecular qualification substance markers。These one or more multiple Molecular Identification substance markers can include 90 or more different molecular qualification substance markers。These one or more multiple Molecular Identification substance markers can include 100 or more different molecular qualification substance markers。These one or more multiple Molecular Identification substance markers can include 300 or more different molecular qualification substance markers。These one or more multiple Molecular Identification substance markers can include 500 or more different molecular qualification substance markers。These one or more multiple Molecular Identification substance markers can include 960 or more different molecular qualification substance markers。These one or more multiple Molecular Identification substance markers can include multiple copies of one or more Molecular Identification substance markers。Two or more multiple Molecular Identification substance markers can include one or more same molecular and identify substance markers。Two or more multiple Molecular Identification substance markers can include 10 or more same molecular qualification substance markers。The Molecular Identification substance markers of more than first Molecular Identification substance markers can be at least about 30% identical with the Molecular Identification substance markers of more than second Molecular Identification substance markers。The Molecular Identification substance markers of more than first Molecular Identification substance markers can be at least about 50% identical with the Molecular Identification substance markers of more than second Molecular Identification substance markers。The Molecular Identification substance markers of more than first Molecular Identification substance markers can be at least about 80% identical with the Molecular Identification substance markers of more than second Molecular Identification substance markers。
Molecular Identification substance markers can include mark zone (such as molecular marker district, molecule index area)。The mark zone of two or more Molecular Identification substance markers of the Molecular Identification substance markers of more than first can be different。One or more multiple Molecular Identification substance markers can include at least about 20 different mark zones。One or more multiple Molecular Identification substance markers can include at least about 50 different mark zones。One or more multiple Molecular Identification substance markers can include at least about 96 different mark zones。One or more multiple Molecular Identification substance markers can include at least about 200 different mark zones。One or more multiple Molecular Identification substance markers can include at least about 500 different mark zones。One or more multiple Molecular Identification substance markers can include at least about 960 different mark zones。
These Molecular Identification substance markers can include at least about 1,2,3,4,5,6,7,8,9,10 or more nucleotide。These Molecular Identification substance markers can include at least about 20,30,40,50 or more nucleotide。These Molecular Identification substance markers can include at least about 21 nucleotide。
These Molecular Identification substance markers may further include target-specific district。Target-specific district can include few dT sequence。
These Molecular Identification substance markers may further include one or more dye marker。These Molecular Identification substance markers may further include Cy3 dyestuff。These Molecular Identification substance markers may further include Tye563 dyestuff。
Method disclosed here and test kit can include one or more labeled molecule。One or more labeled molecule can be produced by making multiple molecule contact with multiple sample labels。One or more labeled molecule can be produced by making multiple nucleic acid contact with multiple sample labels。Make multiple nucleic acid contact with multiple sample labels can include one or more sample labels are connected to one or more nucleic acid。Make multiple nucleic acid contact with multiple sample labels can include one or more sample labels are hybridized to one or more nucleic acid。Make multiple nucleic acid contact with multiple sample labels can include carrying out one or more nucleic acid reaction of propagation。These one or more nucleic acid reactions of propagation can include reverse transcription。
Method disclosed here and test kit may further include and one or more oligonucleotide joints are attached to the plurality of nucleic acid。These methods and test kit may further include and one or more oligonucleotide joints are attached to this sample labeling nucleic acid。These methods and test kit may further include and one or more oligonucleotide joints are attached to these labeled nucleic acid。These one or more joints can include at least about 10 nucleotide。
Method disclosed here and test kit may further include and one or more labeled nucleic acid are attached to holder。This holder can include solid support。This holder can include pearl。Holder can include array。Holder can include microscope slide。
Labeled nucleic acid is attached to holder and can include amine-mercaptan crosslinking, maleimide crosslinking, N-hydroxy-succinamide or N-hydroxy thiosuccinimide, pool agriculture (Zenon), site click (SiteClick) or their combination。Labeled nucleic acid is attached to holder can include biotin is attached to one or more labeled nucleic acid。
Holder can include one or more pearl。These one or more pearls can include coated pearl。Coated pearl can be coated with streptavidin。
Holder can include array。Holder can include one or more probe。Labeled nucleic acid can be attached to this one or more probes。These one or more probes can include one or more oligonucleotide。These one or more probes can be attached at least some of of labeled nucleic acid。The part being attached to the labeled nucleic acid of these one or more probes can include at least one of sample label, Molecular Identification substance markers, molecular bar code, nucleic acid or their combination。
Holder can include microscope slide。This microscope slide can include one or more hole。One or more hole can be etched on microscope slide。These one or more holes can include at least 960 holes。This microscope slide can include one or more probe。These one or more probes can be printed on this microscope slide。These one or more holes may further include one or more probe。These one or more probes can be printed in these one or more holes。One or more probes can include 960 nucleic acid。These nucleic acid can be different。These nucleic acid can be identical。
The counting of one or more molecules that method disclosed here and test kit are determined in one or more samples。Determine that the counting of one or more molecule can include determining that the number of different labeled nucleic acid。Determine that the number of different labeled nucleic acid can include at least some of of the labeled nucleic acid of detection。Detect labeled nucleic acid can include at least partially detect at least one of sample label, Molecular Identification substance markers, molecular bar code, nucleic acid or their combination。
Determine that the number of different labeled nucleic acid can include order-checking。Order-checking can include MiSeq order-checking。Order-checking can include HiSeq order-checking。Determine that the number of different labeled nucleic acid can include array。Determine that the number of different labeled nucleic acid can include making labeled nucleic acid contact with one or more probes。
Determine that the number of different labeled nucleic acid can include making labeled nucleic acid and array contact。Array can include multiple probe。Determine that the number of different labeled nucleic acid can include making labeled nucleic acid contact with the microscope slide of multiple probes。
Determine that the number of different labeled nucleic acid can include labeled probe hybridization, target-specific amplification, target-specific order-checking, carry out checking order for the labeled nucleotide of the little nucleotide polymorphisms of target with specificity, carry out checking order for the labeled nucleotide of digestion with restriction enzyme pattern with specificity, carry out checking order for the labeled nucleotide of sudden change with specificity or their combination。
Determine that the number of different labeled nucleic acid can include the selected by flow cytometry apoptosis of sequence-specific labelling。Determine that the number of different labeled nucleic acid can include detecting the labeled nucleic acid being attached to pearl。Detection is attached to the labeled nucleic acid of pearl can include fluoroscopic examination。
Determine that the number of different labeled nucleic acid can include, by the FRET (fluorescence resonance energy transfer) (FRET) between target-specific probe and labeled nucleic acid or the labeled label probe of target-specific, multiple labeled nucleic acid being counted。Determine that the number of different labeled nucleic acid can include labeled nucleic acid is attached to holder。
Method disclosed here and test kit may further include the immunoprecipitation of target sequence and nucleic acid binding protein。
Method disclosed here and test kit may further include and be allocated in multiple holes of microwell plate by multiple samples。One or more in the plurality of sample can include multiple cell。One or more in the plurality of sample can include multiple nucleic acid。Method disclosed here and test kit may further include and distribute one or less cell to multiple holes。The plurality of cell can be cracked in microwell plate。Method disclosed here and test kit may further include synthesis cDNA in microwell plate。Synthesis cDNA can include the reverse transcription of mRNA。
Method disclosed here and test kit may further include and multiple first sample labels, multiple second sample label, multiple Molecular Identification substance markers or its any combination be allocated in microwell plate。
Method disclosed here and test kit may further include and be allocated in microwell plate by one or more pearls。Microwell plate can include being manufactured by soft lithographic on PDMS, etch on silicon, on microscope slide etching, on microscope slide the microwell plate of photoresist patterned or its combination。Micropore can include the hole on microcapillary plate。Microwell plate can include water in oil emulsion。Microwell plate can include at least one or more hole。Microwell plate can include at least about 6 holes, 12 holes, 48 holes, 96 holes, 384 holes, 960 holes or 1000 holes。
Method disclosed here and test kit may further include chip。Microwell plate can be attached to chip。Chip can include at least about 6 holes, 12 holes, 48 holes, 96 holes, 384 holes, 960 holes, 1000 holes, 2000 holes, 3000 holes, 4000 holes, 5000 holes, 6000 holes, 7000 holes, 8000 holes, 9000 holes, 10,000 hole, 20,000 hole, 30,000 hole, 40,000 hole, 50,000 hole, 60,000 hole, 70,000 hole, 80,000 hole, 90,000 holes, 100,000 holes, 200,000 hole, 500,000 holes or 1,000,000 holes。Hole can include at least about 300 microns2, 400 microns2, 500 microns2, 600 microns2, 700 microns2, 800 microns2, 900 microns2, 1000 microns2, 1100 microns2, 1200 microns2, 1300 microns2, 1400 microns2, 1500 microns2Area。Method disclosed here and test kit may further include the sample distributed on chip between about 10,000 and 30,000。
Method disclosed here and test kit may further include diagnosis to the disease in its subject in need, disease or imbalance。
Method disclosed here and test kit may further include prediction to the disease in its subject in need, disease or imbalance。Method disclosed here and test kit may further include the treatment determined for the disease in its subject in need, disease or imbalance。
The plurality of sample can include the one or more samples from the experimenter suffering from disease or disease。The plurality of sample can include the one or more samples from health volunteer。
What disclose further at this is the method for forensic analysis, and the method includes: a) randomly two or more molecules in two or more samples of labelling to produce two or more labeled molecules；And b) detect this two or more labeled molecule。
The method selecting customization primer may further include and selects customization primer based on one or more nucleic acid。These one or more nucleic acid can include mRNA transcript, non-coding transcripts (including structure RNA), the pseudogene transcribed, the model mRNA provided by genome annotation process, corresponding to the sequence of genome contig or their any combination。These one or more nucleic acid can be RNA。These one or more nucleic acid can be mRNA。These one or more nucleic acid can include one or more exon。The method selecting customization primer may further include the nucleic acid being enriched with one or more subgroups。These one or more subgroups include low abundance mRNA。The method selecting customization primer may further include computational algorithm。
Method disclosed here and test kit can include using one or more comparison。These one or more comparisons are doped comparisons。These one or more comparisons can include nucleic acid。These one or more samples including multiple nucleic acid can be mixed with one or more comparison nucleic acid。These one or more comparison nucleic acid may be used for measuring the efficiency producing labeled nucleic acid library。
Method disclosed here and test kit may be used for producing one or more nucleic acid library。These one or more nucleic acid library can include multiple labeled nucleic acid or their derivant (such as labeled amplicon)。The method producing labeled nucleic acid library can include with two or more nucleic acid in the molecular bar code of two or more groups two or more samples of labelling randomly, to produce multiple labeled nucleic acid。The method producing labeled nucleic acid library can include making two or more samples contact with multiple sample labels and multiple molecular specificity marker, to produce multiple labeled nucleic acid。Labeled nucleic acid can include sample index area, mark zone and nucleic acid district。That sample index area may be used for giving sample or subsample identity is to nucleic acid。Sample index area is determined for the source of nucleic acid。Mark zone may be used for giving unique identity to nucleic acid, so that two or more identical nucleic acids can distinguished in same sample or subsample。
The method producing nucleic acid library may further include the one or more labeled nucleic acid of amplification, to produce the labeled nucleic acid of one or more enrichment。The method may further include the experiment (pull-downassay) of leaving behind of the labeled nucleic acid carrying out one or more enrichment。The method may further include the labeled nucleic acid of these one or more enrichments of purification。
Test kit disclosed here can include multiple pearl, primer and/or amplification agent。One or more test kits may be used for analyzing at least about 10,20,30,40,50,60,70,80,90 or 100 or more sample or subsample。One or more test kits may be used for analyzing at least about 96 samples。One or more test kits may be used for analyzing at least about 384 samples。Test kit may further include the description for design of primers and optimization。
Test kit may further include one or more microwell plate。These one or more microwell plates may be used for distributing one or more pearl。These one or more microwell plates may be used for distributing the one or more molecules from one or more samples or their derivant (such as labeled molecule, labeled amplicon)。
Test kit may further include one or more other container。These one or more other containers can include one or more other multiple sample labels。One or more other multiple sample labels in one or more other containers can be differently configured from more than first sample label in the first container。These one or more other containers can include one or more other multiple Molecular Identification substance markers。One or more other multiple Molecular Identification substance markers of these one or more other containers can be at least about 50% identical with the one or more other Molecular Identification substance markers of second container。One or more other multiple Molecular Identification substance markers of these one or more other containers can be at least about 80% identical with the one or more other Molecular Identification substance markers of second container。One or more other multiple Molecular Identification substance markers of these one or more other containers can be at least about 90% identical with the one or more other Molecular Identification substance markers of second container。
The method producing one or more groups labeled pearl is further disclosed at this。The method producing one or more groups labeled pearl can include one or more nucleic acid are attached to one or more pearl, thus produces one or more groups labeled pearl。These one or more nucleic acid can include one or more molecular bar code。These one or more nucleic acid can include one or more sample label。These one or more nucleic acid can include one or more Molecular Identification substance markers。These one or more nucleic acid can include a) guiding region；B) sample index area；And c) joint or aptamer district。These one or more nucleic acid can include a) guiding region；B) mark zone；And c) joint or aptamer district。These one or more nucleic acid can include a) sample index area；And b) mark zone。These one or more nucleic acid may further include guiding region。These one or more nucleic acid may further include target-specific district。These one or more nucleic acid may further include joint area。These one or more nucleic acid may further include aptamer district。These one or more nucleic acid may further include sample index area。These one or more nucleic acid may further include mark zone。
Can be at least about 70% identical for the guiding region of the nucleic acid of pearl one group labeled。Can be at least about 90% identical for the guiding region of the nucleic acid of pearl one group labeled。Guiding region for the nucleic acid of pearl one group labeled can be identical。
Can be at least about 70% identical for the sample index area of the nucleic acid of pearl one group labeled。Can be at least about 90% identical for the sample index area of the nucleic acid of pearl one group labeled。Sample index area for the nucleic acid of pearl one group labeled can be identical。About 40% can be less than identical for the sample index area of the nucleic acid of the sample indexation pearl of two or more groups。About 50% can be less than identical for the sample index area of the nucleic acid of the sample indexation pearl of two or more groups。About 60% can be less than identical for the sample index area of the nucleic acid of the sample indexation pearl of two or more groups。Sample index area for the nucleic acid of the sample indexation pearl of two or more groups can be different。
Can be at least about 70% identical for the mark zone of the nucleic acid of the labeled pearl of two or more groups。Can be at least about 90% identical for the mark zone of the nucleic acid of the labeled pearl of two or more groups。Mark zone for the nucleic acid of the labeled pearl of two or more groups can be identical。About 40% can be less than identical for the mark zone of the nucleic acid of pearl one group labeled。About 50% can be less than identical for the mark zone of the nucleic acid of pearl one group labeled。About 60% can be less than identical for the mark zone of the nucleic acid of pearl one group labeled。Mark zone for two or more nucleic acid of pearl one group labeled can be different。
Can be at least about 70% identical for the connector area of nucleic acid of pearl one group labeled or aptamer district。Can be at least about 90% identical for the connector area of nucleic acid of pearl one group labeled or aptamer district。The connector area of nucleic acid or aptamer district for pearl one group labeled can be identical。
Can be at least about 70% identical for the target-specific district of the nucleic acid of the target-specific pearl of two or more groups。Can be at least about 90% identical for the target-specific district of the nucleic acid of the target-specific pearl of two or more groups。Target-specific district for the nucleic acid of the target-specific pearl of two or more groups can be identical。About 40% can be less than identical for the target-specific district of the nucleic acid of one group of target-specific pearl。About 50% can be less than identical for the target-specific district of the nucleic acid of one group of target-specific pearl。About 60% can be less than identical for the target-specific district of the nucleic acid of one group of target-specific pearl。Target-specific district for two or more nucleic acid of one group of target-specific pearl can be different。
This labeled pearl of one or more groups can include 1,000,000 or more labeled pearl。This labeled pearl of one or more groups can include 10,000,000 or more labeled pearl。
These one or more nucleic acid are attached to pearl and can include covalency attachment。These one or more nucleic acid are attached to pearl can include puting together。These one or more nucleic acid are attached to pearl and can include ionic interaction。
These pearls can be coated pearl。Nucleic acid can be attached to one or more label。These pearls can be coated with streptavidin。Nucleic acid can be attached to biotin。These pearls can also be coated with antibody or nucleic acid, and via this type of Surface coating material, nucleic acid can be attached to these pearls indirectly。
In an aspect, present disclosure provides a kind of compositions, said composition includes: solid support, wherein said solid support includes multiple oligonucleotide, at least two in wherein said multiple oligonucleotide includes cell marking and molecular marker, the described cell marking of the described at least two in wherein said multiple oligonucleotide is identical, and the described molecular marker of the described at least two in wherein said multiple oligonucleotide is different。In certain embodiments, the plurality of oligonucleotide farther includes sample labelling。In certain embodiments, the plurality of oligonucleotide farther includes target land。In certain embodiments, target land includes being adapted to be the sequence being hybridized to target nucleic acid。In certain embodiments, target land includes the sequence being selected from lower group, this group is made up of the following: random polymer, for instance the more high polymer sequence of random dimer, trimer, the tetramer, pentamer, six aggressiveness, heptamer, eight aggressiveness, nine aggressiveness, ten aggressiveness or any length；Gene-specific primer；With oligomerization dT；Or its any combination。In certain embodiments, the plurality of oligonucleotide includes common tags。In certain embodiments, this common tags includes the binding site for sequencing primer。In certain embodiments, the plurality of oligonucleotide includes joint。In certain embodiments, this joint includes functional group。In certain embodiments, this joint is positioned at the 5 ' of described oligonucleotide。In certain embodiments, joint is selected from lower group, and this group is made up of the following: C6, biotin, streptavidin, primary amine, aldehyde and ketone, or their any combination。In certain embodiments, this solid support is made up of polystyrene。In certain embodiments, solid support is magnetic。In certain embodiments, this solid support is selected from lower group, this group is made up of the following: PDMS solid support, glass solid support, polypropylene solid holder, agarose solid support, gelatin solid support, magnetic retention holder and pluronic (pluronic) solid support, or their any combination。In certain embodiments, this solid support includes pearl。In certain embodiments, this solid support includes the diameter of about 20 microns。In certain embodiments, this solid support includes the diameter from about 5 microns to about 40 microns。In certain embodiments, this solid support includes functional group。In certain embodiments, this functional group is selected from lower group, and this group is made up of the following: C6, biotin, streptavidin, primary amine, aldehyde and ketone, or their any combination。In certain embodiments, this cell marking includes multiple cell marking。In certain embodiments, the plurality of cell marking is scattered with multiple joint marker sequence。In certain embodiments, the plurality of oligonucleotide includes from 10,000 to 10 hundred million oligonucleotide。
In an aspect, present disclosure provides solid support, this solid support includes: the first oligonucleotide, this first oligonucleotide includes: the first cell marking, this first cell marking includes the first random sequence, the second random sequence and the first joint marker sequence, and wherein said first joint marker sequence connects described first random sequence and described second random sequence；And include the first molecular marker of random sequence；And second oligonucleotide, this second oligonucleotide includes: the second cell marking, this second cell marking includes the 3rd random sequence, the 4th random sequence and the second joint marker sequence, and wherein said second joint marker sequence connects described 3rd random sequence and described 4th random sequence；And including the second molecular marker of random sequence, wherein said first cell marking and described second cell marking are identical and described first molecular marker and described second molecular marker is different。In certain embodiments, this first and second oligonucleotide farther includes same sample index area。In certain embodiments, sample index area includes random sequence。In certain embodiments, sample index area is that 4-12 nucleotide is long。In certain embodiments, cell marking is attached directly to described molecular marker。In certain embodiments, cell marking and described molecular marker are attached by joint marker sequence。In certain embodiments, the random sequence of described cell marking is long from 4-12 nucleotide。In certain embodiments, the constant series of described cell marking is that at least 4 nucleotide are long。In certain embodiments, cell marking has the overall length of at least 12 nucleotide。In certain embodiments, cell marking farther includes one or more other random sequence。In certain embodiments, cell marking farther includes one or more other joint marker sequence。In certain embodiments, these one or more other joint marker sequences connect this one or more other random sequences。In certain embodiments, the random sequence of this cell marking is that 4-12 nucleotide is long。
In an aspect, present disclosure provides a kind of compositions, said composition includes: solid support, and wherein said solid support includes multiple oligonucleotide, and at least two in wherein said multiple oligonucleotide includes: cell marking, molecular marker；With target land；And multiple target nucleic acid, the described cell marking of the described at least two in wherein said multiple oligonucleotide is identical, and the described molecular marker of the described at least two in wherein said multiple oligonucleotide is different。In certain embodiments, target land include being adapted for hybridize in the plurality of target nucleic acid at least one on sequence。In certain embodiments, target land includes the sequence being selected from lower group, this group is made up of the following: random polymer, for instance the more high polymer sequence of random dimer, trimer, the tetramer, pentamer, six aggressiveness, heptamer, eight aggressiveness, nine aggressiveness, ten aggressiveness or any length；Gene-specific primer；With oligomerization dT；Or its any combination。In certain embodiments, the plurality of oligonucleotide includes from 10,000 to 10 hundred million oligonucleotide。In certain embodiments, the plurality of oligonucleotide includes the oligonucleotide number of the number more than the target nucleic acid in the plurality of target nucleic acid。In certain embodiments, the plurality of target nucleic acid includes multiple copies of identical target nucleic acid。In certain embodiments, the plurality of target nucleic acid includes multiple copies of different target nucleic acid。In certain embodiments, the plurality of target nucleic acid combines to the plurality of oligonucleotide。In certain embodiments, oligonucleotide farther includes sample labelling。In certain embodiments, the plurality of oligonucleotide includes common tags。In certain embodiments, this common tags includes the binding site for sequencing primer。In certain embodiments, the plurality of oligonucleotide includes joint。In certain embodiments, this joint includes functional group。In certain embodiments, this joint is positioned at the 5 ' of described oligonucleotide。In certain embodiments, this functional group includes amino。In certain embodiments, joint is selected from lower group, and this group is made up of the following: C6, biotin, streptavidin, primary amine, aldehyde and ketone, or their any combination。In certain embodiments, this solid support is made up of polystyrene。In certain embodiments, this solid support is magnetic。In certain embodiments, this solid support is selected from lower group, this group is made up of the following: PDMS solid support, glass solid support, polypropylene solid holder, agarose solid support, gelatin solid support, magnetic retention holder and pluronic (pluronic) solid support, or their any combination。In certain embodiments, this solid support includes pearl。In certain embodiments, this solid support includes the diameter of about 20 microns。In certain embodiments, this solid support includes the diameter from about 5 microns to about 40 microns。In certain embodiments, this solid support includes functional group。In certain embodiments, this functional group includes carboxyl。In certain embodiments, this functional group is selected from lower group, and this group is made up of the following: C6, biotin, streptavidin, primary amine, aldehyde and ketone, or their any combination。In certain embodiments, this cell marking includes multiple cell marking。In certain embodiments, the plurality of cell marking is scattered with multiple joint marker sequence。
In an aspect, present disclosure provides a kind of test kit, this test kit includes: the first solid support, wherein said first solid support includes more than first oligonucleotide, wherein said more than first oligonucleotide includes identical first cell marking, second solid support, wherein said second solid support includes more than second oligonucleotide, and wherein said more than second oligonucleotide includes identical second cell marking；Operation instructions, wherein said first cell marking and described second cell marking are different。In certain embodiments, molecular marker is included from the oligonucleotide of described more than first oligonucleotide and described more than second oligonucleotide。In certain embodiments, the molecular marker of described oligonucleotide is different。In certain embodiments, the molecular marker of described oligonucleotide is identical。In certain embodiments, the molecular marker of some described oligonucleotide is different and some are identical。In certain embodiments, target land is included from the oligonucleotide of described more than first oligonucleotide and described more than second oligonucleotide。In certain embodiments, test kit farther includes: microwell array。In certain embodiments, test kit farther includes: buffer。In certain embodiments, buffer is selected from lower group, and this group is made up of the following: rehydration buffer, dilution buffer and stabilizing buffer, or their any combination。
In an aspect, the method that present disclosure provides amount for determining target nucleic acid, the method includes: make sample and solid support into contact, wherein said solid support includes multiple oligonucleotide, at least two in wherein said multiple oligonucleotide includes cell marking and molecular marker, the described cell marking of the described at least two in wherein said multiple oligonucleotide is identical, and the described molecular marker of the described at least two in wherein said multiple oligonucleotide is different；And the oligonucleotide hybridization by described target nucleic acid and the plurality of oligonucleotide from described sample。In certain embodiments, sample includes cell。In certain embodiments, lysate sample before described hybridization。In certain embodiments, hybridization includes multiple copies of identical target nucleic acid and the plurality of oligonucleotide hybridization。In certain embodiments, the method farther includes: expand described target nucleic acid。In certain embodiments, amplification includes target nucleic acid described in reverse transcription。In certain embodiments, amplification includes using the method selected from lower group to expand, and this group is made up of the following: PCR, quantitative PCR, real-time PCR and digital pcr or their any combination。In certain embodiments, described solid support is made directly amplification。In certain embodiments, the template transcribed from described solid support expands。In certain embodiments, the method farther includes: checked order by described target nucleic acid。In certain embodiments, order-checking includes checking order described target nucleic acid and described molecular marker。In certain embodiments, the method farther includes: determine the amount of described target nucleic acid。In certain embodiments, this determines the level including quantifying described target nucleic acid。In certain embodiments, this determines that the number including the molecular marker through checking order to described target nucleic acid counts。In certain embodiments, this contact occurs in micropore。In certain embodiments, this micropore is made up of the material selected from lower group, and this group is made up of the following: hydrophilic plastic, plastics, elastomer and hydrogel, or their any combination。In certain embodiments, this micropore includes agarose。In certain embodiments, this micropore is a micropore of microwell array。In certain embodiments, this microwell array includes at least 90 micropores。In certain embodiments, this microwell array includes at least 150,000 micropore。In certain embodiments, this micropore includes at least one solid support/hole。In certain embodiments, this micropore includes at most two solid support/holes。In certain embodiments, this micropore has the size holding at most two described solid supports。In certain embodiments, this micropore has the size holding an at most described solid support。In certain embodiments, this micropore be at least 25 microns deep。In certain embodiments, this micro-pore diameter is at least 25 microns。
In an aspect, the method that present disclosure provides amplification bias for reducing target nucleic acid, the method includes: make sample and solid support into contact, wherein said solid support includes multiple oligonucleotide, at least two in wherein said multiple oligonucleotide includes cell marking and molecular marker, the described cell marking of the described at least two in wherein said multiple oligonucleotide is identical, and the described molecular marker of the described at least two in wherein said multiple oligonucleotide is different；And by target nucleic acid and the plurality of oligonucleotide hybridization from described sample；Expand described target nucleic acid；Being checked order by described target nucleic acid, the described molecular marker of the described oligonucleotide that described target nucleic acid and described target nucleic acid combine is checked order by wherein said order-checking；And determine the amount of described target nucleic acid。In certain embodiments, hybridization includes multiple copies of identical target nucleic acid and the plurality of oligonucleotide hybridization。In certain embodiments, this determines that the number including the molecular marker through checking order to identical target nucleic acid counts。In certain embodiments, the number of the copy to described identical target nucleic acid is counted by this counting。In certain embodiments, sample includes cell。In certain embodiments, amplification includes target nucleic acid described in reverse transcription。In certain embodiments, amplification includes using the method selected from lower group to expand, and this group is made up of the following: PCR, quantitative PCR, real-time PCR and digital pcr or their any combination。In certain embodiments, described solid support is made directly amplification。In certain embodiments, the template transcribed from described solid support expands。
In an aspect, present disclosure provides a kind of compositions, said composition includes: micropore；Pond；And solid support, wherein said solid support includes multiple oligonucleotide, at least two in wherein said multiple oligonucleotide includes cell marking and molecular marker, the described cell marking of the described at least two in wherein said multiple oligonucleotide is identical, and the described molecular marker of the described at least two in wherein said multiple oligonucleotide is different。In certain embodiments, at least two in the plurality of oligonucleotide farther includes sample labelling。In certain embodiments, at least two in the plurality of oligonucleotide farther includes target land。In certain embodiments, target land includes the sequence being selected from lower group, this group is made up of the following: random polymer, for instance the more high polymer sequence of random dimer, trimer, the tetramer, pentamer, six aggressiveness, heptamer, eight aggressiveness, nine aggressiveness, ten aggressiveness or any length；Gene-specific primer；With oligomerization dT；Or its any combination。In certain embodiments, the plurality of oligonucleotide includes common tags。In certain embodiments, this common tags includes the binding site for sequencing primer。In certain embodiments, this solid support is made up of polystyrene。In certain embodiments, this solid support is magnetic。In certain embodiments, this solid support is selected from lower group, this group is made up of the following: PDMS solid support, glass solid support, polypropylene solid holder, agarose solid support, gelatin solid support, magnetic retention holder and pluronic (pluronic) solid support, or their any combination。In certain embodiments, this solid support includes pearl。In certain embodiments, this solid support has the diameter of about 20 microns。In certain embodiments, this solid support has the diameter from about 5 microns to about 40 microns。In certain embodiments, this cell marking includes multiple cell marking。In certain embodiments, the plurality of cell marking is scattered with multiple joint sequence。In certain embodiments, this micropore is made up of the material selected from lower group, and this group is made up of the following: hydrophilic plastic, plastics, elastomer and hydrogel, or their any combination。In certain embodiments, this micropore includes agarose。In certain embodiments, this micropore is the micropore of microwell array。In certain embodiments, this micropore includes at least one solid support/hole。In certain embodiments, this micropore includes at most two solid support/holes。In certain embodiments, this micropore has the size holding at least one described solid support and at least one described cell。In certain embodiments, micropore has the size holding at most a described solid support and at least one described cell。In certain embodiments, this micropore be at least 25 microns deep。In certain embodiments, this micro-pore diameter is at least 25 microns。In certain embodiments, this micropore is flat。
In an aspect, present disclosure provides a kind of device, this device includes: include the first substrate of the first microwell array；Wherein said first microwell array includes being configured to carrying out multiple unicellular random labelling and that molecule index measures, the first predetermined space arrange in multiple first micropores。
In certain embodiments, this device includes the first substrate, and this first substrate includes at least one second microwell array, and at least one second microwell array wherein said includes at least one second micropore multiple at least one the second predetermined space arranges。In certain embodiments, these first micropores and this at least one second micropore are identical。In certain embodiments, these first micropores and this at least one second micropore are different。In certain embodiments, this first predetermined space arrangement and this at least one second predetermined space arrangement are identical。In certain embodiments, this first predetermined space arrangement and this at least one second predetermined space arrangement are different。In certain embodiments, this predetermined space arrangement includes one-dimensional or two dimension array pattern。In certain embodiments, two-dimensional array pattern includes square net, rectangular mesh or hexagonal gridding。In certain embodiments, these micropores include cylindrical geometry shape, circular cone geometry, hemisphere geometry, rectangular geometry, polyhedron shape or their combination。In certain embodiments, the diameter of these micropores is between about 5 microns and about 50 microns。In certain embodiments, the degree of depth of these micropores is between about 10 microns and about 60 microns。In certain embodiments, the spacing of the center to center between two adjacent cells is between about 15 microns and about 75 microns。In one embodiment, the sum of the micropore in first or at least one second microwell array is about 96 with about between 5,000,000。In certain embodiments, this first substrate includes silicon, fused silica, glass, polymer, metal or their combination。In certain embodiments, this first substrate includes agarose or hydrogel。In certain embodiments, microwell array farther includes at least one surface character, wherein said surface character is around one or more independent micropores or strides across the space between independent micropore, and wherein said surface character is hemispheric, ridged or pointed。
In an aspect, present disclosure provides a kind of device, this device includes: include the first substrate of at least one the first microwell array；And include the mechanical clamp of top board, base plate and pad；Wherein when the first substrate and mechanical clamp are in assembling form, first substrate is between pad and base plate, pad and the first substrate form leakproof seal, and top board and pad form at least one first Room containing at least one the first microwell array described, so make cell sample and the oligonucleotide marker based on pearl can be dispersed into described at least the first room, with carry out multiple unicellular random labelling and molecule index measure。
In certain embodiments, this at least one first microwell array is any array described here。In certain embodiments, pad manufactures from polydimethylsiloxane (PDMS) or similar elastomeric body material。In certain embodiments, top board is manufacture from aluminum, anodised aluminium, rustless steel, Teflon, polymethyl methacrylate, Merlon or similar hard polymer material with base plate。
In an aspect, present disclosure provides a kind of device, this device includes: farther include at least one substrate of at least one microwell array；And flow cell；Wherein for delivering fluid to the purpose of described microwell array, flow cell around or be attached at least one substrate described, and include at least one entrance and at least one outlet；And wherein this device is configured for multiple unicellular random labelling and molecule index mensuration。
In certain embodiments, at least one substrate described includes at least one microwell array as described in this。In certain embodiments, flow cell farther includes the multiple microarray chamber coordinated with multiple microwell arrays, so allows to the one or more sample of parallel processing。In certain embodiments, flow cell farther includes tool hole barrier or flow diffuser, to provide cell and pearl to the evenly delivery of at least one microwell array。In certain embodiments, flow cell farther includes to be divided into each room comprising microwell array the separator of segmentation, these segmentations collectively cover same total array region and provide cell and pearl to the evenly delivery of at least one microwell array。In certain embodiments, the width being incorporated to the fluid passage of this device is between about 50 microns and 20mm。In certain embodiments, the degree of depth being incorporated to the fluid passage of this device is at about 50 microns with about between 2mm。In certain embodiments, flow cell is to manufacture from the material selected from lower group, and this group is made up of the following: silicon, fused silica, glass, polydimethylsiloxane (PDMS；Elastomer), polymethyl methacrylate (PMMA), Merlon (PC), polypropylene (PP), polyethylene (PE), high density polyethylene (HDPE) (HDPE), polyimides, cyclic olefin polymer (COP), cyclic olefine copolymer (COC), polyethylene terephthalate (PET), epoxy resin, metal, or the combination of these materials。In certain embodiments, the fixing parts of the instrument system that this device includes being configured to carrying out the multiple unicellular random labelling of automatization and molecule index measures。In certain embodiments, the removable member of the instrument system that this device includes being configured to carrying out the multiple unicellular random labelling of automatization and molecule index measures。
In an aspect, present disclosure provides cylinder, this cylinder includes: farther include at least one first substrate of at least one the first microwell array；At least one first flow cell or microwell array room；Sample or one or more reservoirs of reagent；And wherein for delivering the fluid purpose at least one the first microwell array described, this cylinder farther includes at least one entrance and at least one outlet；And wherein this cylinder is configured for multiple unicellular random labelling and molecule index mensuration。
In certain embodiments, at least one first substrate described includes at least one first microwell array as described in this。In certain embodiments, this cylinder includes multiple microwell array and is configured to the one or more sample of parallel processing。In certain embodiments, this at least one first flow cell or microwell array room farther include tool hole barrier or flow diffuser, to provide cell and pearl to the evenly delivery of at least one the first microwell array。In certain embodiments, at least one first flow cell or microwell array room farther include at least one first flow cell or microwell array room by this and are divided into the separator of segmentation, and these segmentations collectively cover same total array region and provide cell and pearl to the evenly delivery of microwell array。In certain embodiments, the width being incorporated to the fluid passage of this cylinder is between about 50 microns and 200 microns。In certain embodiments, the width being incorporated to the fluid passage of this cylinder is between about 200 microns and 2mm。In certain embodiments, the width being incorporated to the fluid passage of this cylinder is about between 2mm and 10mm。In certain embodiments, the width being incorporated to the fluid passage of this cylinder is about between 10mm and 20mm。In certain embodiments, the degree of depth being incorporated to the fluid passage of this cylinder is at about 50 microns with about between 2mm。In certain embodiments, the degree of depth being incorporated to the fluid passage of this cylinder is between about 500 microns and 1mm。In certain embodiments, the degree of depth being incorporated to the fluid passage of this cylinder is at about 1mm with about between 2mm。In certain embodiments, these one or more flow cells or microwell array room are to manufacture from the material selected from lower group, and this group is made up of the following: silicon, fused silica, glass, polydimethylsiloxane (PDMS；Elastomer), polymethyl methacrylate (PMMA), Merlon (PC), polypropylene (PP), polyethylene (PE), high density polyethylene (HDPE) (HDPE), polyimides, cyclic olefin polymer (COP), cyclic olefine copolymer (COC), polyethylene terephthalate (PET), epoxy resin, metal, or the combination of these materials。In certain embodiments, removable, the consumable parts of the instrument system that this device includes being configured to carrying out the multiple unicellular random labelling of automatization and molecule index measures。In certain embodiments, this cylinder farther includes bypass channel or other design features, in order to provides distribution or is injected into the cell sample of this cylinder or the self-metering of pearl suspension。In certain embodiments, this cylinder farther includes integrated micro pump, in order to controls the fluid through this device and flows。In certain embodiments, this cylinder farther includes integrated micro valve, in order to separates the reagent of prestrain and to control the fluid through this device and to flow。In certain embodiments, this cylinder farther includes passage, in order to provide the escape paths of air entrapment。In certain embodiments, this cylinder farther includes design considerations, to produce physics or chemistry barrier, these barriers are effectively increased path and the molecule diffusion preventing or minimizing between micropore, wherein these design considerations are selected from lower group, this group is made up of the following: serpentine channel pattern, delivery for cell and pearl at least one the first microwell array, it is pressed into the scalable pressing plate or deformable film that contact with the surface of at least one the first microwell array, or immiscible hydrophobic fluid is from the release of the reservoir in this cylinder。In certain embodiments, this cylinder farther includes integrated temperature control unit or integrated hot interface, in order to provides and thermally contacts with the good of external instrument system。In certain embodiments, this cylinder farther includes interface or the window of optics, for the optical imagery of at least one the first microwell array。In certain embodiments, this cylinder farther includes to be configured to the one or more removable sample collection room that coordinates with stand alone type PCR thermal cycler and/or sequenator。In certain embodiments, this cylinder self is configured to direct and free-standing PCR thermal cycler and/or sequenator coordinates。
In certain aspects, present disclosure provides a kind of instrument system, this instrument system includes: farther include at least one the first flow cell or cylinder of at least one the first microwell array；And flow governor；Wherein this flow governor control cell sample, based on the oligonucleotide marker reagent of pearl and other measure the reagent delivery at least one the first microwell array, and this instrument system is configured for multiple unicellular random labelling and molecule index mensuration。
In certain embodiments, this at least one first microwell array is as described herein。In certain embodiments, this at least one first flow cell is the fixing parts of this system。In certain embodiments, this at least one first flow cell is removable, the consumable parts of this system。In certain embodiments, this at least one first cylinder is removable, the consumable parts of this system。In certain embodiments, directly distributed by the user oligonucleotide reagent by cell sample with based on pearl or be injected into this cylinder。In certain embodiments, the mensuration reagent except cell sample is preloaded into this cylinder。In certain embodiments, this instrument system farther includes imaging system, in order to make this at least one microwell array imaging。In certain embodiments, this instrument system farther includes cell or pearl distribution system, for promoting the uniform distribution of at least one the first microwell array across this of cell and pearl, wherein the mechanism under described distribution system is selected from lower group, and this group is made up of the following: vibration, vibration, whirlpool, recirculation flow, low frequency stirring or high frequency stirring。In certain embodiments, this instrument system farther includes cell lysis system, and wherein this system uses high frequency piezo transducer, for supersound process cell。In certain embodiments, this instrument system farther includes temperature controller, for maintaining the temperature that user is specified, or for specifying interval through two or more, raises and lifts temperature between two or more assigned temperatures。In certain embodiments, this instrument system farther includes field controller, is used for from micropore eluting pearl。In certain embodiments, this instrument system farther includes to be programmed to provide the user interface of systemic-function and the computer of control or processor。In certain embodiments, this instrument system farther includes program code, is used for providing real-time image analysis ability。In certain embodiments, coupling real-time image analysis and instrument controlling function, so allow to extend or repetitive cell and the sample load step of pearl, until realize best cell/distribution of pearl。In certain embodiments, this instrument system farther includes integrated PCR thermal cycler, for the amplification of oligonucleotide marker。In certain embodiments, this instrument system farther includes integrated sequenator, for the order-checking of oligonucleotide library, thus provides sample to answer ability。In certain embodiments, these cell samples include Patient Sample A, and the result that multiple unicellular random labelling and molecule index measure is used to clinical diagnostic applications。In certain embodiments, these cell samples include Patient Sample A, and are used multiple unicellular random labelling and the result of molecule index mensuration by medical supplier, to make the health care Treatment decsion of wisdom。
In an aspect, the invention provides the software being present in computer-readable medium being programmed to carry out one or more following sequence data analytic function: determine reading number/gene/cell and uniqueness transcript molecule amount/gene/cell；Principal component analysis or other statistical analysiss, with prediction for determining the confidence interval of transcript molecule amount/gene/cell；The comparison of gene sequence data and known canonical sequence；Decoding/the demultiplexing of sample bar code, cell bar code and molecular bar code；And automatically the clustering of molecular marker, to compensate amplification or order-checking error；Wherein by carrying out multiple unicellular random labelling and molecule index mensuration generation sequence data。
In an aspect, present disclosure provides a kind of compositions, said composition includes: solid support, wherein this solid support includes multiple oligonucleotide, wherein at least two in the plurality of oligonucleotide includes cell marking and molecular marker, wherein the cell marking of this at least two in the plurality of oligonucleotide is identical, and the molecular marker of wherein this at least two in the plurality of oligonucleotide is different。
In certain embodiments, the plurality of oligonucleotide farther includes sample labelling。In certain embodiments, the plurality of oligonucleotide farther includes target land。In certain embodiments, this target land includes being adapted to be the sequence being hybridized to target nucleic acid。In certain embodiments, this target nucleic acid includes multiple target nucleic acid, and the plurality of target nucleic acid includes at least the 0.01% of the transcript of organic transcript profile, 0.02%, 0.05%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% or 100%。In certain embodiments, this target nucleic acid is DNA。In certain embodiments, this target nucleic acid is RNA。In certain embodiments, this target nucleic acid is mRNA。In certain embodiments, this DNA is genomic DNA。In certain embodiments, genomic DNA is sheared。In certain embodiments, the genomic DNA of shearing includes at least 0.01%, 0.02%, 0.05%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% or the 100% of organic genomic gene。In certain embodiments, target land includes the sequence being selected from lower group, this group is made up of the following: random polymer, for instance the more high polymer sequence of random dimer, trimer, the tetramer, pentamer, six aggressiveness, heptamer, eight aggressiveness, nine aggressiveness, ten aggressiveness or any length；Gene-specific primer；With oligomerization dT；Or its any combination。In certain embodiments, the plurality of oligonucleotide includes common tags。In certain embodiments, this common tags includes the binding site for sequencing primer。In certain embodiments, the plurality of oligonucleotide includes joint。In certain embodiments, this joint includes functional group。In certain embodiments, this joint is positioned at the 5 ' of oligonucleotide。In certain embodiments, joint is selected from lower group, and this group is made up of the following: C6, biotin, streptavidin, primary amine, aldehyde and ketone, or their any combination。In certain embodiments, this solid support is made up of polystyrene。In certain embodiments, this solid support is magnetic。In certain embodiments, this solid support is selected from lower group, this group is made up of the following: PDMS solid support, glass solid support, polypropylene solid holder, agarose solid support, gelatin solid support, magnetic retention holder and pluronic (pluronic) solid support, or their any combination。In certain embodiments, this solid support includes pearl。In certain embodiments, this solid support includes the diameter of about 20 microns。In certain embodiments, this solid support includes the diameter from about 5 microns to about 40 microns。In certain embodiments, this solid support includes functional group。In certain embodiments, this functional group is selected from lower group, and this group is made up of the following: C6, biotin, streptavidin, primary amine, aldehyde and ketone, or their any combination。In certain embodiments, this cell marking includes multiple cell marking。In certain embodiments, the plurality of cell marking is scattered with multiple joint marker sequence。In certain embodiments, the plurality of oligonucleotide includes from 10,000 to 10 hundred million oligonucleotide。In certain embodiments, the plurality of oligonucleotide includes from 10,000 to 10 hundred million target lands。In certain embodiments, the plurality of oligonucleotide includes from 10,000 to 10 hundred million different target lands。In certain embodiments, the plurality of oligonucleotide includes from 10,000 to 10 hundred million identical target lands。In certain embodiments, different target lands can be hybridized at least the 0.01% of transcript of organic transcript profile, 0.02%, 0.05%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% or 100%。In certain embodiments, different target lands can be hybridized at least the 0.01% of transcript of organic transcript profile, 0.02%, 0.05%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% or 100%。
In an aspect, present disclosure provides a kind of compositions, said composition includes: solid support, wherein this solid support includes multiple oligonucleotide, wherein at least two in the plurality of oligonucleotide includes cell marking and molecular marker, wherein the cell marking of this at least two in the plurality of oligonucleotide is identical, and the molecular marker of wherein this at least two in the plurality of oligonucleotide is different。
In certain embodiments, the plurality of oligonucleotide farther includes sample labelling。In certain embodiments, the plurality of oligonucleotide farther includes target land。In certain embodiments, this target land includes being adapted to be the sequence being hybridized to target nucleic acid。In certain embodiments, this target nucleic acid includes multiple target nucleic acid, and the plurality of target nucleic acid includes at least the 0.01% of the transcript of organic transcript profile, 0.02%, 0.05%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% or 100%。In certain embodiments, this target nucleic acid includes the genomic DNA sheared, and wherein the genomic DNA of this shearing includes at least 0.01%, 0.02%, 0.05%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% or the 100% of organic genomic gene。In certain embodiments, target land includes oligomerization dT。In certain embodiments, this at least two in the plurality of oligonucleotide includes the first oligonucleotide and the second oligonucleotide, wherein this first oligonucleotide includes the first cell marking and the first molecular marker, wherein this first cell marking includes the first random sequence, the second random sequence and the first joint marker sequence, and wherein this first joint marker sequence connects this first random sequence and this second random sequence；And this first molecular marker includes random sequence；And this second oligonucleotide includes the second cell marking and the second molecular marker, wherein this second cell marking includes the 3rd random sequence, the 4th random sequence and the second joint marker sequence, and wherein this second joint marker sequence connects the 3rd random sequence and the 4th random sequence；And this second molecular marker includes random sequence, and wherein this first cell marking and this second cell marking are identical and this first molecular marker and this second molecular marker are different。
In an aspect, present disclosure provides a kind of test kit, this test kit includes any compositions described here and operation instructions。
In an aspect, present disclosure provides a kind of method, the method includes: make sample and solid support into contact, wherein this solid support includes multiple oligonucleotide, wherein at least two in the plurality of oligonucleotide includes cell marking and molecular marker, wherein the cell marking of this at least two in the plurality of oligonucleotide is identical, and the molecular marker of wherein this at least two in the plurality of oligonucleotide is different；And the oligonucleotide hybridization by target nucleic acid and the plurality of oligonucleotide from this sample。
In certain embodiments, this sample includes cell。In certain embodiments, lysate sample before this hybridization。In certain embodiments, hybridization includes multiple copies of identical target nucleic acid and the plurality of oligonucleotide hybridization。In certain embodiments, the method farther includes reverse transcription target nucleic acid。In certain embodiments, the method farther includes to carry out oligonucleotide amplification。In certain embodiments, amplification includes using the method selected from lower group to expand, and this group is made up of the following: PCR, quantitative PCR, real-time PCR and digital pcr or their any combination。
In an aspect, present disclosure provides solid support, this solid support includes: the first oligonucleotide, this first oligonucleotide includes: the first cell marking, this first cell marking includes the first random sequence, the second random sequence and the first joint marker sequence, and wherein this first joint marker sequence connects this first random sequence and this second random sequence；And include the first molecular marker of random sequence；And second oligonucleotide, this second oligonucleotide includes: the second cell marking, this second cell marking includes the 3rd random sequence, the 4th random sequence and the second joint marker sequence, and wherein this second joint marker sequence connects the 3rd random sequence and the 4th random sequence；And include the second molecular marker of random sequence, wherein this first cell marking and this second cell marking are identical and this first molecular marker and this second molecular marker are different。In certain embodiments, this first and second oligonucleotide farther includes same sample index area。In certain embodiments, this sample index area includes random sequence。In certain embodiments, this sample index area is that 4-12 nucleotide is long。In certain embodiments, this cell marking is attached directly to this molecular marker。In certain embodiments, this cell marking and this molecular marker are attached by joint marker sequence。In certain embodiments, the random sequence of this cell marking is long from 4-12 nucleotide。In certain embodiments, the constant series of this cell marking is that at least 4 nucleotide are long。In certain embodiments, this cell marking has the overall length of at least 12 nucleotide。In certain embodiments, this cell marking farther includes one or more other random sequence。In certain embodiments, this cell marking farther includes one or more other joint marker sequence。In certain embodiments, these one or more other joint marker sequences connect this one or more other random sequences。In certain embodiments, the random sequence of this cell marking is that 4-12 nucleotide is long。
In an aspect, present disclosure provides a kind of compositions, said composition includes: solid support, and wherein this solid support includes multiple oligonucleotide, and wherein at least two in the plurality of oligonucleotide includes: cell marking, molecular marker；With target land；And multiple target nucleic acid, wherein the cell marking of this at least two in the plurality of oligonucleotide is identical, and the molecular marker of wherein this at least two in the plurality of oligonucleotide is different。
In certain embodiments, this target land include being adapted for hybridize in the plurality of target nucleic acid at least one on sequence。In certain embodiments, target land includes the sequence being selected from lower group, this group is made up of the following: random polymer, for instance the more high polymer sequence of random dimer, trimer, the tetramer, pentamer, six aggressiveness, heptamer, eight aggressiveness, nine aggressiveness, ten aggressiveness or any length；Gene-specific primer；With oligomerization dT；Or its any combination。In certain embodiments, the plurality of oligonucleotide includes from 10,000 to 10 hundred million oligonucleotide。In certain embodiments, the plurality of oligonucleotide includes the oligonucleotide number of the number of target nucleic acids more than the plurality of target nucleic acid。In certain embodiments, the plurality of target nucleic acid includes multiple copies of identical target nucleic acid。In certain embodiments, the plurality of target nucleic acid includes multiple copies of different target nucleic acid。In certain embodiments, the plurality of target nucleic acid combines to the plurality of oligonucleotide。In certain embodiments, this oligonucleotide farther includes sample labelling。In certain embodiments, the plurality of oligonucleotide includes common tags。In certain embodiments, this common tags includes the binding site for sequencing primer。In certain embodiments, the plurality of oligonucleotide includes joint。In certain embodiments, this joint includes functional group。In certain embodiments, this joint is positioned at the 5 ' of this oligonucleotide。In certain embodiments, functional group includes amino。In certain embodiments, joint is selected from lower group, and this group is made up of the following: C6, biotin, streptavidin, primary amine, aldehyde and ketone, or their any combination。In certain embodiments, this solid support is made up of polystyrene。In certain embodiments, solid support is magnetic。In certain embodiments, this solid support is selected from lower group, this group is made up of the following: PDMS solid support, glass solid support, polypropylene solid holder, agarose solid support, gelatin solid support, magnetic retention holder and pluronic (pluronic) solid support, or their any combination。In certain embodiments, this solid support includes pearl。In certain embodiments, this solid support includes the diameter of about 20 microns。In certain embodiments, this solid support includes the diameter from about 5 microns to about 40 microns。In certain embodiments, this solid support includes functional group。In certain embodiments, functional group includes carboxyl。In certain embodiments, this functional group is selected from lower group, and this group is made up of the following: C6, biotin, streptavidin, primary amine, aldehyde and ketone, or their any combination。In certain embodiments, this cell marking includes multiple cell marking。In certain embodiments, the plurality of cell marking is scattered with multiple joint marker sequence。
In an aspect, present disclosure provides a kind of test kit, this test kit includes: the first solid support, and wherein this first solid support includes more than first oligonucleotide, and wherein this more than first oligonucleotide includes identical first cell marking；Second solid support, wherein this second solid support includes more than second oligonucleotide, and wherein this more than second oligonucleotide includes identical second cell marking；And operation instructions, wherein this first cell marking and this second cell marking are different。
In certain embodiments, molecular marker is included from the oligonucleotide of this more than first oligonucleotide He this more than second oligonucleotide。In certain embodiments, the molecular marker of these oligonucleotide is different。In certain embodiments, the molecular marker of these oligonucleotide is identical。In certain embodiments, the molecular marker of some in these oligonucleotide is different and some are identical。In certain embodiments, target land is included from the oligonucleotide of this more than first oligonucleotide He this more than second oligonucleotide。In certain embodiments, this test kit includes microwell array。In certain embodiments, this test kit farther includes buffer。In certain embodiments, buffer is selected from lower group, and this group is made up of the following: rehydration buffer, dilution buffer and stabilizing buffer, or their any combination。
In an aspect, the method that present disclosure provides amount for determining target nucleic acid, the method includes: make sample and solid support into contact, wherein this solid support includes multiple oligonucleotide, wherein at least two in the plurality of oligonucleotide includes cell marking and molecular marker, wherein the cell marking of this at least two in the plurality of oligonucleotide is identical, and the molecular marker of wherein this at least two in the plurality of oligonucleotide is different；And the oligonucleotide hybridization by target nucleic acid and the plurality of oligonucleotide from this sample。
In certain embodiments, this sample includes cell。In certain embodiments, lysate sample before this hybridization。In certain embodiments, hybridization includes multiple copies of identical target nucleic acid and the plurality of oligonucleotide hybridization。In certain embodiments, the method farther includes amplification target nucleic acid。In certain embodiments, this amplification includes reverse transcription target nucleic acid。In certain embodiments, amplification includes using the method selected from lower group to expand, and this group is made up of the following: PCR, quantitative PCR, real-time PCR and digital pcr or their any combination。In certain embodiments, solid support is made directly amplification。In certain embodiments, the template transcribed from solid support expands。In certain embodiments, the method farther includes target nucleic acid is checked order。In certain embodiments, this order-checking includes target nucleic acid and molecular marker are checked order。In certain embodiments, the method further comprises determining that the amount of target nucleic acid。In certain embodiments, this determines the level including quantifying target nucleic acid。In certain embodiments, this determines that the number including the molecular marker through checking order to target nucleic acid counts。In certain embodiments, this contact occurs in micropore。In certain embodiments, this micropore is made up of the material selected from lower group, and this group is made up of the following: hydrophilic plastic, plastics, elastomer and hydrogel, or their any combination。In certain embodiments, this micropore includes agarose。In certain embodiments, this micropore is a micropore of microwell array。In certain embodiments, this microwell array includes at least 90 micropores。In certain embodiments, this microwell array includes at least 150,000 micropore。In certain embodiments, this micropore includes at least one solid support/hole。In certain embodiments, this micropore includes at most two solid support/holes。In certain embodiments, this micropore has the size holding at most two solid supports。In certain embodiments, this micropore has the size holding an at most solid support。In certain embodiments, this micropore be at least 25 microns deep。In certain embodiments, this micro-pore diameter is at least 25 microns。
In an aspect, the method that present disclosure provides amplification bias for reducing target nucleic acid, the method includes: make sample and solid support into contact, wherein this solid support includes multiple oligonucleotide, wherein at least two in the plurality of oligonucleotide includes cell marking and molecular marker, wherein the cell marking of this at least two in the plurality of oligonucleotide is identical, and the molecular marker of wherein this at least two in the plurality of oligonucleotide is different；And by target nucleic acid and the plurality of oligonucleotide hybridization from this sample；Expand this target nucleic acid or its complement。This target nucleic acid or its complement are checked order, and wherein the molecular marker of the oligonucleotide that this target nucleic acid or its complement and this target nucleic acid or its complement combine is checked order by this order-checking。Determine the amount of target nucleic acid。
In certain embodiments, hybridization includes multiple copies of identical target nucleic acid and the plurality of oligonucleotide hybridization。In certain embodiments, this determines that the number including the molecular marker through checking order to identical target nucleic acid counts。In certain embodiments, the number of the copy of identical target nucleic acid is counted by this counting。In certain embodiments, this sample includes cell。In certain embodiments, this amplification includes reverse transcription target nucleic acid。In certain embodiments, amplification includes using the method selected from lower group to expand, and this group is made up of the following: PCR, quantitative PCR, real-time PCR and digital pcr or their any combination。In certain embodiments, this amplification is made directly on solid support。In certain embodiments, the template transcribed from solid support expands。
In an aspect, present disclosure provides a kind of compositions, said composition includes micropore；Pond；And solid support, wherein this solid support includes multiple oligonucleotide, wherein at least two in the plurality of oligonucleotide includes cell marking and molecular marker, wherein the cell marking of this at least two in the plurality of oligonucleotide is identical, and the molecular marker of wherein this at least two in the plurality of oligonucleotide is different。
In certain embodiments, this at least two in the plurality of oligonucleotide farther includes sample labelling。In certain embodiments, this at least two in the plurality of oligonucleotide farther includes target land。In certain embodiments, target land includes the sequence being selected from lower group, this group is made up of the following: random polymer, for instance the more high polymer sequence of random dimer, trimer, the tetramer, pentamer, six aggressiveness, heptamer, eight aggressiveness, nine aggressiveness, ten aggressiveness or any length；Gene-specific primer；With oligomerization dT；Or its any combination。In certain embodiments, the plurality of oligonucleotide includes common tags。In certain embodiments, this common tags includes the binding site for sequencing primer。In certain embodiments, this solid support is made up of polystyrene。In certain embodiments, this solid support is magnetic。In certain embodiments, this solid support is selected from lower group, this group is made up of the following: PDMS solid support, glass solid support, polypropylene solid holder, agarose solid support, gelatin solid support, magnetic retention holder and pluronic (pluronic) solid support, or their any combination。In certain embodiments, this solid support includes pearl。In certain embodiments, this solid support has the diameter of about 20 microns。In certain embodiments, this solid support has the diameter from about 5 microns to about 40 microns。In certain embodiments, this cell marking includes multiple cell marking。In certain embodiments, the plurality of cell marking is scattered with multiple joint sequence。In certain embodiments, this micropore is made up of the material selected from lower group, and this group is made up of the following: hydrophilic plastic, plastics, elastomer and hydrogel, or their any combination。In certain embodiments, this micropore includes agarose。In certain embodiments, this micropore is the micropore of microwell array。In certain embodiments, this micropore includes at least one solid support/hole。In certain embodiments, this micropore includes at most two solid support/holes。In certain embodiments, this micropore has the size holding at least one solid support and at least one cell。In certain embodiments, micropore has the size holding at most a solid support and at least one cell。In certain embodiments, this micropore be at least 25 microns deep。In certain embodiments, this micro-pore diameter is at least 25 microns。In certain embodiments, this micropore is flat。
In an aspect, present disclosure provides a kind of device, this device includes multiple micropore, and wherein the plurality of micropore includes at least two micropore；And wherein each micropore of the plurality of micropore has scope from about 1,000 μm3To about 120,000 μm3Volume。In certain embodiments, the volume of each micropore in the plurality of micropore is about 20,000 μm3。In certain embodiments, the plurality of micropore includes from about 1,000 to about 5,000,000 micropore。In certain embodiments, the plurality of micropore includes about 100,000 to about 200,000 micropores。In certain embodiments, these micropores include in the material of monolayer。In certain embodiments, at least about the micropore of 10% farther includes cell。In certain embodiments, at least about the micropore of 10% farther includes solid support, this solid support includes multiple oligonucleotide, wherein at least two in the plurality of oligonucleotide includes cell marking and molecular marker, wherein the cell marking of this at least two in the plurality of oligonucleotide is identical, and the molecular marker of wherein this at least two in the plurality of oligonucleotide is different。In certain embodiments, this solid support is magnetized。
In an aspect, present disclosure provides a kind of equipment, this equipment includes any device described here and liquid processor。
In certain embodiments, this liquid processor delivered liquid extremely the plurality of micropore in about 1 second。In certain embodiments, this equipment is from single input mouth delivery liquid to the plurality of micropore。In certain embodiments, this equipment farther includes magnet。In certain embodiments, this equipment farther includes at least one in following item: entrance, outlet, pump, valve, passage, reservoir, sample collection room, Temperature-controlled appliance or its any combination。In certain embodiments, this equipment includes sample collection room, and wherein sample collection room can be removed from this equipment。In certain embodiments, this equipment farther includes optical imaging instrument。In certain embodiments, optical imaging instrument produces the output signal for controlling liquid processor。In certain embodiments, the thermal circulation mechanism that the polymerase chain reaction (PCR) that this equipment farther includes to be configured to carry out oligonucleotide expands。
In an aspect, present disclosure provides the method for producing clinical diagnosis test result, the method includes producing this clinical diagnosis test result with any device described here or equipment。In certain embodiments, clinical diagnosis test result is transmitted via communication medium。
In an aspect, present disclosure provides a kind of device, this device includes: farther include one or more substrate of one or more microwell array；Wherein this microwell array is used to carry out multiple unicellular random labelling and molecule index mensuration。
In certain embodiments, the microwell array of these substrate includes the micropore that arranges by the array pattern of one-dimensional or two dimension。In certain embodiments, the two-dimensional array pattern of micropore is selected from lower group, and this group includes: square net, rectangular mesh or hexagonal gridding。
In certain embodiments, using the hole geometry selected from lower group to manufacture the micropore of microwell array, this group includes: cylinder, circular cone, hemisphere, rectangle or polyhedron。In certain embodiments, using and include two or more micropores selected from the whole geometry body manufacture microwell array of the component geometry body of lower group, this group includes: cylinder, circular cone, hemisphere, rectangle or polyhedron。In certain embodiments, the diameter of the micropore in microwell array is between about 5 microns and about 50 microns。In certain embodiments, the degree of depth of the micropore in microwell array is between about 10 microns and about 60 microns。In certain embodiments, the spacing of the center to center between the micropore in microwell array is between about 15 microns and about 75 microns。In one embodiment, the sum of the micropore in each microwell array is about 96 with about between 5,000,000。In certain embodiments, these one or more substrate are to manufacture from the material selected from lower group, and this group includes: silicon, fused silica, glass, polymer or metal。In certain embodiments, these one or more substrate manufacture from agarose or hydrogel。In certain embodiments, microwell array farther include around these micropores or stride across space between micropore and surface character between the micropore of lower group, this group includes hemispheric, ridged or pointed surface character。
In an aspect, present disclosure provides a kind of device, this device includes: farther include the substrate of one or more microwell array；And include the mechanical clamp of top board, base plate and pad；Wherein when this substrate is between pad and base plate, pad forms leakproof seal with substrate, and top board and pad form the one or more rooms containing microwell array, so make one or more cell sample and the oligonucleotide marker based on pearl can be allocated into these rooms, for carrying out multiple unicellular random labelling and the purpose of molecule index mensuration。
In certain embodiments, this substrate includes one or more microwell array as described in this。In certain embodiments, pad manufactures from polydimethylsiloxane (PDMS) or similar elastomeric body material。In certain embodiments, top board is manufacture from aluminum, anodised aluminium, rustless steel, Teflon, polymethyl methacrylate, Merlon or similar hard polymer material with base plate。
In an aspect, present disclosure provides a kind of device, this device includes: farther include one or more substrate of one or more microwell array；With one or more flow cells；Wherein for delivering fluid to the purpose of these microwell arrays, these one or more flow cells around or be attached to this one or more substrate, and include at least one entrance and at least one outlet；And wherein this device is used to carry out multiple unicellular random labelling and molecule index mensuration。
In certain embodiments, these one or more substrate include any one or more microwell arrays as described in this。In certain embodiments, each in these one or more flow cells farther includes the multiple microarray chamber coordinated with multiple microwell arrays, so allows to the one or more sample of parallel processing。In certain embodiments, these one or more flow cells farther include tool hole barrier or flow diffuser, to provide cell and pearl to the evenly delivery of microwell array。In certain embodiments, these one or more flow cells farther include to be divided into the room comprising microwell array the separator of segmentation, these segmentations collectively cover same total array region and provide cell and pearl to the evenly delivery of microwell array。In certain embodiments, the width being incorporated to the fluid passage of this device is between about 50 microns and 20mm。In certain embodiments, the degree of depth being incorporated to the fluid passage of this device is at about 50 microns with about between 2mm。In certain embodiments, these one or more flow cells are to manufacture from the material selected from lower group, and this group is made up of the following: silicon, fused silica, glass, polydimethylsiloxane (PDMS；Elastomer), polymethyl methacrylate (PMMA), Merlon (PC), polypropylene (PP), polyethylene (PE), high density polyethylene (HDPE) (HDPE), polyimides, cyclic olefin polymer (COP), cyclic olefine copolymer (COC), polyethylene terephthalate (PET), epoxy resin, metal, or the combination of these materials。In certain embodiments, this device includes the fixing parts of the instrument system for carrying out the multiple unicellular random labelling of automatization and molecule index mensuration。In certain embodiments, this device includes the removable member of the instrument system for carrying out the multiple unicellular random labelling of automatization and molecule index mensuration。
In an aspect, present disclosure provides a kind of cylinder, this cylinder includes: farther include one or more substrate of one or more microwell array；One or more flow cells or microwell array room；Sample or one or more reservoirs of reagent；And wherein for delivering the fluid purpose to microwell array, this cylinder farther includes at least one entrance and at least one outlet；And wherein this cylinder is used to carry out multiple unicellular random labelling and molecule index mensuration。
In certain embodiments, these one or more substrate include any one or more microwell arrays as described in this。In certain embodiments, these one or more flow cells or microwell array room coordinate with multiple microwell arrays, so allow to the one or more sample of parallel processing。In certain embodiments, these one or more flow cells or microwell array room farther include tool hole barrier or flow diffuser, to provide cell and pearl to the evenly delivery of microwell array。In certain embodiments, these one or more flow cells or microwell array room farther include to be divided into flow cell or room the separator of segmentation, these segmentations collectively cover same total array region and provide cell and pearl to the evenly delivery of microwell array。In certain embodiments, the width being incorporated to the fluid passage of this cylinder is between about 50 microns and 200 microns。In certain embodiments, the width being incorporated to the fluid passage of this cylinder is between about 200 microns and 2mm。In certain embodiments, the width being incorporated to the fluid passage of this cylinder is about between 2mm and 10mm。In certain embodiments, the width being incorporated to the fluid passage of this cylinder is about between 10mm and 20mm。In certain embodiments, the degree of depth being incorporated to the fluid passage of this cylinder is at about 50 microns with about between 10mm。In certain embodiments, the degree of depth being incorporated to the fluid passage of this cylinder is between about 500 microns and 1mm。In certain embodiments, the degree of depth being incorporated to the fluid passage of this cylinder is at about 1mm with about between 2mm。In certain embodiments, these one or more flow cells or microwell array room are to manufacture from the material selected from lower group, and this group is made up of the following: silicon, fused silica, glass, polydimethylsiloxane (PDMS；Elastomer), polymethyl methacrylate (PMMA), Merlon (PC), polypropylene (PP), polyethylene (PE), high density polyethylene (HDPE) (HDPE), polyimides, cyclic olefin polymer (COP), cyclic olefine copolymer (COC), polyethylene terephthalate (PET), epoxy resin, metal, or the combination of these materials。In certain embodiments, this device includes removable, the consumable parts of the instrument system for carrying out the multiple unicellular random labelling of automatization and molecule index mensuration。In certain embodiments, this cylinder farther includes bypass channel or other design features, in order to provides distribution or is injected into the cell sample of this cylinder or the self-metering of pearl suspension。In certain embodiments, this cylinder farther includes integrated micro pump, in order to controls the fluid through this device and flows。In certain embodiments, this cylinder farther includes integrated micro valve, in order to separates the reagent of prestrain and to control the fluid through this device and to flow。In certain embodiments, this cylinder farther includes passage, in order to provide the escape paths of air entrapment。In certain embodiments, this cylinder farther includes design considerations, to produce physics or chemistry barrier, these barriers are effectively increased path and the molecule diffusion preventing or minimizing between micropore, wherein this design considerations is selected from lower group, this group is made up of the following: the pattern of serpentine channel, delivery for cell and pearl to microwell array, it is pressed into scalable pressing plate or deformable film that the surface with microwell array contacts, or immiscible hydrophobic fluid is from the release of the reservoir in this cylinder。In certain embodiments, this cylinder farther includes integrated temperature control unit or integrated hot interface, in order to provides and thermally contacts with the good of external instrument system。In certain embodiments, this cylinder farther includes interface or the window of optics, for the optical imagery of these one or more microwell arrays。In certain embodiments, this cylinder farther includes to be configured to the one or more removable sample collection room that coordinates with stand alone type PCR thermal cycler and/or sequenator。In certain embodiments, this cylinder self is configured to direct and free-standing PCR thermal cycler and/or sequenator coordinates。
In an aspect, present disclosure provides a kind of instrument system, this instrument system includes: farther include one or more flow cells or the cylinder of one or more microwell array；And flow governor；Wherein this flow governor control cell sample, based on the oligonucleotide marker reagent of pearl and other measure the reagent delivery to microwell array, and this instrument system is used to carry out multiple unicellular random labelling and molecule index mensuration。
In certain embodiments, these one or more microwell arrays are any described here any。In certain embodiments, these one or more flow cells are the fixing parts of this system。In certain embodiments, these one or more flow cells are removable, the consumable parts of this system。In certain embodiments, these one or more cylinders are removable, the consumable parts of this system。In certain embodiments, directly distributed by the user oligonucleotide reagent by cell sample with based on pearl or be injected into this cylinder。In certain embodiments, the mensuration reagent except cell sample is preloaded into this cylinder。In certain embodiments, this instrument system farther includes imaging system, in order to make this microwell array imaging。In certain embodiments, this instrument system farther includes cell or pearl distribution system, for promoting that cell and pearl are across the uniform distribution of microwell array, wherein the mechanism under this distribution system is selected from lower group, and this group is made up of the following: vibration, vibration, whirlpool, recirculation flow, low frequency stirring or high frequency stirring。In certain embodiments, this instrument system farther includes cell lysis system, and wherein this system uses high frequency piezo transducer, for supersound process cell。In certain embodiments, this instrument system farther includes temperature controller, is used for maintaining user assigned temperature, or for specifying interval through two or more, lifts temperature between two or more assigned temperatures。In certain embodiments, this instrument system farther includes field controller, is used for from micropore eluting pearl。In certain embodiments, this instrument system farther includes to be programmed to provide the user interface of systemic-function and the computer of control or processor。In certain embodiments, this instrument system farther includes program code, is used for providing real-time image analysis ability。In certain embodiments, coupling real-time image analysis and instrument controlling function, so allow to extend or repetitive cell and the sample load step of pearl, until realize best cell/distribution of pearl。In certain embodiments, this instrument system farther includes integrated PCR thermal cycler, for the amplification of oligonucleotide marker。In certain embodiments, this instrument system farther includes integrated sequenator, for the order-checking of oligonucleotide library, thus provides sample to answer ability。In certain embodiments, these cell samples include Patient Sample A, and the result that multiple unicellular random labelling and molecule index measure is used to clinical diagnostic applications。In certain embodiments, these cell samples include Patient Sample A, and are used multiple unicellular random labelling and the result of molecule index mensuration by medical supplier, to make the health care Treatment decsion of wisdom。
In an aspect, the invention provides the software being present in computer-readable medium being programmed to carry out one or more following sequence data analysis: determine reading number/gene/cell and uniqueness transcript molecule amount/gene/cell；Principal component analysis or other statistical analysiss, with prediction for determining the confidence interval of transcript molecule amount/gene/cell；The comparison of gene sequence data and known canonical sequence；Decoding/the demultiplexing of sample bar code, cell bar code and molecular bar code；And automatically the clustering of molecular marker, to compensate amplification or order-checking error；Wherein by carrying out multiple unicellular random labelling and molecule index mensuration generation sequence data。

Claims (102)

1. a method, including
A () obtains the sample comprising multiple cell；
(b) use following item to the first cell from the plurality of cell and two or more polynucleotide molecules of the second cell from the plurality of cell, its complement or from its product carry out labelling at least partially
I this first cell is had specific first-phase and has the same cell marking of specific second-phase with cell marking with to this second cell by ()；And
(ii) these two or more polynucleotide molecules, its complement or the product from it are each had specific molecular marker,
Wherein from these two or more polynucleotide molecules of this first cell, its complement or each molecular marker from its product be relative to each other uniqueness, and
Wherein from these two or more polynucleotide molecules of this second cell, its complement or each molecular marker from its product be relative to each other uniqueness。
2. the method for claim 1, farther includes these two or more polynucleotide molecules, its complement or this of product from it are checked order at least partially。
3. method as claimed in claim 2, farther includes to analyze the sequence data from this order-checking, to identify the some independent molecule in these polynucleotide in the specific cells of these cells。
4. the method for claim 1, wherein these cells are cancerous cell。
5. the method for claim 1, wherein these cells are infected by viral polynucleotide。
6. the method for claim 1, wherein these cells are antibacterial or fungus。
7. method as claimed in claim 2, wherein this order-checking includes checking order with the reading length of at least 100 bases。
8. method as claimed in claim 2, wherein this order-checking includes checking order with the reading length of at least 500 bases。
9. the method for claim 1, wherein these polynucleotide molecules are mRNA or Microrna, and its complement and product thereof are the complements of these mRNA or Microrna and from the product of these mRNA or Microrna。
10. the method for claim 1, wherein these molecular markers are on pearl。
11. the method for claim 1, it is on pearl that individual cells wherein has specific labelling。
12. the method for claim 1, wherein individual cells is had specific labelling and these molecular markers are on pearl。
13. the method as according to any one of claim 1-12, it carries out at least in part in emulsion。
14. the method as according to any one of claim 1-12, it carries out at least in part in the hole of array or micropore。
15. the method as according to any one of claim 1-14, the existence of the polynucleotide relevant to disease or disease wherein detected。
16. method as described in any of claims 15, wherein this disease or disease are cancers。
17. the method as according to any one of claim 1-16, Microrna, its complement or product at least some of from it wherein detected。
18. method as claimed in claim 15, wherein this disease or disease are viral infection。
19. method as claimed in claim 18, wherein this viral infection is from enveloped virus。
20. method as claimed in claim 18, wherein this viral infection is from nonenveloped virus。
21. method as claimed in claim 20, wherein this virus viral DNA containing double-strand。
22. method as claimed in claim 20, wherein this virus viral DNA containing strand。
23. method as claimed in claim 18, wherein this virus is selected from lower group, and this group is made up of the following: poxvirus, herpesvirus, varicella zoster virus, cytomegalovirus, Epstein-Barr virus, hepadnavirus, papovavirus, polyoma virus and any combination thereof。
24. the method as according to any one of claim 1-23, wherein this first cell is from not suffering from the people of disease or disease and this second cell from the people suffering from this disease or disease。
25. method as claimed in claim 24, wherein these people are different。
26. method as claimed in claim 24, wherein these people are identical, but cell takes in different time points。
27. the method as according to any one of claim 1-23, wherein this first cell is from suffering from the people of this disease or disease and this second cell from same people。
28. the method as according to any one of claim 1-23, wherein the cell in this sample includes coming the cell of self-organizing or organ。
29. the method as according to any one of claim 1-28, wherein the cell in this sample includes the cell from following item: thymus, leukocyte, erythrocyte, hepatocyte, splenocyte, pneumonocyte, heart cell, brain cell, Skin Cell, pancreatic cell, gastric cells, cell from oral cavity, cell from nasal cavity, colon cell, small intestine cells, nephrocyte, cell from body of gland, brain cell, neurocyte, neurogliocyte, eye cell, reproductive organ cells, bladder cells, gametid, human cell, fetal cell, amnion cell or its any combination。
30. a solid support, including multiple oligonucleotide, the plurality of oligonucleotide each includes cell marking and molecular marker, and wherein each cell marking of the plurality of oligonucleotide is identical, and each molecular marker of the plurality of oligonucleotide is different；And wherein
A () this solid support is pearl,
B this solid support is had specificity by () this cell marking,
C () this solid support is when being placed on the center of three Cartesian coordinates, its oligonucleotide extends at least seven of eight octants, or
Any combination of (d) (a)-(c)。
31. solid support as claimed in claim 30, wherein the plurality of oligonucleotide farther includes at least one in the following:
(a) sample labelling；
(b) common tags；And
(c) target nucleic acid land。
32. solid support as claimed in claim 31, wherein this solid support includes this target nucleic acid land, wherein this target nucleic acid land includes the sequence selected from lower group, and this group is made up of the following: gene specific sequence, oligomerization-dT sequence, random polymer and any combination thereof。
33. the solid support as described in claim 31 or 32, farther include target nucleic acid or its complement。
34. solid support as claimed in claim 33, include including multiple target nucleic acids or its complement, the plurality of target nucleic acid or its complement
The transcript from about 0.01% to about 100% of (a) organism transcript profile or its complement, or
The genomic gene from about 0.01% to about 100% of (b) organism or its complement。
35. the solid support as according to any one of claim 30-34, wherein
A the cell marking of () the plurality of oligonucleotide includes the first random sequence utilizing the first labelling catenation sequence and the second random sequence to connect；And
B the molecular marker of () the plurality of oligonucleotide includes random sequence。
36. the solid support as according to any one of claim 30-35, wherein this solid support is selected from lower group, and this group is made up of the following: polydimethylsiloxane (PDMS) solid support, polystyrene solid support, glass solid support, polypropylene solid holder, agarose solid support, gelatin solid support, magnetic retention holder, pluronic solid support and any combination thereof。
37. the solid support as according to any one of claim 30-35, wherein
A () the plurality of oligonucleotide includes the joint comprising joint functional group, and
B () this solid support includes solid support functional group；
Wherein this solid support functional group and joint functional group are connected to each other。
38. solid support as claimed in claim 37, wherein this joint functional group and this solid support functional group are individually selected from lower group, and this group is made up of the following: C6, biotin, Streptavidin, one or more primary amine, one or more aldehyde, one or more ketone and any combination thereof。
39. the solid support as according to any one of claim 30-38, wherein the molecular marker of the plurality of oligonucleotide includes at least 15 nucleotide。
40. a test kit, including the solid support according to any one of such as claim 30-39 and operation instructions。
41. test kit as claimed in claim 40, farther include hole。
42. test kit as claimed in claim 41, wherein this hole is involved in an array。
43. the test kit as according to any one of claim 40-42, wherein this hole is micropore。
44. the test kit as according to any one of claim 40-43, farther include buffer。
45. an emulsion, including the solid support according to any one of such as claim 30-39。
46. a compositions, including hole and the solid support as according to any one of claim 30-39。
47. a compositions, including cell and the solid support as according to any one of claim 30-39。
48. emulsion as claimed in claim 45 or compositions as claimed in claim 46, farther include cell。
49. compositions as according to any one of claim 47 or 48 or emulsion, wherein this cell is unicellular。
50. compositions as claimed in claim 46, wherein this hole is micropore。
51. compositions as claimed in claim 50, wherein the volume range of this micropore is from about 1,000 μm3To about 120,000 μm3。
52. a method, including:
A () makes sample and the solid support into contact as according to any one of claim 30-32 or 35-39,
B () makes the oligonucleotide hybridization of the target nucleic acid from this sample and the plurality of oligonucleotide。
53. method as claimed in claim 52, farther include
C () expands this target nucleic acid or its complement。
54. method as claimed in claim 53, farther include
D this target nucleic acid or its complement are checked order by (), wherein this order-checking includes the molecular marker of the oligonucleotide being combined with this target nucleic acid or its complement is checked order。
55. method as claimed in claim 54, farther include
E () determines the amount of this target nucleic acid or its complement, wherein this is determined and includes:
The level of (i) quantitatively this target nucleic acid or its complement；
(ii) the some sequences comprising same molecular labelling are counted；
Or the combination of (i) and (ii) (iii)。
56. the method as described in claim 54 or 55, wherein the method does not include any identical molecular marker of comparison or any identical cell marking。
57. the method as according to any one of claim 53-56, wherein this amplification includes this target nucleic acid of reverse transcription。
58. the method as according to any one of claim 53-57, wherein this amplification utilizes the method selected from lower group, and this group is made up of the following: PCR, nest-type PRC, quantitative PCR, real-time PCR, digital pcr and any combination thereof。
59. the method as according to any one of claim 53-58, wherein this amplification is carried out as follows
A () is directly on this solid support；
B () is in the template transcribed from this solid support；Or
The combination of (c) (a) and (b)。
60. the method as according to any one of claim 52-59, wherein this sample includes cell。
61. method as claimed in claim 60, wherein this cell is unicellular。
62. the method as according to any one of claim 52-61, wherein this contact occurs in hole。
63. method as claimed in claim 62, wherein this hole is micropore and is comprised in microwell array。
64. a device, including multiple micropores, wherein the volume range of each micropore in the plurality of micropore is from about 1,000 μm3To about 120,000 μm3。
65. the device as described in claim 64, wherein the volume of each micropore in the plurality of micropore is about 20,000 μm3。
66. the device as described in claim 64 or 65, wherein the plurality of micropore includes the micropore from about 96 to about 200,000。
67. the device as according to any one of claim 64-66, wherein these micropores are comprised in material layer。
68. the device as according to any one of claim 64-67, the micropore of at least a part of which about 10% farther includes cell。
69. the device as according to any one of claim 64-69, farther include the solid support as according to any one of claim 30-39。
70. an equipment, including the device according to any one of such as claim 64-69 and liquid processor。
71. the equipment as described in claim 70, wherein this liquid processor in about one second by liquid delivery to the plurality of micropore。
72. the equipment as described in claim 70 or 71, wherein liquid is delivered to the plurality of micropore from single input port by this liquid processor。
73. the equipment as according to any one of claim 70-72, farther include magnet。
74. the equipment as according to any one of claim 70-73, farther include at least one in following item: entrance, outlet, pump, valve, passage, reservoir, sample collection room, temperature controller or its any combination。
75. the equipment as described in claim 74, including this sample collection room, wherein this sample collection room can be removed from this equipment。
76. the equipment as according to any one of claim 70-75, farther include optical imaging instrument。
77. the equipment as described in claim 76, wherein this optical imaging instrument produces the output signal for controlling this liquid processor。
78. the equipment as according to any one of claim 70-77, the thermal circulation mechanism that the polymerase chain reaction (PCR) farther including to be configured to carry out oligonucleotide expands。
79. the method producing clinical diagnosis test result, produce this clinical diagnosis test result including with following item:
(a) device as according to any one of claim 70-78 or equipment；
(b) solid support as according to any one of claim 30-39；
(c) method as according to any one of claim 1-29 or 52-63；Or
Any combination of (d) (a)-(c)。
80. the method as described in claim 79, wherein transmit this clinical diagnosis test result via communication medium。
81. a method for the solid support that manufacture is as according to any one of claim 30-39, the method includes
A () is attached to solid support: the first polynucleotide, it includes
The Part I of (i) this cell marking, and
(ii) the first joint；And
B () contacts the second polynucleotide, it includes
The Part II of (i) this cell marking,
(ii) sequence complementary with this first joint, and
(iii) this molecular marker。
82. the method as described in claim 81, wherein the 3rd polynucleotide farther include target nucleic acid land。
83. the test kit as according to any one of claim 40-44, wherein this test kit is comprised in packaging。
84. the test kit as described in claim 83, wherein this packaging is box。
85. the test kit as described in claim 83 or 84, wherein the volume of this packaging or box is 2 cubic feet or less。
86. the test kit as described in claim 83 or 84, wherein the volume of this packaging or box is 1 cubic feet or less。
87. the method as according to any one of claim 1-86, wherein emulsion, micropore or hole contain only a cell。
88. the method as according to any one of claim 1-87, wherein from 1 to 2,000,000 emulsion, micropore or hole each contain only a cell。
89. the method as according to any one of claim 1-88, it is assigned in each emulsion, micropore or hole including by most cell。
90. the method as according to any one of claim 1-89, wherein by single solid support with unicellular be assigned in emulsion, micropore or hole。
91. the method as according to any one of claim 1-90, wherein from 1 to 2,000,000 emulsion, micropore or hole have each been assigned with a cell and a solid support wherein。
92. the method as according to any one of claim 1-91, including distribution at most solid support/emulsion, micropore or hole。
93. the method as according to any one of claim 1-92, each one one solid support of distribution and the cell including to from 1 to 2, in 000,000 micropore, emulsion or hole。
94. the method as according to any one of claim 1-93, wherein cell distribution is random or nonrandom。
95. the method as according to any one of claim 1-94, wherein cell distribution is random。
96. the method as according to any one of claim 1-95, wherein utilize cell sorter distribution cell。
97. the method as according to any one of claim 1-96, wherein distribute cell, so make an at most cell be assigned in these one or more holes, micropore or emulsion by making one or more hole, micropore or emulsion contact with the dilute solution through diluting cells。
98. the method as according to any one of claim 1-97, wherein these target-specific districts, the target-specific district of the plurality of oligonucleotide or the target-specific district of these two or more polynucleotide molecules include the sequence of two or more target-complementary with target surface plate。
99. the method as described in claim 98, wherein two or more targets of this target surface plate are biomarkers。
100. the method as described in claim 99, wherein these biomarkers are the biomarkers of disease or disease。
101. the method as described in claim 100, wherein this disease or disease are cancer, infection, viral infection, inflammatory diseases, neurodegenerative diseases, fungal disease, antibacterial infection or its any combination。
102. the method as according to any one of claim 98-101, wherein this panel includes from 2-50, and 000,2-40,000,2-30,000,2-20,000,2-10,000,2-9000,2-8,000,2-7,000,2-6,000,2-5,000,2-1,000,2-800,2-700,2-600,2-500,2-400,2-300,2-200,2-100,2-75,2-50,2-40,2-30,2-20,2-10 or 2-5 kind biomarker。
CN201480059505.3A 2013-08-28 2014-08-28 Extensive parallel single cell analysis Active CN105705659B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911165393.0A CN110964796B (en) 2013-08-28 2014-08-28 Large-scale parallel single cell analysis

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US201361871232P 2013-08-28 2013-08-28
US61/871,232 2013-08-28
US201461952036P 2014-03-12 2014-03-12
US61/952,036 2014-03-12
US201462012237P 2014-06-13 2014-06-13
US62/012,237 2014-06-13
PCT/US2014/053301 WO2015031691A1 (en) 2013-08-28 2014-08-28 Massively parallel single cell analysis

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CN201911165393.0A Division CN110964796B (en) 2013-08-28 2014-08-28 Large-scale parallel single cell analysis

Publications (2)

Publication Number Publication Date
CN105705659A true CN105705659A (en) 2016-06-22
CN105705659B CN105705659B (en) 2019-11-29

Family

ID=51519182

Family Applications (2)

Application Number Title Priority Date Filing Date
CN201480059505.3A Active CN105705659B (en) 2013-08-28 2014-08-28 Extensive parallel single cell analysis
CN201911165393.0A Active CN110964796B (en) 2013-08-28 2014-08-28 Large-scale parallel single cell analysis

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN201911165393.0A Active CN110964796B (en) 2013-08-28 2014-08-28 Large-scale parallel single cell analysis

Country Status (11)

Country Link
US (13) US9567645B2 (en)
EP (3) EP3039158B1 (en)
JP (2) JP6545682B2 (en)
KR (4) KR102182834B1 (en)
CN (2) CN105705659B (en)
AU (3) AU2014312208B2 (en)
DK (1) DK3039158T3 (en)
ES (2) ES2857908T3 (en)
GB (2) GB2525104B (en)
SG (2) SG11201601188TA (en)
WO (1) WO2015031691A1 (en)

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107058310A (en) * 2016-08-12 2017-08-18 艾吉泰康生物科技(北京)有限公司 A kind of amplicon library constructing method for improving gene low frequency abrupt climatic change sensitivity
CN107177693A (en) * 2017-07-19 2017-09-19 中山大学 A kind of many times of PCR amplification methods
CN107208158A (en) * 2015-02-27 2017-09-26 赛卢拉研究公司 Spatially addressable molecule bar coding
CN109112182A (en) * 2018-09-04 2019-01-01 安徽农业大学 The method of the single oocyte gene quantitative expression of one boar
CN109843435A (en) * 2016-09-28 2019-06-04 通用自动化实验技术公司 For determining high resolution system, the kit, device and method with the application of other high-flux microorganisms of bacterial community relationship
CN110191756A (en) * 2016-11-17 2019-08-30 赛尔希诊断公司 System and method for recycling and analyzing particle
CN110799654A (en) * 2017-03-21 2020-02-14 穆韦尔斯有限公司 Sealed micropore assay
CN110951580A (en) * 2019-09-29 2020-04-03 中国科学院苏州生物医学工程技术研究所 High-throughput single-cell transcriptome and gene mutation integration analysis integrated device
CN111479631A (en) * 2017-10-27 2020-07-31 10X基因组学有限公司 Methods and systems for sample preparation and analysis
CN111492068A (en) * 2017-12-19 2020-08-04 贝克顿迪金森公司 Particles associated with oligonucleotides
CN112272710A (en) * 2018-05-03 2021-01-26 贝克顿迪金森公司 High throughput omics sample analysis
CN112969789A (en) * 2018-11-08 2021-06-15 贝克顿迪金森公司 Single cell whole transcriptome analysis using random priming
CN113150989A (en) * 2021-05-06 2021-07-23 上海交通大学医学院附属第九人民医院 Support for biomechanical bionic research
CN113166192A (en) * 2018-11-30 2021-07-23 吉内恩福赛克公司 Method for generating random oligonucleotides and determining the sequence thereof
WO2021147069A1 (en) * 2020-01-23 2021-07-29 青岛华大智造普惠科技有限公司 Droplet microfluidics-based single cell sequencing and applications
CN113454234A (en) * 2019-02-14 2021-09-28 贝克顿迪金森公司 Hybrid targeting and whole transcriptome amplification
CN113450336A (en) * 2021-07-01 2021-09-28 维柯基科技(上海)有限公司 Processing method and device of porous fluorescent microarray image, computer equipment and computer readable storage medium
CN114214395A (en) * 2021-12-31 2022-03-22 上海星耀医学科技发展有限公司 Nucleic acid amplification method and kit for improving gene detection accuracy
CN114480592A (en) * 2020-10-27 2022-05-13 重庆医科大学 SNPs detection technology based on UDG mediated PCR, magnetic nano enrichment and strand displacement reaction
CN114507743A (en) * 2022-01-28 2022-05-17 中国农业科学院植物保护研究所 RPA primer, probe and kit for rapidly detecting Heterodera filipjevi and application of RPA primer, probe and kit
US11492660B2 (en) 2018-12-13 2022-11-08 Becton, Dickinson And Company Selective extension in single cell whole transcriptome analysis
TWI804560B (en) * 2018-01-11 2023-06-11 美商奈諾卡福有限責任公司 Microfluidic cellular device and methods of use thereof

Families Citing this family (326)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7311794B2 (en) 2004-05-28 2007-12-25 Wafergen, Inc. Methods of sealing micro wells
KR101829182B1 (en) 2009-04-02 2018-03-29 플루이다임 코포레이션 Multi-primer amplification method for barcoding of target nucleic acids
US8835358B2 (en) 2009-12-15 2014-09-16 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US9315857B2 (en) 2009-12-15 2016-04-19 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse label-tags
US9074251B2 (en) 2011-02-10 2015-07-07 Illumina, Inc. Linking sequence reads using paired code tags
US10457936B2 (en) 2011-02-02 2019-10-29 University Of Washington Through Its Center For Commercialization Massively parallel contiguity mapping
EP2710172B1 (en) * 2011-05-20 2017-03-29 Fluidigm Corporation Nucleic acid encoding reactions
US10466160B2 (en) 2011-08-01 2019-11-05 Celsee Diagnostics, Inc. System and method for retrieving and analyzing particles
US9404864B2 (en) 2013-03-13 2016-08-02 Denovo Sciences, Inc. System for imaging captured cells
CA2842359A1 (en) 2011-08-01 2013-02-07 Denovo Sciences Cell capture system and method of use
US11177020B2 (en) 2012-02-27 2021-11-16 The University Of North Carolina At Chapel Hill Methods and uses for molecular tags
WO2013130674A1 (en) 2012-02-27 2013-09-06 Cellular Research, Inc. Compositions and kits for molecular counting
LT3305918T (en) 2012-03-05 2020-09-25 President And Fellows Of Harvard College Methods for epigenetic sequencing
US20150011396A1 (en) 2012-07-09 2015-01-08 Benjamin G. Schroeder Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing
GB2539836B (en) 2012-08-13 2017-03-29 Univ California Methods for detecting target nucleic acids in sample lysate droplets
US10323279B2 (en) 2012-08-14 2019-06-18 10X Genomics, Inc. Methods and systems for processing polynucleotides
US9701998B2 (en) 2012-12-14 2017-07-11 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10273541B2 (en) * 2012-08-14 2019-04-30 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10752949B2 (en) 2012-08-14 2020-08-25 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10221442B2 (en) 2012-08-14 2019-03-05 10X Genomics, Inc. Compositions and methods for sample processing
US11591637B2 (en) 2012-08-14 2023-02-28 10X Genomics, Inc. Compositions and methods for sample processing
CA3216609C (en) 2012-08-14 2024-05-14 10X Genomics, Inc. Microcapsule compositions and methods
US10584381B2 (en) 2012-08-14 2020-03-10 10X Genomics, Inc. Methods and systems for processing polynucleotides
US9951386B2 (en) 2014-06-26 2018-04-24 10X Genomics, Inc. Methods and systems for processing polynucleotides
CA2894694C (en) 2012-12-14 2023-04-25 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10533221B2 (en) 2012-12-14 2020-01-14 10X Genomics, Inc. Methods and systems for processing polynucleotides
US9606102B2 (en) 2013-01-26 2017-03-28 Denovo Sciences, Inc. System and method for capturing and analyzing cells
CA2900543C (en) 2013-02-08 2023-01-31 10X Genomics, Inc. Partitioning and processing of analytes and other species
CA3094792A1 (en) 2013-03-13 2014-09-18 Illumina, Inc. Methods and compositions for nucleic acid sequencing
US9707562B2 (en) 2013-03-13 2017-07-18 Denovo Sciences, Inc. System for capturing and analyzing cells
US9822408B2 (en) 2013-03-15 2017-11-21 Nugen Technologies, Inc. Sequential sequencing
US11859171B2 (en) 2013-04-17 2024-01-02 Agency For Science, Technology And Research Method for generating extended sequence reads
US10391490B2 (en) 2013-05-31 2019-08-27 Celsee Diagnostics, Inc. System and method for isolating and analyzing cells
US9856535B2 (en) 2013-05-31 2018-01-02 Denovo Sciences, Inc. System for isolating cells
DK3013983T3 (en) 2013-06-25 2023-03-06 Prognosys Biosciences Inc SPATIALLY ENCODED BIOLOGICAL ASSAYS USING A MICROFLUIDIC DEVICE
AU2014312208B2 (en) 2013-08-28 2019-07-25 Becton, Dickinson And Company Massively parallel single cell analysis
EP3055676A1 (en) 2013-10-07 2016-08-17 Cellular Research, Inc. Methods and systems for digitally counting features on arrays
WO2015073711A1 (en) 2013-11-13 2015-05-21 Nugen Technologies, Inc. Compositions and methods for identification of a duplicate sequencing read
RU2675502C1 (en) * 2013-11-29 2018-12-19 Конинклейке Филипс Н.В. Optical control of chemical reaction
US9824068B2 (en) 2013-12-16 2017-11-21 10X Genomics, Inc. Methods and apparatus for sorting data
DK3083994T3 (en) 2013-12-20 2021-09-13 Illumina Inc Preservation of genomic connectivity information in fragmented genomic DNA samples
EP4219010A1 (en) 2014-04-10 2023-08-02 10X Genomics, Inc. Methods for encapsulating and partitioning reagents
US20150298091A1 (en) 2014-04-21 2015-10-22 President And Fellows Of Harvard College Systems and methods for barcoding nucleic acids
US10975371B2 (en) 2014-04-29 2021-04-13 Illumina, Inc. Nucleic acid sequence analysis from single cells
EP3680333A1 (en) * 2014-04-29 2020-07-15 Illumina, Inc. Multiplexed single cell expression analysis using template switch and tagmentation
WO2015166768A1 (en) * 2014-05-02 2015-11-05 国立大学法人金沢大学 Method for analyzing nucleic acid derived from single cell
KR20230070325A (en) 2014-06-26 2023-05-22 10엑스 제노믹스, 인크. Methods of analyzing nucleic acids from individual cells or cell populations
US10697007B2 (en) 2014-06-27 2020-06-30 The Regents Of The University Of California PCR-activated sorting (PAS)
WO2016022833A1 (en) 2014-08-06 2016-02-11 Nugen Technologies, Inc. Digital measurements from targeted sequencing
WO2018176007A1 (en) * 2017-03-23 2018-09-27 BioSpyder Technologies, Inc. Modulation of targets in cellular pathways identified by resolution of stochastic gene expression
CA2997906A1 (en) * 2014-09-09 2016-03-17 The Broad Institute, Inc. A droplet-based method and apparatus for composite single-cell nucleic acid analysis
BR122021026781B1 (en) 2014-10-17 2023-11-14 Illumina Cambridge Limited CONTIGUITY PRESERVING TRANSPOSON
DK3207134T3 (en) * 2014-10-17 2019-09-23 Illumina Cambridge Ltd CONTIGUITY CONVERSING TRANSPOSITION
WO2016065056A1 (en) 2014-10-22 2016-04-28 The Regents Of The University Of California High definition microdroplet printer
MX2017005267A (en) 2014-10-29 2017-07-26 10X Genomics Inc Methods and compositions for targeted nucleic acid sequencing.
US9975122B2 (en) 2014-11-05 2018-05-22 10X Genomics, Inc. Instrument systems for integrated sample processing
US10900065B2 (en) * 2014-11-14 2021-01-26 University Of Washington Methods and kits for labeling cellular molecules
CN107407638B (en) 2014-12-03 2021-01-12 伊索普莱西斯公司 Analysis and screening of cellular secretion characteristics
US20160163235A1 (en) * 2014-12-09 2016-06-09 Avery Dennison Corporation Can End Label
US10616219B2 (en) 2014-12-11 2020-04-07 FlowJo, LLC Single cell data management and analysis systems and methods
BR112017012875B1 (en) * 2014-12-19 2021-03-23 The University Of Ottawa INTEGRATING NANOPORE SENSORS INSIDE MICROFLUID CHANNEL MATRICES AS USE OF CONTROLLED BREAK
CN112126675B (en) 2015-01-12 2022-09-09 10X基因组学有限公司 Method and system for preparing nucleic acid sequencing library and library prepared by using same
US11111519B2 (en) 2015-02-04 2021-09-07 The Regents Of The University Of California Sequencing of nucleic acids via barcoding in discrete entities
GB201501907D0 (en) * 2015-02-05 2015-03-25 Technion Res & Dev Foundation System and method for single cell genetic analysis
EP3766988B1 (en) 2015-02-19 2024-02-14 Becton, Dickinson and Company High-throughput single-cell analysis combining proteomic and genomic information
EP3259602B9 (en) 2015-02-20 2021-05-19 Takara Bio USA, Inc. Method for rapid accurate dispensing, visualization and analysis of single cells
EP3262407B1 (en) 2015-02-24 2023-08-30 10X Genomics, Inc. Partition processing methods and systems
AU2016222719B2 (en) 2015-02-24 2022-03-31 10X Genomics, Inc. Methods for targeted nucleic acid sequence coverage
WO2016138500A1 (en) * 2015-02-27 2016-09-01 Cellular Research, Inc. Methods and compositions for barcoding nucleic acids for sequencing
WO2016145416A2 (en) * 2015-03-11 2016-09-15 The Broad Institute, Inc. Proteomic analysis with nucleic acid identifiers
WO2016145409A1 (en) 2015-03-11 2016-09-15 The Broad Institute, Inc. Genotype and phenotype coupling
WO2016149418A1 (en) * 2015-03-18 2016-09-22 Cellular Research, Inc. Methods and compositions for labeling targets and haplotype phasing
JP7508191B2 (en) * 2015-03-30 2024-07-01 ベクトン・ディキンソン・アンド・カンパニー Methods and compositions for combinatorial barcoding
EP3901282B1 (en) 2015-04-10 2023-06-28 Spatial Transcriptomics AB Spatially distinguished, multiplex nucleic acid analysis of biological specimens
US11746367B2 (en) 2015-04-17 2023-09-05 President And Fellows Of Harvard College Barcoding systems and methods for gene sequencing and other applications
US10677793B2 (en) * 2015-04-21 2020-06-09 General Automation Lab Technologies Inc. High resolution systems, kits, apparatus, and methods using lateral flow for high throughput microbiology applications
US10900073B2 (en) * 2015-04-21 2021-01-26 General Automation Lab Technologies Inc. High resolution systems, kits, apparatus, and methods for high throughput microbiology applications
US10788452B2 (en) * 2015-04-21 2020-09-29 General Automation Lab Technologies Inc. High resolution systems, kits, apparatus, and methods for bacterial community relationship determination and other high throughput microbiology applications
EP3286326A1 (en) 2015-04-23 2018-02-28 Cellular Research, Inc. Methods and compositions for whole transcriptome amplification
MX2017013471A (en) 2015-04-27 2018-08-01 Abvitro Llc Methods of sequencing, determining, pairing, and validating therapeutic agents and disease specific antigens.
BR112017023188B1 (en) 2015-05-11 2023-11-14 Illumina, Inc PLATFORM FOR DISCOVERY AND ANALYSIS OF THERAPEUTIC AGENTS
JP2018522532A (en) * 2015-05-12 2018-08-16 ウェイク・フォレスト・ユニバーシティ・ヘルス・サイエンシーズＷａｋｅ Ｆｏｒｅｓｔ Ｕｎｉｖｅｒｓｉｔｙ Ｈｅａｌｔｈ Ｓｃｉｅｎｃｅｓ Identification of genetic modifications
EP3303633B1 (en) * 2015-05-26 2024-02-21 The Trustees of Columbia University in the City of New York Rna printing and sequencing devices, and systems
WO2016196229A1 (en) 2015-06-01 2016-12-08 Cellular Research, Inc. Methods for rna quantification
CN108138225B (en) * 2015-07-27 2022-10-14 亿明达股份有限公司 Spatial localization of nucleic acid sequence information
WO2017031125A1 (en) * 2015-08-17 2017-02-23 The Regents Of The University Of California Microdroplet-based multiple displacement amplification (mda) methods and related compositions
CN115928221A (en) * 2015-08-28 2023-04-07 Illumina公司 Single cell nucleic acid sequence analysis
ES2745694T3 (en) * 2015-09-11 2020-03-03 Cellular Res Inc Methods and compositions for nucleic acid library normalization
US11092607B2 (en) 2015-10-28 2021-08-17 The Board Institute, Inc. Multiplex analysis of single cell constituents
WO2017075297A1 (en) 2015-10-28 2017-05-04 The Broad Institute Inc. High-throughput dynamic reagent delivery system
US11098304B2 (en) * 2015-11-04 2021-08-24 Atreca, Inc. Combinatorial sets of nucleic acid barcodes for analysis of nucleic acids associated with single cells
KR101745590B1 (en) * 2015-11-13 2017-06-09 고려대학교 산학협력단 Optical Microscopy for RNA Splicing on Single Molecules Using Scattering Intensity, Localized Surface Plasmon Resonance and Surface-Enhanced Raman Scattering
US11371094B2 (en) 2015-11-19 2022-06-28 10X Genomics, Inc. Systems and methods for nucleic acid processing using degenerate nucleotides
ES2926495T3 (en) 2015-12-04 2022-10-26 10X Genomics Inc Methods and compositions for nucleic acid analysis
WO2017096110A1 (en) * 2015-12-04 2017-06-08 Siemens Healthcare Diagnostics Inc. Method and device for optimizing the process of identification of pathogens
CA3006994A1 (en) 2015-12-16 2017-06-22 Fluidigm Corporation High-level multiplex amplification
WO2017124101A2 (en) * 2016-01-15 2017-07-20 The Broad Institute Inc. Semi-permeable arrays for analyzing biological systems and methods of using same
WO2017139501A1 (en) * 2016-02-10 2017-08-17 The Board Of Trustees Of The Leland Stanford Junior University Rna fixation and detection in clarity-based hydrogel tissue
CN108779491B (en) 2016-02-11 2021-03-09 10X基因组学有限公司 Systems, methods, and media for de novo assembly of whole genome sequence data
KR20220167397A (en) * 2016-03-04 2022-12-20 애보트 다이어그노스틱스 스카보로, 인크. Automated nested recombinase polymerase amplification
WO2017168493A1 (en) * 2016-03-28 2017-10-05 株式会社日立製作所 System for capturing single cell-derived biomolecules
EP3443123B1 (en) * 2016-04-11 2021-08-11 Board of Regents, The University of Texas System Methods and compositions for detecting single t cell receptor affinity and sequence
WO2017181161A1 (en) 2016-04-15 2017-10-19 Predicine, Inc. Systems and methods for detecting genetic alterations
AU2017261189B2 (en) * 2016-05-02 2023-02-09 Becton, Dickinson And Company Accurate molecular barcoding
WO2017197338A1 (en) 2016-05-13 2017-11-16 10X Genomics, Inc. Microfluidic systems and methods of use
US10301677B2 (en) 2016-05-25 2019-05-28 Cellular Research, Inc. Normalization of nucleic acid libraries
JP7046007B2 (en) 2016-05-26 2022-04-01 ベクトン・ディキンソン・アンド・カンパニー How to adjust the molecular label count
US10640763B2 (en) 2016-05-31 2020-05-05 Cellular Research, Inc. Molecular indexing of internal sequences
JP6231709B1 (en) * 2016-05-31 2017-11-15 シスメックス株式会社 Fluorescence image analyzer and analysis method
US10202641B2 (en) 2016-05-31 2019-02-12 Cellular Research, Inc. Error correction in amplification of samples
US10640824B1 (en) * 2016-06-03 2020-05-05 Verily Life Sciences Llc Methods of identifying nucleic acids from a single cell using an electrical cell-trapping array
EP3472359B1 (en) 2016-06-21 2022-03-16 10X Genomics, Inc. Nucleic acid sequencing
EP3686287A1 (en) * 2016-06-28 2020-07-29 Hifibio Method for transcriptome analysis of single cells
US11460405B2 (en) 2016-07-21 2022-10-04 Takara Bio Usa, Inc. Multi-Z imaging and dispensing with multi-well devices
WO2018031691A1 (en) 2016-08-10 2018-02-15 The Regents Of The University Of California Combined multiple-displacement amplification and pcr in an emulsion microdroplet
US11174503B2 (en) 2016-09-21 2021-11-16 Predicine, Inc. Systems and methods for combined detection of genetic alterations
JP7091348B2 (en) 2016-09-26 2022-06-27 ベクトン・ディキンソン・アンド・カンパニー Measurement of protein expression using reagents with barcoded oligonucleotide sequences
US10190155B2 (en) 2016-10-14 2019-01-29 Nugen Technologies, Inc. Molecular tag attachment and transfer
JP7254349B2 (en) * 2016-10-26 2023-04-10 インテグレーテッド ナノ－テクノロジーズ，インコーポレイティド System and method for optical detection of biomolecular targets
CN109906274B (en) 2016-11-08 2023-08-25 贝克顿迪金森公司 Methods for cell marker classification
US11164659B2 (en) 2016-11-08 2021-11-02 Becton, Dickinson And Company Methods for expression profile classification
JP7348066B2 (en) 2016-11-11 2023-09-20 アイソプレキシス コーポレイション Compositions and methods for simultaneous analysis of single cell genome, transcriptome and proteome
CN110226084A (en) 2016-11-22 2019-09-10 伊索普莱克西斯公司 For the systems, devices and methods of cell capture and its manufacturing method
US20180165414A1 (en) 2016-12-14 2018-06-14 FlowJo, LLC Applied Computer Technology for Management, Synthesis, Visualization, and Exploration of Parameters in Large Multi-Parameter Data Sets
US20220033893A1 (en) 2016-12-21 2022-02-03 The Regents Of The University Of California Single Cell Genomic Sequencing Using Hydrogel Based Droplets
EP3558510B1 (en) * 2016-12-22 2022-11-23 Illumina, Inc. Array including sequencing primer and non-sequencing entity
US10011872B1 (en) 2016-12-22 2018-07-03 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10550429B2 (en) 2016-12-22 2020-02-04 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10815525B2 (en) 2016-12-22 2020-10-27 10X Genomics, Inc. Methods and systems for processing polynucleotides
KR101903255B1 (en) * 2016-12-29 2018-10-02 한국표준과학연구원 Sensor for detecting botulinum neurotoxin using spinning carbon-nanotube
CN110461244A (en) * 2017-01-04 2019-11-15 卡洛斯·盖蒂 For handling, detecting and the Multiple-Aperture Device of the biomaterial of paraffin or plastic embedding (IFPE) that multiple analysis is completely fixed
EP3568234B1 (en) * 2017-01-13 2023-09-06 Cellular Research, Inc. Hydrophilic coating of fluidic channels
EP3545089B1 (en) 2017-01-30 2022-03-09 10X Genomics, Inc. Methods and systems for droplet-based single cell barcoding
WO2018144240A1 (en) 2017-02-01 2018-08-09 Cellular Research, Inc. Selective amplification using blocking oligonucleotides
US10995333B2 (en) 2017-02-06 2021-05-04 10X Genomics, Inc. Systems and methods for nucleic acid preparation
WO2018156935A1 (en) 2017-02-24 2018-08-30 The Regents Of The University Of California Particle-drop structures and methods for making and using the same
SG11201907762RA (en) * 2017-03-24 2019-10-30 Nat Univ Singapore Methods for multiplex detection of molecules
WO2018175458A2 (en) * 2017-03-24 2018-09-27 Cellular Research, Inc. Synthetic multiplets for multiplets determination
WO2018203576A1 (en) * 2017-05-02 2018-11-08 国立大学法人 東京大学 Method for integrally detecting nondestructive measurement information and genome-related information of one cell
JP6990456B2 (en) * 2017-05-02 2022-01-12 国立大学法人 東京大学 A method for monitoring dynamic changes in cells or their origins and a method for classifying cells using the same method.
US11072816B2 (en) 2017-05-03 2021-07-27 The Broad Institute, Inc. Single-cell proteomic assay using aptamers
SG11201910195WA (en) * 2017-05-05 2019-11-28 Scipio Bioscience Methods for trapping and barcoding discrete biological units in hydrogel
WO2018217933A1 (en) 2017-05-25 2018-11-29 FlowJo, LLC Visualization, comparative analysis, and automated difference detection for large multi-parameter data sets
EP4230746A3 (en) 2017-05-26 2023-11-01 10X Genomics, Inc. Single cell analysis of transposase accessible chromatin
US10844372B2 (en) 2017-05-26 2020-11-24 10X Genomics, Inc. Single cell analysis of transposase accessible chromatin
KR102438495B1 (en) 2017-06-05 2022-09-01 백톤 디킨슨 앤드 컴퍼니 Sample indexing for single cells
US11029242B2 (en) 2017-06-12 2021-06-08 Becton, Dickinson And Company Index sorting systems and methods
WO2019018129A1 (en) 2017-07-18 2019-01-24 Becton, Dickinson And Company Dynamic interactive display of multi-parameter quantitative biological data
WO2019018128A1 (en) 2017-07-18 2019-01-24 Becton, Dickinson And Company Dynamic interactive display of multi-parameter quantitative biological data
US10593082B2 (en) 2017-07-18 2020-03-17 Becton, Dickinson And Company Dynamic display of multi-parameter quantitative biological data
US11331019B2 (en) 2017-08-07 2022-05-17 The Research Foundation For The State University Of New York Nanoparticle sensor having a nanofibrous membrane scaffold
CN112980667A (en) 2017-08-29 2021-06-18 伯乐实验室有限公司 Systems and methods for separating and analyzing cells
FI3684949T3 (en) * 2017-09-22 2024-07-17 Univ Washington In situ combinatorial labeling of cellular molecules
EP4379727A1 (en) 2017-09-25 2024-06-05 Becton, Dickinson and Company Immune receptor-barcode error correction
US10837047B2 (en) 2017-10-04 2020-11-17 10X Genomics, Inc. Compositions, methods, and systems for bead formation using improved polymers
US11485966B2 (en) * 2017-10-11 2022-11-01 Mgi Tech Co., Ltd. Method for improving loading and stability of nucleic acid
US10501739B2 (en) 2017-10-18 2019-12-10 Mission Bio, Inc. Method, systems and apparatus for single cell analysis
US11099202B2 (en) 2017-10-20 2021-08-24 Tecan Genomics, Inc. Reagent delivery system
WO2019084043A1 (en) 2017-10-26 2019-05-02 10X Genomics, Inc. Methods and systems for nuclecic acid preparation and chromatin analysis
WO2019099751A1 (en) 2017-11-15 2019-05-23 10X Genomics, Inc. Functionalized gel beads
CN110770352B (en) * 2017-11-17 2023-12-15 10X基因组学有限公司 Methods and systems for correlating physical and genetic properties of biological particles
US10829815B2 (en) 2017-11-17 2020-11-10 10X Genomics, Inc. Methods and systems for associating physical and genetic properties of biological particles
WO2019100024A1 (en) * 2017-11-20 2019-05-23 Freenome Holdings, Inc. Methods for reduction in required material for shotgun sequencing
EP3717661A1 (en) * 2017-11-27 2020-10-07 The Trustees of Columbia University in the City of New York Rna printing and sequencing devices, methods, and systems
WO2019108851A1 (en) 2017-11-30 2019-06-06 10X Genomics, Inc. Systems and methods for nucleic acid preparation and analysis
WO2019113457A1 (en) 2017-12-07 2019-06-13 Massachusetts Institute Of Technology Single cell analyses
DK3498865T3 (en) * 2017-12-14 2020-12-21 Univ Muenchen Ludwig Maximilians Detection and quantification of single molecules using DNA nanotechnology in microwells
US20200340915A1 (en) * 2018-01-19 2020-10-29 Nitto Denko Corporation Flow path, measurement tape, and measurement device
EP3752832A1 (en) 2018-02-12 2020-12-23 10X Genomics, Inc. Methods characterizing multiple analytes from individual cells or cell populations
US11639928B2 (en) 2018-02-22 2023-05-02 10X Genomics, Inc. Methods and systems for characterizing analytes from individual cells or cell populations
WO2019169028A1 (en) 2018-02-28 2019-09-06 10X Genomics, Inc. Transcriptome sequencing through random ligation
US20190276820A1 (en) * 2018-03-12 2019-09-12 Mantra Bio, Inc. Single extracellular vesicle multiplexed protein and rna analysis
JP7003763B2 (en) * 2018-03-19 2022-02-04 凸版印刷株式会社 Reagent cartridge
US11519027B2 (en) * 2018-03-30 2022-12-06 Massachusetts Institute Of Technology Single-cell RNA sequencing using click-chemistry
CN112262218A (en) 2018-04-06 2021-01-22 10X基因组学有限公司 System and method for quality control in single cell processing
US11365409B2 (en) 2018-05-03 2022-06-21 Becton, Dickinson And Company Molecular barcoding on opposite transcript ends
WO2019217758A1 (en) 2018-05-10 2019-11-14 10X Genomics, Inc. Methods and systems for molecular library generation
US11254975B2 (en) * 2018-05-24 2022-02-22 National Center For Child Health And Development Method of amplifying a polynucleotide of interest
US10883912B2 (en) 2018-06-04 2021-01-05 Becton, Dickinson And Company Biexponential transformation for graphics display
US11932899B2 (en) 2018-06-07 2024-03-19 10X Genomics, Inc. Methods and systems for characterizing nucleic acid molecules
WO2019241249A1 (en) * 2018-06-11 2019-12-19 The Brigham And Women's Hospital, Inc. Single cell cloning approaches for biological studies
US11703427B2 (en) 2018-06-25 2023-07-18 10X Genomics, Inc. Methods and systems for cell and bead processing
WO2020010311A2 (en) * 2018-07-05 2020-01-09 Active Genomes Expressed Diagnostics, Inc Viral oncogene influences and gene expression patterns as indicators of early tumorigenesis
WO2020012057A1 (en) * 2018-07-13 2020-01-16 Universidad De Granada Preparation of nucleic acid libraries or gene banks
US20200032335A1 (en) 2018-07-27 2020-01-30 10X Genomics, Inc. Systems and methods for metabolome analysis
US20200040379A1 (en) 2018-08-03 2020-02-06 Cellular Research, Inc. Nuclei barcoding and capture in single cells
EP3837378B1 (en) 2018-08-17 2023-04-05 Becton, Dickinson and Company Aptamer barcoding
US12065688B2 (en) 2018-08-20 2024-08-20 10X Genomics, Inc. Compositions and methods for cellular processing
WO2020046833A1 (en) 2018-08-28 2020-03-05 Cellular Research, Inc. Sample multiplexing using carbohydrate-binding and membrane-permeable reagents
US20200090782A1 (en) * 2018-09-18 2020-03-19 California Institute Of Technology Systems and methods for dissecting heterogeneous cell populations
EP3861134B1 (en) 2018-10-01 2024-09-04 Becton, Dickinson and Company Determining 5' transcript sequences
EP3891303A4 (en) * 2018-12-07 2022-09-14 Qiagen Sciences LLC Methods for preparing cdna samples for rna sequencing, and cdna samples and uses thereof
US11459607B1 (en) 2018-12-10 2022-10-04 10X Genomics, Inc. Systems and methods for processing-nucleic acid molecules from a single cell using sequential co-partitioning and composite barcodes
US11358137B2 (en) 2018-12-26 2022-06-14 Industrial Technology Research Institute Tubular structure for producing droplets and method for producing droplets
US11926867B2 (en) 2019-01-06 2024-03-12 10X Genomics, Inc. Generating capture probes for spatial analysis
US11649485B2 (en) 2019-01-06 2023-05-16 10X Genomics, Inc. Generating capture probes for spatial analysis
GB2580385B (en) * 2019-01-08 2022-10-12 Quantumdx Group Ltd Oligonucleotide deposition onto polypropylene substrates
US11845983B1 (en) 2019-01-09 2023-12-19 10X Genomics, Inc. Methods and systems for multiplexing of droplet based assays
US11371076B2 (en) 2019-01-16 2022-06-28 Becton, Dickinson And Company Polymerase chain reaction normalization through primer titration
WO2020154247A1 (en) 2019-01-23 2020-07-30 Cellular Research, Inc. Oligonucleotides associated with antibodies
WO2020167830A1 (en) 2019-02-12 2020-08-20 Becton, Dickinson And Company Determining expressions of transcript variants and polyadenylation sites
US11467153B2 (en) 2019-02-12 2022-10-11 10X Genomics, Inc. Methods for processing nucleic acid molecules
US11851683B1 (en) 2019-02-12 2023-12-26 10X Genomics, Inc. Methods and systems for selective analysis of cellular samples
WO2020168013A1 (en) 2019-02-12 2020-08-20 10X Genomics, Inc. Methods for processing nucleic acid molecules
US11655499B1 (en) 2019-02-25 2023-05-23 10X Genomics, Inc. Detection of sequence elements in nucleic acid molecules
SG11202111242PA (en) 2019-03-11 2021-11-29 10X Genomics Inc Systems and methods for processing optically tagged beads
US11579217B2 (en) 2019-04-12 2023-02-14 Western Digital Technologies, Inc. Devices and methods for frequency- and phase-based detection of magnetically-labeled molecules using spin torque oscillator (STO) sensors
US11738336B2 (en) 2019-04-12 2023-08-29 Western Digital Technologies, Inc. Spin torque oscillator (STO) sensors used in nucleic acid sequencing arrays and detection schemes for nucleic acid sequencing
US11609208B2 (en) * 2019-04-12 2023-03-21 Western Digital Technologies, Inc. Devices and methods for molecule detection based on thermal stabilities of magnetic nanoparticles
US10633693B1 (en) 2019-04-16 2020-04-28 Celsee Diagnostics, Inc. System and method for leakage control in a particle capture system
US11965208B2 (en) 2019-04-19 2024-04-23 Becton, Dickinson And Company Methods of associating phenotypical data and single cell sequencing data
KR20220016477A (en) 2019-05-07 2022-02-09 바이오 래드 래버러토리스 인코오포레이티드 Systems and Methods for Automated Single Cell Processing
US11273439B2 (en) 2019-05-07 2022-03-15 Bio-Rad Laboratories, Inc. System and method for target material retrieval from microwells
EP3973074A4 (en) 2019-05-22 2023-09-06 Mission Bio, Inc. Method and apparatus for simultaneous targeted sequencing of dna, rna and protein
WO2020243579A1 (en) 2019-05-30 2020-12-03 10X Genomics, Inc. Methods of detecting spatial heterogeneity of a biological sample
JP7356519B2 (en) 2019-06-14 2023-10-04 バイオ－ラッド ラボラトリーズ インコーポレイテッド Systems and methods for automated single cell processing and analysis
CA3145243A1 (en) * 2019-06-27 2020-12-30 Cell Microsystems, Inc. Systems and methods for associating single cell imaging with rna transcriptomics
WO2021003255A1 (en) 2019-07-01 2021-01-07 Mission Bio Method and apparatus to normalize quantitative readouts in single-cell experiments
JP7511257B2 (en) * 2019-07-11 2024-07-05 学校法人東京理科大学 Nucleic acid amplification method using a solid phase carrier
US20220276235A1 (en) * 2019-07-18 2022-09-01 Essenlix Corporation Imaging based homogeneous assay
US11939622B2 (en) 2019-07-22 2024-03-26 Becton, Dickinson And Company Single cell chromatin immunoprecipitation sequencing assay
WO2021034974A1 (en) * 2019-08-19 2021-02-25 Universal Sequencing Technology Corporation Methods and compositions for tracking nucleic acid fragment origin for nucleic acid sequencing
US11208682B2 (en) 2019-09-13 2021-12-28 Western Digital Technologies, Inc. Enhanced optical detection for nucleic acid sequencing using thermally-dependent fluorophore tags
CN114829626A (en) 2019-10-10 2022-07-29 1859公司 Methods and systems for microfluidic screening
WO2021092386A1 (en) 2019-11-08 2021-05-14 Becton Dickinson And Company Using random priming to obtain full-length v(d)j information for immune repertoire sequencing
EP4025711A2 (en) 2019-11-08 2022-07-13 10X Genomics, Inc. Enhancing specificity of analyte binding
EP4055185A1 (en) 2019-11-08 2022-09-14 10X Genomics, Inc. Spatially-tagged analyte capture agents for analyte multiplexing
US11747329B2 (en) 2019-11-22 2023-09-05 Western Digital Technologies, Inc. Magnetic gradient concentrator/reluctance detector for molecule detection
EP4069867A4 (en) 2019-12-04 2023-10-11 Becton, Dickinson and Company Magnetic capture bead mediated molecular barcoding of nucleic acid targets in single particles and compositions for use in the same
AU2020412766A1 (en) 2019-12-23 2022-06-09 10X Genomics, Inc. Methods for spatial analysis using RNA-templated ligation
WO2021146207A1 (en) 2020-01-13 2021-07-22 Becton, Dickinson And Company Methods and compositions for quantitation of proteins and rna
JP2023511278A (en) 2020-01-13 2023-03-17 フルーエント バイオサイエンシーズ インコーポレイテッド Methods and systems for single-cell gene profiling
JP2023511279A (en) 2020-01-13 2023-03-17 フルーエント バイオサイエンシーズ インコーポレイテッド Single cell sequencing
CN115279919A (en) 2020-01-13 2022-11-01 贝克顿迪金森公司 Cell capture using DU-containing oligonucleotides
EP4090328A4 (en) 2020-01-13 2024-02-14 Fluent Biosciences Inc. Emulsion based drug screening
CN115298322A (en) 2020-01-17 2022-11-04 贝克顿迪金森公司 Methods and compositions for single cell secretogomics
US11702693B2 (en) 2020-01-21 2023-07-18 10X Genomics, Inc. Methods for printing cells and generating arrays of barcoded cells
US11732299B2 (en) 2020-01-21 2023-08-22 10X Genomics, Inc. Spatial assays with perturbed cells
EP4097228B1 (en) 2020-01-29 2024-08-14 Becton, Dickinson and Company Barcoded wells for spatial mapping of single cells through sequencing
US20210238661A1 (en) 2020-01-31 2021-08-05 Becton, Dickinson And Company Mesophilic dna polymerase extension blockers
CN113275053A (en) 2020-02-03 2021-08-20 帝肯基因组学公司 Reagent storage system
US11898205B2 (en) 2020-02-03 2024-02-13 10X Genomics, Inc. Increasing capture efficiency of spatial assays
US11732300B2 (en) 2020-02-05 2023-08-22 10X Genomics, Inc. Increasing efficiency of spatial analysis in a biological sample
US11835462B2 (en) 2020-02-11 2023-12-05 10X Genomics, Inc. Methods and compositions for partitioning a biological sample
WO2021163374A2 (en) 2020-02-12 2021-08-19 Becton, Dickinson And Company Intracellular abseq
US11891654B2 (en) 2020-02-24 2024-02-06 10X Genomics, Inc. Methods of making gene expression libraries
US11926863B1 (en) 2020-02-27 2024-03-12 10X Genomics, Inc. Solid state single cell method for analyzing fixed biological cells
US11504719B2 (en) 2020-03-12 2022-11-22 Bio-Rad Laboratories, Inc. System and method for receiving and delivering a fluid for sample processing
EP4121016A1 (en) 2020-03-16 2023-01-25 Fluent Biosciences Inc. Multi-omic analysis in monodisperse droplets
EP4139485B1 (en) 2020-04-22 2023-09-06 10X Genomics, Inc. Methods for spatial analysis using targeted rna depletion
WO2021222302A1 (en) * 2020-04-27 2021-11-04 10X Genomics, Inc. Methods and systems for increasing cell recovery efficiency
CN113567690A (en) * 2020-04-28 2021-10-29 深圳迎凯生物科技有限公司 Incubation assembly, incubation device and automatic analysis device
US11851700B1 (en) 2020-05-13 2023-12-26 10X Genomics, Inc. Methods, kits, and compositions for processing extracellular molecules
EP4150118A1 (en) 2020-05-14 2023-03-22 Becton Dickinson and Company Primers for immune repertoire profiling
EP4153776A1 (en) 2020-05-22 2023-03-29 10X Genomics, Inc. Spatial analysis to detect sequence variants
WO2021236929A1 (en) 2020-05-22 2021-11-25 10X Genomics, Inc. Simultaneous spatio-temporal measurement of gene expression and cellular activity
CN115803445A (en) 2020-06-02 2023-03-14 贝克顿迪金森公司 Oligonucleotides and beads for 5-prime gene expression assays
WO2021247543A2 (en) 2020-06-02 2021-12-09 10X Genomics, Inc. Nucleic acid library methods
WO2021247568A1 (en) 2020-06-02 2021-12-09 10X Genomics, Inc. Spatial trancriptomics for antigen-receptors
US12031177B1 (en) 2020-06-04 2024-07-09 10X Genomics, Inc. Methods of enhancing spatial resolution of transcripts
EP4162074B1 (en) 2020-06-08 2024-04-24 10X Genomics, Inc. Methods of determining a surgical margin and methods of use thereof
WO2021258024A1 (en) * 2020-06-19 2021-12-23 California Institute Of Technology Sensitive and multiplexed detection of nucleic acids and proteins for large scale serological testing
AU2021294334A1 (en) 2020-06-25 2023-02-02 10X Genomics, Inc. Spatial analysis of DNA methylation
US11761038B1 (en) 2020-07-06 2023-09-19 10X Genomics, Inc. Methods for identifying a location of an RNA in a biological sample
US11981960B1 (en) 2020-07-06 2024-05-14 10X Genomics, Inc. Spatial analysis utilizing degradable hydrogels
US11932901B2 (en) 2020-07-13 2024-03-19 Becton, Dickinson And Company Target enrichment using nucleic acid probes for scRNAseq
WO2022015667A1 (en) 2020-07-13 2022-01-20 Becton, Dickinson And Company Cdna spike-in control for single cell analysis
EP4190910A4 (en) * 2020-07-29 2024-05-15 MGI Tech Co., Ltd. Method for loading nucleic acid molecule on solid support
CN116194589A (en) 2020-07-31 2023-05-30 贝克顿迪金森公司 Single cell assay for transposase accessible chromatin
US11981958B1 (en) 2020-08-20 2024-05-14 10X Genomics, Inc. Methods for spatial analysis using DNA capture
US11926822B1 (en) * 2020-09-23 2024-03-12 10X Genomics, Inc. Three-dimensional spatial analysis
WO2022067494A1 (en) * 2020-09-29 2022-04-07 Singleron (Nanjing) Biotechnologies, Ltd. Method for detection of whole transcriptome in single cells
WO2022081766A1 (en) * 2020-10-13 2022-04-21 Arizona Board Of Regents On Behalf Of Arizona State University Transmembrane sensors and molecular amplifiers for lysis-free detection of intracellular targets
WO2022082025A1 (en) * 2020-10-16 2022-04-21 Biomems Analytics Llc Cellular response analysis method
EP4228815A1 (en) 2020-10-19 2023-08-23 Bio-Rad Laboratories, Inc. System and method for rapid multiplexed sample processing with applications for nucleic acid amplification assays
EP3995178A1 (en) * 2020-11-09 2022-05-11 Université de Genève Method
US20220154288A1 (en) 2020-11-17 2022-05-19 Becton, Dickinson And Company Combined analysis of cell-free nucleic acids and single cells for oncology diagnostics
US11827935B1 (en) 2020-11-19 2023-11-28 10X Genomics, Inc. Methods for spatial analysis using rolling circle amplification and detection probes
US11739443B2 (en) 2020-11-20 2023-08-29 Becton, Dickinson And Company Profiling of highly expressed and lowly expressed proteins
EP4247968A1 (en) 2020-11-20 2023-09-27 Becton, Dickinson and Company Use of dextramer in single cell analysis
AU2021385367A1 (en) * 2020-11-25 2023-06-29 Alida Biosciences, Inc. Multiplexed profiling of rna and dna modifications
CN116569042A (en) 2020-12-09 2023-08-08 贝克顿迪金森公司 Multiplexed single cell immunoassays
WO2022132206A1 (en) 2020-12-15 2022-06-23 Becton, Dickinson And Company Single cell secretome analysis
WO2022140028A1 (en) 2020-12-21 2022-06-30 10X Genomics, Inc. Methods, compositions, and systems for capturing probes and/or barcodes
KR102684852B1 (en) * 2021-01-01 2024-07-15 (주)옵토레인 Well array for a hybrid pcr cartridge and pcr analysis method using the same
CA3204188A1 (en) * 2021-01-14 2022-07-21 Integrated Dna Technologies, Inc. Methods for production and quantification of unique molecular identifier-labeled beads
US20220277808A1 (en) * 2021-02-19 2022-09-01 Twist Bioscience Corporation Libraries for identification of genomic variants
WO2022182682A1 (en) 2021-02-23 2022-09-01 10X Genomics, Inc. Probe-based analysis of nucleic acids and proteins
WO2022192671A1 (en) * 2021-03-12 2022-09-15 Singular Genomics Systems, Inc. Nanoarrays and methods of use thereof
US11884977B2 (en) * 2021-03-12 2024-01-30 Singular Genomics Systems, Inc. Nanoarrays and methods of use thereof
AU2022238446A1 (en) 2021-03-18 2023-09-07 10X Genomics, Inc. Multiplex capture of gene and protein expression from a biological sample
WO2022226234A1 (en) * 2021-04-21 2022-10-27 Rutgers, The State University Of New Jersey Identifying microbial signatures and gene expression signatures
CN113358866B (en) * 2021-04-22 2023-06-23 四川大学华西医院 Homogeneous ultrasensitive two-dimensional visualization and fluorescence analysis method for tetanus antigen based on triple parallel hybridization chain reaction and application thereof
WO2022251419A1 (en) * 2021-05-26 2022-12-01 Board Of Regents, The University Of Texas System Methods and systems for single cell protein analysis
US20220380856A1 (en) * 2021-05-28 2022-12-01 Fluent Biosciences Inc. Spatial transcriptomics in pips
WO2022256503A1 (en) 2021-06-03 2022-12-08 10X Genomics, Inc. Methods, compositions, kits, and systems for enhancing analyte capture for spatial analysis
US11535892B1 (en) 2021-06-17 2022-12-27 Element Biosciences, Inc. Compositions and methods for pairwise sequencing
US11859241B2 (en) 2021-06-17 2024-01-02 Element Biosciences, Inc. Compositions and methods for pairwise sequencing
CN118176306A (en) 2021-08-30 2024-06-11 贝克顿迪金森公司 Template Switching Oligonucleotides (TSOs) for mRNA 5' analysis
EP4396368A1 (en) 2021-08-31 2024-07-10 Becton, Dickinson and Company Use of decoy polynucleotides in single cell multiomics
CN117897498A (en) 2021-08-31 2024-04-16 贝克顿迪金森公司 RNA preservation and recovery from immobilized cells
WO2023034872A1 (en) 2021-09-01 2023-03-09 Becton, Dickinson And Company Spatial multiomics using in situ reverse transcription
WO2023034489A1 (en) 2021-09-01 2023-03-09 10X Genomics, Inc. Methods, compositions, and kits for blocking a capture probe on a spatial array
CN117999358A (en) 2021-09-08 2024-05-07 贝克顿迪金森公司 Non-sequencing PCR-based method for detecting antibody conjugated oligonucleotides
CN117957330A (en) 2021-09-14 2024-04-30 贝克顿迪金森公司 Full length single cell RNA sequencing
CN114277091B (en) * 2021-09-17 2024-02-27 广东省人民医院 Method for constructing high-quality immune repertoire library
WO2023091376A1 (en) * 2021-11-16 2023-05-25 Bio-Rad Laboratories, Inc. Methods and compositions for genotyping and phenotyping cells
AU2022397404A1 (en) * 2021-11-24 2024-06-13 Alida Biosciences, Inc. Rna and dna analysis using engineered surfaces
WO2023122041A1 (en) * 2021-12-20 2023-06-29 Enumerix, Inc. Detection and digital quantitation of multiple targets
US11834714B2 (en) 2021-12-20 2023-12-05 Enumerix, Inc. Detection and digital quantitation of multiple targets
WO2023150764A1 (en) 2022-02-07 2023-08-10 Becton, Dickinson And Company Sorting of mrna and abseq containing barcoded beads by flow
WO2023150763A1 (en) 2022-02-07 2023-08-10 Becton, Dickinson And Company Preparing nucleic acid for further analysis of their sequence
WO2023154694A1 (en) 2022-02-08 2023-08-17 Becton, Dickinson And Company Reference beads for linking imaging and sequencing readouts with single-cell resolution
WO2023172977A1 (en) 2022-03-09 2023-09-14 Becton, Dickinson And Company Modified flow proxy assay prior to single-cell cite-seq
EP4272764A1 (en) 2022-05-03 2023-11-08 Scipio Bioscience Method of complexing biological units with particles
CN114891856A (en) * 2022-05-16 2022-08-12 武汉科技大学 Large-queue sample single cell enrichment and mixed sample library construction sequencing method
WO2023235317A1 (en) * 2022-05-31 2023-12-07 Bio-Rad Laboratories, Inc. Methods and hydrogel compositions for partitioning biological samples
WO2023250283A1 (en) * 2022-06-23 2023-12-28 The Trustees Of The University Of Pennsylvania Patterning wettability in complex microfluidic channels for very large-scale generation of double emulsions
US20240050949A1 (en) * 2022-08-10 2024-02-15 Becton, Dickinson And Company Highly efficient partition loading of single cells
WO2024073442A1 (en) * 2022-09-27 2024-04-04 Fred Hutchinson Cancer Center Methods for isolating, detecting, and quantifying intercellular proteins
WO2024097263A1 (en) 2022-11-01 2024-05-10 Becton, Dickinson And Company Bead-based single cell secretome analysis
WO2024097719A1 (en) 2022-11-02 2024-05-10 Becton, Dickinson And Company Application for peptide nucleic acid (pna) blocker
WO2024097718A1 (en) 2022-11-02 2024-05-10 Becton, Dickinson And Company Polymerase mediated end modification of abseq
US12030053B1 (en) 2023-05-05 2024-07-09 Panazee Inc. Multi-step kinetic immunoassay systems and methods
US11802870B1 (en) 2022-12-13 2023-10-31 Panazee Kinetic immunoassay systems and methods
WO2024137527A1 (en) 2022-12-19 2024-06-27 Becton, Dickinson And Company Sorting method using barcoded chambers for single cell workflow

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6436675B1 (en) * 1999-09-28 2002-08-20 Maxygen, Inc. Use of codon-varied oligonucleotide synthesis for synthetic shuffling
WO2010117620A2 (en) * 2009-03-30 2010-10-14 Illumina, Inc. Gene expression analysis in single cells
WO2012048341A1 (en) * 2010-10-08 2012-04-12 President And Fellows Of Harvard College High-throughput single cell barcoding
US20120142018A1 (en) * 2010-12-05 2012-06-07 Wenbin Jiang Rapid Single Cell Based Parallel Biological Cell Sorter
WO2012083225A2 (en) * 2010-12-16 2012-06-21 Gigagen, Inc. System and methods for massively parallel analysis of nycleic acids in single cells
US20130116130A1 (en) * 2009-12-15 2013-05-09 Affymetrix, Inc. Digital Counting of Individual Molecules by Stochastic Attachment of Diverse Label-Tags
US20130190206A1 (en) * 2010-07-13 2013-07-25 Dublin City University Direct Clone Analysis and Selection Technology

Family Cites Families (591)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4437975A (en) 1977-07-20 1984-03-20 Mobil Oil Corporation Manufacture of lube base stock oil
US4510244A (en) 1980-04-17 1985-04-09 The Board Of Trustees Of The Leland Stanford Jr. University Cell labeling with antigen-coupled microspheres
US4786600A (en) 1984-05-25 1988-11-22 The Trustees Of Columbia University In The City Of New York Autocatalytic replication of recombinant RNA
US5242794A (en) 1984-12-13 1993-09-07 Applied Biosystems, Inc. Detection of specific sequences in nucleic acids
US4725536A (en) 1985-09-19 1988-02-16 Genetics Institute, Inc. Reagent polynucleotide complex with multiple target binding regions, and kit and methods
US6150517A (en) 1986-11-24 2000-11-21 Gen-Probe Methods for making oligonucleotide probes for the detection and/or quantitation of non-viral organisms
IL86724A (en) 1987-06-19 1995-01-24 Siska Diagnostics Inc Method and kits for the amplification and detection of nucleic acid sequences
WO1989001050A1 (en) 1987-07-31 1989-02-09 The Board Of Trustees Of The Leland Stanford Junior University Selective amplification of target polynucleotide sequences
US5149625A (en) 1987-08-11 1992-09-22 President And Fellows Of Harvard College Multiplex analysis of DNA
US5124246A (en) 1987-10-15 1992-06-23 Chiron Corporation Nucleic acid multimers and amplified nucleic acid hybridization assays using same
US5656731A (en) 1987-10-15 1997-08-12 Chiron Corporation Nucleic acid-amplified immunoassay probes
JP2650159B2 (en) 1988-02-24 1997-09-03 アクゾ・ノベル・エヌ・ベー Nucleic acid amplification method
CA1340807C (en) 1988-02-24 1999-11-02 Lawrence T. Malek Nucleic acid amplification process
US4988617A (en) 1988-03-25 1991-01-29 California Institute Of Technology Method of detecting a nucleotide change in nucleic acids
US5130238A (en) 1988-06-24 1992-07-14 Cangene Corporation Enhanced nucleic acid amplification process
JPH04501353A (en) 1988-07-26 1992-03-12 ジエネラブス・テクノロジーズ・インコーポレイテツド RNA and DNA amplification methods
BR8907830A (en) 1988-12-16 1991-10-22 Siska Diagnostics Inc PROCESS FOR PREPARING A DOUBLE-FILAMENT DNA THAT CODES A SEQUENCE THAT MATCHES A OBJECTIVE NUCLEIC ACID SEQUENCE AND PROCESS USED FOR DETECTION OF AT LEAST ONE SPECIFIC OBJECTIVE NUCLEIC ACID SEQUENCE
IE66597B1 (en) 1989-05-10 1996-01-24 Akzo Nv Method for the synthesis of ribonucleic acid (RNA)
US6551784B2 (en) 1989-06-07 2003-04-22 Affymetrix Inc Method of comparing nucleic acid sequences
US6040138A (en) 1995-09-15 2000-03-21 Affymetrix, Inc. Expression monitoring by hybridization to high density oligonucleotide arrays
US5871928A (en) 1989-06-07 1999-02-16 Fodor; Stephen P. A. Methods for nucleic acid analysis
US5143854A (en) 1989-06-07 1992-09-01 Affymax Technologies N.V. Large scale photolithographic solid phase synthesis of polypeptides and receptor binding screening thereof
US5800992A (en) 1989-06-07 1998-09-01 Fodor; Stephen P.A. Method of detecting nucleic acids
US5744101A (en) 1989-06-07 1998-04-28 Affymax Technologies N.V. Photolabile nucleoside protecting groups
US6309822B1 (en) 1989-06-07 2001-10-30 Affymetrix, Inc. Method for comparing copy number of nucleic acid sequences
US5527681A (en) 1989-06-07 1996-06-18 Affymax Technologies N.V. Immobilized molecular synthesis of systematically substituted compounds
US5242974A (en) 1991-11-22 1993-09-07 Affymax Technologies N.V. Polymer reversal on solid surfaces
US5424186A (en) 1989-06-07 1995-06-13 Affymax Technologies N.V. Very large scale immobilized polymer synthesis
US5925525A (en) 1989-06-07 1999-07-20 Affymetrix, Inc. Method of identifying nucleotide differences
US6346413B1 (en) 1989-06-07 2002-02-12 Affymetrix, Inc. Polymer arrays
CA2020958C (en) 1989-07-11 2005-01-11 Daniel L. Kacian Nucleic acid sequence amplification methods
US5252743A (en) 1989-11-13 1993-10-12 Affymax Technologies N.V. Spatially-addressable immobilization of anti-ligands on surfaces
US5200314A (en) 1990-03-23 1993-04-06 Chiron Corporation Polynucleotide capture assay employing in vitro amplification
US5494810A (en) 1990-05-03 1996-02-27 Cornell Research Foundation, Inc. Thermostable ligase-mediated DNA amplifications system for the detection of genetic disease
JPH06500471A (en) 1990-08-24 1994-01-20 ザ・ユニバーシティ・オブ・テネシー・リサーチ・コーポレーション DNA amplification fingerprinting
JP3164814B2 (en) 1990-08-27 2001-05-14 科学技術振興事業団 Preparation of homogenized cDNA library
WO1992007095A1 (en) 1990-10-15 1992-04-30 Stratagene Arbitrarily primed polymerase chain reaction method for fingerprinting genomes
EP0562047A4 (en) 1990-12-06 1995-11-02 Affymax Tech Nv Sequencing by hybridization of a target nucleic acid to a matrix of defined oligonucleotides
JPH04337446A (en) 1991-05-15 1992-11-25 Hitachi Ltd Method and device for measuring fine grain and constant quantity method
US5981179A (en) 1991-11-14 1999-11-09 Digene Diagnostics, Inc. Continuous amplification reaction
US5550215A (en) 1991-11-22 1996-08-27 Holmes; Christopher P. Polymer reversal on solid surfaces
US5384261A (en) 1991-11-22 1995-01-24 Affymax Technologies N.V. Very large scale immobilized polymer synthesis using mechanically directed flow paths
EP0624059A4 (en) 1991-11-22 1994-12-21 Affymax Technologies N.V. Combinatorial strategies for polymer synthesis.
US5324633A (en) 1991-11-22 1994-06-28 Affymax Technologies N.V. Method and apparatus for measuring binding affinity
US5412087A (en) 1992-04-24 1995-05-02 Affymax Technologies N.V. Spatially-addressable immobilization of oligonucleotides and other biological polymers on surfaces
US5424413A (en) 1992-01-22 1995-06-13 Gen-Probe Incorporated Branched nucleic acid probes
US5573905A (en) 1992-03-30 1996-11-12 The Scripps Research Institute Encoded combinatorial chemical libraries
US5514545A (en) 1992-06-11 1996-05-07 Trustees Of The University Of Pennsylvania Method for characterizing single cells based on RNA amplification for diagnostics and therapeutics
US5981176A (en) 1992-06-17 1999-11-09 City Of Hope Method of detecting and discriminating between nucleic acid sequences
US5491074A (en) 1993-04-01 1996-02-13 Affymax Technologies Nv Association peptides
US5858659A (en) 1995-11-29 1999-01-12 Affymetrix, Inc. Polymorphism detection
US5837832A (en) 1993-06-25 1998-11-17 Affymetrix, Inc. Arrays of nucleic acid probes on biological chips
EP0705271B1 (en) 1993-06-25 2002-11-13 Affymetrix, Inc. (a Delaware Corporation) Hybridization and sequencing of nucleic acids
US6087186A (en) 1993-07-16 2000-07-11 Irori Methods and apparatus for synthesizing labeled combinatorial chemistry libraries
US5500356A (en) 1993-08-10 1996-03-19 Life Technologies, Inc. Method of nucleic acid sequence selection
US6309823B1 (en) 1993-10-26 2001-10-30 Affymetrix, Inc. Arrays of nucleic acid probes for analyzing biotransformation genes and methods of using the same
US5681697A (en) 1993-12-08 1997-10-28 Chiron Corporation Solution phase nucleic acid sandwich assays having reduced background noise and kits therefor
US5578832A (en) 1994-09-02 1996-11-26 Affymetrix, Inc. Method and apparatus for imaging a sample on a device
US6090555A (en) 1997-12-11 2000-07-18 Affymetrix, Inc. Scanned image alignment systems and methods
US5631734A (en) 1994-02-10 1997-05-20 Affymetrix, Inc. Method and apparatus for detection of fluorescently labeled materials
KR100230718B1 (en) 1994-03-16 1999-11-15 다니엘 엘. 캐시앙, 헨리 엘. 노르호프 Isothermal strand displacement nucleic acid amplification
US5714330A (en) 1994-04-04 1998-02-03 Lynx Therapeutics, Inc. DNA sequencing by stepwise ligation and cleavage
EP0758403B1 (en) 1994-05-05 1998-06-24 Beckman Instruments, Inc. Oligonucleotide repeat arrays
US5571639A (en) 1994-05-24 1996-11-05 Affymax Technologies N.V. Computer-aided engineering system for design of sequence arrays and lithographic masks
US6495518B1 (en) 1994-06-13 2002-12-17 Vanderbilt University Method for importing biologically active molecules into cells
US5942391A (en) 1994-06-22 1999-08-24 Mount Sinai School Of Medicine Nucleic acid amplification method: ramification-extension amplification method (RAM)
GB2293238A (en) 1994-09-13 1996-03-20 Inceltec Ltd Primers for replication and/or amplification reactions
US5710000A (en) 1994-09-16 1998-01-20 Affymetrix, Inc. Capturing sequences adjacent to Type-IIs restriction sites for genomic library mapping
US5604097A (en) 1994-10-13 1997-02-18 Spectragen, Inc. Methods for sorting polynucleotides using oligonucleotide tags
US6013445A (en) 1996-06-06 2000-01-11 Lynx Therapeutics, Inc. Massively parallel signature sequencing by ligation of encoded adaptors
US5846719A (en) 1994-10-13 1998-12-08 Lynx Therapeutics, Inc. Oligonucleotide tags for sorting and identification
US5695934A (en) 1994-10-13 1997-12-09 Lynx Therapeutics, Inc. Massively parallel sequencing of sorted polynucleotides
US6600996B2 (en) 1994-10-21 2003-07-29 Affymetrix, Inc. Computer-aided techniques for analyzing biological sequences
US5795716A (en) 1994-10-21 1998-08-18 Chee; Mark S. Computer-aided visualization and analysis system for sequence evaluation
ES2271944T3 (en) 1994-10-28 2007-04-16 Gen-Probe Incorporated COMPOSITIONS AND METHODS FOR SIMULTANEOUS DETECTION AND QUANTIFICATION OF MULTIPLE SPECIFIC SEQUENCES OF NUCLEIC ACIDS.
US5599695A (en) 1995-02-27 1997-02-04 Affymetrix, Inc. Printing molecular library arrays using deprotection agents solely in the vapor phase
US5959098A (en) 1996-04-17 1999-09-28 Affymetrix, Inc. Substrate preparation process
EA199700257A1 (en) 1995-04-25 1998-12-24 Ирори MATRIX WITH MEMORY PROGRAMMED AT A DISTANCE, AND THEIR USE
US5624711A (en) 1995-04-27 1997-04-29 Affymax Technologies, N.V. Derivatization of solid supports and methods for oligomer synthesis
US5648245A (en) 1995-05-09 1997-07-15 Carnegie Institution Of Washington Method for constructing an oligonucleotide concatamer library by rolling circle replication
US5968740A (en) 1995-07-24 1999-10-19 Affymetrix, Inc. Method of Identifying a Base in a Nucleic Acid
US5763175A (en) 1995-11-17 1998-06-09 Lynx Therapeutics, Inc. Simultaneous sequencing of tagged polynucleotides
US5854033A (en) 1995-11-21 1998-12-29 Yale University Rolling circle replication reporter systems
US6147205A (en) 1995-12-15 2000-11-14 Affymetrix, Inc. Photocleavable protecting groups and methods for their use
US6613544B1 (en) 1995-12-22 2003-09-02 Amgen Inc. Osteoprotegerin
US5962271A (en) 1996-01-03 1999-10-05 Cloutech Laboratories, Inc. Methods and compositions for generating full-length cDNA having arbitrary nucleotide sequence at the 3'-end
US5830712A (en) 1996-02-06 1998-11-03 Allelix Biopharmaceuticals Inc. Selective template deletion method
US6458530B1 (en) 1996-04-04 2002-10-01 Affymetrix Inc. Selecting tag nucleic acids
WO1997043611A1 (en) 1996-05-16 1997-11-20 Affymetrix, Inc. Systems and methods for detection of labeled materials
JP4468488B2 (en) 1996-05-29 2010-05-26 コーネル・リサーチ・ファンデーション・インコーポレイテッド Detection of nucleic acid sequence differences using combined ligase detection and polymerase chain reaction
JPH1021373A (en) 1996-07-05 1998-01-23 Fuji Photo Film Co Ltd Picture analyzing device
US6984491B2 (en) 1996-07-29 2006-01-10 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US20020172953A1 (en) 1996-07-29 2002-11-21 Mirkin Chad A. Movement of biomolecule-coated nanoparticles in an electric field
US7169556B2 (en) 1996-07-29 2007-01-30 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6100029A (en) 1996-08-14 2000-08-08 Exact Laboratories, Inc. Methods for the detection of chromosomal aberrations
WO1998015644A2 (en) 1996-09-27 1998-04-16 The Chinese University Of Hong Kong Parallel polynucleotide sequencing method
US6124092A (en) 1996-10-04 2000-09-26 The Perkin-Elmer Corporation Multiplex polynucleotide capture methods and compositions
US6117631A (en) 1996-10-29 2000-09-12 Polyprobe, Inc. Detection of antigens via oligonucleotide antibody conjugates
US6046005A (en) 1997-01-15 2000-04-04 Incyte Pharmaceuticals, Inc. Nucleic acid sequencing with solid phase capturable terminators comprising a cleavable linking group
CA2291180A1 (en) 1997-05-23 1998-11-26 Lynx Therapeutics, Inc. System and apparatus for sequential processing of analytes
US6974669B2 (en) 2000-03-28 2005-12-13 Nanosphere, Inc. Bio-barcodes based on oligonucleotide-modified nanoparticles
US6399334B1 (en) 1997-09-24 2002-06-04 Invitrogen Corporation Normalized nucleic acid libraries and methods of production thereof
EP1027456B1 (en) 1997-10-31 2005-03-16 Affymetrix, Inc. (a Delaware Corporation) Expression profiles in adult and fetal organs
WO1999028505A1 (en) 1997-12-03 1999-06-10 Curagen Corporation Methods and devices for measuring differential gene expression
US6235433B1 (en) 1997-12-19 2001-05-22 Nec Corporation High molecular gel electrolyte and secondary battery using the same
US6265163B1 (en) 1998-01-09 2001-07-24 Lynx Therapeutics, Inc. Solid phase selection of differentially expressed genes
US6269846B1 (en) 1998-01-13 2001-08-07 Genetic Microsystems, Inc. Depositing fluid specimens on substrates, resulting ordered arrays, techniques for deposition of arrays
US6428752B1 (en) 1998-05-14 2002-08-06 Affymetrix, Inc. Cleaning deposit devices that form microarrays and the like
US5936324A (en) 1998-03-30 1999-08-10 Genetic Microsystems Inc. Moving magnet scanner
US6787308B2 (en) 1998-07-30 2004-09-07 Solexa Ltd. Arrayed biomolecules and their use in sequencing
US6653077B1 (en) 1998-09-04 2003-11-25 Lynx Therapeutics, Inc. Method of screening for genetic polymorphism
US6262216B1 (en) 1998-10-13 2001-07-17 Affymetrix, Inc. Functionalized silicon compounds and methods for their synthesis and use
US6480791B1 (en) 1998-10-28 2002-11-12 Michael P. Strathmann Parallel methods for genomic analysis
US6197554B1 (en) 1998-11-20 2001-03-06 Shi-Lung Lin Method for generating full-length cDNA library from single cells
US20020019005A1 (en) 1999-02-18 2002-02-14 Arcaris, Inc. Process for identification of genes encoding proteins having cell proliferation-promoting activity
US6629040B1 (en) 1999-03-19 2003-09-30 University Of Washington Isotope distribution encoded tags for protein identification
JP2002539849A (en) 1999-03-26 2002-11-26 ホワイトヘッド インスチチュート フォアー バイオメディカル リサーチ Universal array
CA2644688C (en) 1999-04-20 2012-11-13 Kankyo Engineering Co., Ltd. Method for determining a concentration of target nucleic acid molecules, nucleic acid probes for the method, and method for analysing data obtained by the method
US6355431B1 (en) 1999-04-20 2002-03-12 Illumina, Inc. Detection of nucleic acid amplification reactions using bead arrays
US6372813B1 (en) 1999-06-25 2002-04-16 Motorola Methods and compositions for attachment of biomolecules to solid supports, hydrogels, and hydrogel arrays
US6326148B1 (en) 1999-07-12 2001-12-04 The Regents Of The University Of California Detection of copy number changes in colon cancer
US6440706B1 (en) 1999-08-02 2002-08-27 Johns Hopkins University Digital amplification
JP2001078768A (en) 1999-09-16 2001-03-27 Otsuka Pharmaceut Co Ltd Assay of gene expression
SE9903988D0 (en) 1999-11-03 1999-11-03 Amersham Pharm Biotech Ab Method of analysis
US6582938B1 (en) 2001-05-11 2003-06-24 Affymetrix, Inc. Amplification of nucleic acids
US6489114B2 (en) 1999-12-17 2002-12-03 Bio Merieux Process for labeling a ribonucleic acid, and labeled RNA fragments which are obtained thereby
US6500620B2 (en) 1999-12-29 2002-12-31 Mergen Ltd. Methods for amplifying and detecting multiple polynucleotides on a solid phase support
US7022479B2 (en) 2000-01-24 2006-04-04 Compound Therapeutics, Inc. Sensitive, multiplexed diagnostic assays for protein analysis
US6489116B2 (en) 2000-01-24 2002-12-03 Phylos, Inc. Sensitive, multiplexed diagnostic assays for protein analysis
US6235483B1 (en) 2000-01-31 2001-05-22 Agilent Technologies, Inc. Methods and kits for indirect labeling of nucleic acids
ATE492652T1 (en) 2000-02-07 2011-01-15 Illumina Inc NUCLEIC ACID DETECTION METHOD WITH UNIVERSAL PRIMING
US20050214825A1 (en) 2000-02-07 2005-09-29 John Stuelpnagel Multiplex sample analysis on universal arrays
DE10011579B4 (en) 2000-03-09 2007-06-06 BüHLER GMBH agitating mill
US20020072058A1 (en) 2000-03-24 2002-06-13 Voelker Leroy L. Method for amplifying quinolone-resistance-determining-regions and identifying polymorphic variants thereof
NZ521593A (en) 2000-03-29 2004-11-26 Lgc Ltd Hybridisation beacon and method of rapid sequence detection and discrimination
EP1313879A2 (en) 2000-04-10 2003-05-28 Matthew Ashby Methods for the survey and genetic analysis of populations
US20030207300A1 (en) 2000-04-28 2003-11-06 Matray Tracy J. Multiplex analytical platform using molecular tags
US7630063B2 (en) 2000-08-02 2009-12-08 Honeywell International Inc. Miniaturized cytometer for detecting multiple species in a sample
US6511809B2 (en) 2000-06-13 2003-01-28 E. I. Du Pont De Nemours And Company Method for the detection of an analyte by means of a nucleic acid reporter
CN100462433C (en) 2000-07-07 2009-02-18 维西根生物技术公司 Real-time sequence determination
EP1362121A2 (en) 2000-08-11 2003-11-19 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
CA2356123A1 (en) 2000-08-25 2002-02-25 Riken Method of preparing normalized and/or subtracted cdna
US6934408B2 (en) 2000-08-25 2005-08-23 Amnis Corporation Method and apparatus for reading reporter labeled beads
JP4915492B2 (en) 2000-08-25 2012-04-11 独立行政法人理化学研究所 Method for creating a normalized / subtracted cDNA library
DE60131903T2 (en) 2000-10-24 2008-11-27 The Board of Trustees of the Leland S. Stanford Junior University, Palo Alto DIRECT MULTIPLEX CHARACTERIZATION OF GENOMIC DNA
WO2002046472A2 (en) 2000-12-08 2002-06-13 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US20020142345A1 (en) 2000-12-22 2002-10-03 Nelsen Anita J. Methods for encoding and decoding complex mixtures in arrayed assays
US20030049616A1 (en) 2001-01-08 2003-03-13 Sydney Brenner Enzymatic synthesis of oligonucleotide tags
WO2002070684A2 (en) 2001-01-11 2002-09-12 Lion Bioscience Ag Gene library for screening methods
DK1364065T3 (en) 2001-01-25 2012-05-14 Luminex Molecular Diagnostics Inc Polynucleotides for use as markers and markers, preparation and use thereof
IL153504A0 (en) 2001-03-09 2003-07-06 Nugen Technologies Inc Methods and compositions for amplification of rna sequences
JP2005233974A (en) 2001-03-21 2005-09-02 Olympus Corp Biochemical inspection method
US7027932B2 (en) 2001-03-21 2006-04-11 Olympus Optical Co., Ltd. Biochemical examination method
EP1379693B1 (en) 2001-03-28 2009-05-20 Nanosphere, Inc. Bio-barcodes based on oligonucleotide-modified particles
US20030170675A1 (en) 2001-04-11 2003-09-11 The Gov't Of The U.S Of America As Represented By The Secretary Of The Dept. Of Health & Human Serv. Methods of manipulating nucleic acids
EP1377683A4 (en) 2001-04-11 2004-09-08 Us Gov Health & Human Serv Modified random primers for probe labeling
AUPR480901A0 (en) 2001-05-04 2001-05-31 Genomics Research Partners Pty Ltd Diagnostic method for assessing a condition of a performance animal
CA2344599C (en) 2001-05-07 2011-07-12 Bioneer Corporation Selective polymerase chain reaction of dna of which base sequence is completely unknown
US6905827B2 (en) 2001-06-08 2005-06-14 Expression Diagnostics, Inc. Methods and compositions for diagnosing or monitoring auto immune and chronic inflammatory diseases
EP1395805A4 (en) 2001-06-11 2005-03-09 Illumina Inc Multiplexed detection methods
JP4244534B2 (en) 2001-06-12 2009-03-25 横河電機株式会社 Biochip
US7473767B2 (en) 2001-07-03 2009-01-06 The Institute For Systems Biology Methods for detection and quantification of analytes in complex mixtures
US6830931B2 (en) 2001-07-12 2004-12-14 Automated Cell, Inc. Method and apparatus for monitoring of proteins and cells
WO2006071776A2 (en) 2004-12-23 2006-07-06 Ge Healthcare Bio-Sciences Corp. Ligation-based rna amplification
CA2463323C (en) 2001-10-09 2010-12-21 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
WO2003031591A2 (en) 2001-10-10 2003-04-17 Superarray Bioscience Corporation Detecting targets by unique identifier nucleotide tags
US20030077611A1 (en) 2001-10-24 2003-04-24 Sention Methods and systems for dynamic gene expression profiling
US7655791B2 (en) 2001-11-13 2010-02-02 Rubicon Genomics, Inc. DNA amplification and sequencing using DNA molecules generated by random fragmentation
EP1448800A4 (en) 2001-11-21 2007-05-16 Applera Corp Digital assay
US20030175749A1 (en) 2001-12-08 2003-09-18 Jong-Yoon Chun Annealing control primer and its uses
WO2003062462A2 (en) 2002-01-16 2003-07-31 Dynal Biotech Asa Method for isolating nucleic acids and protein from a single sample
US20030175908A1 (en) 2002-01-29 2003-09-18 Sten Linnarsson Methods and means for manipulating nucleic acid
WO2003069421A2 (en) 2002-02-14 2003-08-21 Immunivest Corporation Methods and algorithms for cell enumeration in a low-cost cytometer
US20030186251A1 (en) 2002-04-01 2003-10-02 Brookhaven Science Associates, Llc Genome sequence tags
US20050175993A1 (en) 2002-04-12 2005-08-11 Chia-Lin Wei Method for making full-length coding sequence cDNA libraries
US20070178478A1 (en) 2002-05-08 2007-08-02 Dhallan Ravinder S Methods for detection of genetic disorders
US6808906B2 (en) 2002-05-08 2004-10-26 Rigel Pharmaceuticals, Inc. Directionally cloned random cDNA expression vector libraries, compositions and methods of use
GB0212391D0 (en) 2002-05-29 2002-07-10 Axis Shield Asa Assay
US20040096368A1 (en) 2002-06-28 2004-05-20 Igen International, Inc. Assay systems and components
US20050019776A1 (en) 2002-06-28 2005-01-27 Callow Matthew James Universal selective genome amplification and universal genotyping system
US7192700B2 (en) 2002-12-20 2007-03-20 Orchid Cellmark Inc. Methods and compositions for conducting primer extension and polymorphism detection reactions
JP2006515065A (en) 2002-08-16 2006-05-18 ディシジョン バイオマーカーズ インコーポレイテッド Fluorescence sequence reading
EP2143803B1 (en) 2002-09-03 2016-04-13 Quanta Biosciences, Inc. Improved compositions and methods for cDNA synthesis
US7361821B2 (en) 2002-09-20 2008-04-22 Intel Corporation Controlled alignment of nanobarcodes encoding specific information for scanning probe microscopy (SPM) reading
EP1546376B9 (en) 2002-09-30 2009-08-12 F.Hoffmann-La Roche Ag Oligonucleotides for genotyping thymidylate synthase gene
WO2004040001A2 (en) 2002-10-02 2004-05-13 California Institute Of Technology Microfluidic nucleic acid analysis
WO2004044225A2 (en) 2002-11-11 2004-05-27 Affymetrix, Inc. Methods for identifying dna copy number changes
US7822555B2 (en) 2002-11-11 2010-10-26 Affymetrix, Inc. Methods for identifying DNA copy number changes
US7704687B2 (en) 2002-11-15 2010-04-27 The Johns Hopkins University Digital karyotyping
WO2004083443A1 (en) 2002-12-20 2004-09-30 Caliper Life Sciences, Inc. Single molecule amplification and detection of dna
US20040214211A1 (en) 2003-01-23 2004-10-28 U.S. Genomics, Inc. Methods for analyzing polymer populations
US7575865B2 (en) 2003-01-29 2009-08-18 454 Life Sciences Corporation Methods of amplifying and sequencing nucleic acids
US8206913B1 (en) 2003-03-07 2012-06-26 Rubicon Genomics, Inc. Amplification and analysis of whole genome and whole transcriptome libraries generated by a DNA polymerization process
ATE484598T1 (en) 2003-03-07 2010-10-15 Rubicon Genomics Inc AMPLIFICATION AND ANALYSIS OF WHOLE GENOME AND WHOLE TRANSCRIPTOME LIBRARIES PRODUCED BY A DNA POLYMERIZATION PROCESS
WO2006102264A1 (en) 2005-03-18 2006-09-28 Fluidigm Corporation Thermal reaction device and method for using the same
US7269518B2 (en) 2003-04-30 2007-09-11 Agilent Technologies, Inc. Chemical array reading
US20040259118A1 (en) 2003-06-23 2004-12-23 Macevicz Stephen C. Methods and compositions for nucleic acid sequence analysis
US8048627B2 (en) 2003-07-05 2011-11-01 The Johns Hopkins University Method and compositions for detection and enumeration of genetic variations
US20060281092A1 (en) 2003-07-24 2006-12-14 Tanja Wille Method for the reverse transcription and/or amplification of nucleic acids
US20050106591A1 (en) 2003-08-13 2005-05-19 Affymetrix, Inc. Methods and kits for preparing nucleic acid samples
GB0319332D0 (en) 2003-08-16 2003-09-17 Astrazeneca Ab Amplification
US20050048498A1 (en) 2003-08-29 2005-03-03 Applera Corporation Compositions, methods, and kits for assembling probes
US7341837B2 (en) 2003-09-02 2008-03-11 Lawton Robert L Soluble analyte detection and amplification
US7354706B2 (en) 2003-09-09 2008-04-08 The Regents Of The University Of Colorado, A Body Corporate Use of photopolymerization for amplification and detection of a molecular recognition event
SG149007A1 (en) 2003-09-10 2009-01-29 Althea Technologies Inc Expression profiling using microarrays
JP2007512811A (en) 2003-11-10 2007-05-24 インベスチゲン， インコーポレイテッド Methods for preparing nucleic acids for detection
CA2552858A1 (en) 2004-01-23 2005-08-04 Lingvitae As Improving polynucleotide ligation reactions
US7217522B2 (en) 2004-02-12 2007-05-15 Campass Genetics Llc Genetic analysis by sequence-specific sorting
US20100216153A1 (en) 2004-02-27 2010-08-26 Helicos Biosciences Corporation Methods for detecting fetal nucleic acids and diagnosing fetal abnormalities
US7432055B2 (en) 2004-03-05 2008-10-07 Uchicago Argonne Llc Dual phase multiplex polymerase chain reaction
JP4951505B2 (en) 2004-05-07 2012-06-13 セファイド Combined detection of biological factors
US20050250147A1 (en) 2004-05-10 2005-11-10 Macevicz Stephen C Digital profiling of polynucleotide populations
CA2569745A1 (en) 2004-06-07 2005-12-22 Irm Llc Dispensing systems, software, and related methods
US20060035258A1 (en) 2004-08-06 2006-02-16 Affymetrix, Inc. Methods for identifying DNA copy number changes
US20060041385A1 (en) 2004-08-18 2006-02-23 Bauer Kenneth D Method of quantitating proteins and genes in cells using a combination of immunohistochemistry and in situ hybridization
US7713697B2 (en) 2004-08-27 2010-05-11 Gen-Probe Incorporated Methods and kits for amplifying DNA
CA2580145C (en) 2004-09-10 2014-10-28 Human Genetic Signatures Pty Ltd Amplification blocker comprising intercalating nucleic acids (ina) containing intercalating pseudonucleotides (ipn)
US20060073506A1 (en) 2004-09-17 2006-04-06 Affymetrix, Inc. Methods for identifying biological samples
US7435084B2 (en) 2004-12-14 2008-10-14 Align Technology, Inc. System and methods for casting physical tooth model
CA2585781A1 (en) 2004-11-03 2006-12-28 Iris Molecular Diagnostics, Inc. Homogeneous analyte detection
CA2592204C (en) 2004-12-23 2013-03-12 I-Stat Corporation Nucleic acid diagnostics system and methods
US7407757B2 (en) 2005-02-10 2008-08-05 Population Genetics Technologies Genetic analysis by sequence-specific sorting
EP1845160A4 (en) 2005-02-10 2009-07-01 Riken Method for amplification of nucleotide sequence
US7393665B2 (en) 2005-02-10 2008-07-01 Population Genetics Technologies Ltd Methods and compositions for tagging and identifying polynucleotides
EP1856293A2 (en) 2005-03-16 2007-11-21 Compass Genetics, Llc Methods and compositions for assay readouts on multiple analytical platforms
WO2006110314A2 (en) 2005-03-25 2006-10-19 Ambion, Inc. Methods and compositions for depleting abundant rna transcripts
US20060263789A1 (en) 2005-05-19 2006-11-23 Robert Kincaid Unique identifiers for indicating properties associated with entities to which they are attached, and methods for using
US7695886B2 (en) 2005-05-19 2010-04-13 Fuji Xerox Co., Ltd. Process for producing resin particle liquid dispersion for electrostatic image developing toner, electrostatic image developing toner and production process thereof
US8407013B2 (en) 2005-06-07 2013-03-26 Peter K. Rogan AB initio generation of single copy genomic probes
US20070065844A1 (en) 2005-06-08 2007-03-22 Massachusetts Institute Of Technology Solution-based methods for RNA expression profiling
US7796815B2 (en) 2005-06-10 2010-09-14 The Cleveland Clinic Foundation Image analysis of biological objects
US20070020640A1 (en) 2005-07-21 2007-01-25 Mccloskey Megan L Molecular encoding of nucleic acid templates for PCR and other forms of sequence analysis
US8486621B2 (en) 2005-08-11 2013-07-16 Cornell Research Foundation, Inc. Nucleic acid-based matrixes
JP5452922B2 (en) 2005-09-13 2014-03-26 アフィメトリックス・インコーポレーテッド Coded microparticles
WO2007035742A2 (en) 2005-09-16 2007-03-29 454 Life Sciences Corporation Cdna library preparation
WO2007044974A2 (en) 2005-10-12 2007-04-19 The Research Foundation Of State University Of New York Absolute pcr quantification
WO2007053692A1 (en) 2005-11-01 2007-05-10 Symyx Technologies, Inc. Liquid dispensing for high-throughput experimentation
US7375211B2 (en) 2005-11-18 2008-05-20 Kou Zhong C Method for detection and quantification of T-cell receptor Vβ repertoire
US20080070303A1 (en) * 2005-11-21 2008-03-20 West Michael D Methods to accelerate the isolation of novel cell strains from pluripotent stem cells and cells obtained thereby
US7636465B2 (en) 2005-12-09 2009-12-22 Cytyc Corporation Cross-frame object reconstruction for image-based cytology applications
EP1987162A4 (en) 2006-01-23 2009-11-25 Population Genetics Technologi Nucleic acid analysis using sequence tokens
US7537897B2 (en) * 2006-01-23 2009-05-26 Population Genetics Technologies, Ltd. Molecular counting
US8460879B2 (en) 2006-02-21 2013-06-11 The Trustees Of Tufts College Methods and arrays for target analyte detection and determination of target analyte concentration in solution
US20080038727A1 (en) 2006-03-10 2008-02-14 Applera Corporation MicroRNA and Messenger RNA Detection on Arrays
US7880142B2 (en) 2006-04-04 2011-02-01 Sidec Technologies Ab Extended electron tomography
US20080194414A1 (en) 2006-04-24 2008-08-14 Albert Thomas J Enrichment and sequence analysis of genomic regions
WO2007136874A2 (en) 2006-05-18 2007-11-29 President And Fellows Of Harvard College Genomic library construction
US7833716B2 (en) 2006-06-06 2010-11-16 Gen-Probe Incorporated Tagged oligonucleotides and their use in nucleic acid amplification methods
CA2655272C (en) 2006-06-14 2017-04-18 Living Microsystems, Inc. Rare cell analysis using sample splitting and dna tags
EP2077912B1 (en) 2006-08-07 2019-03-27 The President and Fellows of Harvard College Fluorocarbon emulsion stabilizing surfactants
AU2007284651B2 (en) 2006-08-09 2014-03-20 Institute For Systems Biology Organ-specific proteins and methods of their use
EP2069472A4 (en) 2006-10-05 2012-06-20 Nanopoint Inc Systems and methods for active microfluidic cell handling
WO2008057163A2 (en) 2006-10-09 2008-05-15 Carnegie Mellon University Preparation of functional gel particles with a dual crosslink network
CN101542298B (en) 2006-10-18 2012-06-13 大崎电气工业株式会社 Electronic watthour meter
US20100184152A1 (en) 2006-10-23 2010-07-22 Vladislav Sandler Target-oriented whole genome amplification of nucleic acids
EP2518162B1 (en) 2006-11-15 2018-03-07 Biospherex LLC Multitag sequencing and ecogenomics analysis
US8050476B2 (en) 2006-11-22 2011-11-01 General Electric Company Heart rate demodulation of periodic movement in ultrasound data for object identification
EP2762872B1 (en) 2006-12-14 2015-09-16 Life Technologies Corporation Methods and apparatus for measuring analytes using large scale FET arrays
JP5489469B2 (en) 2007-01-16 2014-05-14 オリンパス株式会社 Fluorescence signal analysis apparatus and fluorescence signal analysis method
WO2008109207A2 (en) 2007-01-30 2008-09-12 The Regents Of The University Of California Methods and devices for biomolecular arrays
US20080269068A1 (en) 2007-02-06 2008-10-30 President And Fellows Of Harvard College Multiplex decoding of sequence tags in barcodes
WO2008096318A2 (en) 2007-02-09 2008-08-14 Koninklijke Philips Electronics N.V. Identification system
US8003312B2 (en) 2007-02-16 2011-08-23 The Board Of Trustees Of The Leland Stanford Junior University Multiplex cellular assays using detectable cell barcodes
BRPI0807384A2 (en) 2007-02-27 2014-05-20 Sentoclone Ab STEP METHOD FOR DIRECT OR SIMULTANEOUS DETECTION OF A CANCER CELL OR CANCER CELL ELEMENT IN A BIOLOGICAL SAMPLE, KIT FOR USE IN A METHOD, DATABASE, METHOD FOR INDEFECTING CELLS, CANCER, CELL USE,
WO2008109176A2 (en) 2007-03-07 2008-09-12 President And Fellows Of Harvard College Assays and other reactions involving droplets
KR100882711B1 (en) 2007-03-12 2009-02-06 성균관대학교산학협력단 Uracil-DNA glycosylase of Psychrobacter sp. HJ147 and use thereof
JP2008256428A (en) 2007-04-03 2008-10-23 Intec Systems Institute Inc Method for detecting block position of microarray image
US20080268508A1 (en) 2007-04-30 2008-10-30 Sowlay Mohankumar R Methods and kits for negative selection of desired nucleic acid sequences
US20080274458A1 (en) 2007-05-01 2008-11-06 Latham Gary J Nucleic acid quantitation methods
US20090061513A1 (en) 2007-05-15 2009-03-05 Picovitro Ab Cell sorting and cell cultivation methods
CA2689356A1 (en) 2007-06-01 2008-12-11 454 Life Sciences Corporation System and meth0d for identification of individual samples from a multiplex mixture
US8883691B2 (en) 2007-06-25 2014-11-11 Affymetrix, Inc. Encoded microparticles
US7635566B2 (en) 2007-06-29 2009-12-22 Population Genetics Technologies Ltd. Methods and compositions for isolating nucleic acid sequence variants
ES2391906T3 (en) 2007-09-12 2012-11-30 Institut Pasteur Polynucleotide suitable for a single cell based indicator assay to control gene expression patterns with high spatio-temporal resolution
EP2203749B1 (en) 2007-10-05 2012-08-29 Affymetrix, Inc. Highly multiplexed particle-based assays
WO2009105670A2 (en) 2008-02-21 2009-08-27 Gentel Biosciences, Inc. Substrates for multiplexed assays and uses thereof
US8687189B2 (en) 2008-03-03 2014-04-01 Ajjer, Llc Analysis of arrays by laser induced breakdown spectroscopy
US8206925B2 (en) 2008-04-14 2012-06-26 Medical Diagnostic Laboratories, Llc Splice variants of human IL-23 receptor (IL-23R) mRNA and use of a delta 9 isoform in predicting inflammatory bowel diseases
US20090298709A1 (en) 2008-05-28 2009-12-03 Affymetrix, Inc. Assays for determining telomere length and repeated sequence copy number
DE102008025656B4 (en) 2008-05-28 2016-07-28 Genxpro Gmbh Method for the quantitative analysis of nucleic acids, markers therefor and their use
WO2009148560A2 (en) 2008-05-30 2009-12-10 Board Of Regents, The Universtiy Of Texas System Methods and compositions for nucleic acid sequencing
WO2010021936A1 (en) 2008-08-16 2010-02-25 The Board Of Trustees Of The Leland Stanford Junior University Digital pcr calibration for high throughput sequencing
US8476013B2 (en) 2008-09-16 2013-07-02 Sequenom, Inc. Processes and compositions for methylation-based acid enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses
US8312249B1 (en) 2008-10-10 2012-11-13 Apple Inc. Dynamic trampoline and structured code generation in a signed code environment
US9080211B2 (en) 2008-10-24 2015-07-14 Epicentre Technologies Corporation Transposon end compositions and methods for modifying nucleic acids
US8835110B2 (en) 2008-11-04 2014-09-16 The Johns Hopkins University DNA integrity assay (DIA) for cancer diagnostics, using confocal fluorescence spectroscopy
EP2350657A4 (en) 2008-11-21 2013-06-12 Univ Saint Louis Biosensor for detecting multiple epitopes on a target
US20100159533A1 (en) 2008-11-24 2010-06-24 Helicos Biosciences Corporation Simplified sample preparation for rna analysis
US8492096B2 (en) 2008-12-24 2013-07-23 Boris Pasche TGFBR1 expression modifies risk for colorectal cancer
US9329170B2 (en) 2009-01-20 2016-05-03 The Board Of Trustees Of The Leland Stanford Junior University Single cell gene expression for diagnosis, prognosis and identification of drug targets
US20100323348A1 (en) 2009-01-31 2010-12-23 The Regents Of The University Of Colorado, A Body Corporate Methods and Compositions for Using Error-Detecting and/or Error-Correcting Barcodes in Nucleic Acid Amplification Process
MX2011009244A (en) 2009-03-05 2011-09-26 Daiichi Sankyo Co Ltd Pyridine derivative.
EP2230312A1 (en) 2009-03-19 2010-09-22 Helmholtz-Zentrum für Infektionsforschung GmbH Probe compound for detecting and isolating enzymes and means and methods using the same
US8479125B2 (en) 2009-03-31 2013-07-02 Christophe Pierrat Lithography modeling and applications
KR101829182B1 (en) 2009-04-02 2018-03-29 플루이다임 코포레이션 Multi-primer amplification method for barcoding of target nucleic acids
US9085798B2 (en) 2009-04-30 2015-07-21 Prognosys Biosciences, Inc. Nucleic acid constructs and methods of use
JPWO2010131645A1 (en) 2009-05-14 2012-11-01 和光純薬工業株式会社 Method for synthesizing and amplifying double-stranded DNA corresponding to RNA
FR2945545B1 (en) 2009-05-14 2011-08-05 Univ Aix Marseille Ii METHOD FOR DETECTION OF PROCARYOTE DNA EXTRACTED FROM A SAMPLE SAMPLE
US8673627B2 (en) 2009-05-29 2014-03-18 Life Technologies Corporation Apparatus and methods for performing electrochemical reactions
GB0909923D0 (en) 2009-06-09 2009-07-22 Oxford Gene Tech Ip Ltd Picowell capture devices for analysing single cells or other particles
US20120058902A1 (en) 2009-06-25 2012-03-08 Livingston Robert J Method of measuring adaptive immunity
US8330957B2 (en) 2009-06-29 2012-12-11 Hager Enviromental and Atmospheric Technologies, LLC Device and method for quantification of gases in plumes by remote sensing
EP2789689B1 (en) 2009-06-29 2016-04-27 Luminex Corporation Chimeric primers with hairpin conformations and methods of using same
US8298767B2 (en) 2009-08-20 2012-10-30 Population Genetics Technologies Ltd Compositions and methods for intramolecular nucleic acid rearrangement
WO2011028818A2 (en) * 2009-09-01 2011-03-10 Trustees Of Boston University High throughput multichannel reader and uses thereof
WO2011027268A2 (en) 2009-09-01 2011-03-10 Koninklijke Philips Electronics N.V. Devices and methods for microarray selection
US9625454B2 (en) 2009-09-04 2017-04-18 The Research Foundation For The State University Of New York Rapid and continuous analyte processing in droplet microfluidic devices
US9488656B2 (en) 2009-09-30 2016-11-08 Quest Diagnostics Investments Incorporated BCR-ABL truncation mutations
DK3287525T3 (en) * 2009-12-07 2020-01-20 Univ Pennsylvania RNA preparations comprising purified modified RNA for reprogramming cells
US8835358B2 (en) 2009-12-15 2014-09-16 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
WO2011091046A1 (en) 2010-01-19 2011-07-28 Verinata Health, Inc. Identification of polymorphic sequences in mixtures of genomic dna by whole genome sequencing
DK3260555T3 (en) 2010-01-19 2019-01-21 Verinata Health Inc Hitherto UNKNOWN PROTOCOL FOR PREPARING SEQUENCE LIBRARIES
EP2529026B1 (en) 2010-01-25 2013-11-13 Rd Biosciences Inc. Self-folding amplification of target nucleic acid
EP2534267B1 (en) 2010-02-12 2018-04-11 Raindance Technologies, Inc. Digital analyte analysis
JP5901046B2 (en) 2010-02-19 2016-04-06 国立大学法人 千葉大学 Novel alternative splicing variant of OATP1B3 mRNA
WO2011106738A2 (en) 2010-02-25 2011-09-01 Fred Hutchinson Cancer Research Center Use of tcr clonotypes as biomarkers for disease
US8951940B2 (en) * 2010-04-01 2015-02-10 Illumina, Inc. Solid-phase clonal amplification and related methods
PT2556171E (en) 2010-04-05 2015-12-21 Prognosys Biosciences Inc Spatially encoded biological assays
US20140227691A1 (en) 2010-05-14 2014-08-14 Fluidigm, Inc. Nucleic acid isolation methods
US8828688B2 (en) 2010-05-27 2014-09-09 Affymetrix, Inc. Multiplex amplification methods
WO2011155833A2 (en) 2010-06-09 2011-12-15 Keygene N.V. Combinatorial sequence barcodes for high throughput screening
US20120004132A1 (en) 2010-07-02 2012-01-05 Affymetrix, Inc. Detection of Nucleic Acids and Proteins
CN102971638B (en) 2010-07-07 2015-08-19 株式会社爱德万测试 The test unit that semiconductor devices is tested and test method
US20120040843A1 (en) 2010-08-12 2012-02-16 Dublin City University Centrifugal capture system
WO2012038839A2 (en) 2010-09-21 2012-03-29 Population Genetics Technologies Ltd. Increasing confidence of allele calls with molecular counting
EP2436766A1 (en) 2010-09-29 2012-04-04 Deutsches Krebsforschungszentrum Means and methods for improved protein interaction screening
WO2012042374A2 (en) 2010-10-01 2012-04-05 Anssi Jussi Nikolai Taipale Method of determining number or concentration of molecules
US20120088691A1 (en) 2010-10-08 2012-04-12 Gao Chen Highly multiplexed real-time pcr using encoded microbeads
US20130225623A1 (en) 2010-10-27 2013-08-29 Mount Sinai School Of Medicine Methods of Treating Psychiatric or Neurological Disorders with MGLUR Antagonists
WO2012075028A1 (en) 2010-11-29 2012-06-07 Dako Denmark A/S Methods and systems for analyzing images of specimens processed by a programmable quantitative assay
CN107159328B (en) 2010-12-09 2020-04-14 阿科尼生物系统公司 Sample analysis system
EP2656263B1 (en) 2010-12-22 2019-11-06 Natera, Inc. Methods for non-invasive prenatal paternity testing
US10241075B2 (en) 2010-12-30 2019-03-26 Life Technologies Corporation Methods, systems, and computer readable media for nucleic acid sequencing
DK3216878T3 (en) 2011-01-17 2019-06-11 Life Technologies Corp WORKING PROCEDURE FOR DETERMINING LIGANDS BY USING NUCLEAR ACIDS
WO2012103154A1 (en) 2011-01-24 2012-08-02 Nugen Technologies, Inc. Stem-loop composite rna-dna adaptor-primers: compositions and methods for library generation, amplification and other downstream manipulations
US20120190020A1 (en) 2011-01-25 2012-07-26 Aria Diagnostics, Inc. Detection of genetic abnormalities
JP6069224B2 (en) 2011-01-31 2017-02-01 アプライズ バイオ， インコーポレイテッド Methods for identifying multiple epitopes in a cell
WO2012108864A1 (en) 2011-02-08 2012-08-16 Illumina, Inc. Selective enrichment of nucleic acids
EP3736281A1 (en) 2011-02-18 2020-11-11 Bio-Rad Laboratories, Inc. Compositions and methods for molecular labeling
SG192870A1 (en) 2011-02-23 2013-09-30 Regents Board Of Use of template switching for dna synthesis
US9260753B2 (en) 2011-03-24 2016-02-16 President And Fellows Of Harvard College Single cell nucleic acid detection and analysis
KR20120110431A (en) 2011-03-29 2012-10-10 에스케이하이닉스 주식회사 A semiconductor memory apparatus
GB201106254D0 (en) 2011-04-13 2011-05-25 Frisen Jonas Method and product
AU2012242847B2 (en) 2011-04-15 2017-01-19 The Johns Hopkins University Safe sequencing system
CN103717749A (en) 2011-04-25 2014-04-09 伯乐生命医学产品有限公司 Methods and compositions for nucleic acid analysis
US8946389B2 (en) 2011-04-25 2015-02-03 University Of Washington Compositions and methods for multiplex biomarker profiling
DK3415619T3 (en) 2011-04-28 2021-03-08 Univ Leland Stanford Junior IDENTIFICATION OF POLYNUCLEOTIDS ASSOCIATED WITH A SAMPLE
GB201108259D0 (en) 2011-05-17 2011-06-29 Cambridge Entpr Ltd Gel beads in microfluidic droplets
EP2710172B1 (en) 2011-05-20 2017-03-29 Fluidigm Corporation Nucleic acid encoding reactions
NZ742420A (en) 2011-05-24 2022-10-28 Tron Translationale Onkologie An Der Univ Der Johannes Gutenberg Univ Mainz Gemeinnuetzige Gmbh Individualized vaccines for cancer
WO2012162621A1 (en) 2011-05-26 2012-11-29 Brandeis University Methods for suppression pcr
US8841071B2 (en) 2011-06-02 2014-09-23 Raindance Technologies, Inc. Sample multiplexing
US9752176B2 (en) 2011-06-15 2017-09-05 Ginkgo Bioworks, Inc. Methods for preparative in vitro cloning
WO2012177639A2 (en) 2011-06-22 2012-12-27 Alnylam Pharmaceuticals, Inc. Bioprocessing and bioproduction using avian cell lines
US20140147860A1 (en) 2011-06-27 2014-05-29 Life Technologies Corporation Acoustic Cytometry Methods and Protocols
US9340826B2 (en) 2011-08-01 2016-05-17 Celemics, Inc. Method of preparing nucleic acid molecules
WO2013022961A1 (en) 2011-08-08 2013-02-14 3The Broad Institute Compositions and methods for co-amplifying subsequences of a nucleic acid fragment sequence
JP5816486B2 (en) 2011-08-18 2015-11-18 オリンパス株式会社 Fluorescence observation apparatus, fluorescence observation system, and fluorescence image processing method of fluorescence observation apparatus
PL2756098T3 (en) 2011-09-16 2018-12-31 Lexogen Gmbh Method for making library of nucleic acid molecules
WO2013062931A2 (en) 2011-10-24 2013-05-02 Furchak Jennifer A molecular beacon based assay for the detection of biomarkers of breast cancer metastasis
ES2884100T3 (en) 2011-11-11 2021-12-10 Eli N Glezer Coagent-Assisted Binding Assay Procedures
KR101337094B1 (en) 2011-11-30 2013-12-05 삼성에스디에스 주식회사 Apparatus and method for sequence alignment
EP2794927B1 (en) 2011-12-22 2017-04-12 Ibis Biosciences, Inc. Amplification primers and methods
WO2013117595A2 (en) 2012-02-07 2013-08-15 Illumina Cambridge Limited Targeted enrichment and amplification of nucleic acids on a support
US20130210659A1 (en) 2012-02-10 2013-08-15 Andrew Watson Molecular diagnostic screening assay
WO2013123125A1 (en) 2012-02-17 2013-08-22 President And Fellows Of Harvard College Assembly of nucleic acid sequences in emulsions
US9176031B2 (en) 2012-02-24 2015-11-03 Raindance Technologies, Inc. Labeling and sample preparation for sequencing
WO2013130674A1 (en) 2012-02-27 2013-09-06 Cellular Research, Inc. Compositions and kits for molecular counting
US11177020B2 (en) 2012-02-27 2021-11-16 The University Of North Carolina At Chapel Hill Methods and uses for molecular tags
WO2013137737A1 (en) 2012-03-16 2013-09-19 Flexgen B.V. Methods of creating and screening of dna encoded combinatorial libraries of chemical antibodies
US9803239B2 (en) 2012-03-29 2017-10-31 Complete Genomics, Inc. Flow cells for high density array chips
EP2647426A1 (en) 2012-04-03 2013-10-09 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Replication of distributed nucleic acid molecules with preservation of their relative distribution through hybridization-based binding
ES2711156T3 (en) 2012-05-08 2019-04-30 Adaptive Biotechnologies Corp Method to measure and calibrate the amplification bias in multiplexed PCR reactions
EP2850211B1 (en) 2012-05-14 2021-09-08 iRepertoire, Inc. Method for increasing accuracy in quantitative detection of polynucleotides
JP2015519900A (en) 2012-05-21 2015-07-16 フリューダイム・コーポレイション Single particle analysis method and single particle isolation method for particle population
EP2856177B1 (en) * 2012-05-25 2020-11-18 The University of North Carolina At Chapel Hill Microfluidic devices, solid supports for reagents and related methods
JP2015519909A (en) 2012-06-15 2015-07-16 アダプティブ バイオテクノロジーズ コーポレイション Uniquely tagged rearranged adaptive immune receptor genes in a complex gene set
WO2013188872A1 (en) 2012-06-15 2013-12-19 The Board Of Regents Of The University Of Texas System High throughput sequencing of multiple transcripts of a single cell
US9957549B2 (en) 2012-06-18 2018-05-01 Nugen Technologies, Inc. Compositions and methods for negative selection of non-desired nucleic acid sequences
US20150011396A1 (en) 2012-07-09 2015-01-08 Benjamin G. Schroeder Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing
EP3243937A1 (en) 2012-07-17 2017-11-15 Counsyl, Inc. System and methods for detecting genetic variation
WO2014015098A1 (en) 2012-07-18 2014-01-23 Siemens Healthcare Diagnostics Inc. A method of normalizing biological samples
CA2878694A1 (en) 2012-07-24 2014-01-30 Sequenta, Inc. Single cell analysis using sequence tags
EP2877593B1 (en) 2012-07-26 2018-07-18 Illumina, Inc. Compositions and methods for the amplification of nucleic acids
CN105264088B (en) 2012-08-08 2018-12-28 豪夫迈·罗氏有限公司 Improve the dynamic range of multiple epitopes in identification of cell
US20150005199A1 (en) 2012-08-14 2015-01-01 10X Technologies, Inc. Compositions and methods for sample processing
US10273541B2 (en) 2012-08-14 2019-04-30 10X Genomics, Inc. Methods and systems for processing polynucleotides
US9951386B2 (en) 2014-06-26 2018-04-24 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20150005200A1 (en) 2012-08-14 2015-01-01 10X Technologies, Inc. Compositions and methods for sample processing
US9701998B2 (en) * 2012-12-14 2017-07-11 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10752949B2 (en) 2012-08-14 2020-08-25 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20140378349A1 (en) 2012-08-14 2014-12-25 10X Technologies, Inc. Compositions and methods for sample processing
US10221442B2 (en) 2012-08-14 2019-03-05 10X Genomics, Inc. Compositions and methods for sample processing
CA3216609C (en) 2012-08-14 2024-05-14 10X Genomics, Inc. Microcapsule compositions and methods
US10584381B2 (en) 2012-08-14 2020-03-10 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20140378345A1 (en) 2012-08-14 2014-12-25 10X Technologies, Inc. Compositions and methods for sample processing
US20140378322A1 (en) 2012-08-14 2014-12-25 10X Technologies, Inc. Compositions and methods for sample processing
EP4148118A1 (en) 2012-08-24 2023-03-15 Yale University System, device and method for high-throughput multi-plexed detection
DK3511423T4 (en) 2012-10-17 2024-07-29 Spatial Transcriptomics Ab METHODS AND PRODUCT FOR OPTIMIZING LOCALIZED OR SPATIAL DETECTION OF GENE EXPRESSION IN A TISSUE SAMPLE
US10150996B2 (en) 2012-10-19 2018-12-11 Adaptive Biotechnologies Corp. Quantification of adaptive immune cell genomes in a complex mixture of cells
GB201218909D0 (en) 2012-10-22 2012-12-05 Univ Singapore Assay for the parallel detection of biological material based on PCR
CN104903466B (en) 2012-11-05 2016-11-23 鲁比康基因组学公司 Bar coding nucleic acid
CA2894694C (en) 2012-12-14 2023-04-25 10X Genomics, Inc. Methods and systems for processing polynucleotides
US9683230B2 (en) 2013-01-09 2017-06-20 Illumina Cambridge Limited Sample preparation on a solid support
WO2014108850A2 (en) 2013-01-09 2014-07-17 Yeda Research And Development Co. Ltd. High throughput transcriptome analysis
US9562269B2 (en) * 2013-01-22 2017-02-07 The Board Of Trustees Of The Leland Stanford Junior University Haplotying of HLA loci with ultra-deep shotgun sequencing
CN104955576A (en) 2013-01-24 2015-09-30 沙特基础全球技术有限公司 Microwell plate made from a polyester-polycarbonate
US10017761B2 (en) 2013-01-28 2018-07-10 Yale University Methods for preparing cDNA from low quantities of cells
US10190963B2 (en) 2013-02-01 2019-01-29 Becton, Dickinson And Company Methods and systems for assessing sample behavior in a flow cytometer
CA2900543C (en) 2013-02-08 2023-01-31 10X Genomics, Inc. Partitioning and processing of analytes and other species
EP2954102B1 (en) 2013-02-08 2018-12-19 Bio-Rad Laboratories, Inc. Affinity-based partition assay for detection of target molecules
WO2014126937A1 (en) 2013-02-14 2014-08-21 The Board Of Trustees Of The Leland Stanford Junior University Suspension arrays and multiplexed assays based thereon
US9621600B2 (en) 2013-02-26 2017-04-11 PortAura Group Method and system for providing recommendations using location information
US20140274811A1 (en) 2013-03-14 2014-09-18 Lyle J. Arnold Methods for Amplifying a Complete Genome or Transcriptome
US10119134B2 (en) 2013-03-15 2018-11-06 Abvitro Llc Single cell bar-coding for antibody discovery
CN105189749B (en) 2013-03-15 2020-08-11 血统生物科学公司 Methods and compositions for labeling and analyzing samples
US9255265B2 (en) 2013-03-15 2016-02-09 Illumina, Inc. Methods for producing stranded cDNA libraries
US9938523B2 (en) 2013-03-15 2018-04-10 Arizona Board Of Regents On Behalf Of Arizona State University Nucleic acid-tagged compositions and methods for multiplexed protein-protein interaction profiling
US9328382B2 (en) 2013-03-15 2016-05-03 Complete Genomics, Inc. Multiple tagging of individual long DNA fragments
WO2014165762A1 (en) 2013-04-05 2014-10-09 Raindance Technologies, Inc. Rare cell analysis after negative selection
SG10201805453XA (en) 2013-04-25 2018-08-30 Firefly Bioworks Inc Multiplexed analysis of target nucleic acids
US10822605B2 (en) 2013-05-03 2020-11-03 Gensinta, Inc. Method and apparatus for producing sequence verified DNA
EP2805769A1 (en) 2013-05-24 2014-11-26 European Molecular Biology Laboratory Methods for nano-scale single cell analysis
WO2014201273A1 (en) 2013-06-12 2014-12-18 The Broad Institute, Inc. High-throughput rna-seq
EP3587585B1 (en) 2013-06-12 2021-03-24 The General Hospital Corporation Methods, kits, and systems for multiplexed detection of target molecules and uses thereof
WO2014204939A2 (en) 2013-06-17 2014-12-24 Kim Lewis Methods for quantitative determination of protein-nucleic acid interactions in complex mixtures
DK3013983T3 (en) 2013-06-25 2023-03-06 Prognosys Biosciences Inc SPATIALLY ENCODED BIOLOGICAL ASSAYS USING A MICROFLUIDIC DEVICE
MX361481B (en) * 2013-06-27 2018-12-06 10X Genomics Inc Compositions and methods for sample processing.
US9708657B2 (en) 2013-07-01 2017-07-18 Adaptive Biotechnologies Corp. Method for generating clonotype profiles using sequence tags
US20160153973A1 (en) 2013-07-09 2016-06-02 Lucas David Smith Device and method of rapid linker mediated label-based immunoassays
AU2014312208B2 (en) 2013-08-28 2019-07-25 Becton, Dickinson And Company Massively parallel single cell analysis
US10395758B2 (en) 2013-08-30 2019-08-27 10X Genomics, Inc. Sequencing methods
EP3041957A4 (en) 2013-09-04 2017-03-29 Fluidigm Corporation Proximity assays for detecting nucleic acids and proteins in a single cell
GB201317301D0 (en) 2013-09-30 2013-11-13 Linnarsson Sten Method for capturing and encoding nucleic acid from a plurality of single cells
ES2875998T3 (en) 2013-09-30 2021-11-11 Vesicode Ab Procedures for profiling molecular complexes using proximity-dependent barcodes
EP3055676A1 (en) 2013-10-07 2016-08-17 Cellular Research, Inc. Methods and systems for digitally counting features on arrays
WO2015057985A1 (en) 2013-10-17 2015-04-23 Illumina, Inc. Methods and compositions for preparing nucleic acid libraries
US9709479B2 (en) 2013-10-25 2017-07-18 Massachusetts Institute Of Technology Method and apparatus for tracking cell identity
WO2015061844A1 (en) 2013-10-30 2015-05-07 The University Of Sydney Assay to stratify cancer patients
WO2015070037A2 (en) 2013-11-08 2015-05-14 Prognosys Biosciences, Inc. Polynucleotide conjugates and methods for analyte detection
KR102433825B1 (en) 2013-12-30 2022-08-31 아트레카, 인크. Analysis of nucleic acids associated with single cells using nucleic acid barcodes
EP4219744A3 (en) 2014-01-27 2023-08-30 The General Hospital Corporation Methods of preparing nucleic acids for sequencing
WO2015117163A2 (en) 2014-02-03 2015-08-06 Integrated Dna Technologies, Inc. Methods to capture and/or remove highly abundant rnas from a heterogeneous rna sample
US20160340720A1 (en) 2014-02-13 2016-11-24 Cellular Research Methods and compositions for array-based counting
CA2940764C (en) 2014-02-26 2019-10-29 Nelson Alexander Photo-selective method for biological sample analysis field
WO2015134787A2 (en) 2014-03-05 2015-09-11 Adaptive Biotechnologies Corporation Methods using randomer-containing synthetic molecules
US20150298091A1 (en) * 2014-04-21 2015-10-22 President And Fellows Of Harvard College Systems and methods for barcoding nucleic acids
US10975371B2 (en) 2014-04-29 2021-04-13 Illumina, Inc. Nucleic acid sequence analysis from single cells
EP3680333A1 (en) 2014-04-29 2020-07-15 Illumina, Inc. Multiplexed single cell expression analysis using template switch and tagmentation
WO2015179339A1 (en) 2014-05-19 2015-11-26 William Marsh Rice University Allele-specific amplification using a composition of overlapping non-allele-specific primer and allele-specific blocker oligonucleotides
WO2015200541A1 (en) 2014-06-24 2015-12-30 Bio-Rad Laboratories, Inc. Digital pcr barcoding
AU2015279617A1 (en) 2014-06-26 2017-01-12 10X Genomics, Inc. Analysis of nucleic acid sequences
KR20230070325A (en) 2014-06-26 2023-05-22 10엑스 제노믹스, 인크. Methods of analyzing nucleic acids from individual cells or cell populations
EP3169799B1 (en) 2014-07-15 2019-09-04 Qiagen Sciences, LLC Semi-random barcodes for nucleic acid analysis
US11408024B2 (en) 2014-09-10 2022-08-09 Molecular Loop Biosciences, Inc. Methods for selectively suppressing non-target sequences
EP3950944A1 (en) 2014-09-15 2022-02-09 AbVitro LLC High-throughput nucleotide library sequencing
US9529672B2 (en) 2014-09-25 2016-12-27 Everspin Technologies Inc. ECC word configuration for system-level ECC compatibility
BR122021026781B1 (en) 2014-10-17 2023-11-14 Illumina Cambridge Limited CONTIGUITY PRESERVING TRANSPOSON
US20180320241A1 (en) 2014-12-19 2018-11-08 Roche Sequencing Solutions, Inc. Methods for identifying multiple epitopes in selected sub-populations of cells
CN107407691B (en) 2015-01-22 2021-07-27 贝克顿迪金森公司 Device and system for molecular barcoding of nucleic acid targets in single cells
EP3763825B1 (en) 2015-01-23 2023-10-04 Qiagen Sciences, LLC High multiplex pcr with molecular barcoding
US11111519B2 (en) 2015-02-04 2021-09-07 The Regents Of The University Of California Sequencing of nucleic acids via barcoding in discrete entities
US10854315B2 (en) 2015-02-09 2020-12-01 10X Genomics, Inc. Systems and methods for determining structural variation and phasing using variant call data
EP3766988B1 (en) 2015-02-19 2024-02-14 Becton, Dickinson and Company High-throughput single-cell analysis combining proteomic and genomic information
CN107208158B (en) 2015-02-27 2022-01-28 贝克顿迪金森公司 Spatially addressable molecular barcode
WO2016138500A1 (en) 2015-02-27 2016-09-01 Cellular Research, Inc. Methods and compositions for barcoding nucleic acids for sequencing
WO2016145409A1 (en) 2015-03-11 2016-09-15 The Broad Institute, Inc. Genotype and phenotype coupling
US20160266094A1 (en) 2015-03-13 2016-09-15 University Of Iowa Research Foundation Cellular barcode
WO2016149418A1 (en) 2015-03-18 2016-09-22 Cellular Research, Inc. Methods and compositions for labeling targets and haplotype phasing
US10301660B2 (en) 2015-03-30 2019-05-28 Takara Bio Usa, Inc. Methods and compositions for repair of DNA ends by multiple enzymatic activities
JP7508191B2 (en) 2015-03-30 2024-07-01 ベクトン・ディキンソン・アンド・カンパニー Methods and compositions for combinatorial barcoding
EP3283656A4 (en) 2015-04-17 2018-12-05 Centrillion Technology Holdings Corporation Methods for performing spatial profiling of biological molecules
EP3286326A1 (en) 2015-04-23 2018-02-28 Cellular Research, Inc. Methods and compositions for whole transcriptome amplification
US9618871B2 (en) 2015-04-28 2017-04-11 Kyocera Document Solutions Inc. Image forming apparatus
AU2016268089B2 (en) 2015-05-22 2021-09-23 Sigma-Aldrich Co. Llc Methods for next generation genome walking and related compositions and kits
US20180142290A1 (en) 2015-05-28 2018-05-24 Kaarel Krjutskov Blocking oligonucleotides
WO2016196229A1 (en) 2015-06-01 2016-12-08 Cellular Research, Inc. Methods for rna quantification
US11248262B2 (en) 2015-08-24 2022-02-15 Qiagen Gmbh Method for generating a RNA-sequencing library
CN115928221A (en) 2015-08-28 2023-04-07 Illumina公司 Single cell nucleic acid sequence analysis
ES2745694T3 (en) 2015-09-11 2020-03-03 Cellular Res Inc Methods and compositions for nucleic acid library normalization
BR112018005937A2 (en) 2015-09-24 2019-05-21 Abvitro Llc affinity oligonucleotide conjugates and uses of these
US11092607B2 (en) 2015-10-28 2021-08-17 The Board Institute, Inc. Multiplex analysis of single cell constituents
US11098304B2 (en) 2015-11-04 2021-08-24 Atreca, Inc. Combinatorial sets of nucleic acid barcodes for analysis of nucleic acids associated with single cells
CN108449933A (en) 2015-11-18 2018-08-24 宝生物工程（美国)有限公司 System and method for collecting the sample from Multiple-Aperture Device
WO2017096239A1 (en) 2015-12-04 2017-06-08 St. Jude Children's Research Hospital, Inc. Cloning and expression system for t-cell receptors
EP3397764A4 (en) 2015-12-30 2019-05-22 Bio-Rad Laboratories, Inc. Digital protein quantification
US20170205404A1 (en) 2016-01-19 2017-07-20 General Electric Company Multifunctional beads and methods of use for capturing rare cells
WO2017139690A1 (en) 2016-02-11 2017-08-17 10X Genomics, Inc. Cell population analysis using single nucleotide polymorphisms from single cell transcriptomes
US12060412B2 (en) 2016-03-21 2024-08-13 The Broad Institute, Inc. Methods for determining spatial and temporal gene expression dynamics in single cells
US11162134B2 (en) 2016-04-01 2021-11-02 Baylor College Of Medicine Methods of whole transcriptome amplification
AU2017261189B2 (en) 2016-05-02 2023-02-09 Becton, Dickinson And Company Accurate molecular barcoding
WO2017196768A1 (en) 2016-05-09 2017-11-16 President And Fellows Of Harvard College Self-targeting guide rnas in crispr system
US10301677B2 (en) 2016-05-25 2019-05-28 Cellular Research, Inc. Normalization of nucleic acid libraries
JP7046007B2 (en) 2016-05-26 2022-04-01 ベクトン・ディキンソン・アンド・カンパニー How to adjust the molecular label count
TWI600309B (en) 2016-05-28 2017-09-21 Hon Hai Prec Ind Co Ltd Angle adjusting mechanism
US10202641B2 (en) 2016-05-31 2019-02-12 Cellular Research, Inc. Error correction in amplification of samples
US10640763B2 (en) 2016-05-31 2020-05-05 Cellular Research, Inc. Molecular indexing of internal sequences
EP3686287A1 (en) 2016-06-28 2020-07-29 Hifibio Method for transcriptome analysis of single cells
WO2018017949A1 (en) 2016-07-22 2018-01-25 Verily Life Sciences Llc Quantitative massively parallel proteomics
US20190203270A1 (en) 2016-07-24 2019-07-04 Yeda Research And Development Co., Ltd. Methods and kits for analyzing dna binding moieties attached to dna
US20180037942A1 (en) 2016-08-03 2018-02-08 Cellular Research, Inc. Enzyme-independent molecular indexing
JP2019528059A (en) 2016-08-10 2019-10-10 プレジデント アンド フェローズ オブ ハーバード カレッジ Method for de novo assembly of barcoded genomic DNA fragments
JP7091348B2 (en) 2016-09-26 2022-06-27 ベクトン・ディキンソン・アンド・カンパニー Measurement of protein expression using reagents with barcoded oligonucleotide sequences
EP3521425A4 (en) 2016-09-29 2019-10-23 FUJIFILM Corporation Method for designing primers for multiplex pcr
CN109790537A (en) 2016-09-29 2019-05-21 富士胶片株式会社 For the design method of the primer of multiplex PCR
KR102650753B1 (en) 2016-10-01 2024-03-26 버클리 라잇츠, 인크. DNA barcode compositions and methods for in situ identification in microfluidic devices
CN114875125A (en) 2016-10-19 2022-08-09 10X基因组学有限公司 Methods and systems for barcoding nucleic acid molecules of individual cells or cell populations
CN114774520A (en) 2016-11-17 2022-07-22 领星生物科技（上海）有限公司 System and method for detecting tumor development
WO2018111872A1 (en) 2016-12-12 2018-06-21 Grail, Inc. Methods for tagging and amplifying rna template molecules for preparing sequencing libraries
KR20190095410A (en) 2016-12-22 2019-08-14 가던트 헬쓰, 인크. Methods and Systems for Analyzing Nucleic Acid Molecules
US20190177800A1 (en) 2017-12-08 2019-06-13 10X Genomics, Inc. Methods and compositions for labeling cells
US10011872B1 (en) 2016-12-22 2018-07-03 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10550429B2 (en) * 2016-12-22 2020-02-04 10X Genomics, Inc. Methods and systems for processing polynucleotides
GB201622222D0 (en) 2016-12-23 2017-02-08 Cs Genetics Ltd Reagents and methods for molecular barcoding of nucleic acids of single cells
US20210087610A9 (en) 2017-01-12 2021-03-25 Massachusetts Institute Of Technology Methods for analyzing t cell receptors and b cell receptors
US20180208975A1 (en) 2017-01-20 2018-07-26 Merck Sharp & Dohme Corp. Assay for simultaneous genomic and proteomic analysis
EP3545089B1 (en) 2017-01-30 2022-03-09 10X Genomics, Inc. Methods and systems for droplet-based single cell barcoding
WO2018144240A1 (en) 2017-02-01 2018-08-09 Cellular Research, Inc. Selective amplification using blocking oligonucleotides
FI3583214T3 (en) 2017-02-02 2023-12-19 New York Genome Center Inc Methods and compositions for identifying or quantifying targets in a biological sample
US20200115753A1 (en) 2017-03-17 2020-04-16 Massachusetts Institute Of Technology Methods for identifying and modulating co-occurant cellular phenotypes
WO2018175458A2 (en) 2017-03-24 2018-09-27 Cellular Research, Inc. Synthetic multiplets for multiplets determination
SG11201907762RA (en) 2017-03-24 2019-10-30 Nat Univ Singapore Methods for multiplex detection of molecules
EP3631001A4 (en) 2017-05-23 2021-01-20 Centrillion Technology Holdings Corporation Methods for performing spatial profiling of biological molecules
MX2019013993A (en) 2017-05-23 2020-07-28 Harvard College Multiplex end-tagging amplification of nucleic acids.
KR102550778B1 (en) 2017-05-26 2023-07-03 에이비비트로 엘엘씨 High-throughput polynucleotide library sequencing and transcriptome analysis
US10844372B2 (en) 2017-05-26 2020-11-24 10X Genomics, Inc. Single cell analysis of transposase accessible chromatin
JP2020521486A (en) 2017-05-29 2020-07-27 プレジデント アンド フェローズ オブ ハーバード カレッジ Single cell transcriptome amplification method
KR102438495B1 (en) 2017-06-05 2022-09-01 백톤 디킨슨 앤드 컴퍼니 Sample indexing for single cells
US20200217850A1 (en) 2017-09-15 2020-07-09 Apton Biosystems, Inc. Heterogeneous single cell profiling using molecular barcoding
EP4379727A1 (en) 2017-09-25 2024-06-05 Becton, Dickinson and Company Immune receptor-barcode error correction
DK3688157T3 (en) 2017-09-25 2022-07-04 Fred Hutchinson Cancer Center High efficient in-situ targeted genome profile
WO2019076768A1 (en) 2017-10-16 2019-04-25 Tervisetehnoloogiate Arenduskeskus As Method and kit for dna library preparation
US11702649B2 (en) 2017-10-23 2023-07-18 The Broad Institute, Inc. Single cell cellular component enrichment from barcoded sequencing libraries
US20200354767A1 (en) 2017-11-16 2020-11-12 The Regents Of The University Of Colorado, A Body Corporate Methods to measure functional heterogeneity among single cells
WO2019113457A1 (en) 2017-12-07 2019-06-13 Massachusetts Institute Of Technology Single cell analyses
WO2019113499A1 (en) 2017-12-07 2019-06-13 The Broad Institute, Inc. High-throughput methods for identifying gene interactions and networks
US11332736B2 (en) 2017-12-07 2022-05-17 The Broad Institute, Inc. Methods and compositions for multiplexing single cell and single nuclei sequencing
EP4403644A2 (en) 2017-12-08 2024-07-24 10X Genomics, Inc. Methods and compositions for labeling cells
WO2019118355A1 (en) 2017-12-12 2019-06-20 10X Genomics, Inc. Systems and methods for single cell processing
WO2019126789A1 (en) 2017-12-22 2019-06-27 10X Genomics, Inc. Systems and methods for processing nucleic acid molecules from one or more cells
SG11202006110UA (en) 2018-01-05 2020-07-29 Billiontoone Inc Quality control templates for ensuring validity of sequencing-based assays
CN112004920B (en) 2018-02-05 2024-08-02 斯坦福大学托管董事会 Systems and methods for multiplex measurement of single cells and pooled cells
EP3752832A1 (en) 2018-02-12 2020-12-23 10X Genomics, Inc. Methods characterizing multiple analytes from individual cells or cell populations
WO2019178164A1 (en) 2018-03-12 2019-09-19 Silicon Valley Scientific, Inc. Method and apparatus for processing tissue and other samples encoding cellular spatial position information
US20210123044A1 (en) 2018-04-18 2021-04-29 The Regents Of The University Of California Method to Connect Chromatin Accessibility and Transcriptome
WO2019210049A1 (en) 2018-04-27 2019-10-31 X Gen Us Co. Methods and compositions for preparing polynucleotides
EP4234717A3 (en) 2018-05-03 2023-11-01 Becton, Dickinson and Company High throughput multiomics sample analysis
US11365409B2 (en) 2018-05-03 2022-06-21 Becton, Dickinson And Company Molecular barcoding on opposite transcript ends
CN110499251A (en) 2018-05-17 2019-11-26 中国科学院大连化学物理研究所 The extracellular vesica analysis chip of the unicellular source property of high flux multiparameter and application
DK3821011T5 (en) 2018-07-11 2024-08-19 Cygnus Biosciences Beijing Co Ltd TRANSPOSOME-ACTIVATED DNA/RNA SEQUENCE (TED RNA-SEQ)
US20200040379A1 (en) 2018-08-03 2020-02-06 Cellular Research, Inc. Nuclei barcoding and capture in single cells
US20210302422A1 (en) 2018-08-08 2021-09-30 Vanderbilt University Systems and methods for simultaneous detection of antigens and antigen specific antibodies
EP3837378B1 (en) 2018-08-17 2023-04-05 Becton, Dickinson and Company Aptamer barcoding
WO2020046833A1 (en) 2018-08-28 2020-03-05 Cellular Research, Inc. Sample multiplexing using carbohydrate-binding and membrane-permeable reagents
EP3861134B1 (en) 2018-10-01 2024-09-04 Becton, Dickinson and Company Determining 5' transcript sequences
EP3877520A1 (en) 2018-11-08 2021-09-15 Becton Dickinson and Company Whole transcriptome analysis of single cells using random priming
CN113195717A (en) 2018-12-13 2021-07-30 贝克顿迪金森公司 Selective extension in single cell whole transcriptome analysis
JP2022519159A (en) 2018-12-17 2022-03-22 ナテラ， インコーポレイテッド Analytical method of circulating cells
WO2020154247A1 (en) 2019-01-23 2020-07-30 Cellular Research, Inc. Oligonucleotides associated with antibodies
EP3918090A4 (en) 2019-01-28 2022-10-26 Becton, Dickinson and Company Oligonucleotide-comprising cellular component-binding reagents and methods of using the same
EP3924506A1 (en) 2019-02-14 2021-12-22 Becton Dickinson and Company Hybrid targeted and whole transcriptome amplification
US11965208B2 (en) 2019-04-19 2024-04-23 Becton, Dickinson And Company Methods of associating phenotypical data and single cell sequencing data
WO2020219721A1 (en) 2019-04-23 2020-10-29 The Broad Institute, Inc. Compositions and methods characterizing metastasis
SG10201904897UA (en) 2019-05-30 2020-12-30 Nat Univ Singapore Method, structures and system for nucleic acid sequence topology assembly for multiplexed profiling of proteins.
WO2021011433A1 (en) 2019-07-12 2021-01-21 New York Genome Center, Inc Methods and compositions for scalable pooled rna screens with single cell chromatin accessibility profiling
US20210039582A1 (en) 2019-08-07 2021-02-11 ZF Passive Safety Systems US Inc. Airbag package with improved packaging
WO2021092386A1 (en) 2019-11-08 2021-05-14 Becton Dickinson And Company Using random priming to obtain full-length v(d)j information for immune repertoire sequencing
EP4087945B1 (en) 2020-01-10 2024-03-06 10X Genomics, Inc. Methods for determining a location of a target nucleic acid in a biological sample
CN115279919A (en) 2020-01-13 2022-11-01 贝克顿迪金森公司 Cell capture using DU-containing oligonucleotides
WO2021146207A1 (en) 2020-01-13 2021-07-22 Becton, Dickinson And Company Methods and compositions for quantitation of proteins and rna
CN115298322A (en) 2020-01-17 2022-11-04 贝克顿迪金森公司 Methods and compositions for single cell secretogomics
EP4097228B1 (en) 2020-01-29 2024-08-14 Becton, Dickinson and Company Barcoded wells for spatial mapping of single cells through sequencing
US20210238661A1 (en) 2020-01-31 2021-08-05 Becton, Dickinson And Company Mesophilic dna polymerase extension blockers
WO2021163374A2 (en) 2020-02-12 2021-08-19 Becton, Dickinson And Company Intracellular abseq
WO2021168015A1 (en) 2020-02-17 2021-08-26 Universal Sequencing Technology Corporation Methods of barcoding nucleic acid for detection and sequencing
AU2021224760A1 (en) 2020-02-21 2022-09-15 10X Genomics, Inc. Capturing genetic targets using a hybridization approach
EP4111168A1 (en) 2020-02-25 2023-01-04 Becton Dickinson and Company Bi-specific probes to enable the use of single-cell samples as single color compensation control
US20230193246A1 (en) 2020-03-05 2023-06-22 BioLegend, Inc. Methods and compositions for detecting targets
EP4150118A1 (en) 2020-05-14 2023-03-22 Becton Dickinson and Company Primers for immune repertoire profiling
CN115803445A (en) 2020-06-02 2023-03-14 贝克顿迪金森公司 Oligonucleotides and beads for 5-prime gene expression assays
US11932901B2 (en) 2020-07-13 2024-03-19 Becton, Dickinson And Company Target enrichment using nucleic acid probes for scRNAseq
WO2022015667A1 (en) 2020-07-13 2022-01-20 Becton, Dickinson And Company Cdna spike-in control for single cell analysis
CN116194589A (en) 2020-07-31 2023-05-30 贝克顿迪金森公司 Single cell assay for transposase accessible chromatin
CN116529389A (en) 2020-08-20 2023-08-01 贝克顿迪金森公司 Blood cell lysing agent for separating bacteria from blood cultures
US20220154288A1 (en) 2020-11-17 2022-05-19 Becton, Dickinson And Company Combined analysis of cell-free nucleic acids and single cells for oncology diagnostics
US11739443B2 (en) 2020-11-20 2023-08-29 Becton, Dickinson And Company Profiling of highly expressed and lowly expressed proteins
EP4247968A1 (en) 2020-11-20 2023-09-27 Becton, Dickinson and Company Use of dextramer in single cell analysis
CN116569042A (en) 2020-12-09 2023-08-08 贝克顿迪金森公司 Multiplexed single cell immunoassays
WO2022143221A1 (en) 2020-12-31 2022-07-07 中国科学院北京基因组研究所(国家生物信息中心) Method and kit for labeling nucleic acid molecules
JP2024502618A (en) 2021-01-08 2024-01-22 セラノーム， インコーポレイテッド Devices and methods for analyzing biological samples
US20220380838A1 (en) 2021-06-01 2022-12-01 10X Genomics, Inc. Methods and compositions for analyte detection and probe resolution

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6436675B1 (en) * 1999-09-28 2002-08-20 Maxygen, Inc. Use of codon-varied oligonucleotide synthesis for synthetic shuffling
WO2010117620A2 (en) * 2009-03-30 2010-10-14 Illumina, Inc. Gene expression analysis in single cells
US20130116130A1 (en) * 2009-12-15 2013-05-09 Affymetrix, Inc. Digital Counting of Individual Molecules by Stochastic Attachment of Diverse Label-Tags
US20130190206A1 (en) * 2010-07-13 2013-07-25 Dublin City University Direct Clone Analysis and Selection Technology
WO2012048341A1 (en) * 2010-10-08 2012-04-12 President And Fellows Of Harvard College High-throughput single cell barcoding
US20120142018A1 (en) * 2010-12-05 2012-06-07 Wenbin Jiang Rapid Single Cell Based Parallel Biological Cell Sorter
WO2012083225A2 (en) * 2010-12-16 2012-06-21 Gigagen, Inc. System and methods for massively parallel analysis of nycleic acids in single cells

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
G. K. FU等: "Counting individual DNA molecules by the stochastic attachment of diverse labels", 《PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES》 *
G. MIKE MAKRIGIORGOS等: "A PCR-based amplification method retaining the quantitative difference between two complex genomes", 《NATURE BIOTECHNOLOGY》 *
I. KINDE等: "Detection and quantification of rare mutations with massively parallel sequencing", 《PROCEEDINGS OF THE NATIONAAL ACADEMY OF SCIENCES》 *
OLIVER J MILLER等: "Directed evolution by in vitro compartmentalization", 《NATURE METHODS》 *
R. NOVAK等: "Single-cell multiplex gene detection and sequencing with microfluidically generated agarose emulsions", 《ANGEWANDTE CHEMIE》 *

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107208158B (en) * 2015-02-27 2022-01-28 贝克顿迪金森公司 Spatially addressable molecular barcode
CN107208158A (en) * 2015-02-27 2017-09-26 赛卢拉研究公司 Spatially addressable molecule bar coding
CN107058310A (en) * 2016-08-12 2017-08-18 艾吉泰康生物科技(北京)有限公司 A kind of amplicon library constructing method for improving gene low frequency abrupt climatic change sensitivity
CN109843435A (en) * 2016-09-28 2019-06-04 通用自动化实验技术公司 For determining high resolution system, the kit, device and method with the application of other high-flux microorganisms of bacterial community relationship
CN110191756B (en) * 2016-11-17 2021-09-21 伯乐实验室有限公司 System and method for recovering and analyzing particles
CN110191756A (en) * 2016-11-17 2019-08-30 赛尔希诊断公司 System and method for recycling and analyzing particle
CN110799654A (en) * 2017-03-21 2020-02-14 穆韦尔斯有限公司 Sealed micropore assay
CN107177693A (en) * 2017-07-19 2017-09-19 中山大学 A kind of many times of PCR amplification methods
CN111479631A (en) * 2017-10-27 2020-07-31 10X基因组学有限公司 Methods and systems for sample preparation and analysis
US11584954B2 (en) 2017-10-27 2023-02-21 10X Genomics, Inc. Methods and systems for sample preparation and analysis
CN111479631B (en) * 2017-10-27 2022-02-22 10X基因组学有限公司 Methods and systems for sample preparation and analysis
CN111492068A (en) * 2017-12-19 2020-08-04 贝克顿迪金森公司 Particles associated with oligonucleotides
TWI804560B (en) * 2018-01-11 2023-06-11 美商奈諾卡福有限責任公司 Microfluidic cellular device and methods of use thereof
CN112272710A (en) * 2018-05-03 2021-01-26 贝克顿迪金森公司 High throughput omics sample analysis
CN109112182A (en) * 2018-09-04 2019-01-01 安徽农业大学 The method of the single oocyte gene quantitative expression of one boar
CN112969789A (en) * 2018-11-08 2021-06-15 贝克顿迪金森公司 Single cell whole transcriptome analysis using random priming
CN113166192A (en) * 2018-11-30 2021-07-23 吉内恩福赛克公司 Method for generating random oligonucleotides and determining the sequence thereof
US11492660B2 (en) 2018-12-13 2022-11-08 Becton, Dickinson And Company Selective extension in single cell whole transcriptome analysis
CN113454234A (en) * 2019-02-14 2021-09-28 贝克顿迪金森公司 Hybrid targeting and whole transcriptome amplification
CN110951580A (en) * 2019-09-29 2020-04-03 中国科学院苏州生物医学工程技术研究所 High-throughput single-cell transcriptome and gene mutation integration analysis integrated device
WO2021147069A1 (en) * 2020-01-23 2021-07-29 青岛华大智造普惠科技有限公司 Droplet microfluidics-based single cell sequencing and applications
CN114480592A (en) * 2020-10-27 2022-05-13 重庆医科大学 SNPs detection technology based on UDG mediated PCR, magnetic nano enrichment and strand displacement reaction
CN113150989A (en) * 2021-05-06 2021-07-23 上海交通大学医学院附属第九人民医院 Support for biomechanical bionic research
CN113450336A (en) * 2021-07-01 2021-09-28 维柯基科技(上海)有限公司 Processing method and device of porous fluorescent microarray image, computer equipment and computer readable storage medium
CN114214395A (en) * 2021-12-31 2022-03-22 上海星耀医学科技发展有限公司 Nucleic acid amplification method and kit for improving gene detection accuracy
CN114507743B (en) * 2022-01-28 2022-11-25 中国农业科学院植物保护研究所 RPA primer, probe and kit for rapidly detecting heterodera filipjevi and application of RPA primer, probe and kit
CN114507743A (en) * 2022-01-28 2022-05-17 中国农业科学院植物保护研究所 RPA primer, probe and kit for rapidly detecting Heterodera filipjevi and application of RPA primer, probe and kit

Also Published As

Publication number Publication date
AU2014312208B2 (en) 2019-07-25
JP6545682B2 (en) 2019-07-17
EP3480321A1 (en) 2019-05-08
US11702706B2 (en) 2023-07-18
ES2711168T3 (en) 2019-04-30
GB201609740D0 (en) 2016-07-20
AU2019204928A1 (en) 2019-07-25
US20160258012A2 (en) 2016-09-08
CN105705659B (en) 2019-11-29
EP3480321B8 (en) 2021-03-10
GB201511591D0 (en) 2015-08-19
US20180258500A1 (en) 2018-09-13
JP6891199B2 (en) 2021-06-18
EP3039158A1 (en) 2016-07-06
CN110964796B (en) 2024-04-05
AU2022291534A1 (en) 2023-02-02
US10927419B2 (en) 2021-02-23
US20190040474A1 (en) 2019-02-07
US20180327866A1 (en) 2018-11-15
KR102536833B1 (en) 2023-05-26
US20180327867A1 (en) 2018-11-15
KR102182834B1 (en) 2020-11-27
US20180291470A1 (en) 2018-10-11
SG10201806890VA (en) 2018-09-27
JP2019106998A (en) 2019-07-04
GB2525104A (en) 2015-10-14
KR20220075240A (en) 2022-06-07
US9567646B2 (en) 2017-02-14
US10131958B1 (en) 2018-11-20
KR20230074639A (en) 2023-05-30
WO2015031691A1 (en) 2015-03-05
US20230295742A1 (en) 2023-09-21
AU2014312208A1 (en) 2016-03-10
EP3480321B1 (en) 2020-12-09
GB2546833B (en) 2018-04-18
US20160265069A1 (en) 2016-09-15
EP3039158B1 (en) 2018-11-14
JP2016533187A (en) 2016-10-27
US20150299784A1 (en) 2015-10-22
KR20200133281A (en) 2020-11-26
US10253375B1 (en) 2019-04-09
KR102402446B1 (en) 2022-05-30
GB2525104B (en) 2016-09-28
EP3842542A1 (en) 2021-06-30
US11618929B2 (en) 2023-04-04
US20160145683A1 (en) 2016-05-26
US20210198754A1 (en) 2021-07-01
AU2019204928B2 (en) 2022-11-17
US10954570B2 (en) 2021-03-23
US9598736B2 (en) 2017-03-21
US10151003B2 (en) 2018-12-11
US9567645B2 (en) 2017-02-14
US20160010151A1 (en) 2016-01-14
US9637799B2 (en) 2017-05-02
GB2546833A (en) 2017-08-02
DK3039158T3 (en) 2019-03-04
SG11201601188TA (en) 2016-03-30
US20180002764A1 (en) 2018-01-04
KR20160055168A (en) 2016-05-17
US20190085412A1 (en) 2019-03-21
ES2857908T3 (en) 2021-09-29
US10208356B1 (en) 2019-02-19
CN110964796A (en) 2020-04-07

Similar Documents

Publication Publication Date Title
US11702706B2 (en) Massively parallel single cell analysis
US20240294991A1 (en) Massively parallel single cell analysis

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right
TA01 Transfer of patent application right

Effective date of registration: 20181102

Address after: new jersey

Applicant after: Becton, Dickinson

Address before: American California

Applicant before: CELLULAR RESEARCH, INC.

GR01 Patent grant
GR01 Patent grant