CN108929901B - Multiple amplification library building method for trace DNA and special kit thereof - Google Patents
Multiple amplification library building method for trace DNA and special kit thereof Download PDFInfo
- Publication number
- CN108929901B CN108929901B CN201810840309.XA CN201810840309A CN108929901B CN 108929901 B CN108929901 B CN 108929901B CN 201810840309 A CN201810840309 A CN 201810840309A CN 108929901 B CN108929901 B CN 108929901B
- Authority
- CN
- China
- Prior art keywords
- sequencing
- amplification
- library
- dna
- dna molecule
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a multiple amplification library building method for trace DNA and a special kit thereof. The multiple amplification library construction method can realize multiple amplification sequencing by taking trace DNA and even DNA at single cell level as a template, and the whole reaction process can be realized in a single tube. Experiments prove that: the library building method realizes the amplification of one-tube amplicons with the weight of 207 at the level of single cells, has higher fidelity than that of the existing commercial kit, not only has the advantages of convenient operation, economic cost, high sequencing quality and high sensitivity, but also can meet the sequencing requirements of two sequencing platforms. The method is suitable for the high-throughput low-frequency mutation detection field such as ctDNA mutation detection field and the germ line mutation detection field of low initial amount DNA such as single cell mutation detection screening.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a multiple amplification library building method for trace DNA and a special kit thereof.
Background
Amplicon sequencing is the sequencing of a PCR product or captured fragment of a specific length, analyzing the variations in the sequence. Amplicon sequencing can perform high-coverage sequencing on a target region, is convenient for low-frequency mutation detection, and has important value in the aspects of exploring gene variation (such as heterogeneous somatic mutation) of a complex sample for sequencing and the like. In practical applications, there is a difficulty in how to perform high fidelity amplicon sequencing library preparation on low DNA starting samples, including low starting samples with DNA degradation.
The existing technical scheme aiming at low initial quantity is mainly the multiplex amplification technology of Ampliseq products of Life company, and has the advantages of simplicity, convenience, high amplification efficiency and uniformityThe advantage of good performance is a good target sequencing technology. The amplimer product is bound with an ion torrent semiconductor sequencing platform, and after the amplification product is digested by adding FuPa reagent, the primer sequence is removed. Then adding an ion torrent sequencing joint of Life company, and finally sequencing based on an ion torrent sequencing platform. With 10ng of DNA, hundreds of key mutations can be rapidly assessed in a single day. However, the technology usually adopts the DNA with the initial amount not less than 10ng for amplification reaction, and adopts the ion torrent semiconductor sequencing technology for mutation detection, so that the base error rate is relatively high, the technology is not suitable for the variation detection of the polyN type, and the variation detection of the trace sample, particularly the detection of low-frequency mutation, is limited to a certain extent. Furthermore, Ion AmpliSeqTMThe fidelity of the amplification enzyme system of the technology is relatively low, and the detection of low-frequency mutations may be affected. Multiplex amplification of DNA templates based on ultra-low initial amounts of trace DNA and even single cell levels is rarely reported.
The mainstream amplicon sequencing-based platform mainly comprises a proton platform of Life corporation and a Hiseq platform of Illumina corporation, and the two companies respectively have respective kits for sample amplification and library establishment. The single-round running cost of the related kit of Life company is economic, but the method is not suitable for the poly N type mutation detection due to the technical limit, and the indel detection error rate is relatively high. Although the sequencing error rate of the Illumina platform is relatively low, the library building of the Illumina platform firstly needs a series of reactions such as end repairing, phosphorylation and A adding on nucleic acid, then uses a Y-type sticky end joint for connection, and can carry out sequencing after library amplification is completed by connection, so that the cost is high and the steps are complicated. Because the joints used by the two platforms are different, the library building products cannot be commonly used on the two platforms. Therefore, the development of a common library building method for two platforms has important significance in integrating the advantages of the two platforms.
Disclosure of Invention
It is an object of the present invention to provide a multiplex amplification library construction kit for trace amounts of DNA.
The kit provided by the invention comprises a multiple amplification system, a primer digestion system and a joint connection system;
the multiplex amplification system comprises DNA polymerase, a PCR buffer system and multiplex amplification primers;
the primer digestion system comprises at least one of uracil-DNA glycosylase (UDG enzyme, NEB), uracil-N-glycosylase (UNG enzyme, Thermo), exonuclease I (exonuclease I, Thermo), 8-oxoguanine DNA glycosylase (Fpg, NEB) and Klenow Fragment (NEB);
the joint connection system comprises a sequencing joint, T4DNA ligase and DNA ligase buffer solution.
Further, in the multiplex amplification system, the DNA polymerase may be at least one of Platinum Taq DNA high fidelity polymerase (Invitrogen), Phusion U Hot Start DNA polymerase (Thermo), KAPA HiFi HotStart DNA polymerase (KAPA), KAPA2G Robust DNA polymerase (KAPA), Pfu Turbo DNA polymerase (Agilent), KOD DNA polymerase (TOYOBO) and TaKaRa Taq DNA polymerase (TaKaRa).
The PCR buffer system can be a premixed solution of DNA polymerase, and can also be a buffer solution of DNA polymerase.
The multiple amplification primer is Ion AmpliSeqTMPrimer Pool, the Ion AmpliSeqTMThe Primer Pool is specifically 2 × Ion AmpliSeqTM Primer Pool(Life)。
In the joint connection system, the T4DNA ligase is T4DNA ligase (NEB);
the DNA Ligase Buffer solution is specifically DNA Ligase Buffer (NEB);
the sequencing linker can be an Illumina sequencing linker or an ion torrent sequencing linker. In practical application, the corresponding joint can be selected according to requirements. In one embodiment of the invention, the Illumina sequencing linker used is a blunt-ended linker, illu _ adaptor, which is different from the traditional Illumina Y-linker. Specifically, the blunt end connector illu _ adapter consists of a connector A and a connector B; the adaptor A is obtained by annealing a single-stranded DNA molecule adoligo1 and a single-stranded DNA molecule adoligo 3; the single-stranded DNA molecule adoligo3 and the 3' end of the single-stranded DNA molecule adoligo1 are in reverse complementary pairing to form a double-stranded structure; the adaptor B is obtained by annealing the single-stranded DNA molecule adoligo2 with the single-stranded DNA molecule adoligo 3; the single-stranded DNA molecule adoligo3 and the 3' end of the single-stranded DNA molecule adoligo2 are in reverse complementary pairing to form a double-stranded structure. The 3' end of the double-stranded structure formed by the single-stranded DNA molecule adoligo3 and the single-stranded DNA molecule adoligo1 or the single-stranded DNA molecule adoligo2 is a flat end. The single-stranded DNA molecule adoligo1 and the single-stranded DNA molecule adoligo2 have different 5' end sequences, can be added with a sequencing element and a sample barcode by a PCR method, are used for blunt end connection of an amplification product, and are suitable for an Illumina sequencing platform. More specifically, the nucleotide sequence of the single-stranded DNA molecule adoligo1 is shown as a sequence 1; the nucleotide sequence of the single-stranded DNA molecule adoligo2 is shown as a sequence 2, and the nucleotide sequence of the single-stranded DNA molecule adoligo3 is shown as a sequence 3.
In another embodiment of the invention, the Ion Torrent sequencing linker used is KAPA Adapter kit Ion TorrentTMThe platfoms linker is suitable for a sequencing platform of an ion torrent.
Furthermore, the multiplex amplification system comprises at least one of Platinum Taq DNA high fidelity polymerase, Phusion U Hot Start DNA polymerase, KAPA HiFi HotStart DNA polymerase, KAPA2G Robust DNA polymerase, Pfu Turbo DNA polymerase, KOD DNA polymerase and TaKaRa Taq DNA polymerase, 2 × Ion AmpliSeqTMPrimer Pool and 1 × PCR buffer system. The concentrations of the enzymes in the multiplex amplification system are as follows: the concentration of the Platinum Taq DNA high-fidelity polymerase in the multiplex amplification system is (0-0.2) U/mu L, and preferably (0.01-0.2) U/mu L; the concentration of Phusion U Hot Start DNA polymerase in the multiplex amplification system is (0-0.2) U/muL, preferably (0.01-0.2) U/muL; the concentration of the KAPA HiFi HotStart DNA polymerase in the multiplex amplification system is (0-0.2) U/muL, preferably (0.01-0.2) U/muL; the concentration of the KAPA2G Robust DNA polymerase in the multiplex amplification system is (0-0.2) U/muL, preferably (0.01-0.2) U/muL; the concentration of the Pfu Turbo DNA polymerase in the multiplex amplification system is (0-0.2) U/muL, preferably (0.01-0.2) U/muL; concentration of the KOD DNA polymerase in the multiplex amplification SystemIs (0-0.2) U/μ L, preferably (0.01-0.2) U/μ L; the concentration of the TaKaRa Taq DNA polymerase in the multiplex amplification system is (0-0.2) U/mu L, and preferably (0.01-0.2) U/mu L. The 2 × Ion AmpliSeqTMPrimer Pool is 2 Xion AmpliSeqTM Primer Pool(0.2～1)×。
The primer digestion system is composed of at least one of UDG enzyme, UNG enzyme, exonuclease, 8-oxidation guanine DNA glycosylase and Klenow fragment U. The concentrations of the enzymes in the primer digestion system are as follows: the concentration of the UDG enzyme in the primer digestion system is (0-2) U/muL, preferably (0.2-2) U/muL; the concentration of the UNG enzyme in the primer digestion system is (0-2) U/muL, preferably (0.2-2) U/muL; the concentration of the exonuclease in the primer digestion system is (0-10) U/muL, preferably (0.2-2) U/muL; the concentration of the 8-oxoguanine DNA glycosylase in the primer digestion system is (0-2) U/muL, preferably (0.2-2) U/muL; the concentration of the Klenow fragment in the primer digestion system is (0-4) U/muL, and preferably (0.2-4) U/muL.
The adaptor connection system consists of a sequencing adaptor solution, T4DNA Ligase and 1 XDNA Ligase buffer solution. The concentration of the T4DNA Ligase in the adaptor connection system is (0.5-3) U/mu L. The concentrations of the linker A and the linker B in the sequencing linker solution are both (10-50) mu M.
The application of the kit in trace DNA library construction or trace DNA low-frequency variation detection also belongs to the protection scope of the invention.
Another object of the present invention is to provide a method for constructing a trace amount of DNA library using the aforementioned kit.
The method for constructing the trace DNA library comprises the following steps:
1) adding a DNA sample into the multiple amplification system to perform multiple PCR amplification to obtain multiple amplification products;
2) adding the primer digestion system into the multiple amplification products for digestion reaction to obtain digestion products;
3) and adding the joint connection system into the digestion product to carry out joint connection reaction to obtain a connection joint product, namely the constructed library.
Further, in the step 1), the multiplex amplification system comprises at least one of Platinum Taq DNA Hi-Fi polymerase, Phusion U Hot Start DNA polymerase, KAPA HiFi HotStart DNA polymerase, KAPA2G Robust DNA polymerase, Pfu Turbo DNA polymerase, KOD DNA polymerase and TaKaRa Taq DNA polymerase, 2 × Ion AmpliSeqTMPrimer Pool and 1 × PCR buffer system.
The primer digestion system in the 2) is composed of at least one of UDG enzyme, UNG enzyme, exonuclease, 8-oxoguanine DNA glycosylase and Klenow fragment.
In the step 3), the linker connection system consists of a sequencing linker solution, T4DNA Ligase and 1 XDNA Ligase buffer.
Further, in the 1), picogram-microgram-grade DNA samples are added into the multiplex amplification system; the starting amount of the DNA sample may be at the single cell level.
The concentration of the Platinum Taq DNA high-fidelity polymerase in the multiplex amplification system is (0-0.2) U/mu L, and preferably (0.01-0.2) U/mu L; the concentration of Phusion U Hot Start DNA polymerase in the multiplex amplification system is (0-0.2) U/muL, preferably (0.01-0.2) U/muL; the concentration of the KAPA HiFi HotStart DNA polymerase in the multiplex amplification system is (0-0.2) U/muL, preferably (0.01-0.2) U/muL; the concentration of the KAPA2G Robust DNA polymerase in the multiplex amplification system is (0-0.2) U/muL, preferably (0.01-0.2) U/muL; the concentration of the Pfu Turbo DNA polymerase in the multiplex amplification system is (0-0.2) U/muL, preferably (0.01-0.2) U/muL; the concentration of the KOD DNA polymerase in the multiplex amplification system is (0-0.2) U/muL, preferably (0.01-0.2) U/muL; the concentration of the TaKaRa Taq DNA polymerase in the multiplex amplification system is (0-0.2) U/mu L, and preferably (0.01-0.2) U/mu L. The 2 × Ion AmpliSeqTMPrimer Pool is 2 Xion AmpliSeqTM Primer Pool(0.2～1)×。
In the step 2), the concentration of the UDG enzyme in the primer digestion system is (0-2) U/muL, preferably (0.2-2) U/muL; the concentration of the UNG enzyme in the primer digestion system is (0-2) U/muL, preferably (0.2-2) U/muL; the concentration of the exonuclease in the primer digestion system is (0-10) U/muL, preferably (0.2-2) U/muL; the concentration of the 8-oxoguanine DNA glycosylase in the primer digestion system is (0-2) U/muL, preferably (0.2-2) U/muL; the concentration of the Klenow fragment in the primer digestion system is (0-4) U/muL, and preferably (0.2-4) U/muL.
In the step 3), the concentration of the T4DNA Ligase in the adaptor connection system is (0.5-3) U/muL. The concentrations of the linker A and the linker B in the sequencing linker solution are both (10-50) mu M.
In the method, in the 1), the reaction conditions for the multiplex PCR amplification are as follows: pre-denaturation at 90-99 deg.C for 1-3 min; (90-99) DEG C denaturation (10-30) sec, (50-60) DEG C annealing (2-5) min, for (18-35) cycles; keeping the temperature at (4-15) DEG C.
In the 2), the digestion reaction conditions are as follows: reacting at 30-50 ℃ for 10-30 min; reacting at 50-70 ℃ for 10-30 min; reacting at 4-15 deg.C for 0.5-2 h.
In the step 3), the conditions of the ligation reaction are as follows: reacting at 10-30 ℃ for 10-30 min; (60-80) reacting for 10-30 min; reacting at 4-15 deg.C for 0.5-2 h.
The last purpose of the invention is to provide a method for detecting low-frequency variation of trace DNA.
The method for detecting the low-frequency variation of the trace DNA provided by the invention comprises the following steps:
(1) performing multiple amplification and library building on the trace DNA sample to be detected according to the method to obtain a library to be sequenced;
(2) and sequencing the library to be sequenced, and determining the variation condition of the trace DNA sample to be sequenced according to a sequencing result.
In the method for detecting low-frequency variation of trace DNA, a step of adding a sequencing index is further included between (1) and (2).
The method for adding the sequencing index comprises the step of adding a PCR reaction mixed solution into the library to be sequenced for PCR amplification. The PCR reaction mixture consisted of 1 XKAPA HiFi HotStart ReadyMix, adapter 1 primer (0.2. mu.M) and adapter 2_ index primer (0.2. mu.M). The conditions for the PCR amplification were as follows: pre-denaturation at 90-99 deg.C for 1-3 min; (90-99) DEG C denaturation (10-30) sec, (50-60) DEG C annealing (1-3) min for (4-8) cycles; keeping the temperature at (4-15) DEG C.
And the steps of purification are also included before and after the addition of the sequencing index. The purification method can be magnetic bead purification or membrane purification.
In the method for detecting low-frequency variation of trace DNA, the sequencing platform may be an Illumina sequencing platform or an ion torrent sequencing platform.
The invention has the following beneficial effects:
1. the invention adopts a new enzyme system, improves reaction conditions and the like, realizes multiplex amplification sequencing by using trace DNA even single-cell level DNA as a template, has the amplification sequencing weight of 207, and has better amplification uniformity.
2. The steps of multiplex amplification, primer digestion, joint connection and the like are all carried out in the same tube, so that the operation steps are obviously simplified, and the library building efficiency is high.
3. According to the invention, a blunt end joint different from a traditional Illumina Y-type joint is adopted, an amplification product of an Ampliseq primer is connected with an Illumina sequencing joint, and Illumina sequencing platform sequencing is carried out. Compared with the Ampliseq primer, the sequencing background error is reduced on the proton platform, and the sequencing quality is improved. In addition, the invention can replace the joint with an ion torrent joint, and the same technical system can construct a sequencing platform suitable for the ion torrent, thereby having certain flexibility.
4. The fidelity of the amplification system is higher than that of the existing commercial kit, which is beneficial to improving the detection sensitivity of low-frequency mutation and is more suitable for detecting the low-frequency mutation.
The invention develops a method for trace DNA multiple amplification and library establishment by adopting a new enzyme system, improving reaction conditions and the like, can realize multiple amplification sequencing by taking trace DNA even DNA at a single cell level as a template, and can realize the whole reaction process in a single tube. Experiments prove that: the library building method realizes the amplification of one-tube amplicons with the weight of 207 at the level of single cells, has higher fidelity than that of the existing commercial kit, not only has the advantages of convenient operation, economic cost, high sequencing quality and high sensitivity, but also can meet the sequencing requirements of two sequencing platforms. The method is suitable for the field of high-throughput (up to 207 amplicons) low-frequency mutation detection, such as the field of ctDNA mutation detection, and the field of germ line mutation detection of low-initial-amount DNA, such as single-cell mutation detection screening.
Drawings
Fig. 1 shows the 2100 results for the linker.
FIG. 2 is a schematic diagram of amplification pooling.
FIG. 3 shows the results of a library 2100 constructed from multiple amplicons of a quality control product. The library size was 200-300 bp.
FIG. 4 is a sequencing quality chart of the library constructed in the present invention. A is a sequencing quality map of a commercial kit Ampliseq, and B is a sequencing quality map of the method of the invention.
FIG. 5 shows the quality control results of two amplification systems for amplifying 5% quality control products. A is a quality control result of a commercial kit amplification and library construction; and B is the quality control result of the amplification and library building of the invention.
FIG. 6 is a graph of background nuclear density of amplification. Orange stands for commercial kit and blue stands for amplification library building system of the invention.
FIG. 7 shows the result of single cell level multiplex amplification electrophoresis.
FIG. 8 shows the results of a single cell level multiplex amplification 2100. The library size was 200-300 bp.
FIG. 9 shows the results of ligation of the ion torrent linker library 2100. The library size was 150-300 bp.
FIG. 10 shows the result of electrophoresis of the amplification product.
FIG. 11 shows the result of electrophoresis of the digestion product.
Detailed Description
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
In the quantitative tests in the following examples, three replicates were set up and the results averaged.
Example 1, sequencing adaptors of the invention and their use in trace DNA pooling.
First, the sequencing linker of the invention
1. Preparation of linker sequences
The following linker sequences were prepared:
adoigo 1: t a TA CACTCTTTCCCTACACGACGCTCTTCCG a T C T (seq id No. 1);
adoigo 2: g C T GTGACTGGAGTTCAGACGTGTGCTCTTCCG A C T (SEQ ID NO: 2);
adlogo 3: a G T CGGAA G a G C (seq id No. 3);
wherein denotes a thio modification.
2. Preparation of Adaptor1 and Adaptor2 linkers
(1) The adogo 1, the adogo 2 and the adogo 3 were prepared as stock solutions with a final concentration of 500. mu.M, respectively.
(2) The equimolar amounts of adogo 1 and adogo 3 were mixed to prepare a reaction system shown in table 1, and the reaction was carried out according to the procedure shown in table 3 to form linker Adaptor 1.
The equimolar amounts of adogo 2 and adogo 3 were mixed to prepare a reaction system shown in table 2, and the reaction was carried out according to the procedure shown in table 3 to form linker Adaptor 2.
The 10 × Oligo hybridization Buffer formulation is as follows: 10mM Tris-HCl (pH8.0), 500mM NaCl, 1mM EDTA (pH 8.0).
TABLE 1 Adaptor1 reaction System
| |
Volume of | |
| 10× |
10 | 1X |
| adoligo1(500μM) | 40 | 200μM |
| adoligo3(500μM) | 40 | 200μM |
| ddH2O | 10 | —— |
TABLE 2 Adaptor2 reaction System
| |
Volume of | |
| 10× |
10 | 1X |
| adoligo2(500μM) | 40 | 200μM |
| adoligo3(500μM) | 40 | 200μM |
| ddH2O | 10 | —— |
TABLE 3 reaction sequence
| Temperature of | Time | |
| 95 | 10s | |
| 12℃ | 0.1℃/sec |
3. Preparation of Joint illu _ adapter
And (3) mixing the Adaptor1 joint and the Adaptor2 joint in equal volume to obtain the Adaptor illu _ Adaptor (100 mu M). The linker, illu _ adapter, was diluted for use so that the final concentrations of adapter 1 linker and adapter 2 linker were both 30 μ M.
4. Quality inspection of joint
And (3) accurately quantifying the adaptor illu _ adaptor prepared in the step (3) by using a Qubit2.0DNA detection kit, and qualitatively analyzing the adaptor illu _ adaptor prepared in the step (3) by using an Agilent 2100Bioanalyzer and an Agilent 2100HS kit.
The results are shown in FIG. 1. As can be seen from the figure: there is a single peak at 52bp, no other impurity peaks appear, and the linker size is correct.
Second, multiple amplification and library building method for trace DNA
Multiplex amplification and library construction were performed on 10ng of a commercial quality control Multiplex I cfDNA Reference Standard Set (horizons, USA). The flow of the multiplex amplification and library construction method of the present invention is shown in FIG. 2. The method comprises the following specific steps:
1. multiplex amplification of cfDNA
(1) The amplification reaction system was configured as in Table 4, mixed well by aspiration, and centrifuged briefly to collect the liquid.
TABLE 4 amplification reaction System configuration
(2) Place on the PCR machine and run the program of Table 5. After the procedure was completed, the reaction solution was collected by brief centrifugation to obtain an amplification product.
TABLE 5 amplification reaction procedure
2. Digestion of primers
(1) Mix prepared in table 6 is added into the amplification product, mixed evenly by blowing and sucking, and reaction liquid is collected by short-time centrifugation.
TABLE 6 primer digestion System configuration
| Composition (I) | Volume of |
| UDG enzyme (1U/. mu.L, NEB) | 0.6μL |
| Fpg(8U/μL，NEB) | 0.35μL |
| Klenow Fragment(5U/μL，NEB) | 0.6μL |
| Total volume | 1.55μL |
(2) The procedure of Table 7 was run on a PCR machine to obtain the digestion product.
TABLE 7 primer digestion procedure
| Phases | Temperature of | Time |
| Holding | 37 | 30min |
| Holding | ||
| 60℃ | 20min | |
| |
4℃ | - |
3. Ligation of sequencing adaptors
(1) Adding the connecting system prepared in the table 8 into the digestion product, uniformly mixing by blowing and sucking, and centrifuging for a short time to collect reaction liquid.
TABLE 8 Joint connection System
| Composition (I) | Volume of |
| Joint illu _ adaptor (Joint prepared in step one) | 2μL |
| DNA Ligase Buffer(NEB) | 3μL |
| T4DNA Ligase(5U/μL，NEB) | 2μL |
| Total volume | 8μL |
(2) The ligation linker product was obtained by running the procedure of Table 9 on a PCR instrument, i.e., the constructed multiplex library was obtained.
TABLE 9 Joint connection procedure
| Temperature of | |
|
| 22℃ | 30min | |
| 72 | 10min | |
| 10℃ | - |
(3) And (3) purifying the connection joint product obtained in the step (2) by adopting a magnetic bead purification method, which comprises the following specific steps:
(3-1) preparation of reagents
A. Taking the Agencour AMPure XP Beads out of the furnace in advance from 4 ℃, balancing the materials at room temperature for 30min, and shaking and mixing the materials uniformly for later use; a2.0 mL plate was used and the beads were dispensed in 54. mu.L/well according to the sample size.
B. 80% ethanol was prepared in 400. mu.L of each sample.
(3-2) to a 2.0mL shallow well plate containing 54. mu.L of magnetic beads, the reaction product was added, pipetted and mixed well, and allowed to stand at room temperature for 5 min.
(3-3) placing the shallow-hole plate on a 24-head magnetic frame, and standing until the liquid is clear.
(3-4) aspirating the liquid in the plate using a pipette.
(3-5) adding 200. mu.L of 80% ethanol into each well, and standing on a magnetic frame at room temperature until the liquid is clear. The supernatant was aspirated.
(3-6) repeating the step (3-5), and completely sucking the ethanol.
(3-7) adding 25 mu L of clean-free Water into the shallow-hole plate, uniformly mixing by blowing, and standing for 2min at room temperature for later use.
(3-8) placing the shallow-hole plate on a 24-head magnetic frame, and standing for 5min until the liquid is clear.
(3-9) transfer 23. mu.L of the clarified solution obtained in step (3-8) to a new 1.5mL centrifuge tube with the library number and date marked on the tube cover for use.
4. Add sample library sequencing index
(1) PCR reaction systems were prepared as shown in Table 10.
TABLE 10 preparation of PCR reaction mixtures
| Composition (I) | Volume of |
| 2×KAPA HiFi HotStart ReadyMix(KAPA Biosystems) | 25μL |
| Adaptor1primer(10μM) | 1μL |
| Adaptor2_index primer(10μM) | 1μL |
Adaptor1primer：
CAAGCAGAAGACGGCATATAGCCTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT；
Adaptor2_index primer：
AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATCT；
Wherein XXXXX is sequencing index.
(2) The products (3-9) were added to the above PCR reaction system and subjected to the amplification procedure of Table 11.
TABLE 11 PCR amplification procedure
(3) Purifying the amplification product obtained in the step (2) by using a magnetic bead purification method
(3-1) preparation of reagents
A. Taking the Agencour AMPure XP Beads out of the furnace in advance from 4 ℃, balancing the materials at room temperature for 30min, and shaking and mixing the materials uniformly for later use; a2.0 mL shallow well plate was taken.
B. 80% ethanol was prepared in 400. mu.L of each sample.
(3-2) uniformly blowing and stirring the reaction product, transferring the reaction product into a 2.0mL shallow-hole plate, placing the shallow-hole plate on a 24-head magnetic frame, and standing until the liquid is clear.
(3-3) pipette the liquid from the plate into a new 2.0mL shallow well plate using a pipette.
(3-4) to a 2.0mL shallow well plate containing 45. mu.L of the reaction product, 72. mu.L of the magnetic beads were added, pipetted and mixed well, and allowed to stand at room temperature for 5 min.
(3-5) placing the shallow-hole plate on a 24-head magnetic frame, and standing until the liquid is clear.
(3-6) aspirating the liquid in the plate using a pipette.
(3-7) adding 200. mu.L of 80% ethanol into each well, and standing on a magnetic frame at room temperature until the liquid is clear. The supernatant was aspirated.
(3-8) repeating the step (3-7), and completely sucking the ethanol.
(3-9) to the shallow well plate, 23. mu.L of nucleic-free Water was added, and the mixture was vortexed, and allowed to stand at room temperature for 2 min.
(3-10) placing the shallow-hole plate on a 24-head magnetic frame, and standing for 5min until the liquid is clear.
(3-11) transfer 21. mu.L of the clarified solution obtained in step (3-10) to a new 1.5mL centrifuge tube whose lid has been marked with the library number and date of construction.
5. Library quality inspection
And (3) accurately quantifying the purified product obtained in the step (4) by using a Qubit2.0DNA detection kit, and qualitatively analyzing the purified product obtained in the step (4) by using an Agilent 2100Bioanalyzer and an Agilent 2100HS kit.
The results are shown in FIG. 3. As can be seen from the figure: the size of the library fragment is between 200 and 300bp, and no adapter pollution exists. And the quality inspection requirement of the library is met.
6. Library sequencing and sequencing result analysis
Libraries of different barcodes were mixed in equal amounts and sequenced using the illumina sequencing platform PE150bp, with each library sequencing depth of 50000X.
The results are shown in FIG. 4. As can be seen from the figure: the sequencing quality of the library constructed by the method is greatly improved compared with that of an amplification product of a commercial kit in an ion torrent semiconductor sequencing. Data analysis and quality control show that the rate of the sequencing data Q >30 is 94.24-94.76%, the average rate is 94.38%, the uniformity is 92.58-96.09%, and the average rate is 94.87%.
Example 2 comparison of the fidelity of the amplification library building System of the present invention and Ampliseq kit
The method comprises the steps of respectively taking cfDNA quality control products with mutation frequencies of 5%, 1% and 0.5% (the cfDNA quality control products with the mutation frequencies of 5% and 1% are purchased from the horizons Discovery company in America, and the cfDNA quality control products with the mutation frequencies of 0.5% are prepared by mixing the cfDNA quality control products with the mutation frequencies of 0% and 1% purchased from the horizons Discovery company in a mass ratio of 1: 1) as samples to be tested, respectively adopting an amplification library building system and an Ampliseq kit to carry out amplification and library building, and comparing the fidelity of the two methods. The method comprises the following specific steps:
1. construction of the library
(1) Amplification library construction method of the invention
The library constructed by the method of the present invention was obtained by amplification and library construction according to the method of step two in example 1.
(2) Amplification and library building method of Ampliseq kit
Amplification and library construction were performed using the Ampliseq kit (purchased from Thermo Fisher Inc.), and the specific steps were performed according to the standard methods described in the specification, to obtain a library constructed with the Ampliseq kit.
2. Library quality inspection
The library constructed by the method and the library constructed by the Ampliseq kit are accurately quantified by utilizing a Qubit2.0DNA detection kit, and the library constructed by the method and the library constructed by the Ampliseq kit are qualitatively analyzed by utilizing an Agilent 2100Bioanalyzer and an Agilent 2100HS kit.
The results are shown in FIG. 5. As can be seen from the figure: the sizes of the fragments of the library constructed by the method and the library constructed by the Ampliseq kit are both between 200-300bp, and the adapter pollution is avoided. And the quality inspection requirement of the library is met.
3. Library sequencing and sequencing result analysis
(1) Sequencing
Libraries of different barcodes were mixed in equal amounts and sequenced using the illumina sequencing platform PE150bp, with each library sequencing depth of 50000X.
The results show that: the rate of the sequencing data Q >30 of the library constructed by the method is 99.38-99.41%, the average rate is 99.40%, the uniformity is 90.82-92.75%, and the average rate is 91.62%. The rate of the sequencing data Q >30 of the library constructed by the Ampliseq kit is 99.37-99.38%, the average rate is 99.38%, the uniformity is 95.65-96.62%, and the average rate is 96.14%. It is demonstrated that the uniformity of the library constructed using the amplified library-building system of the present invention is comparable to the Ampliseq kit, and that the Q >30 rate is equal to the Ampliseq.
(2) Abrupt frequency detection of background noise
Taking a quality control product with mutation frequency of 5% as an example, the amplification backgrounds of the two are selected and compared by a nuclear density map.
The results are shown in FIG. 6. Wherein orange represents Ampliseq kit and blue represents the amplification pooling system of the present invention. As can be seen from the figure: the mutation frequency of the background noise of the Ampliseq amplification kit is higher than that of the amplification library construction system of the invention. Compared with the Ampliseq kit, the background noise mutation frequency of the amplification and library building system is lower, so that the sequencing background error is reduced, and the accuracy of the sequencing result is improved.
(3) Detection of mutation
The results of analysis of the detection of mutations are shown in Table 12. When the threshold of the mutation frequency to be detected was set at 0.01 to 0.15, the results showed that: the correct detection rate of the amplification library construction system is closer to that of an Ampliseq kit, but the correct detection rate of the amplification library construction system for high-frequency mutation of 5% is higher.
In conclusion, the amplification and library construction system developed by the invention has the detection condition of mutation sites close to or even better than that of the Ampliseq kit. And the fidelity is higher, so that the replication errors introduced in the amplification process are less, and the kit also has greater advantage in the field of detecting low-frequency mutation compared with an Ampliseq kit.
TABLE 12 mutation detection results
Example 3 multiplex amplification and banking methods at Single cell level
In the embodiment, amplification and library building are carried out by taking gDNA at a single cell level of 12pg as an initial template (the preparation method of the gDNA at the single cell level is that fragmented human genome gDNA is fragmented by an ultrasonic disruptor to obtain fragmented human genome gDNA which is about 200bp on average, and then the fragmented human genome gDNA is subjected to gradient dilution to obtain the gDNA at the single cell level), and the amplification performance of the amplification and library building system on a picogram-level sample is detected. The method comprises the following specific steps:
1. multiplex amplification of single cell level DNA
(1) The amplification reaction system was prepared as shown in Table 4, and the mixture was aspirated and mixed, centrifuged briefly to collect the liquid.
(2) Place on the PCR machine and run the program of Table 5. After the procedure was completed, the reaction solution was collected by brief centrifugation to obtain an amplification product.
2. Digestion of primers
Same as 2 of step two of example 1.
3. Ligation of sequencing adaptors
Same as step two, step 3 of example 1.
4. Add sample library sequencing index
Same as in step two of example 1, step 4.
5. Library electrophoretic detection
And (4) carrying out electrophoretic detection on the library constructed in the step (3).
The results are shown in FIG. 7. As can be seen from the figure: the size of the library fragment is about 150-200bp and is basically consistent with the size of the amplified fragment with the initial amount of 10ng, which indicates that the DNA sample with the initial amount of 12pg can be effectively amplified.
6. Library quality inspection
The library was quantified accurately using the Qubit2.0DNA detection kit and qualitatively analyzed using the Agilent 2100Bioanalyzer using the Agilent 2100HS kit.
The results are shown in FIG. 8. As can be seen from the figure: the size of the library fragment is between 200 and 300bp, and no adapter pollution exists. And the quality inspection requirement of the library is met.
7. Library sequencing and sequencing result analysis
Libraries of different barcodes were mixed in equal amounts and sequenced using the illumina sequencing platform PE150bp, with each library sequencing depth of 50000X.
The results show that: the rate of the sequencing data Q >30 of the library constructed by the method is 94.61-94.76%, the average rate is 94.68%, and the coverage degree basically reaches 100%.
Example 4 multiplex amplification and library construction methods based on ion torrent linker
Multiplex amplification and pooling was performed on 10ng of commercial quality control Multiplex I cfDNA Reference Standard Set (horizons, USA) based on ion tordant adaptors. The method comprises the following specific steps:
1. multiplex amplification and primer digestion of cfDNA
The steps of multiplex amplification and primer digestion of cfDNA were performed as in 1 and 2 of example 1, step two.
2. Connection of ion torrent joint
Using KAPA Library Preparation Kit Ion TorrentTMThe primer-digested system (digested product) was ligated with a platfoms kit (purchased from KAPA Co.) using a KAPA Adapter kit Ion TorrentTMThe specific procedures of the platform linker (purchased from KAPA) were performed according to the standard method described in the specification to obtain a library of ligation ion torrent linkers.
3. Library quality control
The library of the connection ion torrent joint constructed by the method is accurately quantified by utilizing a Qubit2.0DNA detection kit, and is qualitatively analyzed by utilizing an Agilent 2100Bioanalyzer and an Agilent 2100HS kit.
The results are shown in FIG. 9. As can be seen from the figure: the size of the library fragment is between 150-300bp, and no adapter pollution exists. And the quality inspection requirement of the library is met. Illustrating that the multiplex amplification and library construction method of the present invention is compatible with the ion torrent linker ligation system.
Example 5 comparison of amplification Effect of different multiplex amplification systems
10ng of a commercial quality control Multiplex I cfDNA Reference Standard Set (horizons, USA) was subjected to Multiplex amplification using the Multiplex amplification system and Ampliseq kit of the present invention. The method comprises the following specific steps:
first, the multiplex amplification system of the present invention performs multiplex amplification
1. Respectively configuring amplification reaction systems according to tables 13-16 (the PCR buffers in each system are respectively matched with respective DNA polymerases), blowing, sucking, mixing uniformly, and centrifuging for a short time to collect liquid.
TABLE 13 amplification reaction System configuration
(the amplification reaction system contained 0.5U of KAPA HiFi HotStart DNA Polymerase)
TABLE 14 amplification reaction System configuration
(the amplification reaction system contained 0.5U of KAPA2G Robust DNA Polymerase)
TABLE 15 amplification reaction System configuration
(the amplification reaction system contained 1.25U of Pfu Turbo DNA Polymerase)
TABLE 16 amplification reaction System configuration
(amplification reaction system contained 1.25U of KOD DNA polymerase)
2. Each amplification system was placed on a PCR instrument and the procedure of Table 5 was run. After the procedure was completed, the reaction solution was collected by brief centrifugation to obtain amplification products, respectively.
Second, Ampliseq kit is used for multiple amplification
Amplification was performed using an Ampliseq kit (purchased from Thermo Fisher Co., Ltd.) and the specific steps were performed according to the standard method described in the specification to obtain an Ampliseq kit amplification product.
The amplification products obtained in the first and second steps were collected and subjected to quality inspection by DNA electrophoresis, and the results of the quality inspection are shown in FIG. 10. As can be seen from the figure: the target fragments can be successfully amplified by four enzymes, namely KAPA HiFi HotStart DNA Polymerase, KAPA2G Robust DNA Polymerase, Pfu Turbo DNA Polymerase and KOD DNA Polymerase, and the size of the fragments is between 100bp and 250 bp.
Example 6 comparison of the primer digestion Effect of different primer digestion enzyme systems
One, multiple amplification
Multiplex amplification was carried out according to the method in step two 1 of example 1 to obtain an amplification product.
Secondly, digestion of the primers
1. Adding the amplification products in the step one into primer digestion systems shown in tables 17-19 respectively.
TABLE 17 primer digestion System configuration
| Composition (I) | Volume of |
| UDG enzyme (1U/. mu.L, NEB) | 0.6μL |
| Fpg(8U/μL，NEB) | 0.35μL |
| Exo I(20U/μL，Thermo) | 0.6μL |
| Total volume | 1.55μL |
TABLE 18 primer digestion System configuration
| Composition (I) | Volume of |
| UDG enzyme (1U/. mu.L, NEB) | 0.6μL |
| Fpg(8U/μL，NEB) | 0.35μL |
| Klenow Fragment(5U/μL，NEB) | 0.6μL |
| Total volume | 1.55μL |
TABLE 19 primer digestion System configuration
| Composition (I) | Volume of |
| UDG enzyme (1U/. mu.L, NEB) | 0.6μL |
| Exo I(20U/μL，Thermo) | 0.6μL |
| Fpg(8U/μL，NEB) | 0.35μL |
| Klenow Fragment(5U/μL，NEB) | 0.6μL |
| Total volume | 2.15μL |
2. The procedure of table 7 was run with each digestion system placed on a PCR instrument to obtain the digestion products.
Secondly, digesting the primers by an Ampliseq kit
Primer digestion was performed using an amplieq kit (purchased from Thermo Fisher) according to the standard protocol in the specification to obtain Ampliseq primer digestion products.
The digestion products obtained in the first step and the second step are collected respectively, and the quality test results are shown in FIG. 11 (lane 1 is the undigested amplification product, lane 2 is the digestion product of Ampliseq kit, lane 3 is the digestion combination of UDG + Fpg + Exo I primers, lane 4 is the digestion combination of UDG + Fpg + klenow fragment primers, and lane 5 is the digestion combination of UDG + Fpg + Exo I + klenow fragment primers). As can be seen from the figure: the digestion combination of the three primers can successfully digest the primers, and the size of the digested fragment is between 100bp and 200 bp.
Sequence listing
<110> Boao bionts Ltd
<120> multiple amplification and library building method for trace DNA and special kit thereof
<160>3
<170>PatentIn version 3.5
<210>1
<211>33
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
taatacactc tttccctaca cgacgctctt ccgatct 37
<210>2
<211>34
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
gcctg tgactggagt tcagacgtgt gctcttccga tct 34
<210>3
<211>13
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
agatcggaag agc 13
Claims (3)
1.A method for creating a library of a trace DNA library comprises the following steps:
1) adding the DNA sample into a multiple amplification system for multiple PCR amplification to obtain multiple amplification products;
2) adding a primer digestion system into the multiple amplification products for digestion reaction to obtain digestion products;
3) adding a linker connecting system into the digestion product to carry out linker connecting reaction to obtain a connecting linker product, namely the constructed library;
in the step 1), the multiplex amplification system comprises at least one of KAPA HiFi HotStart DNA polymerase, KAPA2G Robust DNA polymerase, Pfu Turbo DNA polymerase and KOD DNA polymerase, 2 × Ion AmpliSeq ™ Primer Pool and 1 × PCR buffer system; the concentration of the KAPA HiFi HotStart DNA polymerase in the multiplex amplification system is 0.01-0.2U/mu L; the concentration of the KAPA2G Robust DNA polymerase in the multiplex amplification system is 0.01-0.2U/mu L; the concentration of the Pfu Turbo DNA polymerase in the multiplex amplification system is 0.01-0.2U/mu L; the concentration of the KOD DNA polymerase in the multiplex amplification system is 0.01-0.2U/mu L;
in the 2), the primer digestion system consists of at least one of exonuclease I and Klenow fragment; the concentration of the exonuclease I in the primer digestion system is 0.2-2U/mu L; the concentration of the Klenow fragment in the primer digestion system is 0.2-4U/mu L;
in the step 3), the joint connection system consists of a sequencing joint solution, T4DNA Ligase and 1 XDNA Ligase buffer solution; the concentration of the T4DNA Ligase in the adaptor connection system is 0.5-3U/mu L; the sequencing joint consists of a joint A and a joint B; the concentrations of the first linker and the second linker in the sequencing linker solution are both 10-50 mu M;
the adaptor A is obtained by annealing a single-stranded DNA molecule adoligo1 and a single-stranded DNA molecule adoligo 3; the single-stranded DNA molecule adoligo3 and the 3' end of the single-stranded DNA molecule adoligo1 are in reverse complementary pairing to form a double-stranded structure;
the adaptor B is obtained by annealing the single-stranded DNA molecule adoligo2 and the single-stranded DNA molecule adoligo 3; the single-stranded DNA molecule adoligo3 and the 3' end of the single-stranded DNA molecule adoligo2 are in reverse complementary pairing to form a double-stranded structure;
the single-stranded DNA molecule adoligo1 differs in sequence from the 5' end of the single-stranded DNA molecule adoligo 2;
the joint A and the joint B are both flat-end joints;
the nucleotide sequence of the single-stranded DNA molecule adoligo1 is shown as a sequence 1;
the nucleotide sequence of the single-stranded DNA molecule adoligo2 is shown as a sequence 2;
the nucleotide sequence of the single-stranded DNA molecule adoligo3 is shown as a sequence 3;
or, the sequencing linker is an ion torrent linker;
in the step 1), a DNA sample of picogram to microgram grade is added into the multiplex amplification system;
or, the starting amount of the DNA sample is at a single cell level;
in the 1), the reaction conditions for the multiplex PCR amplification are as follows: pre-denaturation at 90-99 ℃ for 1-3 min; denaturation at 90-99 ℃ for 10-30 sec, annealing at 50-60 ℃ for 2-5 min, and 18-35 cycles; keeping at 4-15 ℃;
in the 2), the digestion reaction conditions are as follows: reacting for 10-30 min at 30-50 ℃; reacting for 10-30 min at 50-70 ℃; reacting for 0.5-2 h at 4-15 ℃;
in the step 3), the conditions of the ligation reaction are as follows: reacting for 10-30 min at 10-30 ℃; reacting for 10-30 min at 60-80 ℃; reacting for 0.5-2 h at 4-15 ℃.
2.A method for detecting low-frequency variation of trace DNA comprises the following steps:
(1) performing multiple amplification library building on a trace DNA sample to be detected according to the method of claim 1 to obtain a library to be sequenced;
(2) sequencing the library to be sequenced, and determining the variation condition of the trace DNA sample to be sequenced according to a sequencing result;
the methods are methods for non-disease diagnostic and therapeutic purposes.
3. The method of claim 2, wherein: the platform for sequencing can be an Illumina sequencing platform or an ion torrent sequencing platform.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810840309.XA CN108929901B (en) | 2018-07-27 | 2018-07-27 | Multiple amplification library building method for trace DNA and special kit thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810840309.XA CN108929901B (en) | 2018-07-27 | 2018-07-27 | Multiple amplification library building method for trace DNA and special kit thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108929901A CN108929901A (en) | 2018-12-04 |
| CN108929901B true CN108929901B (en) | 2022-02-01 |
Family
ID=64445052
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810840309.XA Active CN108929901B (en) | 2018-07-27 | 2018-07-27 | Multiple amplification library building method for trace DNA and special kit thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108929901B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110117574B (en) * | 2019-05-15 | 2021-03-23 | 常州桐树生物科技有限公司 | Method and kit for enriching circulating tumor DNA based on multiple PCR |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104562213A (en) * | 2014-12-26 | 2015-04-29 | 北京诺禾致源生物信息科技有限公司 | Amplification sublibrary and construction method thereof |
| CN107058310A (en) * | 2016-08-12 | 2017-08-18 | 艾吉泰康生物科技(北京)有限公司 | A kind of amplicon library constructing method for improving gene low frequency abrupt climatic change sensitivity |
| CN108149326A (en) * | 2018-03-01 | 2018-06-12 | 北京创新乐土生物科技有限公司 | A kind of high throughput library construction Kit and its application |
-
2018
- 2018-07-27 CN CN201810840309.XA patent/CN108929901B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104562213A (en) * | 2014-12-26 | 2015-04-29 | 北京诺禾致源生物信息科技有限公司 | Amplification sublibrary and construction method thereof |
| CN107058310A (en) * | 2016-08-12 | 2017-08-18 | 艾吉泰康生物科技(北京)有限公司 | A kind of amplicon library constructing method for improving gene low frequency abrupt climatic change sensitivity |
| CN108149326A (en) * | 2018-03-01 | 2018-06-12 | 北京创新乐土生物科技有限公司 | A kind of high throughput library construction Kit and its application |
Non-Patent Citations (1)
| Title |
|---|
| Aptamer selection by high-throughput sequencing and informatic analysis;Shawn Hoon等;《Bio Techniques》;20111231;第51卷(第6期);第413-416页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108929901A (en) | 2018-12-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108300716B (en) | Linker element, application thereof and method for constructing targeted sequencing library based on asymmetric multiplex PCR | |
| KR102475710B1 (en) | Single-cell whole-genome libraries and combinatorial indexing methods for their preparation | |
| Khodakov et al. | Diagnostics based on nucleic acid sequence variant profiling: PCR, hybridization, and NGS approaches | |
| JP7379418B2 (en) | Deep sequencing profiling of tumors | |
| CN105603535B (en) | Construct the kit and method of DNA library | |
| WO2012068919A1 (en) | Dna library and preparation method thereof, and method and device for detecting snps | |
| WO2018184495A1 (en) | Method for constructing amplicon library through one-step process | |
| CN107475779A (en) | Library method for building up and its application suitable for unicellular RRBS sequencings | |
| CN111041069B (en) | High-throughput sequencing library construction method for low-initial-quantity DNA sample and application thereof | |
| CN109686404B (en) | Method and device for detecting sample confusion | |
| CN110791813B (en) | Method for processing single-stranded DNA and application thereof | |
| CN108929901B (en) | Multiple amplification library building method for trace DNA and special kit thereof | |
| US11827929B2 (en) | Optimized clinical sample sequencing | |
| CN116463408A (en) | ABO gene amplification primer, amplification system, amplification method, sequencing library construction method and sequencing method | |
| CN113215663B (en) | Construction method of gastric cancer targeted therapy genome library based on high-throughput sequencing and primers | |
| CN114277114A (en) | Method for adding unique identifier in amplicon sequencing and application | |
| CN114317751A (en) | Probe library for detecting tumor marker of urinary system, gene chip and kit thereof | |
| CN107904297B (en) | Primer group, joint group and sequencing method for microbial diversity research | |
| WO2020252749A1 (en) | Method and use for construction of sequencing library based on dna samples | |
| CN111793623A (en) | Typing genetic marker composition, kit, identification system and typing method of 62 multi-allelic SNP-NGS | |
| CN104630372A (en) | Building method of high-throughput sequencing library | |
| CN114774514B (en) | Library construction method and kit suitable for high-throughput targeted genome methylation detection | |
| CN112080566B (en) | Thyroid cancer detection product based on high-throughput sequencing method and application | |
| CN112410406A (en) | Method for determining amplification cycle number of library | |
| CN117467740A (en) | Multi-sample multi-site DNA methylation detection method and kit with unique molecular tag |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |