CN107012173A - A kind of recombined lentivirus vector and its preparation method and application - Google Patents
A kind of recombined lentivirus vector and its preparation method and application Download PDFInfo
- Publication number
- CN107012173A CN107012173A CN201710330912.9A CN201710330912A CN107012173A CN 107012173 A CN107012173 A CN 107012173A CN 201710330912 A CN201710330912 A CN 201710330912A CN 107012173 A CN107012173 A CN 107012173A
- Authority
- CN
- China
- Prior art keywords
- lentivirus vector
- recombined lentivirus
- pcdh
- carrier
- signal peptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/70—Vectors containing special elements for cloning, e.g. topoisomerase, adaptor sites
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention belongs to biological technical field, more particularly to a kind of recombined lentivirus vector and its preparation method and application, the recombined lentivirus vector is using slow virus carrier pCDH CMV MCS EF1 copGFP T2A Puro as skeleton, inserted with signal peptide sequence S and His label.Recombined lentivirus vector transfection cost prepared by the present invention is substantially reduced, and efficiency of infection is high, and can filter out overexpression stable cell line, secreting, expressing destination protein, protein yield can be greatly improved, effectively reduction foreign protein ratio, introduce detection and purifying that His labels are conducive to expressing protein.
Description
Technical field
The invention belongs to biological technical field, more particularly to a kind of recombined lentivirus vector and its preparation method and application.
Background technology
Lentivirus Retroviridae, is RNA virus.Slow virus refers to human immunodeficiency virus-1 (H IV-1)
A kind of viral vector in source, slow virus carrier contains the hereditary information required for packaging, transfection, stable integration, is slow disease
The chief component of poisonous carrier system.
Slow virus carrier system is mainly made up of three kinds of different plasmids, is transferring plasmid, helper plasmid and coating respectively
Expression plasmid.Transferring plasmid is primarily used to insert external source target gene, while also remaining the integration to virus has replicated master
The element to be acted on.Helper plasmid mainly includes gag, pol and rev albumen, and gag is mainly the core protein of coding virus, pol
Then in main code virus replication required for enzyme, and rev albumen then participates in encoding HIV structural proteins mRNA core-slurry
Transport process.
Signal peptide refers to 15~30 amino acid of secretory protein precursor N- ends, has its specific in polypeptide chain synthesis
Effect.The function of signal peptide, which is mainly, makes the ribosomes translated be attached on RER films, guides protein to transport in the cell
It is defeated.The signal peptide that research is used at present come the signal sequence of self-formulating system itself or exogenous signals sequence, or both it is simultaneous and have
It.
The content of the invention
Present invention aim to address above-mentioned the deficiencies in the prior art, there is provided a kind of recombined lentivirus vector and its preparation side
Method and application.
The present invention is achieved by the following technical solutions：
A kind of recombined lentivirus vector, the recombined lentivirus vector is with slow virus carrier pCDH-CMV-MCS-EF1-
CopGFP-T2A-Puro is skeleton, inserted with signal peptide sequence S.
Preferably, the signal peptide sequence S is that two complementary oligonucleotide chains with XbaI and EcoRI restriction enzyme sites are moved back
Fire is formed, and sequence is as shown in SEQ ID NO.1,2.
Preferably, the recombined lentivirus vector also includes His labels.
A kind of described recombined lentivirus vector is prepared, is comprised the following steps：
(1) carrier pCDH-CMV-MCS-EF1-copGFP-T2A-Puro is subjected to XbaI and EcoRI double digestions, reclaimed
Carrier framework part；
(2) the signal peptide sequence S with XbaI and EcoRI cohesive ends is designed and synthesized；
(3) carrier framework part is attached with ligase with signal peptide sequence S, obtains recombined lentivirus vector.
Another recombined lentivirus vector is prepared, is comprised the following steps：
(1) carrier pCDH-CMV-MCS-EF1-copGFP-T2A-Puro is subjected to XbaI and EcoRI double digestions, reclaimed
Carrier framework part；
(2) the signal peptide sequence S with XbaI and EcoRI cohesive ends is designed and synthesized；
(3) carrier framework part is attached with ligase with signal peptide sequence S, obtains recombinant vector, be named as
pCDH-S；
(4) to design sense primer at recombinant vector pCDH-S NotI restriction enzyme sites, 6 × His labels and termination are introduced
Codon, to design anti-sense primer at PstI restriction enzyme sites, using recombinant vector pCDH-S as template, is contained by PCR reactions
The PCR primer of His labels；
(5) PCR primer of the label containing His is connected structure after NotI and PstI double digestions respectively with recombinant vector pCDH-S
Build recombined lentivirus vector pCDH-S-His.
A kind of preparation method of recombined lentivirus vector according to claim 6, it is characterised in that：Step (4) institute
The primer sequence stated is as shown in SEQ ID NO.3,4.
The present invention also protects application of the described recombined lentivirus vector in the protein stabilized cell line of secreting, expressing is built.
Preferably, the albumen behaviour placenta growth factor (PLGF), people's pigment epidermal derived factors (PEDF) or into fibre
Tie up growth factor receptors (FGFR1-1 α).
The beneficial effects of the present invention are：
1) the method expressing protein of existing plasmid transfection eukaryotic is, it is necessary to large quantity extracting plasmid and culture cell, work
Measuring greatly, and extract albumen needs to purify after cell lysis, yields poorly, foreign protein is more, purity is low.Utilize this patent band signal peptide
Slow virus carrier and helper plasmid 293T cells are transfected by PEI and are packaged into slow virus postoperative infection cell, transfection cost is much
Less than liposome, efficiency of infection is high.And overexpression stable cell line can be filtered out, serum free suspension culture, secretion is carried out
Express express target protein, can greatly improve protein yield, effectively reduction foreign protein ratio.2) original slow virus carrier does not have label,
Expressing protein is unfavorable for purifying, introduces detection and purifying that His labels are conducive to expressing protein.
Brief description of the drawings
Fig. 1 is pCDH-CMV-MCS-EF1-copGFP-T2A-Puro collection of illustrative plates；
Fig. 2 is the vector construction schematic flow sheet of the present invention；
Fig. 3 is that recombinant slow virus of the present invention builds schematic flow sheet；
Fig. 4 is the expression of target protein PLGF in detection cell conditioned medium after recombinant slow virus of the present invention transduction 293T cells.
Embodiment
To be best understood from the present invention, with reference to embodiment and accompanying drawing, the invention will be further described, following examples
Only it is that the present invention will be described rather than it is limited.
The slow virus carrier skeleton of embodiment 1
Skeleton carrier pCDH-CMV-MCS-EF1-copGFP-T2A-Puro collection of illustrative plates is shown in Fig. 1.
Vector construction schematic diagram is shown in Fig. 2.
Skeleton carrier digestion is reclaimed：By plasmid pCDH-CMV-MCS-EF1-copGFP-T2A-Puro carry out XbaI and
EcoRI double digestions, reclaim carrier framework part.
Embodiment 2 inserts signal peptide S sequences
2 oligonucleotide chains are designed and synthesized, sequence is as follows：
It is positive：(5 ' → 3 ') XbaI cohesive ends are carried
CTAGAATGGAGACAGACACACTCCTGCTGTGGGTGCTGCTGCTCTGGG
TCCCAGGCTCCACTGGCGACGGG(SEQ ID NO.1)；
Reversely：(5 ' → 3 ') EcoRI cohesive ends are carried
AATTCCCGTCGCCAGTGGAGCCTGGGACCCAGAGCAGCAGCACCCAC
AGCAGGAGTGTGTCTGTCTCCATA(SEQ ID NO.2)。
By the annealing of above-mentioned two oligonucleotide chains, 16 DEG C of companies are carried out with ligase with the carrier framework part in embodiment 1
Connect, Escherichia coli incubated overnight is converted after 1h, every other day picking monoclonal bacterium colony incubated overnight, extract plasmid and sequence verification, most
Recombinant vector pCDH-S is obtained eventually.
Embodiment 3 is inserted into His labels
Recombinant vector pCDH-S (embodiment 2) NotI and PstI double digestions, reclaim carrier large fragment part.
According to recombinant vector pCDH-S primers, to be designed at recombinant vector pCDH-S NotI restriction enzyme sites
Brigade commander's primer, and comprising 6 × His labels, and terminator codon is added, to design anti-sense primer, primer at PstI restriction enzyme sites
Sequence is as follows：
Sense primer：
5’-TCCGCGGCCGCTCATCATCACCATCACCATTGAGAAGGATCTGCGAT CGCT-3’(SEQ ID
NO.3)；
Anti-sense primer：
5’-TTCTGCAGGATGCTGGGGTGGAT-3’(SEQ ID NO.4)。
Using recombinant vector pCDH-S as template, PCR primer is obtained by PCR reactions.Amplification program is 4 points of pre-degeneration 95 DEG C
Clock, denaturation 95 DEG C 30 seconds, annealing 55 DEG C 30 seconds, extension 72 DEG C 1 minute, period 35, finally extend 72 DEG C 10 minutes.
PCR primer is used after purification, through NotI and PstI double digestions, glue reclaim is run, then the pCDH-S reclaimed with digestion is carried
Body large fragment is attached conversion with ligase, and plasmid and sequence verification are extracted after picking monoclonal bacterium colony culture, final to obtain
Improved recombined lentivirus vector pCDH-S-His.
Improved slow virus carrier pCDH-S-His, with the addition of secreting, expressing signal peptide sequence, it is possible to achieve target egg
The white secreting, expressing in cell, while with the addition of His labels is convenient for protein purification and detection.
The pCDH-S-PLGF-His construction of recombinant plasmid of embodiment 4
Skeleton carrier digestion is reclaimed：Improved recombined lentivirus vector pCDH-S-His is subjected to EcoRI and NotI double
Digestion, reclaims carrier framework part.
Primer amplification Human plactnta growth factor PLGF genes are designed, comprising EcoRI and NotI restriction enzyme sites, primer sequence is such as
Under：
Sense primer：
5’-TTTGAATTCCCTGCCTGCTGTGCCCCCCCA-3’(SEQ ID NO.5)；
Anti-sense primer：
5’-TTTGCGGCCGCGCCTCCGGGGAACAGCAT-3’(SEQ ID NO.6)。
Using human peripheral lymphocyte cDNA as template, PLGF genes are obtained by PCR reactions.Amplification program is pre-degeneration
95 DEG C 4 minutes, denaturation 95 DEG C 30 seconds, annealing 55 DEG C 30 seconds, extension 72 DEG C 40 seconds, period 35, finally extend 72 DEG C 10 points
Clock.
PCR primer is used after purification, through EcoRI and NotI double digestions, glue reclaim, then the pCDH-S- reclaimed with digestion is run
His carrier frameworks part is attached conversion with ligase, and plasmid and sequence verification are extracted after picking monoclonal bacterium colony culture.Most
Recombinant plasmid pCDH-S-PLGF-His is obtained eventually.
The virus packaging of embodiment 5 (schematic diagram is shown in Fig. 3)
Plasmid is carried greatly：Recombinant plasmid pCDH-S-PLGF-His, two helper plasmids pSPAX2 and pMD2.G are carried out big
Carry the plasmid for obtaining high concentration high-purity endotoxin-free.
Cell culture：293T cells are cultivated in conventional manner, and inoculating cell is to 60mm culture dishes, cell number after stable passage
Amount is to cultivate 24 hours up to 85% degree of converging as foundation.
By plasmid pCDH-S-PLGF-His, pSPAX2 and pMD2.G according to 4：3：Totally 8 μ g plasmids are added to 500 μ L to 1 ratio
In PBS, gently mix, while 20 μ g PEI are added in 500 μ L PBS, are vortexed and mix.PEI mixed liquors are added to plasmid again
In, room temperature places 20min after gently mixing；
The culture medium 1mL of 293T cells is first siphoned away, then mixed liquor is added in cell；
Incubated overnight harvests supernatant after liquid, continuation culture 48h are changed after 12h, while adding fresh culture continuation again
Supernatant is harvested after culture 24h.Period is in fluorescence microscopy Microscopic observation cell green fluorescence situation, it is ensured that transfection process is normal, turns
Contaminate efficiency normal.
4 DEG C of 10000g centrifugation 10min after supernatant mixing twice are incited somebody to action, supernatant is collected.
Supernatant is filtered with 0.45 μm of filter.
Dispense virus liquid and cryopreservation.
The viral transduction cell detection protein expression of embodiment 6
Cell is inoculated with：293T cells are cultivated in conventional manner, and are inoculated with a 60mm culture dish.
500 μ L recombinant slow virus are added in 4mL DMEM complete mediums, while it is (final concentration of to add polybrene
8μg/mL)；
60mm culture dish cell conditioned mediums are discarded, above-mentioned mixed liquor, incubated overnight is added；
Liquid is changed every other day, commercialization serum free medium is changed into, is continued to cultivate 48h, is collected cell conditioned medium.
The supernatant of harvest is concentrated with super filter tube.
SDS-PAGE detection target proteins PLGF expression, is shown in Fig. 4, there is obvious protein band, and foreign protein at 25KD
It is few.
The structure of the pCDH-S-PEDF-His recombinant plasmids of embodiment 7
Using recombined lentivirus vector pCDH-S-His as skeleton, skeleton part is reclaimed through EcoRI and NotI double digestions.
Primer amplification PEDF genes are designed, primer sequence is as follows：
Sense primer：
5’-TTTGAATTCTATGCAGGCCCTGGTGCTA-3’(SEQ ID NO.7)；
Anti-sense primer：
5’-TTTGCGGCCGCGGGGCCCCTGGGGTCCAGAA-3’(SEQ ID NO.8)；
Using people cDNA as template, PEDF genes are obtained by PCR reactions.Amplification program is pre-degeneration 95 DEG C 4 minutes, becomes
Property 95 DEG C 30 seconds, annealing 55 DEG C 30 seconds, extension 72 DEG C 20 seconds 1 minute, period 35, finally extend 72 DEG C 10 minutes.
PCR primer is used into EcoRI and NotI double digestions after purification, glue reclaim, then the pCDH-S-His reclaimed with digestion is run
Carrier framework part is attached with ligase, then converts Escherichia coli, and plasmid is extracted after picking monoclonal bacterium colony culture and is surveyed
Sequence is verified.It is final to obtain recombinant plasmid pCDH-S-PEDF-His.
The structure of the pCDH-S-FGFR1-1 α-His recombinant plasmids of embodiment 8
Using recombined lentivirus vector pCDH-S-His as skeleton, skeleton part is reclaimed through BamHI and NotI double digestions.
Primer amplification FGFR1-1 α genes are designed, primer sequence is as follows：
Sense primer：
5’-CGGGATCCTGAGGCCGTCCCCGACCTTGCCTGAAC-3’(SEQ ID NO.9)；
Anti-sense primer：
5’-ATAAGAATGCGGCCGCCGAGGTCATCACTGCCGGCCTC-3’(SEQ ID NO.10)；
Using people cDNA as template, FGFR1-1 α genes are obtained by PCR reactions.Amplification program is pre-degeneration 95 DEG C 4 minutes,
Denaturation 95 DEG C 30 seconds, annealing 55 DEG C 30 seconds, extension 72 DEG C 20 seconds 1 minute, period 35, finally extend 72 DEG C 10 minutes；
PCR primer is used into BamHI and NotI double digestions respectively after purification, glue reclaim, then the pCDH-S- reclaimed with digestion is run
His carrier frameworks part is attached with ligase, then converts Escherichia coli, and plasmid is extracted simultaneously after picking monoclonal bacterium colony culture
Sequence verification.It is final to obtain recombinant plasmid pCDH-S-FGFR1-1 α-His.
The method expressing protein of existing plasmid transfection eukaryotic is, it is necessary to large quantity extracting plasmid and culture cell, workload
Greatly, and extract albumen need after cell lysis purify, yield poorly, foreign protein is more, purity is low.Utilize this patent band signal peptide
Slow virus carrier and helper plasmid transfect 293T cells by PEI and are packaged into slow virus postoperative infection cell, and transfection cost is much low
In liposome, efficiency of infection is high.And overexpression stable cell line can be filtered out, serum free suspension culture is carried out, table is secreted
Up to destination protein, protein yield can be greatly improved, effectively reduction foreign protein ratio.In addition, original slow virus carrier does not have label,
Expressing protein is unfavorable for purifying, introduces detection and purifying that His labels are conducive to expressing protein.
Embodiment described above is only that the preferred embodiment of the present invention is described, not to the model of the present invention
Enclose and be defined, on the premise of design spirit of the present invention is not departed from, technical side of the those of ordinary skill in the art to the present invention
In various modifications and improvement that case is made, the protection domain that claims of the present invention determination all should be fallen into.
SEQUENCE LISTING
<110>Hefei Zhi En Bioisystech Co., Ltd
<120>A kind of recombined lentivirus vector and its preparation method and application
<130> 1
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 71
<212> DNA
<213>It is artificial synthesized
<400> 1
ctagaatgga gacagacaca ctcctgctgt gggtgctgct gctctgggtc ccaggctcca 60
ctggcgacgg g 71
<210> 2
<211> 71
<212> DNA
<213>It is artificial synthesized
<400> 2
aattcccgtc gccagtggag cctgggaccc agagcagcag cacccacagc aggagtgtgt 60
ctgtctccat a 71
<210> 3
<211> 51
<212> DNA
<213>It is artificial synthesized
<400> 3
tccgcggccg ctcatcatca ccatcaccat tgagaaggat ctgcgatcgc t 51
<210> 4
<211> 23
<212> DNA
<213>It is artificial synthesized
<400> 4
ttctgcagga tgctggggtg gat 23
<210> 5
<211> 30
<212> DNA
<213>It is artificial synthesized
<400> 5
tttgaattcc ctgcctgctg tgccccccca 30
<210> 6
<211> 29
<212> DNA
<213>It is artificial synthesized
<400> 6
tttgcggccg cgcctccggg gaacagcat 29
<210> 7
<211> 28
<212> DNA
<213>It is artificial synthesized
<400> 7
tttgaattct atgcaggccc tggtgcta 28
<210> 8
<211> 31
<212> DNA
<213>It is artificial synthesized
<400> 8
tttgcggccg cggggcccct ggggtccaga a 31
<210> 9
<211> 35
<212> DNA
<213>It is artificial synthesized
<400> 9
cgggatcctg aggccgtccc cgaccttgcc tgaac 35
<210> 10
<211> 38
<212> DNA
<213>It is artificial synthesized
<400> 10
ataagaatgc ggccgccgag gtcatcactg ccggcctc 38
Claims (9)
1. a kind of recombined lentivirus vector, it is characterised in that：The recombined lentivirus vector is with slow virus carrier pCDH-CMV-
MCS-EF1-copGFP-T2A-Puro is skeleton, inserted with signal peptide sequence S.
2. a kind of recombined lentivirus vector according to claim 1, it is characterised in that：The signal peptide sequence S is two
Complementary oligonucleotide chain annealing with XbaI and EcoRI restriction enzyme sites is formed, and sequence is as shown in SEQ ID NO.1,2.
3. a kind of recombined lentivirus vector according to claim 1, it is characterised in that：The recombined lentivirus vector is also wrapped
Label containing His.
4. a kind of recombined lentivirus vector according to claim 2, it is characterised in that：The recombined lentivirus vector is also wrapped
Label containing His.
5. prepare a kind of recombined lentivirus vector described in claim 1 or 2, it is characterised in that comprise the following steps：
(1) carrier pCDH-CMV-MCS-EF1-copGFP-T2A-Puro is subjected to XbaI and EcoRI double digestions, reclaims carrier bone
Frame part；
(2) the signal peptide sequence S with XbaI and EcoRI cohesive ends is designed and synthesized；
(3) carrier framework part is attached with ligase with signal peptide sequence S, obtains recombined lentivirus vector.
6. prepare a kind of recombined lentivirus vector described in claim 3 or 4, it is characterised in that comprise the following steps：
(1) carrier pCDH-CMV-MCS-EF1-copGFP-T2A-Puro is subjected to XbaI and EcoRI double digestions, reclaims carrier bone
Frame part；
(2) the signal peptide sequence S with XbaI and EcoRI cohesive ends is designed and synthesized；
(3) carrier framework part is attached with ligase with signal peptide sequence S, obtains recombinant vector, be named as pCDH-S；
(4) to design sense primer at recombinant vector pCDH-S NotI restriction enzyme sites, 6 × His labels and termination codon are introduced
Son, to design anti-sense primer at PstI restriction enzyme sites, using recombinant vector pCDH-S as template, is obtained containing His marks by PCR reactions
The PCR primer of label；
(5) PCR primer of the label containing His is connected structure weight after NotI and PstI double digestions respectively with recombinant vector pCDH-S
Group slow virus carrier pCDH-S-His.
7. a kind of preparation method of recombined lentivirus vector according to claim 6, it is characterised in that：Step (4) is described
Primer sequence as shown in SEQ ID NO.3,4.
8. the recombined lentivirus vector described in any one of Claims 1 to 4 is in the protein stabilized cell line of secreting, expressing is built
Using.
9. application of the recombined lentivirus vector according to claim 8 in the protein stabilized cell line of secreting, expressing is built,
It is characterized in that：The albumen behaviour placenta growth factor, people's pigment epidermal derived factors or fibroblast growth factor receptor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710330912.9A CN107012173A (en) | 2017-05-11 | 2017-05-11 | A kind of recombined lentivirus vector and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710330912.9A CN107012173A (en) | 2017-05-11 | 2017-05-11 | A kind of recombined lentivirus vector and its preparation method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107012173A true CN107012173A (en) | 2017-08-04 |
Family
ID=59449098
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710330912.9A Pending CN107012173A (en) | 2017-05-11 | 2017-05-11 | A kind of recombined lentivirus vector and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107012173A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109439688A (en) * | 2018-12-04 | 2019-03-08 | 华南农业大学 | A kind of recombined lentivirus vector, recombinant slow virus and its application |
| CN110734930A (en) * | 2019-06-20 | 2020-01-31 | 武汉百翼生物科技有限公司 | recombinant lentivirus vectors and recombinant lentiviruses |
| CN114480503A (en) * | 2021-12-20 | 2022-05-13 | 北京镁伽科技有限公司 | Gene overexpression lentivirus plasmid library marked by DNA label and preparation method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103951735A (en) * | 2014-04-23 | 2014-07-30 | 南方医科大学 | Hepatitis C virus (HCV) non-structural protein NS3 antigen efficiently expressed by lentiviral expression system |
-
2017
- 2017-05-11 CN CN201710330912.9A patent/CN107012173A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103951735A (en) * | 2014-04-23 | 2014-07-30 | 南方医科大学 | Hepatitis C virus (HCV) non-structural protein NS3 antigen efficiently expressed by lentiviral expression system |
Non-Patent Citations (3)
| Title |
|---|
| 张宏鹏 等: ""聚乙烯亚胺提升慢病毒滴度的研究"", 《南京农业大学学报》 * |
| 段朝军 等 编著: "《分子生物学与蛋白质组学实验技术》", 31 January 2010 * |
| 贾中发 等: ""Pura基因过表达和RNAi慢病毒载体的构建及应用"", 《宁夏医科大学学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109439688A (en) * | 2018-12-04 | 2019-03-08 | 华南农业大学 | A kind of recombined lentivirus vector, recombinant slow virus and its application |
| CN110734930A (en) * | 2019-06-20 | 2020-01-31 | 武汉百翼生物科技有限公司 | recombinant lentivirus vectors and recombinant lentiviruses |
| CN114480503A (en) * | 2021-12-20 | 2022-05-13 | 北京镁伽科技有限公司 | Gene overexpression lentivirus plasmid library marked by DNA label and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107043786A (en) | A kind of stable cell line construction method of secreting, expressing albumen | |
| AU690667B2 (en) | Enhanced virus-mediated DNA transfer | |
| CN109714962A (en) | System and method for cultivating cell in vitro | |
| CN107012173A (en) | A kind of recombined lentivirus vector and its preparation method and application | |
| CN102272296B (en) | Gene encoding human glucokinase mutant, enzyme encoded by the same, recombinant vectors and hosts, pharmaceutical compositions and uses thereof, methods for treating and preventing diseases | |
| CN111393531A (en) | Subunit fusion protein CD2V-Fc and preparation method and application thereof | |
| CN102295695B (en) | Recombinant human follicle stimulating hormone and preparation thereof | |
| CN109971787A (en) | A kind of CYBB slow virus carrier, stem cell of slow virus carrier transfection and its preparation method and application | |
| CN112410376A (en) | Construction method of functional exosome for efficiently loading specific miRNA | |
| CN111139222B (en) | Recombinant mesenchymal stem cell and preparation method and application thereof | |
| CN111217903A (en) | Recombinant human fibronectin III 1-C and preparation method and application thereof | |
| CN113106098B (en) | Recombinant sequence for specifically expressing human beta globin in erythroid cells and application thereof | |
| CN110760480A (en) | Anti-tumor NK (Natural killer) cell and preparation method thereof | |
| JP7228523B2 (en) | Vectors and compositions for treating hemoglobinopathies | |
| CN111378017B (en) | Subunit F protein of peste des petits ruminants virus and preparation method and application thereof | |
| CN110734930A (en) | recombinant lentivirus vectors and recombinant lentiviruses | |
| CN116218906A (en) | RNA editor expression plasmid, exosome aptamer fusion expression plasmid and targeted gene RNA editing method | |
| WO2022019325A1 (en) | Therapeutic agent for dystrophic epidermolysis bullosa | |
| CN105274089B (en) | A kind of construction method for the REV viral infectivities clone for expressing green fluorescence cyst membrane fusion protein | |
| Quinkal et al. | Mapping of the interaction between the immunodominant loop of the ectodomain of HIV‐1 gp41 and human complement protein C1q | |
| CN101787359B (en) | Recombinant lentivirus for carrying out targeted induction on osteogenic differentiated cell apoptosis as well as preparation method and application thereof | |
| ES2325711B1 (en) | EXPRESSION VECTORS UNDERSTANDING THE PROMOTER OF THE HUMAN PKLR GENE AND ITS USE FOR THE ELABORATION OF PHARMACEUTICAL COMPOSITIONS INTENDED FOR SOMATIC GENE THERAPY WITH SPECIFIC EXPRESSION IN ERYTHROID CELLS. | |
| Qazilbash et al. | Retroviral vector for gene therapy of X-linked severe combined immunodeficiency syndrome | |
| CN112501176B (en) | Polynucleotide and application thereof | |
| CN116083367A (en) | Method for preparing induced liver parenchymal cells and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170804 |