CN102295695B - Recombinant human follicle stimulating hormone and preparation thereof - Google Patents
Recombinant human follicle stimulating hormone and preparation thereof Download PDFInfo
- Publication number
- CN102295695B CN102295695B CN 201110269900 CN201110269900A CN102295695B CN 102295695 B CN102295695 B CN 102295695B CN 201110269900 CN201110269900 CN 201110269900 CN 201110269900 A CN201110269900 A CN 201110269900A CN 102295695 B CN102295695 B CN 102295695B
- Authority
- CN
- China
- Prior art keywords
- fsh
- preparation
- puregon
- carrier
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 238000002360 preparation method Methods 0.000 title claims abstract description 31
- 108010082302 Human Follicle Stimulating Hormone Proteins 0.000 title abstract description 3
- 102000003864 Human Follicle Stimulating Hormone Human genes 0.000 title abstract description 3
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 74
- 230000000694 effects Effects 0.000 claims abstract description 15
- 102000002287 alpha Subunit Glycoprotein Hormones Human genes 0.000 claims description 41
- 108010000732 alpha Subunit Glycoprotein Hormones Proteins 0.000 claims description 41
- 210000004027 cell Anatomy 0.000 claims description 33
- 108010081485 beta Subunit Follicle Stimulating Hormone Proteins 0.000 claims description 30
- 102000035824 beta Subunit Follicle Stimulating Hormone Human genes 0.000 claims description 30
- 238000005571 anion exchange chromatography Methods 0.000 claims description 24
- 108010081934 follitropin beta Proteins 0.000 claims description 21
- 102000002067 Protein Subunits Human genes 0.000 claims description 17
- 108010001267 Protein Subunits Proteins 0.000 claims description 17
- 210000004978 chinese hamster ovary cell Anatomy 0.000 claims description 15
- 238000004587 chromatography analysis Methods 0.000 claims description 15
- 210000003527 eukaryotic cell Anatomy 0.000 claims description 12
- 108091033319 polynucleotide Proteins 0.000 claims description 12
- 102000040430 polynucleotide Human genes 0.000 claims description 12
- 239000002157 polynucleotide Substances 0.000 claims description 12
- 238000002270 exclusion chromatography Methods 0.000 claims description 10
- 230000002209 hydrophobic effect Effects 0.000 claims description 10
- 108091008146 restriction endonucleases Proteins 0.000 claims description 10
- 230000006269 (delayed) early viral mRNA transcription Effects 0.000 claims description 8
- 229920002684 Sepharose Polymers 0.000 claims description 8
- 108010006578 follitropin alfa Proteins 0.000 claims description 8
- 229940057854 gonal f Drugs 0.000 claims description 8
- 230000006303 immediate early viral mRNA transcription Effects 0.000 claims description 8
- 239000007788 liquid Substances 0.000 claims description 8
- 238000001890 transfection Methods 0.000 claims description 8
- 229920002271 DEAE-Sepharose Polymers 0.000 claims description 7
- 239000012228 culture supernatant Substances 0.000 claims description 7
- 239000013604 expression vector Substances 0.000 claims description 6
- 239000012506 Sephacryl® Substances 0.000 claims description 5
- 125000001997 phenyl group Chemical group [H]C1=C([H])C([H])=C(*)C([H])=C1[H] 0.000 claims description 5
- 101000702488 Rattus norvegicus High affinity cationic amino acid transporter 1 Proteins 0.000 claims description 4
- 239000013622 capto Q Substances 0.000 claims description 4
- 239000006228 supernatant Substances 0.000 claims description 4
- 238000000108 ultra-filtration Methods 0.000 claims description 4
- 239000003636 conditioned culture medium Substances 0.000 claims description 2
- 210000004962 mammalian cell Anatomy 0.000 claims description 2
- 238000000034 method Methods 0.000 abstract description 18
- 239000013598 vector Substances 0.000 abstract description 7
- 102000012673 Follicle Stimulating Hormone Human genes 0.000 description 32
- 108010079345 Follicle Stimulating Hormone Proteins 0.000 description 32
- 229940028334 follicle stimulating hormone Drugs 0.000 description 32
- 239000000047 product Substances 0.000 description 15
- 238000012360 testing method Methods 0.000 description 12
- 230000029087 digestion Effects 0.000 description 11
- 239000002299 complementary DNA Substances 0.000 description 10
- 239000012634 fragment Substances 0.000 description 10
- 102000004169 proteins and genes Human genes 0.000 description 10
- 108020004414 DNA Proteins 0.000 description 9
- 235000018102 proteins Nutrition 0.000 description 9
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 8
- 239000012679 serum free medium Substances 0.000 description 8
- 230000013595 glycosylation Effects 0.000 description 7
- 238000006206 glycosylation reaction Methods 0.000 description 7
- 108091028043 Nucleic acid sequence Proteins 0.000 description 6
- 125000003275 alpha amino acid group Chemical group 0.000 description 6
- 230000008859 change Effects 0.000 description 6
- 230000004087 circulation Effects 0.000 description 6
- 239000003292 glue Substances 0.000 description 6
- 235000015097 nutrients Nutrition 0.000 description 6
- 239000002243 precursor Substances 0.000 description 6
- 239000000243 solution Substances 0.000 description 6
- 210000001672 ovary Anatomy 0.000 description 5
- 210000002700 urine Anatomy 0.000 description 5
- QKNYBSVHEMOAJP-UHFFFAOYSA-N 2-amino-2-(hydroxymethyl)propane-1,3-diol;hydron;chloride Chemical compound Cl.OCC(N)(CO)CO QKNYBSVHEMOAJP-UHFFFAOYSA-N 0.000 description 4
- 238000001962 electrophoresis Methods 0.000 description 4
- 238000003780 insertion Methods 0.000 description 4
- 230000037431 insertion Effects 0.000 description 4
- 238000005457 optimization Methods 0.000 description 4
- 230000008569 process Effects 0.000 description 4
- 239000011780 sodium chloride Substances 0.000 description 4
- 238000011144 upstream manufacturing Methods 0.000 description 4
- 101100230376 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372) celI gene Proteins 0.000 description 3
- 241000699802 Cricetulus griseus Species 0.000 description 3
- 238000002965 ELISA Methods 0.000 description 3
- 230000003321 amplification Effects 0.000 description 3
- 230000004071 biological effect Effects 0.000 description 3
- 238000004113 cell culture Methods 0.000 description 3
- 239000006285 cell suspension Substances 0.000 description 3
- 238000010828 elution Methods 0.000 description 3
- 238000005516 engineering process Methods 0.000 description 3
- 239000012467 final product Substances 0.000 description 3
- 229940088597 hormone Drugs 0.000 description 3
- 239000005556 hormone Substances 0.000 description 3
- 239000003550 marker Substances 0.000 description 3
- 239000008194 pharmaceutical composition Substances 0.000 description 3
- -1 wherein Proteins 0.000 description 3
- BWGNESOTFCXPMA-UHFFFAOYSA-N Dihydrogen disulfide Chemical compound SS BWGNESOTFCXPMA-UHFFFAOYSA-N 0.000 description 2
- 241000620209 Escherichia coli DH5[alpha] Species 0.000 description 2
- 102000003886 Glycoproteins Human genes 0.000 description 2
- 108090000288 Glycoproteins Proteins 0.000 description 2
- 102000003960 Ligases Human genes 0.000 description 2
- 108090000364 Ligases Proteins 0.000 description 2
- 235000001014 amino acid Nutrition 0.000 description 2
- 150000001413 amino acids Chemical class 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 238000010790 dilution Methods 0.000 description 2
- 239000012895 dilution Substances 0.000 description 2
- 239000003814 drug Substances 0.000 description 2
- 229940079593 drug Drugs 0.000 description 2
- 239000003937 drug carrier Substances 0.000 description 2
- 238000011156 evaluation Methods 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 238000000605 extraction Methods 0.000 description 2
- 238000013467 fragmentation Methods 0.000 description 2
- 238000006062 fragmentation reaction Methods 0.000 description 2
- 125000003147 glycosyl group Chemical group 0.000 description 2
- 238000002347 injection Methods 0.000 description 2
- 239000007924 injection Substances 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 239000000843 powder Substances 0.000 description 2
- 238000000746 purification Methods 0.000 description 2
- 230000009257 reactivity Effects 0.000 description 2
- 230000008521 reorganization Effects 0.000 description 2
- 238000004007 reversed phase HPLC Methods 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 238000003998 size exclusion chromatography high performance liquid chromatography Methods 0.000 description 2
- 238000010254 subcutaneous injection Methods 0.000 description 2
- 239000000126 substance Substances 0.000 description 2
- 238000013519 translation Methods 0.000 description 2
- 238000005406 washing Methods 0.000 description 2
- 238000001262 western blot Methods 0.000 description 2
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 1
- 108010072454 CTGCAG-specific type II deoxyribonucleases Proteins 0.000 description 1
- 238000013449 Capto Q chromatography Methods 0.000 description 1
- 108700010070 Codon Usage Proteins 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 206010062767 Hypophysitis Diseases 0.000 description 1
- 108091092195 Intron Proteins 0.000 description 1
- 239000012097 Lipofectamine 2000 Substances 0.000 description 1
- 238000010521 absorption reaction Methods 0.000 description 1
- 230000009471 action Effects 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000008827 biological function Effects 0.000 description 1
- 230000037396 body weight Effects 0.000 description 1
- 239000000872 buffer Substances 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 239000003795 chemical substances by application Substances 0.000 description 1
- 238000010276 construction Methods 0.000 description 1
- 238000012937 correction Methods 0.000 description 1
- 238000005314 correlation function Methods 0.000 description 1
- 238000012258 culturing Methods 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 239000002552 dosage form Substances 0.000 description 1
- 238000001976 enzyme digestion Methods 0.000 description 1
- 239000000706 filtrate Substances 0.000 description 1
- 230000003325 follicular Effects 0.000 description 1
- 239000000833 heterodimer Substances 0.000 description 1
- 238000004128 high performance liquid chromatography Methods 0.000 description 1
- 230000007062 hydrolysis Effects 0.000 description 1
- 238000006460 hydrolysis reaction Methods 0.000 description 1
- 238000003317 immunochromatography Methods 0.000 description 1
- 238000001727 in vivo Methods 0.000 description 1
- 208000000509 infertility Diseases 0.000 description 1
- 230000036512 infertility Effects 0.000 description 1
- 231100000535 infertility Toxicity 0.000 description 1
- 238000010255 intramuscular injection Methods 0.000 description 1
- 238000010253 intravenous injection Methods 0.000 description 1
- 210000004072 lung Anatomy 0.000 description 1
- 238000012423 maintenance Methods 0.000 description 1
- 239000012528 membrane Substances 0.000 description 1
- 239000011259 mixed solution Substances 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 238000010369 molecular cloning Methods 0.000 description 1
- 231100000252 nontoxic Toxicity 0.000 description 1
- 230000003000 nontoxic effect Effects 0.000 description 1
- 230000037361 pathway Effects 0.000 description 1
- 239000013612 plasmid Substances 0.000 description 1
- 230000001681 protective effect Effects 0.000 description 1
- 239000012474 protein marker Substances 0.000 description 1
- 238000010926 purge Methods 0.000 description 1
- 210000000664 rectum Anatomy 0.000 description 1
- 230000001105 regulatory effect Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 150000003839 salts Chemical class 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 238000002415 sodium dodecyl sulfate polyacrylamide gel electrophoresis Methods 0.000 description 1
- 239000007787 solid Substances 0.000 description 1
- 230000004936 stimulating effect Effects 0.000 description 1
- 239000007929 subcutaneous injection Substances 0.000 description 1
- 230000004083 survival effect Effects 0.000 description 1
- 208000011580 syndromic disease Diseases 0.000 description 1
- 230000001225 therapeutic effect Effects 0.000 description 1
- 230000005030 transcription termination Effects 0.000 description 1
- 210000001215 vagina Anatomy 0.000 description 1
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention provides high-specific-activity recombinant human follicle stimulating hormone and a preparation method thereof. In addition, the invention also provides a method for preparing an intermediate used in the method, gene, vector and cells.
Description
Invention field
The invention belongs to the protein technical field, particularly, the present invention relates to the Gonal-F and its preparation method of high specific acitivity.In addition, the invention still further relates to intermediate used among this preparation method.
Background technology
Follicle stimulating hormone (FSH) is the important hormone of regulating the reproduction correlation function of female and boar (comprising the mankind), can be used for treating do not ovulate syndromes, CLI and infertility etc.FSH is a heterodimer glycoprotein, by non-covalent bonded α and β subunit be combined into.Wherein, α subunit and β subunit are glycoprotein, respectively are distributed with 2 glycosylation sites.The existence of the glycosyl structure division of FSH and component have determined the performance and the stability of its biological function.And for experience translation, montage and the folding protein that just obtains, its activity has been difficult to expect, and being the character of predicted protein matter product, glycosylated existence and component brought bigger difficulty, to such an extent as to U.S. FDA is said with feeling: " production process of biological products is exactly a product ".
For the preparation of FSH, Chinese patent discloses employing immunochromatography and anti-phase HPLC step purifying people FSH (hFSH) from postmenopause urine gonad-stimulating hormone for No. 88103966.After this, the method for the hFSH (rhFSH) of DNA reorganization preparation also has report.For example, Chinese patent is devoted to for No. 98807811 to stablize FSH by introducing disulfide linkage, No. the 99808813rd, Chinese patent and No. 200480032665 then suddenly change and improve performance and stability by introducing some, but the change of these protein structures will increase the FSH of this sudden change is identified as the hidden danger of heterologous protein by body, thereby brings immune risk when using in vivo.
Chinese patent No. 200480036591, No. 200580037591, No. 200910048718 and No. 200910051483 optimization by the later stage purification step improve performance and the stability of hFSH, and the ratio work of the highly purified FSH that finally obtains reaches 12104IU/mg.
The inventor has developed the FSH preparation method who is different from prior art, on dna level, done significantly and optimized, but on the protein level of final product, do not introduce sudden change, be that final product is identical with the prlmary structure of protein of natural hFSH, translation product is correct, the immune risk when having avoided the body innerlich anwenden; In transfection, cultivation and later stage purifying, carried out comprehensive optimization in addition.Finally, the inventor has not only obtained the high rhFSH of expression level, more unexpectedly is, the activity of the rhFSH of acquisition further is improved, and is higher than than living that prior art reports.
Summary of the invention
The technical problem to be solved in the present invention is to provide the preparation method of the rhFSH that is different from prior art, and the final product that this method obtains is correct, has kept the biological activity of FSH.In addition, the present invention this method preparation also is provided and rhFSH and this method in the intermediate that uses.
Particularly, in first aspect, the invention provides the Puregon of high specific acitivity, its specific activity is preferably greater than 12300IU/mg greater than 12200IU/mg, most preferably is 12350～12400IU/mg, as 12390IU/mg.The preferably mammiferous Puregon of Puregon, most preferably be Gonal-F (rhFSH), this Gonal-F comprises FSH α protein subunit and aminoacid sequence the FSH β protein subunit as SEQ ID NO:4 shown in of aminoacid sequence shown in SEQ IDNO:2.In this article, reorganization expression obtains by the DNA recombinant technology, rather than by from the natural origin separation and Extraction, does not for example extract from urine.
The Puregon of preferred first aspect present invention gets by being prepared as follows the method preparation:
(1) operationally insert FSH α subunit gene and FSH beta subunit gene in the carrier for expression of eukaryon, acquisition can be expressed the transfection carrier of FSH α protein subunit and FSH β protein subunit, wherein, FSH α subunit gene comprises the cDNA sequence and the upstream intron sequences of coding FSH α protein subunit, and the FSH beta subunit gene comprises exon 2, intron 2 and the exon 3 sequence of coding FSH β protein subunit;
(2) transfection carrier is transfected into eukaryotic cell and cultivation; With
(3) with culture supernatant successively through ultrafiltration, anion-exchange chromatography, hydrophobic chromatography, anion-exchange chromatography, molecular exclusion chromatography and anion-exchange chromatography purifying.
In this article, thus operationally insert expression and gene insertion vector can be expressed according to gene order and carrier sequence.Usually, gene is placed between promoter sequence and the transcription termination sequence and maintenance reading frame unanimity.
Can derive a large amount of gene orders according to protein sequence, but the efficient of the transcript and expression of different genes sequence has very big-difference.Although the optimization means based on the codon usage frequency of expressive host is arranged, the optimization of gene order still has very big empirical.Experience according to the inventor, in the preferred first aspect present invention, the subunit gene sequence is near (or preferably equaling) its natural gene sequence, the polynucleotide sequence of preferred FSH α subunit gene is shown in SEQ ID NO:1, and/or the polynucleotide sequence of FSH beta subunit gene is shown in SEQ ID NO:3.These gene orders are variant with the corresponding gene sequences of existing report, and directly from the gene order of native state, this may be one of reason that rhFSH of the present invention can high expression level.
Therefore the glycosyl of FSH has fundamental influence to its biological activity, the carrier that need express in can glycosylated eukaryotic cells.In the preferred first aspect present invention, carrier for expression of eukaryon is a mammalian expression vector, can be the tandem expression carrier, but is more preferably two-cistron expression vector.In the specific embodiment of the present invention, carrier for expression of eukaryon is the pIRES carrier.The inventor finds that this carrier cooperates with the CHO-S cell, and the glycosylation pattern of expressing the rhFSH that obtains can make the specific activity of this rhFSH be improved.
In the preferred first aspect present invention, FSH α subunit gene and FSH beta subunit gene are inserted respectively between the Nhe I/EcoR I restriction enzyme site in the pIRES carrier and between the Xba I/Not I restriction enzyme site.Such construction strategy makes the expression non-interference as far as possible of FSH α subunit and β subunit may improve expression amount thus.
FSH has two subunits, links to each other by a plurality of disulfide linkage, therefore need select to make the correct eukaryotic cell that connects of FSH subunit in the existing expression host cell of magnanimity, as mammalian cell.According to the inventor's experience, in the preferred first aspect present invention, eukaryotic cell is Chinese hamster ovary cell (CHO).In the specific embodiment of the present invention, eukaryotic cell most preferably is the CHO-S cell strain.This cell strain is with respect to other Chinese hamster ovary celIs, and the purity of expressing rhFSH in the supernatant liquor is higher, and expression amount is also higher, has made things convenient for the purifying work in downstream.
In the preferred first aspect present invention, anion-exchange chromatography is selected from DEAE-Sepharose FF anion-exchange chromatography and/or Capto Q anion-exchange chromatography, and it is incomplete same more preferably respectively to go on foot anion-exchange chromatography; Hydrophobic chromatography is a Phenyl Sepharose HP hydrophobic chromatography; Molecular exclusion chromatography is a Sephacryl S-100HR molecular exclusion chromatography.The combination of these downstream purification means can be produced the rhFSH that reaches even substantially exceed the required purity of the drug standard.
In second aspect, the invention provides pharmaceutical composition, it comprises the Puregon and the pharmaceutically acceptable carrier of first aspect present invention.In this article, " pharmaceutically acceptable carrier " refers to nontoxic solid-state, semi-solid state or liquid weighting agent, thinner, buffer reagent, protective material, sanitas, lapping or other pharmaceutical adjuncts.Therefore preferably in all respects of first aspect of the present invention, come administration, especially subcutaneous injection, preferably powder injection (as lyophilized injectable powder) and liquid preparation of described pharmaceutical composition by injecting pathway.This pharmaceutical composition can carry out administration by the known administering mode of one of ordinary skill in the art, treats the not enough disease that causes owing to FSH.Available administering mode comprises, injection, oral, rectum, hypogloeeis, lung, transdermal, ion penetrate, vagina and intranasal administration, and preferred gi tract external administration is as subcutaneous, intramuscular or intravenous injection.Dosage changes to some extent according to the situation of action time of dosage form and expectation and treatment target, the required amount of actual therapeutic can by the clinician according to experimenter's practical situation (as, patient's the state of an illness, body weight, age, sex etc.) and determine easily.
In the third aspect, the invention provides the preparation method of the Puregon of first aspect present invention.Preferred described preparation method comprises:
(1) operationally insert FSH α subunit gene and FSH beta subunit gene in the carrier for expression of eukaryon, acquisition can be expressed the transfection carrier of FSH α protein subunit and FSH β protein subunit, wherein, FSH α subunit gene comprises the cDNA sequence and the upstream intron sequences of coding FSH α protein subunit, and the FSH beta subunit gene comprises exon 2, intron 2 and the exon 3 sequence of coding FSH β protein subunit;
(2) transfection carrier is transfected into eukaryotic cell and cultivation; With
(3) with culture supernatant successively through ultrafiltration, anion-exchange chromatography, hydrophobic chromatography, anion-exchange chromatography, molecular exclusion chromatography and anion-exchange chromatography purifying.
In the preferred third aspect present invention, the subunit gene sequence is near (or preferably equaling) its natural gene sequence, the polynucleotide sequence of preferred FSH α subunit gene is shown in SEQ ID NO:1, and/or the polynucleotide sequence of FSH beta subunit gene is shown in SEQ ID NO:3.
In the preferred third aspect present invention, carrier for expression of eukaryon is a mammalian expression vector, can be the tandem expression carrier, but is more preferably two-cistron expression vector.In the specific embodiment of the present invention, carrier for expression of eukaryon is the pIRES carrier.
In the preferred third aspect present invention, FSH α subunit gene and FSH beta subunit gene are inserted respectively between the Nhe I/EcoR I restriction enzyme site in the pIRES carrier and between the Xba I/Not I restriction enzyme site.
In the preferred third aspect present invention, eukaryotic cell is Chinese hamster ovary cell (CHO).In the specific embodiment of the present invention, eukaryotic cell most preferably is the CHO-S cell strain.
In the preferred third aspect present invention, anion-exchange chromatography is selected from DEAE-Sepharose FF anion-exchange chromatography and/or Capto Q anion-exchange chromatography, and it is incomplete same more preferably respectively to go on foot anion-exchange chromatography; Hydrophobic chromatography is a Phenyl Sepharose HP hydrophobic chromatography; Molecular exclusion chromatography is a Sephacryl S-100HR molecular exclusion chromatography.
In addition, the present invention also provides gene, carrier, cell and cell culture etc., and it can be used as the intermediate among the preparation method of third aspect present invention.
Particularly, in fourth aspect, the invention provides FSH α subunit gene, it comprises the cDNA sequence and the upstream intron sequences of coding FSH α protein subunit, and the aminoacid sequence of preferred FSH α protein subunit is shown in SEQ ID NO:2.In the specific embodiment of the present invention, the polynucleotide sequence of FSH α subunit gene is shown in SEQ ID NO:1.
Aspect the 5th, the invention provides the FSH beta subunit gene, it comprises exon 2, intron 2 and the exon 3 sequence of coding FSH β protein subunit, and the aminoacid sequence of preferred FSH β protein subunit is shown in SEQID NO:4.In the specific embodiment of the present invention, the polynucleotide sequence of FSH beta subunit gene is shown in SEQ ID NO:3.
Aspect the 6th, the invention provides carrier, it comprises the gene of fourth aspect present invention and/or the gene of fifth aspect present invention, preferably comprises the gene of fourth aspect present invention and the gene of fifth aspect present invention.In the specific embodiment of the present invention, most preferred carrier is pIRES-FSH-α/β.
Aspect the 7th, the invention provides cell, it comprises the gene of fourth aspect present invention and/or the gene of sixth aspect present invention, and perhaps it has been transfected into the carrier of sixth aspect present invention.The preferably Chinese hamster ovary celI of cell that sets out of described cell is more preferably the CHO-S cell strain.
Aspect the 7th, the invention provides cell conditioned medium liquid, its for cultivate seventh aspect present invention the supernatant liquor of cell gained.
Beneficial effect of the present invention is: can substitute using and preparing of existing people FSH; RhFSH's of the present invention is active high; Preparation method of the present invention can express the high reactivity rhFSH with suitable glycosylation pattern, and the expression amount height, culture supernatant purity height.
For the ease of understanding, below will the present invention be described in detail by concrete drawings and Examples.It needs to be noted that specific examples and accompanying drawing only are in order to illustrate, not constitute limitation of the scope of the invention.Obviously those of ordinary skill in the art can illustrate according to this paper, within the scope of the invention the present invention is made various corrections and change, and these are repaiied F and change and also include in the scope of the present invention.In addition, the present invention has quoted open source literature, and these documents also are in order more clearly to describe the present invention, and their full text content is all included the present invention in and carried out reference, just look like they full text in specification sheets of the present invention repeated description the same excessively.
Description of drawings
The PCR product electrophorogram of Fig. 1 people FSH α and beta subunit gene sequence, wherein go up all product and be the 1st road: molecular weight marker is followed successively by 0.5kb, 1.0kb, 1.5kb, 2.0kb, 2.5kb, 3.0kb, 4.0kb, 5.0kb, 6.0kb, 8.0kb, 10.0kb; The 2nd road: FSH beta subunit gene [about 1.96kb]; The 3rd road: the about 0.7kb of FSH α subunit cDNA[]; The 4th road: the intron of FSH α subunit gene [about 2.1kb].
The restriction enzyme digestion and electrophoresis of Fig. 2 pIRES-FSH-α of the present invention/β carrier is identified collection of illustrative plates, and wherein go up all product and be the 1st road: molecular weight marker is followed successively by 0.5kb, 1.0kb, 1.5kb, 2.0kb, 2.5kb, 3.0kb, 4.0kb, 5.0kb, 6.0kb, 8.0kb, 10.0kb; The 2nd road: molecular weight marker is followed successively by 0.25kb, 0.5kb, 1.0kb, 1.5kb, 2.0kb; The 3rd road: not enzyme cut pIRES-FSH-α/the β carrier in contrast; The 4th road: pIRES-FSH-α/β carrier Nhe I/EcoRI double digestion; The 5th road: pIRES-FSH-α/β carrier XbaI/NotI double digestion.
Fig. 3 Western Blot is figure as a result, wherein goes up all product and is the 1st road: molecular weight protein marker; The 2nd road: engineering cell strain culture supernatant 10 μ l of the present invention; The 3rd road: existing 5F5 cell culture supernatant 10 μ l in contrast; The 4th road: the urine source property FSH 10 μ g that urinate extraction from the people in contrast.
Fig. 4 DEAE-Sepharose anion-exchange chromatography collection of illustrative plates, wherein the peak shown in the arrow has the FSH activity after testing.
Fig. 5 Phenyl Sepharose HP hydrophobic chromatography collection of illustrative plates, wherein the peak shown in the arrow has the FSH activity after testing.
Fig. 6 Capto Q anion-exchange chromatography collection of illustrative plates, wherein the peak shown in the arrow has the FSH activity after testing.
Fig. 7 Sephacryl S-100HR molecular exclusion chromatography collection of illustrative plates, wherein the peak shown in the arrow has the FSH activity after testing.
Fig. 8 DEAE-Sepharose FF anion-exchange chromatography collection of illustrative plates, wherein the peak shown in the arrow has the FSH activity after testing.
The proteic SEC-HPLC of Fig. 9 FSH identifies collection of illustrative plates.
The RP-HPLC of Figure 10 FSH protein protomer identifies collection of illustrative plates.
Embodiment
Following this paper will describe invention by specific embodiment.As do not specialize part, can be according to " molecular cloning experiment guide " (third edition) (Cold Spring Harbor laboratory Press), " cell experiment guide " (Science Press that those skilled in the art were familiar with, Beijing, China, calendar year 2001), the manufacturer of " protein technical manual " reference that handbook and related drugs rules, regulation and this paper quoted such as (Science Press, 2000) and used reagent, carrier etc. illustrates and implements.In addition, employed material all can be bought by commercial sources except that special instruction is arranged from the market among the embodiment.
The clone and the expression of embodiment 1rhFSH gene
1, the clone of intron sequences in the people FSH α subunit gene
The inventor discovers, although a plurality of introns in the FSH α subunit gene do not exert an influence to the FSH α subunit of final expression, but the expression amount to FSH α subunit exerts an influence, the increase that has is expressed, the but minimizing that has is expressed, wherein the intron of FSH α subunit gene upstream can significantly increase expression amount, therefore keeps this intron fragment is cloned.
Its clone adopts conventional PCR method, is that template increases with human gene group DNA (Clontech company), and amplification program is followed successively by: 95 ℃ 5 minutes, 30 circulations (94 ℃ of every circulations 1 minute, 50 ℃ 1 minute, 72 ℃ 1 minute), 72 ℃ 10 minutes; The used primer that increases following (introducing NheI and PstI restriction enzyme site respectively):
Primer α 1:5 ' AAGGTAAGT
GCTAGCAAATT3 '
NheI
Primer α 2:5 ' TAATCCATGGCGCTC
CTGCAGA3 '
PstI
The PCR product carries out electrophoresis and confirms that its length is (as shown in Figure 1) about 2.1kb on 0.8% sepharose.After reclaiming test kit (U.S. Qiagen company) and reclaim this dna fragmentation with glue, directly connect, be cloned into
In the carrier (U.S. Promega company), the recombinant vectors called after TA-alpha-intron of acquisition.
2, the clone of people FSH α subunit precursor cDNA sequence
The inventor discovers, though FSH α subunit precursor RNA (116 amino acid of encoding) need many step montage processes could produce sophisticated people FSH α subunit (92 amino acid) in cell, use sophisticated people FSH α subunit to express but express the sophisticated people FSH α subunit expression amount that obtains greater than direct, therefore keep the cDNA sequence of people FSH α subunit precursor is cloned with precursor.
Its clone adopts conventional PCR method, so that (Becton Dickinson Company BD) increases for template from people's hypophysis cDNA library, amplification program is followed successively by: 95 ℃ 5 minutes, 30 circulations (94 ℃ of every circulations 1 minute, 50 ℃ 1 minute, 72 ℃ 1 minute), 72 ℃ 10 minutes; The used primer that increases following (introducing PstI and EcoRI restriction enzyme site respectively):
Primer α 3:
5′CATGTCTGT
CTGCAGGAGCGCCATGGATTACTACACA?3′
PstI
Primer α 4:5 ' A
GAATTCAGCACTTGGTAAAACATTTAAGATTT3 '
EcoRI
The PCR product carries out electrophoresis and confirms that its length is (as shown in Figure 1) about 600bp on 0.8% sepharose.After reclaiming test kit and reclaim this dna fragmentation with glue, directly connection is cloned into
In the carrier, the recombinant vectors called after TA-alpha-cDNA of acquisition.
3, the clone of people FSH beta subunit gene sequence
The inventor discovers, directly the dna sequence dna of the sequence of the exon 2, intron 2 and the exon 3 that comprise FSH β gene is expressed, comprising redundant sequence such as the precursor of FSH β and intron, but the output of the people FSH β subunit that obtains will significantly improve, and therefore keep the clone to this dna sequence dna.
Its clone adopts conventional PCR method, is that template increases with human gene group DNA (Clontech company), and amplification program is followed successively by: 95 ℃ 5 minutes, 30 circulations (94 ℃ of every circulations 1 minute, 50 ℃ 1 minute, 72 ℃ 1 minute), 72 ℃ 10 minutes; The used primer that increases following (introducing XbaI and NotI restriction enzyme site respectively):
Primer β 1:
5’A
TCTAGACCAGACCAGGATGAAGACACTC3’
XbaI
Primer β 2:
5’AA
GCGGCCGCAAATGTCCACTGATCTTTATTCTT3’
NotI
The PCR product carries out electrophoresis and confirms that its length is (as shown in Figure 1) about 1.96kb on 0.8% sepharose.After reclaiming test kit and reclaim this dna segment with glue, directly connection is cloned into
In the carrier, recombinant vectors called after TA-beta.
4, the structure of recombinant human FSH two-cistron expression vector
To the TA-alpha-intron carrier of above-mentioned structure with NheI and PstI (restriction endonuclease is all available from U.S. NewEngland Biolabs) double digestion after, reclaim the FSH α subunit intron fragment that test kit reclaims this about 2.1kb with glue; Equally, to the TA-alpha-cDNA carrier of above-mentioned structure with PstI and EcoRI double digestion after, reclaim the FSH α subunit cDNA fragment that test kit reclaims this about 0.7kb with glue.With the pIRES carrier (U.S. CLONTECH company of T4 ligase enzyme (U.S. Promega company) with above-mentioned two double digestion fragments and usefulness NheI//EcoRI double digestion, Cat.No.631605) connect, the recombinant vectors called after pIRES-alpha that obtains, transformed into escherichia coli DH5 α then.Extracting transforms the pIRES-alpha in the positive strain, with Nhe I/EcoRI double digestion, verifies the insertion fragment of the 2.7kb that has an appointment; Sequencing analysis is found, inserts fragment and has the dna sequence dna shown in the SEQ ID NO:1, and we estimate that final expression product is the aminoacid sequence of the sophisticated FSH α subunit of sequence shown in SEQ ID NO:2.Sequence in the public databases such as this dna sequence dna and Genbank is difference to some extent, comprise: be equivalent to the TCTAGA of 10-15 position and the CA of 978-979 position in the sequence in the missing data storehouse, and the 186th be T (in the database for A), the 769th is G (being A in the database), the 1559th is C (being T in the database), and the 1762nd is G (being A in the database).
To the TA-beta carrier of above-mentioned structure with XbaI and NotI double digestion after, reclaim the FSH β subunit fragments that test kit reclaims this about 1.96kb with glue.With the T4 ligase enzyme this double digestion fragment is connected the recombinant vectors called after pIRES-FSH-α/β of acquisition, transformed into escherichia coli DH5 α then with pIRES-alpha carrier with the XbaI/NotI double digestion.Extracting transforms the pIRES-FSH-α t/ β in the positive strain, and respectively with Xba I/NotI and Nhe I/EcoR I double digestion, checking truly has the insertion fragment (as shown in Figure 2) of about 2.7kb and about 1.96kb; Sequencing analysis finds that the insertion fragment of about 1.96kb has the dna sequence dna shown in the SEQ ID NO:3, and we estimate that final expression product is the aminoacid sequence of the sophisticated FSH β subunit of sequence shown in SEQ ID NO:4.Sequence in the public databases such as this dna sequence dna and Genbank is difference to some extent, comprising: be equivalent to the 44th in the database in the sequence and be A (being G in the database).
5, the foundation of rhFSH expression cell line
RhFSH need obtain suitable glycosylation could guarantee its activity and the required expressing quantity of actual production, therefore, through inventor research, need select CHO-S cell in the Chinese hamster ovary cell (CHO) (can available from Gibco company) for use.
Employing is transfected into pIRES-FSH-α/β in the CHO-S cell through the Lipofectamine2000 method that the inventor optimizes.Particularly, the CHO-S cell cultures in 10ml CHO serum-free medium (JRHBiosciences company), is treated that it grows to 1 * 10
6During the density of individual/ml,, discard nutrient solution with the centrifugal 2min of 1000rmp, with CHO serum-free medium washing three times, the centrifugal removal nutrient solution in washing back, then that cell is resuspended with 2ml CHO serum free medium; With 15 μ g pIRES-FSH-α/β plasmid DNA and 45 μ lLipofectamine2000 (available from Invitrogen company) mixing, after room temperature is put 10 minutes, be added in the above-mentioned cell suspension, this mixed solution cultivated 6 hours in 37 ℃ of incubators after, with the centrifugal 5min of 800rmp, abandoning supernatant adds the fresh CHO serum-free medium of 8ml again, continues to cultivate 24 hours.
To cultivate the cell that obtains then and be diluted to cell suspension with the 30ml CHO serum-free medium of 37 ℃ of preheatings, get the 10ml cell suspension, with the dilution of CHO serum-free medium is 40ml, therefrom get 10ml, continuing dilution with the CHO serum-free medium is 50ml, and (the inoculating cell number is 5 * 10 to be inoculated in 96 orifice plates with 50 μ l/ holes
2/ hole).
Above culture plate is put into 37 ℃ of incubators and is cultivated 24h, adds the selectivity nutrient solution (that is, G418 being dissolved in the CHO serum-free medium) that 150ul contains G418 (available from Amresco company) then in each hole, and wherein the initial concentration of G418 is 200 μ g/ml.Cell is reapposed continuation cultivation in 37 ℃ of incubators, changed the selectivity nutrient solution every 3 days, G418 concentration is followed successively by 200 μ g/ml, 400 μ g/ml and 1000 μ g/ml in the selectivity nutrient solution that changes.G418 concentration is progressively increased to lmg/ml cultivation 14～18 days, when the blank cell of the CHO-S of contrast is all dead, and the clone that the Chinese hamster ovary celI appearance of transfection is survived.The collecting cell clone also changes the selectivity nutrient solution cultivation that G418 concentration is 800 μ g/ml, as the engineering cell strain of expressing FSH.Detect ELISA test kit (U.S. R﹠D company) through FSH and detect, the clonal expression level height of survival, the expression level of its rhFSH are 2 μ g/10
6Cell/24hr is higher than the expression amount that has the 5F5 cell now far away; Detect through Western Blot, the rhFSH of its expression is single band, and homogeneity is better than extracting the urine source property FSH (as shown in Figure 3) from people's urine.Repeat this culturing step and all can obtain engineering cell strain.
The purifying of embodiment 2rhFSH and evaluation
Get the culture supernatant 1000ml of the engineering cell strain of embodiment 1, cross the ultra-filtration membrane that molecular weight cut-off is 10kD, get filtrate and be splined on containing 20mmol/L Tris-HCl (pH 8.0) the equilibrated DEAE Sepharose FF anion-exchange chromatography post (GE Healthcare company) of 0.1mol/L NaCl and collecting stream and wear liquid (seeing accompanying drawing 4); The salt ionic concentration that the stream that increases this collection step is worn liquid makes it to reach 0.5mol/L NaCl, last sample Phenyl Sepharose HP chromatography column (GE Healthcare company) carries out chromatography, and with 20mmol/LTris-HCl (pH 8.0) buffer solution elution, collect that the ELISA method detects the peak (see figure 5) that contains FSH in the elutriant; Sample Capto Q chromatography column (GE Healthcare company) on the elutriant of collecting is carried out chromatography, and carry out stepwise elution with the 20mmol/LTris-HCl (pH 8.0) that contains the 20mmol/L Tris-HCl (pH 8.0) of 0.02mol/L NaCl and contain 0.1mol/LNaCl respectively, and collection elutriant, the ELISA method detects the back active fraction and is the elutriant (see figure 6) with 20mmol/LTris-HCl (pH 8.0) wash-out that contains 0.1mol/LNaCl, and collects; To collect liquid directly is splined on and has used the good Sephacryl S-100HR chromatography column (GE Healthcare company) of 10mmol/LTris-HCl (pH 8.0) balance and collected the higher part (see figure 7) of FSH purity in the elutriant according to ultraviolet absorption value, to collect liquid and be splined on DEAE Sepharose FF chromatography column, carry out stepwise elution with the 10mmol/L Tris-HCl (pH 8.0) that contains the 10mmol/L Tris-HCl (pH 8.0) of 0.02M NaCl and contain 0.08mol/LNaCl respectively, and collect the elutriant (see figure 8).Promptly obtained the rhFSH of purifying, optional further lyophilize and concentrating.
The rhFSH hydrolysis of this purifying is after the evaluation of SDS polyacrylamide gel electrophoresis, the rhFSH that obtains through the said process purifying identifies (Fig. 9) through SEC-HPLC (Agilent Technologies company), peak position is consistent with our theoretical value of prediction, and purity reaches 99%; Identify (Figure 10) through reversed-phase HPLC, two molecular weight subunits in the product are all consistent with our theoretical value of prediction, show the correctly montage and transform precursor protein of the FSH engineering cell that obtains by screening, has correct subunit structure, and the molecular weight of the product after its glycosylation is about 43KD, show the glycosylation pattern that can keep rhFSH through above-mentioned purge process, thereby guaranteed to express the high reactivity of FSH.
Adopt conventional rat ovary weightening finish method (Liu Zhiyong, tire and the detection of index of correlation Deng. high purity follicular stimulating hormone. Jiangxi Medical College's journal, 2004, the 1st phase), by relatively FSH standard substance (WHO biological activity standard substance 96/642) and the degree of the rhFSH that obtains through the said process purifying, with tiring of the rhFSH that determines glycosylation pattern of the present invention to female young rat ovary weightening finish.The result shows that biology is 12390IU/mg in the body of this rhFSH than living.
Claims (15)
1. the preparation method of the Puregon of high specific acitivity, it comprises,
(1) operationally insert FSH α subunit gene and FSH beta subunit gene in the carrier for expression of eukaryon, acquisition can be expressed the transfection carrier of FSH α protein subunit and FSH β protein subunit, wherein, the polynucleotide sequence of FSH α subunit gene is shown in SEQ ID NO:1, and the polynucleotide sequence of FSH beta subunit gene is shown in SEQ ID NO:3;
(2) transfection carrier is transfected into eukaryotic cell and cultivation; With
(3) with culture supernatant successively through ultrafiltration, anion-exchange chromatography, hydrophobic chromatography, anion-exchange chromatography, molecular exclusion chromatography and anion-exchange chromatography purifying.
2. the preparation method of the described Puregon of claim 1, wherein, described Gonal-F's specific activity is greater than 12200IU/mg.
3. the preparation method of the described Puregon of claim 2, wherein, described Gonal-F's specific activity is greater than 12300IU/mg.
4. the preparation method of the described Puregon of claim 3, wherein, described Gonal-F's specific activity is 12350～12400IU/mg.
5. the preparation method of the described Puregon of claim 1, wherein, described Gonal-F's specific activity is 12390IU/mg.
6. the preparation method of the described Puregon of claim 1, wherein, the polynucleotide sequence of FSH α subunit gene is shown in SEQ ID NO:1.
7. the preparation method of the described Puregon of claim 1, wherein, the polynucleotide sequence of FSH beta subunit gene is shown in SEQ ID NO:3.
8. the preparation method of the described Puregon of claim 1, wherein, carrier for expression of eukaryon is a mammalian expression vector.
9. the preparation method of the described Puregon of claim 8, wherein, carrier for expression of eukaryon is the pIRES carrier.
10. the preparation method of the described Puregon of claim 1 wherein, inserts FSH α subunit gene and FSH beta subunit gene respectively between the Nhe I/EcoR I restriction enzyme site in the pIRES carrier and between the Xba I/Not I restriction enzyme site.
11. the preparation method of the described Puregon of claim 1, wherein, eukaryotic cell is a mammalian cell.
12. the preparation method of the described Puregon of claim 11, wherein, eukaryotic cell is a Chinese hamster ovary cell.
13. the preparation method of the described Puregon of claim 12, wherein, eukaryotic cell is the CHO-S cell.
14. the preparation method of the described Puregon of claim 1, wherein, anion-exchange chromatography is selected from DEAE-Sepharose FF anion-exchange chromatography and/or Capto Q anion-exchange chromatography, hydrophobic chromatography is a Phenyl Sepharose HP hydrophobic chromatography, and molecular exclusion chromatography is a Sephacryl S-100HR molecular exclusion chromatography.
15. can be used for the intermediate among the preparation method of the described Puregon of claim 1, it is selected from:
(a) FSH α subunit gene, its polynucleotide sequence is shown in SEQ ID NO:1;
(b) FSH beta subunit gene, its polynucleotide sequence is shown in SEQ ID NO:3;
(c) carrier, it comprises (a) and/or (b) described gene;
(d) cell, it comprises (a) and/or (b) described gene, and perhaps it has been transfected into (c) described carrier; Or
(e) cell conditioned medium liquid, it is for cultivating the supernatant liquor of (d) described cell gained.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110269900 CN102295695B (en) | 2011-09-14 | 2011-09-14 | Recombinant human follicle stimulating hormone and preparation thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110269900 CN102295695B (en) | 2011-09-14 | 2011-09-14 | Recombinant human follicle stimulating hormone and preparation thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102295695A CN102295695A (en) | 2011-12-28 |
| CN102295695B true CN102295695B (en) | 2013-07-31 |
Family
ID=45356392
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110269900 Active CN102295695B (en) | 2011-09-14 | 2011-09-14 | Recombinant human follicle stimulating hormone and preparation thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102295695B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102786589A (en) * | 2012-07-30 | 2012-11-21 | 南昌市万华生化药业有限公司 | Recombinant follicle stimulating hormone (rFSH) and genetic engineering strain thereof |
| CN105906704A (en) * | 2016-05-04 | 2016-08-31 | 长春圣金诺生物制药有限公司 | Purifying method of recombinant human follicle stimulating hormone |
| CN107460206B (en) * | 2017-09-11 | 2020-05-01 | 深圳市深研生物科技有限公司 | Recombinant expression vector of human FSH, recombinant cell strain and preparation method of recombinant human FSH |
| CN109957580A (en) * | 2019-05-07 | 2019-07-02 | 西北农林科技大学 | A method of expression human follicle-stimulating growth hormone (FSH) |
| CN110305903B (en) * | 2019-07-31 | 2021-10-01 | 江苏璟泽生物医药有限公司 | Recombinant human follicle stimulating hormone and preparation method thereof |
| WO2022141441A1 (en) * | 2020-12-31 | 2022-07-07 | 南通大学 | Follicle-stimulating hormone and in-vitro self-assembly method therefor |
| CN112679601A (en) * | 2021-01-20 | 2021-04-20 | 长春生物制品研究所有限责任公司 | Preparation method of high specific activity recombinant human follicle stimulating hormone |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101250531B (en) * | 2006-11-27 | 2013-04-24 | 株式会社Lg生命科学 | Nucleotide sequence, expression vector containing the same, zooblast inverted from said vector and method for producing human FSH using the zooblast |
| CN101851287B (en) * | 2009-04-02 | 2013-06-12 | 上海天伟生物制药有限公司 | Menopausal gonadotropin with high specific activity as well as preparation method and application thereof |
-
2011
- 2011-09-14 CN CN 201110269900 patent/CN102295695B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN102295695A (en) | 2011-12-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102295695B (en) | Recombinant human follicle stimulating hormone and preparation thereof | |
| JP3017962B2 (en) | Method for producing pharmaceutical composition for increasing hematocrit | |
| JPH0217156B2 (en) | ||
| CN109851674B (en) | Preparation and purification method of recombinant human serum albumin/growth hormone fusion protein for treating children's dwarf syndrome | |
| CN110845603A (en) | Human collagen 17-type polypeptide, production method and use thereof | |
| CN102816244A (en) | Fusion protein of exendin-4 peptide and human serum albumin (HSA) and preparation method thereof | |
| CN113121705B (en) | Fusion protein for preparing short peptide mixture, target polypeptide, preparation method and application of short peptide mixture | |
| CN101240033B (en) | Fusion protein of insulin secretion accelerating peptide and human serum albumin, and preparation method thereof | |
| CN113265007B (en) | Fusion protein for treating metabolic diseases and preparation method and application thereof | |
| WO2007107882A2 (en) | Method for purifying granulocyte-colony stimulating factor | |
| CN110256575A (en) | A kind of long-acting recombinant human growth hormone fusion protein and its engineering cell | |
| CN101134105B (en) | Pharmaceutical composition containing recombination human pancreatic kininogenase for treating and/or preventing cerebral infarction | |
| CN101525387B (en) | Recombined long-acting glucagons peptide analogue and preparation method thereof | |
| CN112851791B (en) | Novel FGF analogue for resisting metabolic disorder and application thereof | |
| CN101134953B (en) | Recombinant human pancreas kininogenase | |
| CN1962695B (en) | GLP-1 infusion proteins, their preparation and use | |
| CN104558198A (en) | Preparation method and application of fusion protein of GLP-1 analogue and amylin analogue | |
| CN101875699B (en) | Fusion protein of human epidermal growth factor and metallothionein and preparation method and application thereof | |
| CN101451151A (en) | Method for producing biological active outcome by using tumour cell | |
| CN105884901A (en) | Recombinant human serum albumin/pancreatic glucagon peptide fusion protein having blood sugar content continuous control function | |
| CN101967468A (en) | Recombinant human kallidinogenase | |
| CN100535005C (en) | Long chain human insulin-like growth factor(LR3IGF-1) and its preparing process and application method | |
| CN111424035A (en) | Method for expressing human connective tissue growth factor with biological activity based on silkworm silk gland, product and application thereof | |
| JP2018508465A (en) | Methods for producing long acting CTP-modified growth hormone polypeptides | |
| CN109021085A (en) | Sepiella maindroni neuropeptide tyrosine and its recombinant expression method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent for invention or patent application | ||
| CB02 | Change of applicant information |
Address after: 130012 No. 72 Tianhe street, hi tech Development Zone, Jilin, Changchun Applicant after: Jinsai Drug Co., Ltd., Changchun Address before: 130012 No. 72 Tianhe street, hi tech Development Zone, Jilin, Changchun Applicant before: Changchun Genscience Pharmaceuticals Co., Ltd. |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: APPLICANT; FROM: CHANGCHUN GENSCI PHARMACEUTICAL CO., LTD. TO: JINSAI MEDICINE CO., LTD., CHANGCHUN |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address |
Address after: 130012 No. 72 Tianhe street, hi tech Industrial Development Zone, Jilin, Changchun Patentee after: Changchun Genscience Pharmaceuticals Co., Ltd. Address before: 130012 No. 72 Tianhe street, hi tech Development Zone, Jilin, Changchun Patentee before: Jinsai Drug Co., Ltd., Changchun |
|
| CP03 | Change of name, title or address | ||
| CP01 | Change in the name or title of a patent holder | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 130012 No. 72 Tianhe street, hi tech Industrial Development Zone, Jilin, Changchun Patentee after: Jinsai Drug Co., Ltd., Changchun Address before: 130012 No. 72 Tianhe street, hi tech Industrial Development Zone, Jilin, Changchun Patentee before: Changchun Genscience Pharmaceuticals Co., Ltd. |