CN101134953B - Recombinant human pancreas kininogenase - Google Patents
Recombinant human pancreas kininogenase Download PDFInfo
- Publication number
- CN101134953B CN101134953B CN2007101235409A CN200710123540A CN101134953B CN 101134953 B CN101134953 B CN 101134953B CN 2007101235409 A CN2007101235409 A CN 2007101235409A CN 200710123540 A CN200710123540 A CN 200710123540A CN 101134953 B CN101134953 B CN 101134953B
- Authority
- CN
- China
- Prior art keywords
- kininogenase
- human pancreas
- recombinant human
- cell
- wash
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to one kind of recombinant kallidinogenase and its preparation process. The recombinant kallidinogenase is produced by means of molecular biological technology and with host cell for expressing recombinant protein, and is purified through an affinity chromatographic process. It has several clinical uses and less side effects.
Description
Technical field
The present invention relates to a kind of recombinant human pancreas kininogenase and new preparation method thereof.More particularly, the present invention relates to utilize Protocols in Molecular Biology to obtain the host cell of express recombinant human pancreas kininogenase, cultivate or fermentation process production host cell with mass cell, use the affinity chromatography method to extract recombinant human pancreas kininogenase from cell or in the cell exocrine thing, the native protein that extracts in the sugar chain structure ratio of components people urine of this recombinant human pancreas kininogenase is more complicated, serve many purposes clinically, have littler side effect.
Background technology
People's kininogenase gene is the big multigene family of a class, is made up of 15 genes (KLK1-KLK15) at least.But have only pancreas/kidney kininogenase gene (KLK1 gene) encoded protein to have the kininogenase activity, other family member does not nearly all have the kininogenase activity.Human pancreas kininogenase can act on the prokinin substrate, make it to discharge the kassinin kinin of biologically active, the special receptor bound energy produces a series of biological effects on kassinin kinin and the target organ, as the vasodilation blood flow increasing, improve sanguimotor effect, and increase the effect that erythrocytic deformability and anticoagulant, prolongation recalcification time improve hyperlipidemia in addition.
The people of having gone on the market at present urinates the kininogenase product in source, and promptly Human Urinary Kallidinogenase is the glycoprotein that extracts from people's urine.Its amino acid is formed identical with the aminoacid sequence of human pancreas kininogenase, and still, there are Glu/Lys two seed amino acids in proteic 162 sites of kininogenase of extracting from people's urine, and this amino acid whose polymorphism is to the unknown that influences of enzymic activity.End user's urinary kallidinogenase finds that the too fast meeting of intravenous drip causes patient's blood pressure sharply to descend the degradation adverse side effect, has brought certain risk to patient clinically.In addition, the people urinates and collects difficulty, and people's urine protein resource is very limited.It comes source range wide more, and composition is complicated more, may contain compositions such as virus.Simultaneously high-end market such as America and Europe generally not the receiver urinate product-derived.
The development of Protocols in Molecular Biology makes and utilizes host cell expression and large-scale production of recombinant proteins to become possibility, utilizes gene expression method to produce recombinant protein at present and replaced traditional native protein method of extracting from natural resources.For glycoprotein, generally be that the gene with coding glycoprotein changes mammalian cell over to, particularly Chinese hamster ovary cell (Chinese Hamster Ovary, CHO), with produce with native protein near and the recombinant protein of biologically active.
The KLK1 gene is positioned at karyomit(e) 19q13.4, and its size is 6.55kb, and the coding region is 874bp.The kininogenase (being precursor protein) that 262 amino acid of KLK1 full-length gene coding are formed comprises 17 amino acid signal albumen, 7 amino acid proenzyme fragments and 238 amino acid maturation proteins.Kininogenase is further cut and is processed into the ripe human pancreas kininogenase of biologically active in vivo by proteolytic enzyme.The KLK1 gene is expressed the highest at pancreas, kidney and sialisterium.
Human pancreas kininogenase is a kind of glycoprotein, contains 14.4% sugar in the molecule, comprises three N glycosylation sites in its structure, lays respectively at Asn78, Asn84 and Asn141.Studies show that, when human pancreas kininogenase is expressed in Chinese hamster ovary celI, its degree of glycosylation of CHO large scale culturing condition influence, and then also have influence on its intravital activity.Therefore, select suitable CHO culture condition, the active human pancreas kininogenase similar, that side effect is little of preparation becomes scientific research person's the up-to-date difficult problem of capturing.
Summary of the invention
The present invention changes this gene over to host cell and expresses by Protocols in Molecular Biology clone KLK1 gene, and contains the cell of recombinant protein with cell cultures or fermentation process mass production, extracts recombinant human pancreas kininogenase from cell or exocytosis liquid.Preferably, utilize the large scale culturing Chinese hamster ovary celI to prepare recombinant human pancreas kininogenase.This recombinant human pancreas kininogenase has multiple use clinically, and specific activity is similar mutually, side effect is little to urinate the kininogenase in source with the people, especially to the littler characteristics of blood pressure drops influence.
An object of the present invention is to obtain a kind of recombinant human pancreas kininogenase by cell cultures or fermentation process.Specifically, the present invention is the host cell that utilizes Protocols in Molecular Biology clone's KLK1 gene and obtain the express recombinant human pancreas kininogenase; Utilize mass cell cultivation or fermentation process to carry out the mass production of the host cell of express recombinant human pancreas kininogenase, adopt affinity chromatography method purifying to obtain recombinant human pancreas kininogenase.
Another object of the present invention is the purposes that recombinant human pancreas kininogenase is used to prepare the medicine for the treatment of cerebral infarction.
Preferably, the host cell of express recombinant human pancreas kininogenase is a mammalian cell, Chinese hamster ovary celI particularly, and the large scale culturing of this host cell adopts the perfusion reactor to carry out perfusion culture.By optimizing the degree of glycosylation that culture condition has improved cell stand density and expression product.
The invention provides a kind of recombinant human pancreas kininogenase, wherein said recombinant human pancreas kininogenase is formed a strand by 238 amino-acid residues, N-end and C-terminal amino acid residue are respectively Isoleucine and Serine, contain 5 couples of S-S key in the molecule, by the SDS-PAGE cataphoretic determination, its molecular weight is 35.0-44.0KDa, its-level structure is:
Contain 5 couples of S-S key in the described recombinant human pancreas kininogenase molecule, be respectively Cys7-Cys150, Cys26-Cys42, Cys29-Cys196, Cys161-Cys175 and Cys186-Cys211, iso-electric point is about 4.0, contains 14.4% sugar in the molecule, and binding site lays respectively at Asn78, Asn84 and Asn141.
This recombinant human pancreas kininogenase is a kind of glycoprotein, and the glycosylation binding site lays respectively at Asn78, Asn84 and Asn141.
Amino acid on bold-type letter (Glu) expression 162 sites in this recombinant human pancreas kininogenase primary structure.
The degree of glycosylation of recombinant human pancreas kininogenase of the present invention depends primarily on sialic level in the sugar chain.By the SDS-PAGE cataphoretic determination, existing Human Urinary Kallidinogenase molecular weight is 39.0-43.0KDa, recombinant human pancreas kininogenase of the present invention is 35.0-44.0KDa, the electrophoresis band zone of recombinant human pancreas kininogenase is wideer than existing Human Urinary Kallidinogenase, recombinant human pancreas kininogenase is described because the difference of its degree of glycosylation, the difference of especially sialylated degree, promptly recombinant human pancreas kininogenase has more complicated glycosylation composition than existing Human Urinary Kallidinogenase.In addition, the albumen that the recombinant human pancreas kininogenase of the present invention's preparation is made up of single peptide chain is only expressed Glu one seed amino acid on its 162 site; And there are Glu/Lys two seed amino acids in the egg white mixture that existing Human Urinary Kallidinogenase albumen is made up of two peptide chains on its 162 site, and this amino acid whose polymorphism to the influence of enzymic activity still under study for action.
Recombinant human pancreas kininogenase preparation of the present invention comprises that the expression plasmid, the mass cell that utilize gene recombination technology clone KLK1DNA, structure to contain this gene DNA sequence of encoding are cultivated or fermentation process is produced the host cell of express recombinant protein and the purifying of recombinant protein.
The preparation method of recombinant human pancreas kininogenase of the present invention is as follows:
1. the dna sequence dna according to KLK1 designs primer, adopt the RT-PCR method from human pancreas's KLK1DNA sequence that increases, this dna sequence dna comprises the DNA of cDNA (sequence 1 in the sequence table, GenBank NM_002257), genomic dna (sequence 2 in the sequence table) and synthetic.
2. KLK1DNA is cloned into expression vector, makes up the expression plasmid that contains KLK1DNA.Expression vector comprises prokaryotic expression carrier (as pET-32a), Yeast expression carrier (as pPIC9) or carrier for expression of eukaryon (as pcDNA3.1).For the situation of carrier for expression of eukaryon, for stability and its transformation period of prolongation of improving recombinant human pancreas kininogenase, inserted human IgG l Fc fragment at carrier for expression of eukaryon, make up and contain KLK1 and the segmental eukaryon expression plasmid of Fc.
3. will contain the KLK1DNA expression plasmid and change host cell over to, host cell comprises prokaryotic cell prokaryocyte (as intestinal bacteria), yeast (as pichia spp) or mammalian cell (as CHO, the NSO cell).Preferably, with the eukaryon expression plasmid transfection CHO cell, the cell strain of screening stable transfection.
4. with the host cell of fermentation process or mass cell cultural method mass production express recombinant human pancreas kininogenase; Preferably, by the Chinese hamster ovary celI of bio-reactor large scale culturing express recombinant human pancreas kininogenase, its step is as follows:
A) cell strain that will contain express recombinant protein is cultivated with the DMEM substratum (pH7.20) that contains the 5-10% foetal calf serum, after in serum free medium, adopting conventional method to carry out adaptation of virus then, suspension batch cultivation is on a small scale put in 37 ℃ of temperature, the 5%CO2 incubator and is hatched growth.Be inoculated in and carry out the cell cultured continuously in the cell cultures jar, inoculum density is 1.0 * 105/ml-5.0 * 105/ml, and is preferred, 3.0 * 105/ml.37 ℃ of culture temperature, pH7.2, rotating speed 50-120rpm/min, preferred 90rpm/min, dissolved oxygen 50% air saturation and air flow 0.1Lpm.
B) in serum free medium, cultivate after 24-72 hour, preferred, in serum free medium, cultivate after 48 hours, the serum free medium perfusion is entered bio-reactor carry out perfusion culture.Rate of flooding needs to regulate according to the residual sugar amount in the substratum.Keep the residual sugar amount at 0.8-1.2g/L; Extract a jar interior a small amount of nutrient solution, its external activity of detection and tracking..Incubation time was 28 days, received liquid since the 6th day, and high-cell density can reach 0.8 * 107/ml-2 * 107/ml, and is preferred, 1 * 107/ml.
C) collect the substratum that contains the express recombinant human pancreas kininogenase, filter and remove cell debris.Supernatant liquor is used for the purifying of recombinant protein.
5. purification of recombinant proteins from the cell of the express recombinant human pancreas kininogenase of a large amount of cultivations.Preferably, from the expressing cho cell recombinant human pancreas kininogenase, this proteic purifying may further comprise the steps:
A) will contain the substratum ultrafiltration and concentration of recombinant human pancreas kininogenase after, last expanding bed reinforcing yin essence ion exchange column (Streamline Q XL, GE Healthcare company), the flushing pillar to OD
280＜0.2; With containing 0.3M NaCl and 0.02mol/L Tris buffer elution pillar.
B) collect liquid at above-mentioned wash-out and add (NH
4)
2SO
4, adjust with HCl that the phenyl Sepharose flows gel (phenyl Sepharose6Fast Flow, GE Healthcare company) fast on pH7.0 ± 0.1.Elutriant uses the 10000MWCO membrane ultrafiltration to 3L.Add the 90g Trisodium Citrate, with HCl adjust pH to 7.0 ± 0.2,60 ℃ of thermostatically heating are 10 hours then.After the heating solution is transferred pH8.0 ± 0.1, last benzene is pricked pyrimidine cross-linked agarose gel post (Benzamidine Sepharose6B), flushing, wash-out.
C) regulate above-mentioned wash-out and collect liquid pH4.0 ± 0.1, last SP sepharose FF post (SpSepharose
TMFast Flow, GE Healthcare company), wash to effluent liquid OD280＜0.15, wash-out is collected OD280〉0.1 wash-out effluent liquid.Wash-out is collected liquid transfer pH7.0, carry out ultrafiltration and concentration, obtain the recombinant human pancreas kininogenase albumen of purifying with the 10000MWCO film.Measure the enzymic activity of purifying protein with the esterase method.
Carry out the large scale culturing cell and have following feature with aforesaid method: measure by the SDS-PAGE electrophoresis method in conjunction with recombinant human pancreas kininogenase based on the preparation of affinity chromatography technology, wide (recombinant human pancreas kininogenase is 38.0-43.0KDa, and the Human Urinary Kallidinogenase molecular weight is 40.0-43.0KDa) than existing Human Urinary Kallidinogenase in the electrophoresis band of recombinant human pancreas kininogenase zone; Recombinant human pancreas kininogenase is described because the difference of its degree of glycosylation has more complicated composition than existing Human Urinary Kallidinogenase.The result who measures enzymic activity by the esterase method shows that recombinant human pancreas kininogenase is close with existing Human Urinary Kallidinogenase activity.
The present invention is owing to adopted specific large scale culturing condition and fermentation process, thereby make the degree of glycosylation of the recombinant human pancreas kininogenase that obtains and existing Human Urinary Kallidinogenase different, side effect obviously reduces in clinical application, especially blood pressure drops in the body is comparatively relaxed.Though cause the little mechanism of recombinant human pancreas kininogenase side effect and not really clear, we infer it may is because sugar chain structure is different, cause in vivo performance more excellent usefulness.
Through the recombinant human pancreas kininogenase of intravenous administration, generally be solid sterilized form, i.e. lyophilized injectable powder.Can be dissolved in use in sterilized water for injection or various other injection sterile medium.Recombinant human pancreas kininogenase composition through intravenous administration also can be an aqueous solution form, promptly injects liquor.
The dosage that the application recombinant human pancreas kininogenase uses was clinically decided according to severity, the treatment time of the state of an illness, and general intravenous administration amount is administration every day 1-3 times, each 0.005-2.5PNA unit.Preferably, the dosage of medicine is every day 1 time, each 0.1-0.2PNA unit.
PNA unit is defined as: under 37 ℃, pH8.0 condition, hydrolysis substrate Val-Leu-Arg-PNA discharged the free PNA of 1 μ mol in 1 minute, was 1PNA unit.
Description of drawings
Accompanying drawing 1: the SDS of recombinant human pancreas kininogenase of the present invention and existing Human Urinary Kallidinogenase-PAGE electrophorogram.1, recombinant human pancreas kininogenase; 2, Human Urinary Kallidinogenase; 3, the contrast of protein standard molecular weight.
Embodiment
Embodiment 1: the clone of human pancreas kininogenase gene (KLK1 gene)
Material and method: with the total RNA of people's kidney is template, obtains the full-length cDNA of KLK earlier by reverse transcription test kit (American I nvitrogen company).Be template with this cDNA then, the 1-496bp of the KLK that increases at first respectively (is 1 with ATG) and two fragments of 476-789bp use 5 ' and 3 ' to hold primer by overlap extension pcr two fragment assemblies to be become complete KLK gene then.The segmental PCR reaction conditions of amplification KLK: 94 ℃ of 3min sex change; 94 ℃ of 30s; 62 ℃ of 30s; 72 ℃ of 30s; 34 circulations of increasing; Finish reaction behind 72 ℃ of extension 5min.
The 1-496 the primer of amplification KLK is:
Upstream primer: 5 ' GCCTCGCCCTGTCCCTGGGGGGGACTGGTGCTGCGCCCCCGATTCAGTCCCGGATT GTGG3 '
Downstream primer: 5 ' AATTCTCTGGTTCGATGCTGC3 '
Pcr amplification 476-789bp fragment the primer is:
Upstream primer: 5 ' GCAGCATCGAACCAGAGAATTTCTCATTTCCAGATGATCTC3 '
Downstream primer: 5 ' GACACCATAGCGGAGAACTCCTGA3 '
PCR splices two fragment the primers:
Upstream primer: 5 ' GCCTCGCCCTGTCCCTGGGGGGGACTGGTGCTGCGCCCCCGATTCAGTCCCGGATT GTGG3 '
Downstream primer: 5 ' GACACCATAGCGGAGAACTCCTGA3 '
The result:
The KLK1 full length gene sequence of being cloned into through aforesaid method is seen sequence 1 in the sequence table, indicate in the sequence 1 underscore _ base be two pleomorphism sites, the corresponding position is respectively T and G among the GenBank.With the people KLK1 gene pairs ratio that GenBank delivers, clone's KLK1 gene locates to exist two sudden changes at the 405th and 433, and this two places sudden change is the pleomorphism site of having reported in the document.
According to the corresponding primer of genome sequence design, obtained the genomic dna of KLK1 with the RT-PCR method, see sequence 2 in the sequence table, capitalization is partly represented genomic dna sequence exon part, and lowercase is partly represented genomic dna sequence non-coding region and intron part.
Embodiment 2: the structure that contains reorganization KLK1 gene expression plasmid
Xho I and EcoR I site with total length KLK1 gene inserts carrier pcDNA3.1/myc-His (-) A that contains the CMV strong promoter have made up the pcDNA3.1-KLK1 eukaryon expression plasmid.
Make up the pcDNA3.1-KLK1 the primer:
Upstream primer: 5 ' GTGA
CTCGAGACCATGGGGTTCCTGGTTCTGTGC3 ' (underscore is an Xho I restriction enzyme site)
Downstream primer: 5 ' ATCT
GAATTCTCAGGAGTTCTCCGCTATGGTGTC3 ' (underscore is an EcoR I restriction enzyme site).
In addition, contain human pancreas kininogenase and human IgGl Fc fragment so that express more stable in vivo fusion rotein in order to make up, insert human IgGl Fc fragment at the EcoR of pcDNA3.1-KLK1 I and BamH I site, made up the pcDNA3.1-KLK1-Fc eukaryon expression plasmid.The Fc fragment is positioned at the C end of KLK1 gene, connects by the EcoRI restriction enzyme site.
Embodiment 3: expression and the preparation thereof of recombinant human pancreas kininogenase in eukaryotic cell
Method:
1.KLK1 the expression of gene in Chinese hamster ovary celI:
Chinese hamster ovary celI is cultivated in containing the DMEM substratum of 10% foetal calf serum, in 5%CO
2, 37 ℃ hatch.With the pcDNA3.1-KLK eukaryon expression plasmid transfection CHO cell of cationic-liposome (LipofectAMINE2000, Invitrogen company), with G418 screening transfectional cell with the foregoing description 2 preparations; And then by the mono-clonal stable cell line after enzyme assay and the Western Blot evaluation G418 screening.
2. the host cell of large scale culturing express recombinant human pancreas kininogenase:
A) cell strain that will contain express recombinant protein is cultivated with the DMEM substratum (pH7.20) that contains 5% foetal calf serum, after in serum free medium, adopting conventional method to carry out adaptation of virus, suspension batch cultivation is on a small scale put in 37 ℃ of temperature, the 5%CO2 incubator and is hatched growth.Be inoculated in the 5L cell cultures jar (New Brunswick Scientific Co.USA) and carry out the cell cultured continuously, inoculum density is 3.0 * 105/ml.37 ℃ of culture temperature, pH7.2, rotating speed 90rpm/min, dissolved oxygen 50% air saturation and air flow 0.1Lpm.
B) in serum free medium, cultivate after 48 hours, serum-free perfusion culture base is entered bio-reactor with the irrigation rate perfusion of 0.6V/V/day carry out perfusion culture.Along with the continous pouring of fresh culture, cell number increases gradually, and rate of flooding needs to regulate according to the residual sugar amount in the substratum.When every day during perfusion 〉=5L, keep the residual sugar amount at 0.8-1.2g/L; Extract a jar interior a small amount of nutrient solution, its external activity of detection and tracking..Incubation time was 28 days, received liquid since the 6th day, and high-cell density can reach 1.1 * 107/ml.
C) collect the substratum that contains the express recombinant human pancreas kininogenase, filter and remove cell debris.Supernatant liquor is used for the purifying of recombinant protein.
3. the purifying of recombinant protein may further comprise the steps:
A) collect the serum free medium that 10L contains recombinant human pancreas kininogenase, behind the ultrafiltration and concentration, last expanding bed reinforcing yin essence ion-exchange (Streamline Q XL, GE Healthcare company) ion exchange column is with containing 0.15M NaCl and 0.02mol/L Tris buffering flushing pillar to OD280＜0.2; With containing 0.3M NaCl and 0.02mol/L Tris buffer elution pillar.
B) collect liquid at above-mentioned 20L wash-out and add 1800g (NH4) 2SO4, adjust pH7.0 ± 0.1 with HCl, last phenyl Sepharose flows gel (phenyl Sepharose6Fast Flow, GEHealthcare company) fast.With 0.7M (NH4) 2SO4 damping fluid flushing pillar.Carry out the wash-out pillar with 0.4M (NH4) 2SO4 damping fluid, elutriant with 10000 membrane ultrafiltration to 3L.Add the 90g Trisodium Citrate, with HCl adjust pH to 7.0 ± 0.2,60 ℃ of thermostatically heating are 10 hours then.After the heating solution transferred pH8.0 ± 0.1, last benzene is pricked pyrimidine cross-linked agarose gel post (Benzamidine Sepharose6B, GE Healthcare company), with containing 0.1M NaCl and 0.02mol/L Tris washes, carry out wash-out with containing 0.4M NaCl and 0.02mol/L Tris buffering.
C) regulate above-mentioned wash-out and collect liquid pH4.0 ± 0.1, last SP sepharose FF post (SpSepharoseTM Fast Flow, GE Healthcare company), wash to effluent liquid OD280＜0.15 with 0.1M NaAc-HAc damping fluid, with containing 0.1M NaCl and 0.1M NaAc-HAc buffered soln carries out wash-out, collect OD280〉0.1 wash-out effluent liquid.Wash-out is collected liquid transfer pH7.0, carry out ultrafiltration and concentration with 10,000 ultra-filtration membranes.
4. activity determination method:
Configuration contains the Human Urinary Kallidinogenase of equivalent amount of active and the sample solution of recombinant human pancreas kininogenase respectively, in sample solution, add substrate S-2266 (H-D-Val-Leu-Arg-PNA2HCl), put in 37 ± 0.5 ℃ of water-baths accurate response 15 minutes, measure the absorption value A of each sample at 405nm wavelength place, the A value is controlled between 0.1～0.2.With A value substitution following formula calculated activity unit:
PNA unit/ml=173.6 * A * T/1000
Annotate: 173.6 is reaction constant in the formula; T is an extension rate; 1000 is the unit conversion value of unit/L and unit/ml
Activity unit is defined as: under the condition of 37 ℃ of pH8.0, the enzyme amount of hydrolysis in 1 minute 1 μ molVal-Leu-Arg-PNA is called 1PNA unit.
The result:
Under the regulation and control of CMV strong promoter, Chinese hamster ovary celI is arrived in the KLK1 gene transfection, by enzyme assay and the high mono-clonal stable cell line of Western Blot Analysis and Screening enzymic activity, carrying out mass cell by the bio-reactor perfusion cultivates, collection contains the serum free medium of recombinant human pancreas kininogenase, carry out purifying, obtain the recombinant human pancreas kininogenase of purifying.The result who measures enzymic activity by the esterase method shows that recombinant human pancreas kininogenase is close with the Human Urinary Kallidinogenase activity, is respectively 7.1 and 6.8PNA/mg albumen.
Perfusion culture is injected fresh substratum on the one hand continuously in reactor, continuously take out the nutrient solution of equivalent again simultaneously, but do not take out cell in the process, and cell is still stayed in the reactor, makes cell be in the continuous state of a kind of nutrition.Cell density reaches 10 after optimizing culture condition
7/ ml during the high-density culture zooblast, must guarantee replenish to give cell with enough nutrition and remove the malicious metabolite of being always or usually as specified.Pour into fresh nutrient solution during perfusion culture, can guarantee the realization of above-mentioned purpose.By regulating rate of flooding, can remain on stable, useless metabolite to culturing process and be lower than and suppress under the horizontal state.Adopt the superiority of perfusion culture to be to have improved greatly the cell stand density, help the expression and the purifying of product simultaneously.
Existing report shows that the degree of Protein Glycosylation Overview is subjected to influence of various factors, as large scale culturing condition and fermentation process etc.The recombinant human pancreas kininogenase of purifying and existing Human Urinary Kallidinogenase molecular weight are by the SDS-PAGE cataphoretic determination, and the result as shown in Figure 1.From accompanying drawing 1 as can be seen, existing Human Urinary Kallidinogenase molecular weight is 39.0-43.0KDa, recombinant human pancreas kininogenase of the present invention is 35.0-44.0KDa, the electrophoresis band zone of recombinant human pancreas kininogenase is wideer than Human Urinary Kallidinogenase, recombinant human pancreas kininogenase is described because the difference of its degree of glycosylation, the difference of especially sialylated degree, promptly recombinant human pancreas kininogenase has more complicated glycosylation composition than Human Urinary Kallidinogenase.
Embodiment 4 recombinant human pancreas kininogenases are to the influence of new zealand rabbit blood pressure
Animal and grouping:
18 of new zealand rabbits, body weight 2.0-3.0kg, male and female half and half.Raise in illumination abundance, the good animal housing of heating ventilation and air-conditioning equipment, room temperature is controlled at 20-25 ℃, and humidity is 40-65%.Animal is divided into 3 groups at random, 6 every group:
1. control group: sodium chloride injection
2. recombinant human pancreas kininogenase group
3. Human Urinary Kallidinogenase group
Detect index and method: after 20% urethane (5ml/kg) intravenous injection anesthesia, tracheostomize inserts trachea cannula.One bilateral common carotid artery intubate also links to each other with pressure transducer, through AP-601G amplifier measuring femoral blood pressure.Be worth in contrast in the initial arterial pressure of blood pressure index stable back record, intravenous administration (2ml/Kg) has regularly at the uniform velocity been annotated in 20min then, and control group gives the equal-volume sodium chloride injection.Write down after the administration 5,15,30,45 respectively, the mean arterial pressure of 60min time point.Shot recombinant human pancreas kininogenase and Human Urinary Kallidinogenase dosage are 0.005PNA/Kg, dilute with sodium chloride injection.
The result:
Each is organized, and the detected result of new zealand rabbit different time points mean arterial pressure value is following to see Table 1:
Table 1: each organize new zealand rabbit different time points mean arterial pressure (KPa) variation (x ± SD, n=6)
Annotate: wherein 1. group is the sodium chloride injection control group, and 2. group is the recombinant human pancreas kininogenase group, and 3. group is the Human Urinary Kallidinogenase group.In addition, * and * * represent interior different time point pressure of each group and original pressure respectively relatively, P＜0.05 and P＜0.01.
As can be seen from Table 1, control group and recombinant human pancreas kininogenase group begin in the whole observing time that injection finishes from injection, mean arterial pressure is more stable, obviously fluctuation does not appear, the Human Urinary Kallidinogenase group then blood pressure promptly occurs at administration 5min and obviously descends, and intravenously administrable finishes the mean arterial pressure before back 40min recovers injection.
Experimental result shows, recombinant human pancreas kininogenase and Human Urinary Kallidinogenase have notable difference to the influence of rabbits blood pressure, to not obviously influence of blood pressure, Human Urinary Kallidinogenase then shows the decline effect to blood pressure of short-term to recombinant human pancreas kininogenase under above-mentioned administration condition.
Sequence table
Sequence 1: the KLK1 full length gene sequence of being cloned into
Sequence 2:KLK1 genome sequence
Claims (3)
1. the preparation method of a recombinant human pancreas kininogenase, wherein said recombinant human pancreas kininogenase is formed a strand by 238 amino-acid residues, N-end and C-terminal amino acid residue are respectively Isoleucine and Serine, by the SDS-PAGE cataphoretic determination, its molecular weight is 35.0-44.0KDa, and its primary structure is:
Contain 5 pairs of S-S keys in its molecule, be respectively Cys7-Cys150, Cys26-Cys42, Cys129-Cys196, Cys161-Cys175 and Cys186-Cys211, iso-electric point is about 4.0, contain 14.4% sugar in the molecule, binding site lays respectively at Asn78, Asn84 and Asn141
Described recombinant human pancreas kininogenase is to be prepared by following steps:
1), adopt the RT-PCR method from human pancreas's KLK1 DNA sequence that increases according to the dna sequence dna of KLK1 design primer;
2) KLK1DNA is cloned into carrier for expression of eukaryon, makes up the eukaryon expression plasmid that contains KLK1DNA;
3) will contain the KLK1DNA expression plasmid and change Chinese hamster ovary celI over to;
4) with the Chinese hamster ovary celI of fermentation process or mass cell cultural method mass production express recombinant human pancreas kininogenase, its step is as follows:
A) cell strain that will contain express recombinant protein is cultivated with the DMEM substratum that contains the 5-10% foetal calf serum, and after the conventional method of employing was carried out adaptation of virus in serum free medium then, 37 ℃ of temperature, 5%CO were put in batch cultivation that suspends on a small scale
2Hatch growth in the incubator, be inoculated in and carry out the cell cultured continuously in the cell cultures jar, inoculum density is 1.0 * 10
5Individual/ml-5.0 * 10
5Individual/ml, 37 ℃ of culture temperature, pH7.2, rotating speed 50-120rpm, dissolved oxygen 50% air saturation and air flow 0.1Lpm;
B) in serum free medium, cultivate after 24-72 hour, the serum free medium perfusion is entered bio-reactor carry out perfusion culture, keep the residual sugar amount at 0.8-1.2g/L;
C) collect the substratum that contains the express recombinant human pancreas kininogenase, filter and remove cell debris, supernatant liquor is used for the purifying of recombinant protein;
5) purification of recombinant proteins from the cell of the express recombinant human pancreas kininogenase of a large amount of cultivations, this proteic purifying may further comprise the steps:
A) will contain the substratum ultrafiltration and concentration of recombinant human pancreas kininogenase after, last expanding bed reinforcing yin essence ion exchange column, the flushing pillar to OD
280＜0.2; Use the buffer solution elution pillar;
B) collect liquid at above-mentioned wash-out and add (NH
4)
2SO
4Flow gel fast with phenyl Sepharose on the HCl adjustment pH 7.0 ± 0.1, elutriant uses the 10000MWCO membrane ultrafiltration to 3L, add the 90g Trisodium Citrate, with HCl adjust pH to 7.0 ± 0.2,60 ℃ of thermostatically heating are 10 hours then, after the heating solution transferred pH8.0 ± 0.1, last benzene is pricked pyrimidine cross-linked agarose gel post, flushing, wash-out;
C) regulate above-mentioned wash-out and collect liquid pH4.0 ± 0.1, last SP sepharose FF post, wash to effluent liquid OD280＜0.15, wash-out, collect the wash-out effluent liquid of OD280＞0.1, wash-out is collected liquid transfer pH7.0, carry out ultrafiltration and concentration, obtain the recombinant human pancreas kininogenase albumen of purifying with the 10000MWCO film.
2. the preparation method of recombinant human pancreas kininogenase according to claim 1, wherein the KLK1DNA sequence in the step 1) comprises the DNA of cDNA, genomic dna and synthetic.
3. the preparation method of recombinant human pancreas kininogenase according to claim 2, wherein step 4) a) in, described inoculum density is 3.0 * 10
5Individual/ml, rotating speed is 90rpm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007101235409A CN101134953B (en) | 2007-07-02 | 2007-07-02 | Recombinant human pancreas kininogenase |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007101235409A CN101134953B (en) | 2007-07-02 | 2007-07-02 | Recombinant human pancreas kininogenase |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010101989624A Division CN101967468A (en) | 2007-07-02 | 2007-07-02 | Recombinant human kallidinogenase |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101134953A CN101134953A (en) | 2008-03-05 |
| CN101134953B true CN101134953B (en) | 2011-02-09 |
Family
ID=39159277
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007101235409A Active CN101134953B (en) | 2007-07-02 | 2007-07-02 | Recombinant human pancreas kininogenase |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101134953B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2010228068A1 (en) * | 2009-03-25 | 2011-10-20 | Diamedica Inc. | Tissue kallikrein for the treatment of pancreatic beta-cell dysfunction |
| CN101928346B (en) * | 2009-07-31 | 2013-01-16 | 华中科技大学同济医学院附属同济医院 | Monoclonal antibody of anti-human tissue kallikrein and preparation method thereof |
| CN104861057B (en) * | 2015-04-03 | 2016-04-27 | 广州优联康医药科技有限公司 | Recombinant human kallidinogenase and application thereof |
| CN107802827B (en) * | 2017-11-29 | 2019-01-22 | 广东天普生化医药股份有限公司 | A kind of recombination kallikrein freeze-dried powder preparation |
| CN109091667B (en) * | 2018-09-18 | 2020-05-05 | 广东天普生化医药股份有限公司 | Application of human urinary kallidinogenase in preparing medicine for treating migraine and composition thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4252902A (en) * | 1978-07-25 | 1981-02-24 | Toho Pharmaceutical Industries Co., Ltd. | Process for purification of crude kallikrein |
| CN1142984A (en) * | 1995-12-04 | 1997-02-19 | 广州市博普生物技术有限公司 | Double functional chromatographic material and preparing method and use |
| CN1403156A (en) * | 2002-05-13 | 2003-03-19 | 广东天普生化医药股份有限公司 | Application of human urokininogenase in preparing medicine for preventing and treating cerebral infraction |
-
2007
- 2007-07-02 CN CN2007101235409A patent/CN101134953B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4252902A (en) * | 1978-07-25 | 1981-02-24 | Toho Pharmaceutical Industries Co., Ltd. | Process for purification of crude kallikrein |
| CN1142984A (en) * | 1995-12-04 | 1997-02-19 | 广州市博普生物技术有限公司 | Double functional chromatographic material and preparing method and use |
| CN1403156A (en) * | 2002-05-13 | 2003-03-19 | 广东天普生化医药股份有限公司 | Application of human urokininogenase in preparing medicine for preventing and treating cerebral infraction |
Non-Patent Citations (2)
| Title |
|---|
| 屈艺等.人激肽释放酶基因克隆及针和表达的实验研究.药物生物技术第9卷 第5期..2002,第9卷(第5期.),第256-259页. |
| 屈艺等.人激肽释放酶基因克隆及针和表达的实验研究.药物生物技术第9卷 第5期.2002,第9卷(第5期.),第256-259页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101134953A (en) | 2008-03-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| TW516962B (en) | A human TNFR1-IgG1 preparation | |
| Paborsky et al. | Purification of recombinant human tissue factor | |
| US4954437A (en) | Cell encoding recombinant human erythropoietin | |
| CN101134105B (en) | Pharmaceutical composition containing recombination human pancreatic kininogenase for treating and/or preventing cerebral infarction | |
| CN101134953B (en) | Recombinant human pancreas kininogenase | |
| CN107267460A (en) | Cell for producing the restructuring sulfatase of idose 2 | |
| JP6230158B2 (en) | A novel high-functional enzyme that converts the substrate specificity of human β-hexosaminidase B and imparts protease resistance | |
| CN109053893A (en) | A kind of anti-D-dimer antibody and preparation method thereof | |
| CN110305903A (en) | Gonal-F and preparation method thereof | |
| CN102532316B (en) | Anti-vWF (von Willebrand factor) monoclonal antibody and application thereof | |
| CN110090295B (en) | Application of Ephrin-B1 in preparation of medicine for treating inflammatory bowel disease | |
| CN101967468A (en) | Recombinant human kallidinogenase | |
| CN103710367B (en) | A kind of recombined human kallikrein 1 and encoding gene thereof and preparation method | |
| CN107108754A (en) | The antitrypsins of α 1 (A1AT) fusion protein and application thereof | |
| CN101319207B (en) | Site-directed mutagenesis genetic engineering batroxobin and uses thereof | |
| KR100382628B1 (en) | Interferonα / β-binding Protein and Its Preparation and Use | |
| CN101173003A (en) | Hundred-paced pit viper toxin thrombinogen excitor, coded sequence and uses thereof | |
| CN101481692B (en) | Non-blood serum preparation of recombinant human blood coagulation factor IX | |
| CN101092598A (en) | Using methanol yeast to produce human kallikrein - 1 | |
| CN101897959A (en) | Recombinant human pancreatic kininogenase-containing medicine for treating and/or preventing cerebral infarction | |
| CN103374067A (en) | Method for preparing human epididymis protein 4 (HE4) recombinant protein in mammalian cell | |
| CN101897953A (en) | Non-invasive high-penetrability epidermal growth factor and application thereof | |
| KR20230015418A (en) | Interleukin-1 receptor antagonist and fusion protein containing the same | |
| CN109134653A (en) | A kind of preparation method of Procalcitonin antibody | |
| CN108559740A (en) | Recombinant ancrod enzyme and commercial scale preparation method and the application for treating acute cerebral infarction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |