CN101897959A - Recombinant human pancreatic kininogenase-containing medicine for treating and/or preventing cerebral infarction - Google Patents

Abstract

The invention relates to the use of recombinant human pancreatic kininogenase composite in the preparation of medicine for treating and/or preventing the cerebral infarction. Recombinant human pancreatic kininogenase is prepared by being combined with a host cell expressing the recombinant protein by means of molecular biology technology, thus having obvious treatment and/or prevention function(s) for the cerebral infarction. The recombinant human pancreatic kininogenase is generally used in a form of pharmaceutical composite such as freeze-dried powder injection or liquid injection.

Description

Be used for the treatment of and/or the medicine that contains recombinant human pancreas kininogenase of prevention of brain infraction

(1) technical field

The present invention relates to a kind of recombinant human pancreas kininogenase medicine, its preparation method and the purposes in pharmacy.More particularly, the present invention relates to utilize Protocols in Molecular Biology to prepare recombinant human pancreas kininogenase, the invention still further relates to the pharmaceutical composition that contains recombinant human pancreas kininogenase in conjunction with the mass cell cultural method.The invention further relates to the purposes of recombinant human pancreas kininogenase in the medicine of preparation treatment and prevention of brain infraction.

(2) background technology

Human pancreas kininogenase can act on the kininogen substrate, make it to discharge and have vasoactive kassinin kinin, the special receptor binding energy produces a series of biological effects on kassinin kinin and the target organ, as the blood vessel dilating blood flow increasing, improve sanguimotor effect, and increase the effect that erythrocytic morphotropism and anticoagulant, prolongation recalcification time improve hyperlipidemia in addition.

The kininogenase product in the Urina Hominis source of having gone on the market at present, promptly the Human Urinary Kallidinogenase is the glycoprotein that extracts from Urina Hominis.Its aminoacid is formed identical with the aminoacid sequence of human pancreas kininogenase, and still, there are Glu/Lys two seed amino acids in proteic 162 sites of the kininogenase that extracts from Urina Hominis, and this amino acid whose polymorphism is to the unknown that influences of enzymatic activity.End user's urinary kallidinogenase finds that the too fast meeting of intravenous drip causes patient's blood pressure sharply to descend the degradation adverse side effect, has brought certain risk to patient clinically.In addition, Urina Hominis is collected difficulty, and the Urina Hominis protein resource is very limited.It comes source range wide more, and composition is complicated more, may contain compositions such as virus.Urina Hominis source product is not generally accepted in high-end markets such as while America and Europe.

The development of Protocols in Molecular Biology makes and utilizes host cell expression and large-scale production of recombinant proteins to become possibility, utilizes gene expression method to produce recombiant protein at present and replaced traditional native protein method of extracting from natural resources.For glycoprotein, generally be that the gene with the coding glycoprotein changes mammalian cell over to, particularly Chinese hamster ovary cell (Chinese Hamster Ovary, CHO) cell, with produce with native protein near and the recombiant protein of biologically active.

The KLK1 gene is positioned at chromosome 19q13.4, and its size is 6.55kb, and the coding region is 874bp.The prokininase (being precursor protein) that 262 aminoacid of KLK1 full-length gene coding are formed comprises 17 amino acid signal albumen, 7 aminoacid proenzyme fragments and 238 aminoacid maturation proteins.Prokininase is further cut and is processed into the ripe human pancreas kininogenase of biologically active in vivo by protease.The KLK1 gene is expressed the highest at pancreas, kidney and salivary gland.

Human pancreas kininogenase is a kind of glycoprotein, contains 14.4% sugar in the molecule, comprises three N glycosylation sites in its structure, lays respectively at Asn78, Asn84 and Asn141.Studies show that, when human pancreas kininogenase is expressed in Chinese hamster ovary celI, its degree of glycosylation of CHO large-scale culture condition influence, and then also have influence on its intravital activity.Therefore, select suitable CHO condition of culture, the active recombinant human pancreas kininogenase similar, that side effect is little of preparation becomes scientific research person's the up-to-date difficult problem of capturing.

(3) summary of the invention

The present invention changes this gene over to host cell and expresses by Protocols in Molecular Biology clone KLK1 gene, and contains the cell of recombiant protein with cell culture or fermentation process mass production, extracts recombinant human pancreas kininogenase from cell or exocytosis liquid.Preferably, utilize the large-scale culture Chinese hamster ovary celI to prepare recombinant human pancreas kininogenase.And then preparation is the pharmaceutical composition of active component by this recombinant human pancreas kininogenase.This recombinant human pancreas kininogenase has multiple use clinically, and specific activity is similar mutually, side effect is little with the kininogenase in Urina Hominis source, especially to the littler characteristics of blood pressure drops influence.The pharmaceutical composition that contains recombinant human pancreas kininogenase of the present invention's preparation can be effective to treat and/or prevent cerebral infarction.

The present invention obtains a kind of recombinant human pancreas kininogenase by cell culture or fermentation process.Specifically, the present invention is the host cell that utilizes Protocols in Molecular Biology clone's KLK1 gene and obtain the express recombinant human pancreas kininogenase; Utilize mass cell cultivation or fermentation process to carry out the mass production of the host cell of express recombinant human pancreas kininogenase, adopt affinity chromatograph method purification to obtain recombinant human pancreas kininogenase.

Preferably, the host cell of express recombinant human pancreas kininogenase is a mammalian cell, Chinese hamster ovary celI particularly, and the large-scale culture of this host cell adopts the perfusion reactor to carry out perfusion cultures.By optimizing the degree of glycosylation that condition of culture has improved cell stand density and expression product.

The purpose of this invention is to provide a kind of medicine that contains recombinant human pancreas kininogenase.

Another object of the present invention is the purposes that the pharmaceutical composition that contains recombinant human pancreas kininogenase is used to prepare the medicine that treats and/or prevents cerebral infarction.

The objective of the invention is to be achieved through the following technical solutions:

A kind of medicine that contains recombinant human pancreas kininogenase, it contains the recombinant human pancreas kininogenase and the pharmaceutically acceptable auxiliaries as active component for the treatment of effective dose, and active component and pharmaceutic adjuvant part by weight are 1: 1～1: 15000.

Wherein said recombinant human pancreas kininogenase is formed a strand by 238 amino acid residues, N-end and C-terminal amino acid residue are respectively isoleucine and serine, contain 5 pairs of S-S keys in the molecule, by the SDS-PAGE electrophoretic determination, its molecular weight is 35.0-44.0KDa, and its primary structure is:

Contain 5 pairs of S-S keys in the described recombinant human pancreas kininogenase molecule, be respectively Cys7-Cys150, Cys26-Cys42, Cys29-Cys196, Cys161-Cys175 and Cys186-Cys211, isoelectric point, IP is about 4.0, contains 14.4% sugar in the molecule, and binding site lays respectively at Asn78, Asn84 and Asn141.

This recombinant human pancreas kininogenase is a kind of glycoprotein, and the glycosylation binding site lays respectively at Asn78, Asn84 and Asn141.

Aminoacid on bold-type letter (Glu) expression 162 sites in this recombinant human pancreas kininogenase primary structure.

The degree of glycosylation of recombinant human pancreas kininogenase of the present invention depends primarily on sialic level in the sugar chain.By the SDS-PAGE electrophoretic determination, existing Human Urinary Kallidinogenase's molecular weight is 39.0-43.0KDa, recombinant human pancreas kininogenase of the present invention is 35.0-44.0KDa, the electrophoresis band zone of recombinant human pancreas kininogenase is wideer than existing Human Urinary Kallidinogenase, recombinant human pancreas kininogenase is described because the difference of its degree of glycosylation, the difference of especially sialylated degree, promptly recombinant human pancreas kininogenase has more complicated glycosylation composition than existing Human Urinary Kallidinogenase.In addition, the albumen that the recombinant human pancreas kininogenase of the present invention's preparation is made up of single peptide chain is only expressed Glu one seed amino acid on its 162 site; And there are Glu/Lys two seed amino acids in the protein mixture that existing Human Urinary Kallidinogenase's albumen is made up of two peptide chains on its 162 site, and this amino acid whose polymorphism to the influence of enzymatic activity still under study for action.

Recombinant human pancreas kininogenase preparation of the present invention comprises that the expression plasmid, the mass cell that utilize gene recombination technology clone KLK1DNA, structure to contain this gene DNA sequence of encoding are cultivated or fermentation process is produced the host cell of express recombinant protein and the purification of recombiant protein.

The preparation method of recombinant human pancreas kininogenase of the present invention is as follows:

1. the DNA sequence according to KLK1 designs primer, adopt the RT-PCR method from human pancreas's KLK1DNA sequence that increases, this DNA sequence comprises the DNA of cDNA (sequence 1 in the sequence table, GenBank NM_002257), genomic DNA (sequence 2 in the sequence table) and synthetic.

2. KLK1DNA is cloned into expression vector, makes up the expression plasmid that contains KLK1DNA.Expression vector comprises prokaryotic expression carrier (as pET-32a), Yeast expression carrier (as pPIC9) or carrier for expression of eukaryon (as pcDNA3.1).For the situation of carrier for expression of eukaryon, for stability and its half-life of prolongation of improving recombinant human pancreas kininogenase, inserted human IgG l Fc fragment at carrier for expression of eukaryon, make up and contain KLK1 and the segmental eukaryon expression plasmid of Fc.

3. will contain the KLK1DNA expression plasmid and change host cell over to, host cell comprises prokaryotic cell (as escherichia coli), yeast (as Pichia sp.) or mammalian cell (as CH0, the NS0 cell).Preferably, with eukaryon expression plasmid transfection CH0 cell, the cell strain of screening stable transfection

4. with the host cell of fermentation process or mass cell cultural method mass production express recombinant human pancreas kininogenase; Preferably, by the Chinese hamster ovary celI of bioreactor large-scale culture express recombinant human pancreas kininogenase, its step is as follows:

A) cell strain that will contain express recombinant protein is cultivated with the DMEM culture medium (pH7.20) that contains the 5-10% hyclone, after in serum-free medium, adopting conventional method to carry out adaptation of virus then, suspension batch cultivation is on a small scale put in 37 ℃ of temperature, the 5%CO2 incubator and is hatched growth.Be inoculated in and carry out the cell continuous culture in the cell culture jar, inoculum density is 1.0 * 105/ml-5.0 * 105/ml, and is preferred, 3.0 * 105/ml.37 ℃ of cultivation temperature, pH7.2, rotating speed 50-120rpm/min, preferred 90rpm/min, dissolved oxygen 50% air saturation and ventilation 0.1Lpm.

B) in serum-free medium, cultivate after 24-72 hour, preferred, in serum-free medium, cultivate after 48 hours, the serum-free medium perfusion is entered bioreactor carry out perfusion cultures.Rate of flooding needs to regulate according to the residual sugar amount in the culture medium.Keep the residual sugar amount at 0.8-1.2g/L; Extract a jar interior a small amount of culture fluid, its external activity of detection and tracking.Incubation time was 28 days, received liquid since the 6th day, and high-cell density can reach 0.8 * 107/ml-2 * 107/ml, and is preferred, 1 * 107/ml.

C) collect the culture medium that contains the express recombinant human pancreas kininogenase, filter and remove cell debris.Supernatant is used for the purification of recombiant protein.

5. purification of recombinant proteins from the cell of the express recombinant human pancreas kininogenase of a large amount of cultivations.Preferably, from the expressing cho cell recombinant human pancreas kininogenase, this proteic purification may further comprise the steps:

A) will contain the culture medium ultrafiltration and concentration of recombinant human pancreas kininogenase after, last expansion bed reinforcing YIN-essence ion exchange column (Streamline Q XL, GE Healthcare company), the flushing pillar to OD ₂₈₀＜0.2; With containing 0.3M NaCl and 0.02mol/L Tris buffer elution pillar.

B) collect liquid at above-mentioned eluting and add (NH ₄) ₂S0 ₄, flow gel (phenyl Sepharose 6 Fast Flow, GE Healthcare company) fast with phenyl Sepharose on the HCl adjustment pH 7.0 ± 0.1.Eluent uses the 10000MWCO membrane ultrafiltration to 3L.Add the 90g sodium citrate, with HCl adjust pH to 7.0 ± 0.2,60 ℃ of heated at constant temperature are 10 hours then.After the heating solution is transferred pH8.0 ± 0.1, last benzene is pricked pyrimidine cross-linked agarose gel post (Benzamidine Sepharose6B), flushing, eluting.

C) regulate above-mentioned eluting and collect liquid pH4.0 ± 0.1, last SP agarose gel FF post (SpSepharose ^TMFast Flow, GE Healthcare company), washing to effluent OD280＜0.15, eluting is collected the eluting effluent of OD280＞0.1.Eluting is collected liquid transfer pH7.0, carry out ultrafiltration and concentration, obtain the recombinant human pancreas kininogenase albumen of purification with the 10000MWCO film.Measure the enzymatic activity of purifying protein with the esterase method.

Carry out the large-scale culture cell and have following feature with said method: measure by the SDS-PAGE electrophoresis method in conjunction with recombinant human pancreas kininogenase based on the preparation of affinity chromatograph technology, the electrophoresis band zone of recombinant human pancreas kininogenase is than existing Human Urinary Kallidinogenase wide (recombinant human pancreas kininogenase is 38.0-43.0KDa, and Human Urinary Kallidinogenase's molecular weight is 40.0-43.0KDa); Recombinant human pancreas kininogenase is described because the difference of its degree of glycosylation has more complicated composition than existing Human Urinary Kallidinogenase.The result who measures enzymatic activity by the esterase method shows that recombinant human pancreas kininogenase is close with existing Human Urinary Kallidinogenase's activity.

The present invention is owing to adopted specific large-scale culture condition and fermentation process, thereby make the degree of glycosylation of the recombinant human pancreas kininogenase that obtains and existing Human Urinary Kallidinogenase different, side effect obviously reduces in clinical practice, especially blood pressure drops in the body is comparatively relaxed.Though cause the little mechanism of recombinant human pancreas kininogenase side effect and not really clear, we infer it may is because sugar chain structure is different, cause in vivo performance more excellent usefulness.

Recombinant human pancreas kininogenase of the present invention generally uses with the form of pharmaceutical composition, this compositions contains the recombinant human pancreas kininogenase and the pharmaceutically acceptable auxiliaries as active component for the treatment of effective dose, active component and pharmaceutic adjuvant part by weight are 1: 1～1: 15000, and wherein preferred proportion is 1: 1～1: 2500.This pharmaceutical composition is preferably with the intravenous injection administration, and main dosage form comprises lyophilized injectable powder and injection liquor.

Through the recombinant human pancreas kininogenase compositions of intravenous administration, generally be solid sterilization composition form, i.e. lyophilized injectable powder.These compositionss can also contain pharmaceutic adjuvant, particularly a kind of or its any mixture in mannitol, dextran, gelatin hydrolysate, sodium citrate, glycine or the Polyethylene Glycol etc. can be dissolved in sterilized water for injection or various other injection sterile medium in use.

Recombinant human pancreas kininogenase compositions through intravenous administration also can be the aqueous solution form, promptly injects liquor, infusion solution.Compositions can also contain a kind of or its any mixture in pharmaceutic adjuvant, particularly mannitol, sodium chloride, glucose or the Polyethylene Glycol etc.

The preparation method of recombinant human pancreas kininogenase freeze-dried powder: the recombinant human pancreas kininogenase 150PNA unit of getting filtration sterilization, add 15 gram mannitol, 2 gram Dextran 40s and 5 gram sodium citrate (sodium citrate) dissolvings, regulate PH to neutral, add injection water to 500 milliliter, aseptic filtration, in 1000 ampoules of packing, lyophilization under the aseptic condition, promptly.

The preparation method of recombinant human pancreas kininogenase injection: get the water-soluble 150PNA unit of filtration sterilization recombinant human pancreas kininogenase, regulate PH to neutral, add injection water to 500 milliliter, add sodium chloride adjusting etc. and ooze, aseptic filtration is in 1000 ampoules of packing, promptly.

Use the dosage of recombinant human pancreas kininogenase combination treatment cerebral infarction and decide according to the order of severity, the treatment time of the state of an illness, general intravenous administration amount is administration every day 1-3 time, each 0.005-2.5PNA unit.Preferably, the dosage of medicine is every day 1 time, each 0.1-0.2PNA unit.

PNA is defined as: under 37 ℃, pH8.0 condition, hydrolysis substrate Val-Leu-Arg-PNA discharged the free PNA of 1umol in 1 minute, was 1PNA unit.

The experimental study that the present invention carried out is shown the pharmaceutical composition that contains recombinant human pancreas kininogenase is evident in efficacy to Cerebral Infarction Patients, side effect is minimum.

Description of drawings:

Fig. 1 recombinant human pancreas kininogenase of the present invention and existing Human Urinary Kallidinogenase's SDS-PAGE electrophoretogram.1, recombinant human pancreas kininogenase; 2, the Human Urinary Kallidinogenase; 3, the contrast of protein standard molecular weight.

Fig. 2 respectively organizes the variation of cerebral infarct size behind the rat brain thrombosis 24h

1 is matched group, and 2 is recombinant human pancreas kininogenase 17.5 * 10-3PNA/kg group, and 3 is recombinant human pancreas kininogenase 3.50 * 10-3PNA/kg group, and 4 is Human Urinary Kallidinogenase 17.5 * 10-3PNA/kg group, and 5 is Human Urinary Kallidinogenase 3.50 * 10-3PNA/kg group.* * represents to compare p＜0.001 with matched group.

Fig. 3 respectively organizes nervous symptoms appraisal result behind the rat brain thrombosis 24h

1 is matched group, and 2 is recombinant human pancreas kininogenase 17.5 * 10-3PNA/kg group, and 3 is recombinant human pancreas kininogenase 3.50 * 10-3PNA/kg group, and 4 is Human Urinary Kallidinogenase 17.5 * 10-3PNA/kg group, and 5 is Human Urinary Kallidinogenase 3.50 * 10-3PNA/kg group.* * and * represent respectively to compare p＜0.001 and p＜0.05 with matched group.

(4) specific embodiment

Embodiment 1: the clone of human pancreas kininogenase gene (KLK1 gene)

Material and method: with the total RNA of people's kidney is template, obtains the full-length cDNA of KLK earlier by reverse transcription test kit (American I nvitrogen company).Be template with this cDNA then, the 1-496bp of the KLK that increases at first respectively (is 1 with ATG) and two fragments of 476-789bp use 5 ' and 3 ' to hold primer by overlap extension pcr two fragment assemblies to be become complete KLK gene then.The segmental PCR reaction condition of amplification KLK: 94 ℃ of 3min degeneration; 94 ℃ of 30s; 62 ℃ of 30s; 72 ℃ of 30s; 34 circulations of increasing; Finish reaction behind 72 ℃ of extension 5min.

The 1-496 the primer of amplification KLK is:

Forward primer: 5 ' GCCTCGCCCTGTCCCTGGGGGGGACTGGTGCTGCGCCCCCGATTCAGTCCCGGATT GTGG3 '

Downstream primer: 5 ' AATTCTCTGGTTCGATGCTGC 3 '

Pcr amplification 476-789bp fragment the primer is:

Forward primer: 5 ' GCAGCATCGAACCAGAGAATTTCTCATTTCCAGATGATCTC3 '

Downstream primer: 5 ' GACACCATAGCGGAGAACTCCTGA3 '

PCR splices two fragment the primers:

Forward primer: 5 ' GCCTCGCCCTGTCCCTGGGGGGGACTGGTGCTGCGCCCCCGATTCAGTCCCGGATT GTGG3 '

Downstream primer: 5 ' GACACCATAGCGGAGAACTCCTGA3 '

The result:

See sequence 1 in the sequence table through the KLK1 full length gene sequence that said method is cloned into, the base that indicates underscore in the sequence 1 is two pleomorphism sites, and the relevant position is respectively T and G among the GenBank.With the people KLK1 gene pairs ratio that GenBank delivers, clone's KLK1 gene locates to exist two sudden changes at the 405th and 433, and this two places sudden change is the pleomorphism site of having reported in the document.

According to the corresponding primer of genome sequence design, obtained the genomic DNA of KLK1 with the RT-PCR method, see sequence 2 in the sequence table, capitalization is partly represented genomic dna sequence exon part, and lower case is partly represented genomic dna sequence noncoding region and intron part.

Embodiment 2: the structure that contains reorganization KLK1 gene expression plasmid

Xho I and EcoR I site with total length KLK1 gene inserts carrier pcDNA3.1/myc-His (-) A that contains the CMV strong promoter have made up the pcDNA3.1-KLK1 eukaryon expression plasmid.

Make up the pcDNA3.1-KLK1 the primer:

Forward primer: 5 ' GTGA CTCGAGACCATGGGGTTCCTGGTTCTGTGC 3 ' (underscore is an Xho I restriction enzyme site)

Downstream primer: 5 ' ATCT GAATTCTCAGGAGTTCTCCGCTATGGTGTC 3 ' (underscore is an EcoR I restriction enzyme site).

In addition, contain human pancreas kininogenase and human IgG1 Fc fragment so that express more stable in vivo fusion rotein in order to make up, insert human IgG1Fc fragment at the EcoR of pcDNA3.1-KLK1 I and BamH I site, made up the pcDNA3.1-KLK1-Fc eukaryon expression plasmid.The Fc fragment is positioned at the C end of KLK1 gene, connects by EcoR I restriction enzyme site.

Embodiment 3: expression and the preparation thereof of recombinant human pancreas kininogenase in eukaryotic cell

Method:

1.KLK1 the expression of gene in Chinese hamster ovary celI:

Chinese hamster ovary celI is cultivated in containing the DMEM culture medium of 10% hyclone, in 5%CO ₂, 37 ℃ hatch.With the pcDNA3.1-KLK eukaryon expression plasmid transfection CHO cell of cationic-liposome (LipofectAMINE 2000, Invitrogen company), with G418 screening transfectional cell with the foregoing description 2 preparations; And then by the monoclonal stable cell line after enzyme assay and the Western Blot evaluation G418 screening.

2. the host cell of large-scale culture express recombinant human pancreas kininogenase:

A) cell strain that will contain express recombinant protein is cultivated with the DMEM culture medium (pH7.20) that contains 5% hyclone, after in serum-free medium, adopting conventional method to carry out adaptation of virus, suspension batch cultivation is on a small scale put in 37 ℃ of temperature, the 5%CO2 incubator and is hatched growth.Be inoculated in the 5L cell culture jar (New Brunswick Scientific Co.USA) and carry out the cell continuous culture, inoculum density is 3.0 * 105/ml.37 ℃ of cultivation temperature, pH7.2, rotating speed 90rpm/min, dissolved oxygen 50% air saturation and ventilation 0.1Lpm.

B) in serum-free medium, cultivate after 48 hours, serum-free perfusion cultures base is entered bioreactor with the irrigation rate perfusion of 0.6V/V/day carry out perfusion cultures.Along with the continous pouring of fresh culture, cell number increases gradually, and rate of flooding needs to regulate according to the residual sugar amount in the culture medium.When every day during perfusion 〉=5L, keep the residual sugar amount at 0.8-1.2g/L; Extract a jar interior a small amount of culture fluid, its external activity of detection and tracking..Incubation time was 28 days, received liquid since the 6th day, and high-cell density can reach 1.1 * 107/ml.

C) collect the culture medium that contains the express recombinant human pancreas kininogenase, filter and remove cell debris.Supernatant is used for the purification of recombiant protein.

3. the purification of recombiant protein may further comprise the steps:

A) collect the serum-free medium that 10L contains recombinant human pancreas kininogenase, behind the ultrafiltration and concentration, last expansion bed reinforcing YIN-essence ion exchange (Streamline Q XL, GE Healthcare company) ion exchange column is with containing 0.15M NaCl and 0.02mol/L Tris buffering flushing pillar to OD280＜0.2; With containing 0.3M NaCl and 0.02mol/L Tris buffer elution pillar.

B) collect liquid at above-mentioned 20L eluting and add 1800g (NH4) 2SO4, adjust pH 7.0 ± 0.1 with HCl, last phenyl Sepharose flows gel (phenyl Sepharose 6Fast Flow, GEHealthcare company) fast.With 0.7M (NH4) 2SO4 buffer flushing pillar.Carry out the eluting pillar with 0.4M (NH4) 2SO4 buffer, eluent with 10000 membrane ultrafiltration to 3L.Add the 90g sodium citrate, with HCl adjust pH to 7.0 ± 0.2,60 ℃ of heated at constant temperature are 10 hours then.After the heating solution transferred pH8.0 ± 0.1, last benzene is pricked pyrimidine cross-linked agarose gel post (Benzamidine Sepharose 6B, GE Healthcare company), with containing 0.1M NaCl and 0.02mol/L Tris washes, carry out eluting with containing 0.4M NaCl and 0.02mol/L Tris buffering.

C) regulate above-mentioned eluting and collect liquid pH4.0 ± 0.1, last SP agarose gel FF post (SpSepharoseTM Fast Flow, GE Healthcare company), wash to effluent OD280＜0.15 with 0.1M NaAc-HAc buffer, with containing 0.1MNaCl and 0.1MNaAc-HAc buffer solution carries out eluting, collect the eluting effluent of OD280＞0.1.Eluting is collected liquid transfer pH7.0, carry out ultrafiltration and concentration with 10,000 ultrafilter membranes.

4. activity determination method:

Configuration contains the Human Urinary Kallidinogenase of equivalent amount of active and the sample solution of recombinant human pancreas kininogenase respectively, in sample solution, add substrate S-2266 (H-D-Val-Leu-Arg-PNA2HCl), put in 37 ± 0.5 ℃ of water-baths accurate response 15 minutes, measure the absorption value A of each sample at 405nm wavelength place, the A value is controlled between 0.1～0.2.With A value substitution following formula calculated activity unit:

PNA unit/ml=173.6 * A * T/1000

Annotate: 173.6 is reaction constant in the formula; T is an extension rate; 1000 is the unit conversion value of unit/L and unit/ml

Active unit is defined as: under the condition of 37 ℃ of pH8.0, the enzyme amount of hydrolysis in 1 minute 1 μ molVal-Leu-Arg-PNA is called 1PNA unit.

The result:

Under the regulation and control of CMV strong promoter, Chinese hamster ovary celI is arrived in the KLK1 gene transfection, by enzyme assay and the high monoclonal stable cell line of Western Blot Analysis and Screening enzymatic activity, carrying out mass cell by the bioreactor perfusion cultivates, collection contains the serum-free medium of recombinant human pancreas kininogenase, carry out purification, obtain the recombinant human pancreas kininogenase of purification.The result who measures enzymatic activity by the esterase method shows that recombinant human pancreas kininogenase is close with Human Urinary Kallidinogenase's activity, is respectively 7.1 and 6.8PNA/mg albumen.

Perfusion cultures is injected fresh culture medium on the one hand continuously in reactor, continuously take out the culture fluid of equivalent again simultaneously, but do not take out cell in the process, and cell is still stayed in the reactor, makes cell be in the continuous state of a kind of nutrition.Cell density reaches 10 after optimizing condition of culture ⁷/ ml during the High Density Cultivation zooblast, must guarantee replenish to give cell with enough nutrition and remove the malicious metabolite of being always or usually as specified.Pour into fresh culture fluid during perfusion cultures, can guarantee the realization of above-mentioned purpose.By regulating rate of flooding, can remain on stable, useless metabolite to incubation and be lower than and suppress under the horizontal state.Adopt the superiority of perfusion cultures to be to have improved greatly the cell stand density, help the expression and the purification of product simultaneously.

Existing report shows that the degree of protein glycosylation is subjected to influence of various factors, as large-scale culture condition and fermentation process etc.The recombinant human pancreas kininogenase of purification and existing Human Urinary Kallidinogenase's molecular weight are by the SDS-PAGE electrophoretic determination, and the result as shown in Figure 1.From accompanying drawing 1 as can be seen, existing Human Urinary Kallidinogenase's molecular weight is 39.0-43.0KDa, recombinant human pancreas kininogenase of the present invention is 35.0-44.0KDa, the electrophoresis band zone of recombinant human pancreas kininogenase is wideer than the Human Urinary Kallidinogenase, recombinant human pancreas kininogenase is described because the difference of its degree of glycosylation, the difference of especially sialylated degree, promptly recombinant human pancreas kininogenase has more complicated glycosylation composition than the Human Urinary Kallidinogenase.

Embodiment 4 preparation recombinant human pancreas kininogenase dry powder pins

Get the recombinant human pancreas kininogenase 150PNA unit of the filtration sterilization of embodiment 3 preparations, add 15 gram mannitol, 2 gram Dextran 40s and 5 gram sodium citrate (sodium citrate) dissolvings, regulate PH to neutral, add injection water to 500 milliliter, aseptic filtration, in 1000 ampoules of packing, lyophilization under the aseptic condition, promptly.

Embodiment 5 preparation recombinant human pancreas kininogenase injection

Get the water-soluble 150PNA unit of filtration sterilization recombinant human pancreas kininogenase of embodiment 3 preparation, regulate PH to neutral, add injection water to 500 milliliter, add sodium chloride adjusting etc. and ooze, aseptic filtration is in 1000 ampoules of packing, promptly.

Embodiment 6 recombinant human pancreas kininogenases are to the experimentation of rat cerebral infarction

Animal and grouping: the Wistar male rat, body weight 280～320g, adopt recombinant human pancreas kininogenase and Human Urinary Kallidinogenase to be therapeutic agent respectively, and animal be divided into 3 groups, 12 every group at random:

1. matched group: only handle behind the cerebral infarction with normal saline;

2. recombinant human pancreas kininogenase group: 30min organizes kininogenase (to be divided into 17.5 * 10 through sublingual vein injection recombined human behind the cerebral infarction ^-3, 3.50 * 10 ^-3Two dosage groups of PNA/kg, 6 every group);

3. Human Urinary Kallidinogenase group: 30min injects the Human Urinary Kallidinogenase through sublingual vein and (is divided into 17.5 * 10 behind the cerebral infarction ^-3, 3.50 * 10 ^-3Two dosage groups of PNA/kg, 6 every group).

Animal Model Making: lumbar injection chloral hydrate 350mg/kg anesthesia, right lateral position is fixed.The surgical exposure zygomatic arch, bite away zygomatic arch with rongeur, cut off fascia, expose Nie's precoila, with little stretching device phosphorus shape bone and lower jawbone spacing are strutted, at the bottom of skull, open one 2cm * 2cm cranium window, tear cerebral dura mater, expose middle cerebral artery, blow with high frequency electric knife, with blocking blood flow, cause local cerebral ischemia, the layer-by-layer suture otch.Carry out the sublingual vein administration after 30 minutes, steam again and raise.Room temperature is strict controlled in 24～25 ℃.By sublingual vein administration (dosage 1ml/kg), matched group is only injected the normal saline of equal volume to the treatment group behind operation 30min.

Detect index and method:

Cerebral infarct size is measured: will peel off complete brain and put into the cuvette that 4 ℃ of refrigerators fill normal saline, remove olfactory bulb, cerebellum and low brain stem after 10 minutes, be cut to five along coronalplane, put into red tetrazolium (TTC) dyeing liquor immediately, lucifuge temperature in 37 ℃ of water-baths was incubated 30 minutes.It is fixing that taking-up brain sheet is put into 10% formalin.Normal structure is a rose; Ischemic tissue is white in color.Measure ischemic areas with the weight method of quadrature, calculate the percentage ratio that ischemic area accounts for full brain area.

Nervous symptoms scoring determination methods and standard:

(1) mention the Mus tail, normal mice two forelimbs are extended straight forward and symmetry.The operation Mus, the forelimb shoulder inward turning and the interior receipts of ischemia brain hemisphere offside are observed its degree difference and are chosen as 0～4 fen.

(2) tractive two limbs, normal rat muscular strength symmetry, the offside muscle of anterior limb of operation back cerebral ischemia hemisphere is unable, observes its degree difference and is chosen as 0～3 fen.

(3) push away two shoulders, normal rat bilateral shoulder resistance symmetry, the offside shoulder resistance of operation back cerebral ischemia hemisphere descends; Observe its degree difference and be chosen as 0～3 fen.

By above standard, full marks are 10 minutes.Mark is high more, illustrates that disordered brain function is serious more.

The result: each is organized the testing result of rat cerebral infarction area and nervous symptoms scoring and sees accompanying drawing 2 and accompanying drawing 3:

As can be seen from Figure 2, but recombinant human pancreas kininogenase group and Human Urinary Kallidinogenase group dosage dwindles the cerebral infarct size behind the rat brain thromboembolism 24h with relying on.Compare heavy dose of (17.5 * 10 with matched group ^-3PNA/kg) the cerebral infarction area of recombinant human pancreas kininogenase group and Human Urinary Kallidinogenase group obviously dwindles (P＜0.001), but dosage reduces to 3.50 * 10 ^-3Two groups are not all had obvious effect during PNA/kg.Act between recombinant human pancreas kininogenase group and the Human Urinary Kallidinogenase group under the same dose and relatively do not have significant difference (P＞0.05).

Each is organized rat nervous symptoms appraisal result and shows after control rats anesthesia is regained consciousness the appearance of hemiplegia sample symptom is arranged promptly, mainly shows as and receives, takes on inward turning, the decline of muscle of anterior limb tension force in the operation offside forelimb, and resistance descends when the operation offside promotes.As can be seen from Figure 3, but recombinant human pancreas kininogenase and Human Urinary Kallidinogenase all dosage improve nervous symptoms with relying on, compared significant difference with matched group for two groups, but compared there was no significant difference between two groups (P＞0.05).

This experimental result shows, the cerebral infarction rat is at cerebral thrombosis 30min intravenous injection recombinant human pancreas kininogenase, can obviously dwindle cerebral infarction scope behind the cerebral infarction 24h, improve behavior disorder, and dose-dependence is arranged.Illustrate that recombinant human pancreas kininogenase can suppress the formation of cerebral thrombosis, has good therapeutical effect to the cerebral infarction rat.

Sequence table

Sequence 1: the KLK1 full length gene sequence of being cloned into

ATGTGGTTCCTGGTTCTGTGCCTCGCCCTGTCCCTGGGGGGGACTGGTGCTGCGCCCC

CGATTCAGTCCCGGATTGTGGGAGGCTGGGAGTGTGAGCAGCATTCCCAGCCCTGGC

AGGCGGCTCTGTACCATTTCAGCACTTTCCAGTGTGGGGGCATCCTGGTGCACCGCC

AGTGGGTGCTCACAGCTGCTCATTGCATCAGCGACAATTACCAGCTCTGGCTGGGTC

GCCACAACTTGTTTGACGACGAAAACACAGCCCAGTTTGTTCATGTCAGTGAGAGCT

TCCCACACCCTGGCTTCAACATGAGCCTCCTGGAGAACCACACCCGCCAAGCAGACG

AGGACTACAGCCACGACCTCATGCTGCTCCGCCTGACAGAGCCTGCTGATACCATCA

CAGACGCTGTGAAGGTCGTGGAGTTGCCCACCCAGGAACCCGAAGTGGGGAGCACC

TGTTTGGCTTCCGGCTGGGGCAGCATCGAACCAGAGAATTTCTCATTTCCAGATGATC

TCCAGTGTGTGGACCTCAAAATCCTGCCTAATGATGAGTGCAAAAAAGCCCACGTCC

AGAAGGTGACAGACTTCATGCTGTGTGTCGGACACCTGGAAGGTGGCAAAGACACC

TGTGTGGGTGATTCAGGGGGCCCGCTGATGTGTGATGGTGTGCTCCAAGGTGTCACAT

CATGGGGCTACGTCCCTTGTGGCACCCCCAATAAGCCTTCTGTCGCCGTCAGAGTGCT

GTCTTATGTGAAGTGGATCGAGGACACCATAGCGGAGAACTCCTGA

Sequence 2:KLK1 genome sequence

agatctctgggactttggaggacaggacgttgagcacccataactgggagcaagaagtgggaggctcattgagacccc

agcattgtttgggagggacactggattttgtaatgctaaagaacttaccctgggagacccctgaaacttcacattcctggat

ctggaggcactaggaatgtggtgatgtgtaccccaaaattttattatgaaaggaacagtagctttggggacctaggtcctg

ggtctgggagtgcaagaaccagggcattctgaaggccaaggcttatatttcagggggaactggcagctgagatgctagt

atcttggctccgagtggtgcagggaatcagagccctaactgctggtgtttgagggcaccaggtctgggggtgcagggcc

ttaattgagactgaggtatatggggctttgtaccaggggtcactgattcctccgtcttcctgtttctgcttcccctcagtccccc

cttgcctcactggctgctccccagagcaaagccccagagccacaggccctgccccacctggcttcaaccccaggaatg

cgtccagcgtgatccagggcctgcagaacaggtgctggttctccctccccgtctacagctctggggatcggaggcggg

ggggcaattgtccagcccccaggcaacaggggaagggccttggcaacatctgggtgccagcagggcaggggtgggg

ctctgaggggataagggcttttaaaagcctccccagggaggttccccAGTTCCTCCACCTGCTGGCCC

CTGGACACCTCTGTCACCATGTGGTTCCTGGTTCTGTGCCTCGCCCTGTCC

CTGGGGGGGACTGgtgagacagtggggggatgtgggagggggaacgggccctgattctcttgctggcctc

acatccccccccgataagaccttcccctccaacaccccaccctcatccctctggcccacagtctatcctagtccggggtgc

cccggctcttatctatcttgcgcggccccaccctaaacttccacccccgctcctccatgttgtcatagtgctcactcccacac

cagattcctgctcctcccaggaagcctcagtactttctcctcttccctagccaacgccctgtcccaccgctttaccaaaggg

gcagattctgggccatctctgtctctctctggaggaccccaaccctcccatgggcttcccccaccccacaggactctgatc

atcccctcctgccccctagttccctgcggccacctatttggctcctgagtctacaaatcccaccacactccagtgactttttcc

atccagctgtccgctctcaactgtgtcctccagaccctgacatctggtctccccagtccttccagggtcccccaaatttcacc

agaaaaccctgcttcccaaactggcatgtgggatcccccatctggtatgggggggggtctgcaaatgtcccttcccaccc

agcacccccagctctcccaggaaaaacaccacaccctcccaccacatgctcctttccttggggaagttccatcccgcccc

aggccccagcccttctctgcctgaattgttcctacacagctctggttttctggaaccccacgccaaggatcctgaatgccttc

tcagccagcgcttctgccctggctcccccaagtcagtatgtgattctacaacctcacatcaagtgggtcctgcattgcattcc

cacagctgcttggcgcctgttctcaccacttctccaatcctcttcctaggattgcctccaagaggaccccatatccttccagt

accctcagaccatgaaccccatccccatgagaaacgaagatcccatccttcaccctgtccgagaaggactgccactcac

gcctccctcctcctgagccccgtcccagtcctgaccgcaactgtgttctcagggccccaacctcccctcatattgccattcc

tggttcacaggaaggaccccaaaacctctcggaagcccacctctagccttaaccatagccctttcttttaccctttaaccag

gaagccctgaaatctaactgtccagccaagctggccccttccaaccccaatgtagggaccccaagtcacccccaaactct

tcagtcgagatgctcttctttacctctcagacctggttccctaaagctgcatcctttcctgaacctcaaaagcccaacccagg

tcctgtttccctagcctaggagccccttagccctccagattcttcctcagtgagcctctgatcctgtcccacccttggcgcctt

gatccctggtttccagaatccctttccactcccctaacccaccacctcccatcccccagccccagaccccaaatgacctga

cgcccagatgcagtgtctgctccagacactgtctcctgtctcctaccctgatccctggaggctgctctactgtcagagcaca

aaatctccccaccaggtccagccaccactccaaaagcccagggaacagtccagagtcccaccccttcccaacacccctt

gcccatgtccccaacctccagccctggtcctctacccgcaatgtcccttcagacccacagcccagctccctctcctagcct

tgtccctggcctctcctgccaaccctgcccttcctgacccagcaccgcctctgcagGTGCTGCGCCCCCGA

TTCAGTCCCGGATTGTGGGAGGCTGGGAGTGTGAGCAGCATTCCCAGCCC

TGGCAGGCGGCTCTGTACCATTTCAGCACTTTCCAGTGTGGGGGCATCCT

GGTGCACCGCCAGTGGGTGCTCACAGCTGCTCATTGCATCAGCGAgtgagtag

gggcctggggtctgggaggagggcatctatgctgccacaggattgacaggccagtggcattccccttggataacctcag

gcaagactggggggctgagccagagaggaaggctctggcgcaggtcgcctggcagggcagagctgggctggacac

ccctctccaaggctgcctgggtctcttgggatctggttctgcttgtgtctctgtgtgactgtgttctggtctctgtcttcctctctc

tcctctgtctccttgtctctgcatctcccctgtctctgtctgtctctgagtctctctgcggcatctctgtcactgtgtctcaccctc

catctctctacccatctctctctctctgggtctctacctcaccgctccctcatccctactaaacacacacccagatggacctaa

gggaggccccagagtaaaggaagggctttatccccaacttgtgtgcctgggagggggcgcctctccctctgtccagctc

cccgccccacaggatatccctccactctggagagacacagggaagggctggtttcagcgggagctgggtggggcaac

tgagggaggaggaaggaggaggcggggcgagaaacgcgcgggagggtgctgggaaccgaagggggcctcgacc

ttggacttcaggccaggccacctgcccctggggagcccgcaccacagccccagctgcagctgagccgctctcaggcct

cccctcctccctacctgcccccaccctccccacctgcccccaccctcccccagggcctccctcccttttctctcccacactc

ggtcactcctgcttcctctctgcctctgtttctagttctcactctgacgtcccgcgtcctttttcatttgtctgcttctcgctcccttc

cgtgttctgttccctcttcctccctcttccctggggcctgtttctcgctgtccctgtcttttatccttctcatctgcctcttttttgctc

accctgtttctcactgccctcccctccgcctttctcacccctctgtccttttgagctcttttttgctctgtctcttcatttgccttttgc

actctcaaactctttcatcttcccattcgctgtctgtatttctccataactatatctttcttcctctgtctccgcccacccacatttttc

tctttccctttctctctttggggaccctcccccatgctcccctgccccatccccttttccccttcccgtcttctcatccctccattc

ccatctttccccagCAATTACCAGCTCTGGCTGGGTCGCCACAACTTGTTTGACGA

CGAAAACACAGCCCAGTTTGTTCATGTCAGTGAGAGCTTCCCACACCCTG

GCTTCAACATGAGCCTCCTGGAGAACCACACCCGCCAAGCAGACGAGGA

CTACAGCCACGACCTCATGCTGCTCCGCCTGACAGAGCCTGCTGATACCAT

CACAGACGCTGTGAAGGTCGTGGAGTTGCCCACCCAGGAACCCGAAGTG

GGGAGCACCTGTTTGGCTTCCGGCTGGGGCAGCATCGAACCAGAGAATTg

tatgtgggggcagactgtgtagcccaaggcggggatggggactcctgcgtccaagggagaaagggccagggaagca

ggtgaggtcgggctgcagccctttttctcccgggttcgtagTCTCATTTCCAGATGATCTCCAGTGT

GTGGACCTCAAAATCCTGCCTAATGATGAGTGCAAAAAAGCCCACGTCCA

GAAGGTGACAGACTTCATGCTGTGTGTCGGACACCTGGAAGGTGGCAAA

GACACCTGTGTGgtgaggcagccctgcccccagggtctggaagggctgagggaggggactcagcctctga

actggcttctgagagctaaccaggcatctgcttcactgcttcccagctagctgtagccactcgccccatcagtgccccagc

tccccctccttccccgcccatccagggacaactgcatctcaccccccacaccagagttcaccgttcctcgtggtaatgtgtt

gttaccgtcgagtcagagagtagtcctggagaggtggcctctgcgatgtgcccgcaggggcagcgtcctgcagatggtc

ctgcccctcctccccctaacctgtctgcaggcactgtccacctggaccctgccccatgtgcaggagctggaccctgaggt

cccttcccccttggccaggactggagaccctgtcccctctgtgggaatccctgcccaccttcctctgggagtgggcactg

gaggccctgtctgcgagctggggctccccaggcagaacttgggccccgtagacctttctcactctcccctcccaccttgt

gctcccagGGTGATTCAGGGGGCCCGCTGATGTGTGATGGTGTGCTCCAAGGT

GTCACATCATGGGGCTACGTCCCTTGTGGCACCCCCAATAAGCCTTCTGTC

GCCGTCAGAGTGCTGTCTTATGTGAAGTGGATCGAGGACACCATAGCGGA

GAACTCCTGAACGCCCAGCCCTGTCCCCTACCCCCAGTAAAATCAAATGT

GCATCCaatgtgtgtcacgttctgccatcacctatctttccagatgtggtgcacctggacccactcggctgaggctgg

ggccaccccagctgtgtcaatctcatgcctggaagtctgaggtcaccagcaggtggggaaaggaaggggctgtgacag

gtgcagacaaacaggcagggaaaggctcagatcccaaagggcgagtcagggacgccagaacagttcactcacacta

ggatggaccctgccctggtggggaggtggggggcaatggaaggtctgaggctgagaggt

Claims (8)

1. medicine that contains recombinant human pancreas kininogenase, it contains the recombinant human pancreas kininogenase and the pharmaceutically acceptable auxiliaries as active component for the treatment of effective dose, and active component and pharmaceutic adjuvant part by weight are 1: 1～1: 15000,

Wherein said recombinant human pancreas kininogenase is formed a strand by 238 amino acid residues, N-end and C-terminal amino acid residue are respectively isoleucine and serine, contain 5 pairs of S-S keys in the molecule, by the SDS-PAGE electrophoretic determination, its molecular weight is 35.0-44.0KDa, and its primary structure is:

2. the medicine that contains recombinant human pancreas kininogenase according to claim 1, contain 5 pairs of S-S keys in the described recombinant human pancreas kininogenase molecule, be respectively Cys7-Cys150, Cys26-Cys42, Cys29-Cys196, Cys161-Cys175 and Cys186-Cys211, isoelectric point, IP is about 4.0, contain 14.4% sugar in the molecule, binding site lays respectively at Asn78, Asn84 and Asn141.

3. the medicine that contains recombinant human pancreas kininogenase according to claim 2, wherein said recombinant human pancreas kininogenase is to be prepared by following steps:

1), adopt the RT-PCR method from human pancreas's KLK1 DNA sequence that increases according to the DNA sequence of KLK1 design primer;

2) with the KLK1 dna clone to expression vector, make up the expression plasmid contain KLK1 DNA;

3) will contain KLK1 DNA expression plasmid and change host cell over to;

4) with the host cell of fermentation process or mass cell cultural method mass production express recombinant human pancreas kininogenase, its step is as follows:

A) cell strain that will contain express recombinant protein is cultivated with the DMEM culture medium that contains the 5-10% hyclone, and after the conventional method of employing was carried out adaptation of virus in serum-free medium then, 37 ℃ of temperature, 5%CO were put in batch cultivation that suspends on a small scale ₂Hatch growth in the incubator, be inoculated in and carry out the cell continuous culture in the cell culture jar, inoculum density is 1.0 * 10 ⁵/ ml-5.0 * 10 ⁵/ ml, 37 ℃ of cultivation temperature, pH7.2, rotating speed 50-120rpm/min, dissolved oxygen 50% air saturation and ventilation 0.1Lpm;

B) in serum-free medium, cultivate after 24-72 hour, the serum-free medium perfusion is entered bioreactor carry out perfusion cultures, keep the residual sugar amount at 0.8-1.2g/L;

C) collect the culture medium that contains the express recombinant human pancreas kininogenase, filter and remove cell debris, supernatant is used for the purification of recombiant protein;

5) purification of recombinant proteins from the cell of the express recombinant human pancreas kininogenase of a large amount of cultivations, this proteic purification may further comprise the steps:

A) will contain the culture medium ultrafiltration and concentration of recombinant human pancreas kininogenase after, last expansion bed reinforcing YIN-essence ion exchange column, the flushing pillar to OD ₂₈₀＜0.2; With containing 0.3M NaCl and 0.02mol/L Tris buffer elution pillar;

B) collect liquid at above-mentioned eluting and add (NH ₄) ₂SO ₄Flow gel fast with phenyl Sepharose on the HCl adjustment pH 7.0 ± 0.1, eluent uses the 10000MWCO membrane ultrafiltration to 3L, add the 90g sodium citrate, with HCl adjust pH to 7.0 ± 0.2,60 ℃ of heated at constant temperature are 10 hours then, after the heating solution transferred pH8.0 ± 0.1, last benzene is pricked pyrimidine cross-linked agarose gel post, flushing, eluting.

C) regulate above-mentioned eluting and collect liquid pH4.0 ± 0.1, last SP agarose gel FF post, wash to effluent OD280＜0.15, eluting, collect the eluting effluent of OD280＞0.1, eluting is collected liquid transfer pH7.0, carry out ultrafiltration and concentration, obtain the recombinant human pancreas kininogenase albumen of purification with the 10000MWCO film.

4. the medicine that contains recombinant human pancreas kininogenase according to claim 3, wherein the part by weight of recombinant human pancreas kininogenase and pharmaceutically acceptable auxiliaries is 1: 1～1: 2500.

5. the medicine that contains recombinant human pancreas kininogenase according to claim 4, it is a lyophilized injectable powder, pharmaceutically acceptable auxiliaries is a kind of or its any mixture in mannitol, dextran, gelatin hydrolysate, sodium citrate, glycine or the Polyethylene Glycol etc.

6. the medicine that contains recombinant human pancreas kininogenase according to claim 4, it is the injection liquor, pharmaceutically acceptable auxiliaries is a kind of or its any mixture in mannitol, sodium chloride, glucose or the Polyethylene Glycol.

7. according to the described medicine that contains recombinant human pancreas kininogenase of any claim of claim 5-6, the specification of described medicine be 0.1～0.2PNA unit/or bottle.

8. the medicine that contains recombinant human pancreas kininogenase according to claim 7, it is by recombinant human pancreas kininogenase 150PNA unit, add 15 gram mannitol, 2 gram Dextran 40s and 5 gram sodium citrate (sodium citrate) dissolvings, regulate PH to neutral, add injection water to 500 milliliter, aseptic filtration is in 1000 ampoules of packing, lyophilization under the aseptic condition, promptly.

Images