CN102241776A - RANKL-TNF (Receptor Activator of Nuclear Factor Kappa-B Ligand-Tumour Necrosis Factor) sample region fusion protein and preparation method and application thereof - Google Patents
RANKL-TNF (Receptor Activator of Nuclear Factor Kappa-B Ligand-Tumour Necrosis Factor) sample region fusion protein and preparation method and application thereof Download PDFInfo
- Publication number
- CN102241776A CN102241776A CN2011101350193A CN201110135019A CN102241776A CN 102241776 A CN102241776 A CN 102241776A CN 2011101350193 A CN2011101350193 A CN 2011101350193A CN 201110135019 A CN201110135019 A CN 201110135019A CN 102241776 A CN102241776 A CN 102241776A
- Authority
- CN
- China
- Prior art keywords
- rankl
- tnf
- fusion rotein
- fusion protein
- sample region
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention provides an RANKL-TNF (Receptor Activator of Nuclear Factor Kappa-B Ligand-Tumour Necrosis Factor) sample region fusion protein, and in particular relates to a fusion protein of an RANKL-TNF sample region protein and a Th2 cell epiposition segment with broad host range property. An experiment shows that an antibody produced by an RANKL-TNF sample region fusion protein immune mouse has the effect of combining RANKL with TNF-alpha, can be used for treating diseases such as rheumatoid arthritis and the like and can play effects of antagonistic bone destruction and inflammation inhibition. The RANKL-TNF sample region fusion protein disclosed by the invention can be used as a therapeutic vaccine and provides a new therapeutic approach and thinking for the diseases such as rheumatoid arthritis and the like. According to the invention, the RANKL-TNF sample region fusion protein is expressed in vitro, and therefore the method has the advantages of high expression yield, strong controllability and relatively low production cost;, and the product has good immunogenicity and is easy to realize mass production.
Description
Technical field
The present invention relates to biomedicine field, be specifically related to a kind of RANKL-TNF sample district fusion rotein, the invention still further relates to the preparation method and the purposes in the treating rheumatoid arthritis vaccine of this fusion rotein.
Technical background
Rheumatoid arthritis (rheumatoid arthritis, RA) being a kind of chronic general autoimmune disease, is feature with the arthritis mutilans, and lesion characteristic is the aggressiveness synovitis, and joint cartilage that causes thus and destruction of bone, finally cause joint deformity and disable.Because morbidity height, disability rate height, the cause of disease of RA are not illustrated as yet fully, particularly RA has caused heavy losses for social economy, labor force, and therefore, the research that RA is treated has important medical and social and economic significance.And RA is a kind of refractory disease, though existing treatment means is varied, all not satisfactory.The present invention is directed to osteoclasia and the key pathology problem of these two RA that are associated of chronic inflammatory reaction in the RA morbidity, development RANKL-TNF sample district fusion rotein is for a kind of new thinking has been opened up in the treatment of RA.
RANKL be tumor necrosis factor superfamily (gene is positioned at No. 13 karyomit(e) 13q14 of people for tumor necrosis factor superfamily, member TNFSF), 316 amino acid of total length, the molecular weight size is 35～45kD, divides three hypotype: RANKL
1And RANKL
2Be transmembrane tripolymer (trimeric transmembrane form), RANKL
3Be solvable type monomer (solublemonomer), two types all can with bait acceptor osteoprotegerin (osteoprotegerin, OPG) in conjunction with and lose biological activity, human-mouse homologous is 77%.RANKL is an I type transmembrane protein, by in the born of the same parents, born of the same parents are outer and stride the film section and forms, core texture be born of the same parents' 158 amino acid of carboxyl terminal outward, is folded by several β types to constitute, and is TNF family homology structural domain.RANKL mainly is distributed in immunity system, Skeletal system and the recycle system.The RANKL that participates in osteoclasia is mainly secreted by skeletonization/marrow stromal cell, activated T cell, synovium of joint cell and mononuclear macrophage, combines with acceptor RANK by autocrine and paracrine mode to play a role.The expression of RANKL is subjected to the regulation and control of the various kinds of cell factor, as bone resorbing factor, glucocorticosteroid, 1 α, and 25 (OH)
2-VD
3, IL-1, IL-6, IL-11, TNF-α, PGE
2With PTH etc., but these factors induced osteogenesis cell expressing RANKL all, thus promote bone resorption.The discovery of RANKL makes us, and (osteoclast, OC) differentiation, activation, propagation have had further understanding to osteoclast.The acceptor RANK of RANKL (receptor activatorof nuclear factor) is tumor necrosis factor receptor super family (tumor necrosis factor receptorsuperfamily, TNFRSF) member, the assignment of genes gene mapping is in 18q22.1, be 616 amino acid whose peptide sections, belong to I type transmembrane protein, 21 the amino acid whose interior C-terminals of cell of wearing cytolemma group and 383 amino-acid residues that contain of a weak point are arranged, and human-mouse homologous is 60%.Mainly be expressed in mononuclear phagocyte system, comprise osteoclast and precursor cell, lymphocyte, endotheliocyte, inoblast.RANKL combines in the increase of RA patient's joint cavity expression amount and with the RANK on osteoclast and precursor cell surface thereof, (TNF receptor-associated factor 6 TRAF6) makes its activation after the combination for RANK born of the same parents' internal area conformational change and its adaptin TNF (tumor necrosis factor) receptor associated factor 6; Activated T RAF6 makes transcription factor NF-KB or mitogen activated protein kinase (mitogen-activated protein kinase as a multi-functional second messenger (second messager), MAPK) activate, wherein MAPK has comprised stress activated protein kinase (c-Jun N-terminalkinases/stress-activated protein kinase again, JNK) and extracellular signal-regulated kinase (extracellular signal-regulated kinases, ERK) two approach.JNK can further activate c-Jun and activated protein 1 (AP-1), influences the activity of osteoclast and T nucleus intrinsic factor.ERK is the regulatory factor whether c-Fos expresses, and the latter is important transcription factor in the osteoclast differentiation.NF-κ B activates the back is entered karyon identification dna sequence dna by endochylema kB site as a dimer transcription factor; Calcium signal enabling nf activated T cell c1 (nuclear factor ofactivated T cell c1, NFATc1) and with promoter region combine, make osteoclast differentiation associated gene transcriptional expression, broken bone precursor cell propagation, differentiation, ripe for the osteoclast of function is arranged increase bone resorption.Simultaneously, also there is RANK in the osteoclast surface, and makes brokenly the bone increased functionality after RANKL combines.Meanwhile, the RANKL that is expressed on the activated T cell combines with self or the last RANK of DC, can activating immune system.Experiment in vitro proves that the RANKL that the T cell produces can directly start the propagation of osteoclast; Ctla4
-/-The clpp gene deratization can suppress the destruction of activating T cell to bone density.Vicious cycle between immunity system and the skeletal system is the reason that the RA osteoclasia continues existence.
RA is the systemic inflammation of chronic progress, and many inflammatory factors have participated in rheumatoid pathologic process, and TNF-α is one of inflammatory cytokine that holds the central place in the RA pathogeny, and it has participated in the generation evolution of RA.(inter-cellularadhesion molecule ICAM), promotes white corpuscle and blood vessel endothelium to stick infiltration and causes partial inflammation but TNF-α inducing endothelial cell is expressed adhesion molecule.In addition, TNF-α stimulates synovial membrane fibroblast and chondrocyte to produce PGE
2(prostaglandin E
2, PGE
2) and collagenase, promote destruction of bone and the absorption of bone and the hyperplasia of fibroblast, suppress the synthetic of osso-albumin.TNF-α also can promote human chondrocytes eccrine fiber albumen lyase activator, make proplasmin become Tryptase and accelerate arthritic loss process, TNF-α has increased the release of synovial membrane endotheliocyte and fibroblast growth factor and has promoted the formation of pannus.TNF-α also can impel synovial cell, scavenger cell, fibroblast and chondrocyte to produce IL-1, IL-8, in addition TNF-α itself and increase the weight of tissue injury.Scholars such as Saxne report that the TNF-alpha levels raises among 50% the RA patients serum, and TNF-α raise mostly be the obvious swelling in joint, tenderness and the fast active period patient of erythrocyte sedimentation rate.Prompting RA arthritis is heavy more, and the TNF-alpha levels is high more.TNF-α participates in three kinds of main pathologic processes in reactivity RA: 1. activate vascular endothelial cell, strengthen the expression of endotheliocyte ICAM, blood middle leukocytes is pooled to joint cavity by the interaction with ICAM just when sacroiliitis.2. stimulate phoirocyte and polymorphonuclear cell to produce small molecules inflammatory mediators such as PGE.3. by stimulating synovial cell and chondrocyte, make osteoclast reduce glycoprotein and synthesize, increase the glycoprotein degraded, and produce collagenase and other neutral proteases, release bone calcium etc., thus the destruction that causes bone and cartilage.Soluble TNF R can alleviate the pathological change of adjuvant-induced arthritis effectively.
Discovering, is the medicine destruction that can alleviate RA bone and cartilage of blocking-up target with RANKL, can significantly improve the symptom of molten bone of metastases and postmenopausal osteoporosis with RANKL monoclonal antibody or RANK-Fc.In an Argentine random double blind test, use studies show that of humanized monoclonal antibody AMG-162 treatment postmenopausal osteoporosis patient, the RANKL monoclonal antibody can significantly increase the bone amount, alleviate symptoms such as ostalgia, do not see obvious adverse reaction, but shortcoming is invalid to struvite synovitis, must with other preparation combined utilization of anti-TNF-α.The TNF-alpha-2 antagonists is to suppress the sure preparation of RA inflammatory reaction curative effect clinically, but has 1/3 patient invalid to three kinds of antagonists of present listing, and since the price comparison costliness of TNF-alpha-2 antagonists be difficult to be widely used.
Summary of the invention
First purpose of the present invention is to provide a kind of RANKL-TNF sample district fusion rotein at above-mentioned deficiency.
Second purpose of the present invention is to provide the preparation method of above-mentioned RANKL-TNF sample district fusion rotein.
The 3rd purpose of the present invention is to provide the purposes of above-mentioned RANKL-TNF sample district fusion rotein in the biotechnological formulation/vaccine production of treatment rheumatoid arthritis.
RANKL-TNF sample of the present invention district fusion rotein, it is for RANKL-TNF sample district albumen and have the segmental fusion rotein of promiscuous Th2 cell epitope.
RANKL and TNF-α are the key factors that RA bone injury and inflammation continue existence, simultaneously, RANKL is the TNFSF family member, the TNF sample district of RANKL and the aminoacid sequence of TNF-α have the similarity of height, the present invention with among the RANKL with the candidate epi-position of the high two sections zones of TNF-α similarity as polypeptide vaccine, but RANKL is from the body composition, so is difficult to produce antibody under the native state.The present invention replaces with promiscuous Th2 cell epitope by the non-similar area with RANKL and TNF-α, thereby has strengthened its immunogenicity.The gene order GAATGGGAGTTCGTAAACACCCCACCTCTCGTC (aminoacid sequence EWEFVNTPPLV) of the BRU strain reversed transcriptive enzyme RT (414-424aa) that this promiscuous Th2 cell epitope can be HIV-I, or other general host's property Th2 cell epitope, for example: OVA, BSA, PPD etc.
Term " general host's property " is meant host's adaptability widely.
In embodiments of the present invention, aminoacid sequence such as SEQ ID No.2 or 4 of described RANKL-TNF sample district fusion rotein; Those skilled in the art can not influence under its active prerequisite according to this fragment, replace, lack and/or add one or several amino acid, obtain described proteic mutant nucleotide sequence.For example, the 6th Serine is replaced with tyrosine, perhaps, perhaps add die aromatischen Aminosaeuren at the 118th with the 77th Methionin disappearance.Therefore, RANKL-TNF sample district fusion rotein comprises that also aminoacid sequence shown in SEQ ID No.2 or 4 is substituted, replaces and/or increases one or several amino acid, has the equal active protein of being derived and being obtained by SEQ ID No.2 or 4.
The present invention also comprises the gene of the above-mentioned fusion rotein of encoding.In embodiments of the present invention, encode the nucleotide sequence of this antigen-4 fusion protein gene shown in SEQ ID No.1 or 3.Should be understood that the degeneracy of considering codon and the preferences of different plant species codon, those skilled in the art can use as required and be fit to the codon that specific species are expressed.
Said gene of the present invention can be operably connected with expression vector, obtain to express the recombinant expression vector of fusion rotein of the present invention, and then this expression vector can be imported host cell, obtain expressing the genetic engineering bacterium of RANKL-TNF sample district fusion rotein.Expression vector used in the present invention can be selected various known prokaryotic expression carriers for use.
The present invention also provides a kind of method for preparing above-mentioned fusion rotein, comprise the steps: that gene clone with coding RANKL-TNF sample district fusion rotein is in expression vector, with described expression vector transformed host cell, screening positive clone, behind yeast culture and abduction delivering, separation and purification obtains this fusion rotein.
In embodiments of the present invention, by making up recombination, be connected with the pET-28a expression vector, transformed into escherichia coli BL21 (DE3), expressed fusion protein, and fusion rotein is carried out purifying by methods such as molecular sieve or ion exchange chromatographies, adopt SDS-PAGE, Western-blot etc. that fusion rotein is carried out physico-chemical property and identify.
In a preferred embodiment of the present invention, comprise in the step of appropriate condition bottom fermentation culturing engineering bacterium:
Recombinant clone plasmid transformation escherichia coli BL21 (DE3) competent cell that order-checking is correct is selected single colony inoculation in 10mL LB substratum (kantlex that contains 30mg/L), and 37 ℃, the 250rpm shaking culture is spent the night.Get the 30mL overnight culture next day and transfer in 1L LB substratum (kantlex that contains 30mg/L), 37 ℃, 250rpm is cultured to OD
600To 0.5, it is 0.4mM that adding IPTG makes it final concentration, 37 ℃, and centrifugal collection thalline behind the 250rpm continuation shaking culture 4.5h.
Get and cultivate the coli somatic that collect the back, use the PBS of precooling to wash thalline 6 times, ultrasonic resuspended 10min (super 4s stops 6s, and power is 40%).It is resuspended that every gram wet thallus adds the bacterial cellular protein lysate of 10 times of volumes, adds N,O-Diacetylmuramidase to 1mg/mL, adds proteinase inhibitor PMSF to 1mM simultaneously, after placing 30min on ice, the ultrasonic bacterium 10min that splits in ice bath, 12, the centrifugal 10min collecting precipitation of 000rpm.Again respectively once with TE damping fluid, each washing of 1%trixton-100, precipitation is dissolved in ultrasonic resuspended thalline (5mL/g wet thallus) among the PBS, slowly drip isopyknic 8M urea soln simultaneously, magnetic stir bar stirs 30min, centrifuged deposit washs 1 time with the 4M urea soln, precipitation is resuspended in the dissolving damping fluid that contains 4M urea, and the centrifuging and taking supernatant obtains to contain the sex change liquid of purpose fusion rotein through the filtering with microporous membrane of 0.45 μ m.Affinity chromatography (Ni-NTAHis prepacked column 5mL) purified fusion protein.According to the BCA albuminimetry with the protein denaturation liquid concentration dilution of purifying to 0.5mg/mL.Prepare renaturation solution (4M urea by progressively the successively decrease method of (4M-3M-2.5M-2M-1.5M-1.2M-0.8M-0.5M-0.2M-0M) of urea concentration, 50mM Tris, 0.5mM EDTA, 50mM NaCl, the 3mM reduced glutathion, the 1mM Sleep-promoting factor B, 10% (V/V) glycerine, 1% glycine, PBS, pH7.6), the protein denaturation liquid that dilutes is placed in the dialysis tubing, the ratio that is not more than 1: 20 in the inside and outside liquid proportional of renaturation slowly stirs the dialysis renaturation for 4 ℃.Whether separate out and what of the amount of separating out are determined best renaturation dialysis conditions according to albumen in the dialysis procedure, the dialyzate that urea concentration of replacing in about 4 hours reduces gradually, last in the PBS of pH7.6 solution dialysed overnight, change PBS solution therebetween one time, to the protein denaturation liquid renaturation of dialysing.
Experiment shows, the antibody that RANKL-TNF sample district fusion protein immunization mouse produces has the effect in conjunction with RANKL and TNF-α, can be used for the treatment of diseases such as rheumatoid arthritis, performance alleviates osteoclasia and inflammation-inhibiting effect, thereby can be used to prepare the vaccine of rheumatoid arthritis.And then the present invention also comprises a kind of treatment treatment of rheumatoid arthritis vaccine, and it is made for acceptable carrier on above-mentioned RANKL-TNF sample district's fusion rotein of effective dose and the biotechnological formulation/vaccinology.
RANKL-TNF sample of the present invention district fusion rotein provides a kind of new treatment approach and thinking for diseases such as rheumatoid arthritis.The present invention passes through vivoexpression RANKL-TNF sample district fusion rotein, the expression amount height, and controllability is strong, and production cost is relatively low, and expression product has good immunogenicity, easy realization of large-scale production.
Description of drawings
Fig. 1 shows the structural representation of the expression vector that the present invention is selected and the back expression vector of recombinating; Wherein, Fig. 1 (a) is pET-28a (+) plasmid synoptic diagram; Fig. 1 (b) is pET-28a (+)-RTFP-1 recombinant plasmid synoptic diagram; Fig. 1 (c) is pET-28a (+)-RTFP-2 recombinant plasmid synoptic diagram; Fig. 1 (d) is pET-28a (+)-RTFP-3 recombinant plasmid synoptic diagram.
Fig. 2 is a RANKL-TNF sample district fusion rotein PCR product agarose gel electrophoretogram; Wherein, Fig. 2 (a) is the structure result of fusion rotein RTFP-1 recombinant expression plasmid, swimming lane M
1, M
2: molecular weight Marker; Full gene cloning plasmid (BC117286, the 1097bp of swimming lane 1:RANKL; PDONR223,5004bp); Swimming lane 2,3: the AB of goal gene, CD fragment; Swimming lane 4: goal gene total length (443bp); Swimming lane 5: the double digestion fragment of goal gene total length (Sal I, Nde I); Swimming lane 6:pET-28a (+) plasmid; Swimming lane 7:pET-28a (+) plasmid double digestion (Sal I, Nde I); Swimming lane 8: the recombinant expression plasmid (pET-28a (+)-RTFP-1) that contains goal gene; Swimming lane 9,10: the PCR of recombinant expression plasmid identifies (pET-28a (+), pET-28a (+)-RTFP-1); The double digestion of swimming lane 11:pET-28a (+)-RTFP-1 recombinant expression plasmid is identified (Sal I, Nde I);
Wherein, Fig. 2 (b) is the structure result of fusion rotein RTFP-2 recombinant expression plasmid, swimming lane M
1, M
2: molecular weight Marker; Full gene cloning plasmid (BC117286, the 1097bp of swimming lane 1:RANKL; PDONR223,5004bp); Swimming lane 2,3,4: the AB of goal gene, CD, CE fragment; Swimming lane 5: goal gene total length (443bp); Swimming lane 6: the double digestion fragment of goal gene total length (Sal I, Nde I); Swimming lane 7::pET-28a (+) plasmid; Swimming lane 8:pET-28a (+) plasmid double digestion (Sal I, Nde I); Swimming lane 9: the recombinant expression plasmid (pET-28a (+)-RTFP-2) that contains goal gene; Swimming lane 10,11: the PCR of recombinant expression plasmid identifies (pET-28a (+), pET-28a (+)-RTFP-2); The double digestion of swimming lane 12:pET-28a (+)-RTFP-2 recombinant expression plasmid is identified (Sal I, Nde I);
Wherein, the structure result of Fig. 2 (c) fusion rotein RTFP-3 recombinant expression plasmid, swimming lane M
1, M
2: molecular weight Marker; Swimming lane 1,2: the total length of goal gene (410bp); Swimming lane 3:pET-28a (+) plasmid; Swimming lane 4,5: the recombinant expression plasmid (pET-28a (+)-RTFP-3) that contains goal gene.
Fig. 3 is a RANKL-TNF sample district fusion rotein SDS-PAGE electrophoretogram; Wherein, swimming lane M
1: molecular weight Marker; Swimming lane 1,3,5,7: do not add IPTG inductive recombinant expression plasmid (pET-28a (+), pET-28a (+)-RTFP-1, pET-28a (+)-RTFP-2, pET-28a (+)-RTFP-3; 37 ℃, 250rpm); Swimming lane 2,4,6,8: add IPTG inductive recombinant expression plasmid (pET-28a (+), pET-28a (+)-RTFP-1 (17.9KDa), pET-28a (+)-RTFP-2 (19.9KDa), pET-28a (+)-RTFP-3 (16.6KDa); 37 ℃, 250rpm, IPTG 0.4mM).
What Fig. 4 showed is that Western-blot analyzes RANKL-TNF sample district fusion rotein;
Wherein, figure a is for detecting fusion rotein, swimming lane 1:RTFP-1 fusion rotein with anti-people RANKL polyclonal antibody; Swimming lane 2:RTFP-2 fusion rotein; Swimming lane 3:RTFP-3 fusion rotein;
Wherein, figure b is for detecting fusion rotein with anti-humanTNF-'s polyclonal antibody, swimming lane 1: and positive control (rhTNF-α, 17.5KDa); Swimming lane 2: negative control (pET-28a (+) plasmid); Swimming lane 3:RTFP-1 fusion rotein; Swimming lane 4:RTFP-2 fusion rotein; Swimming lane 5:RTFP-3 fusion rotein.
RANKL-TNF sample district fusion rotein SDS-PAGE electrophoretogram behind Fig. 5 purification renaturation; Wherein, swimming lane M
1: molecular weight Marker; Swimming lane 1:RTFP-1 fusion rotein; Swimming lane 2:RTFP-2 fusion rotein; Swimming lane 3:RTFP-3 fusion rotein.
What Fig. 6 showed is the security evaluation of RANKL-TNF sample district fusion rotein;
Wherein, Fig. 6 (a) is that osteoclast generates test, wherein A. positive controls: (M-CSF10ng/mL+RANKL 40ng/mL); B. fusion rotein RTFP-1 experimental group: (M-CSF10ng/mL+ fusion rotein RTFP-1 30 μ g/mL); C. fusion rotein RTFP-2 experimental group: (M-CSF 10ng/mL+ fusion rotein RTFP-2 30 μ g/mL);
Wherein, Fig. 6 (b) is the test of L929 apoptosis, wherein A. blank group: (L929); B. positive controls: (L929+TNF-α 20ng/mL); C. fusion rotein RTFP-1 experimental group: (L929+ fusion rotein RTFP-1 30ug/mL); D. fusion rotein RTFP-2 experimental group: (L929+ fusion rotein RTFP-2 30ug/mL);
Wherein, Fig. 6 (c) is that fusion rotein is to the active measurement result of L929 apoptosis.
What Fig. 7 showed is titre and the time length that RANKL-TNF sample district fusion rotein stimulates body to produce antibody, and wherein Fig. 7 (a) detects NAT and the time length that produces in the immune serum with rhRANKL as envelope antigen; Fig. 7 (b) detects NAT and the time length that produces in the immune serum with rhTNF-α as envelope antigen.
What Fig. 8 showed is that RANKL-TNF sample district fusion rotein stimulates body to produce in the antibody and the ability of rhTNF-α and rhRANKL, and wherein Fig. 8 (a) is that the survival rate of respectively organizing of the cachexy mouse due to the rhTNF-α detects; Fig. 8 (b) is that the calcium level of respectively organizing mouse after discharging with bone calcium due to the rhRANKL is measured.
What Fig. 9 showed is that (wherein Fig. 9 (a) is a sickness rate of respectively organizing mouse to RANKL-TNF sample district fusion rotein stimulation body generation antibody for Collagen-Induced Arthritis, the CIA) provide protection of mouse assessment to collagen-induced sacroiliitis; Fig. 9 (b) is that the swollen joint expansibility of respectively organizing mouse is measured; Fig. 9 (c) is the joint scoring of respectively organizing mouse; Fig. 9 (d) is that the bone erosion degree of respectively organizing mouse Micro-CT changes.
Embodiment
Following examples further specify content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, modification or replacement to the inventive method, step or condition are done all belong to scope of the present invention.
If do not specialize the conventional means that used technique means is well known to those skilled in the art among the embodiment.
The structure of embodiment 1 RANKL-TNF sample district fusion protein prokaryotic expression carrier
According to RANKL-TNF sample district recombinant fragment (RANKL P171-234, P246-309, the BRU strain reversed transcriptive enzyme RT (414-424aa) of HIV-1) the characteristic Design primer (seeing the following form) of gene order and pET-28a (+) expression vector, with the RANKL full-length cDNA is template (Gen Bank NO:BC117286,1097bp; PDONR223,5004bp), kept the His label that pET-28a carries, adopt the method connection three's of recombinant PCR gene fragment, wherein the gene order of the BRU strain reversed transcriptive enzyme RT (414-424aa) of HIV-I is inserted in the centre of two RANKL-TNF sample district gene fragments, making up and obtaining expression vector is pET-28a (+)-RTFP-1; The gene order of the BRU strain reversed transcriptive enzyme RT (414-424aa) of HIV-I is inserted in the end of two RANKL-TNF sample district gene fragments, it is pET-28a (+)-RTFP-2 that structure obtains expression vector, and is pET-28a (+)-RTFP-3 with the expression vector that the wild-type mutant of above-mentioned two RANKL-TNF sample district gene fragment direct splicing obtains in contrast.Corresponding fusion gene sequence is shown in SEQ ID No.1 or 3,5.The PCR reaction conditions: 98 ℃ of pre-sex change 30s, circulate 30 times by following parameter: 96 ℃ of sex change 5s, 55-65 ℃ of annealing 15s, 72 ℃ are extended 15s, and last 72 ℃ are extended 10min.The PCR product carries out its size of electrophoresis observation in 1% sepharose, PCR by recombinant expression plasmid identifies and the double digestion evaluation, see Fig. 2, pcr amplification goes out the purpose band of expection size, and double digestion identifies that the target gene fragment that recombinant plasmid contains is the expection size, illustrates that the present invention has successfully made up the prokaryotic expression carrier of RANKL-TNF sample district fusion rotein.
Table 1 relevant primer
The abduction delivering of embodiment 2 RANKL-TNF sample district fusion roteins in intestinal bacteria
Recombinant clone plasmid transformation escherichia coli BL21 (DE3) competent cell that order-checking is correct is selected single colony inoculation in 10mL LB substratum (kantlex that contains 30mg/L), and 37 ℃, the 250rpm shaking culture is spent the night.Get the 30mL overnight culture next day and transfer in 1L LB substratum (kantlex that contains 30mg/L), 37 ℃, 250rpm is cultured to OD
600To 0.5, it is 0.1mM that adding IPTG makes it final concentration, 37 ℃, and centrifugal collection thalline behind the 250rpm continuation shaking culture 4.5h, SDS-PAGE and Western-blot analysis revealed can obtain a large amount of fusion roteins after 0.4mMIPTG induces, see Fig. 3,4.
The purifying and the renaturation of embodiment 3 RANKL-TNF sample district fusion roteins
The positive colony bacterial strain is in 0.4mM IPTG, and behind 37 ℃ of inducing culture 4.5h, 4 ℃, the centrifugal 15min of 6000rpm collects thalline, uses the PBS of precooling to wash thalline 6 times, ultrasonic resuspended 10min (super 4s stops 6s, and power is 40%).It is resuspended that every gram wet thallus adds the bacterial cellular protein lysate of 10 times of volumes, adds N,O-Diacetylmuramidase to 1mg/mL, adds proteinase inhibitor PMSF to 1mM simultaneously, after placing 30min on ice, the ultrasonic bacterium 10min that splits in ice bath, 12, the centrifugal 10min collecting precipitation of 000rpm.Again respectively once with TE damping fluid, each washing of 1%trixton-100, precipitation is dissolved in ultrasonic resuspended thalline (5mL/g wet thallus) among the PBS, slowly drip isopyknic 8M urea soln simultaneously, magnetic stir bar stirs 30min, centrifuged deposit is washed 1 time with the 4M urea soln, precipitation is resuspended in the dissolving damping fluid that contains 4M, and the centrifuging and taking supernatant obtains to contain the sex change liquid of purpose fusion rotein through the filtering with microporous membrane of 0.45 μ m.Affinity chromatography (Ni-NTAHis prepacked column 5mL) purifying target protein.According to the BCA albuminimetry with the protein denaturation liquid concentration dilution of purifying to 0.5mg/mL.Prepare renaturation solution (4M urea by progressively the successively decrease method of (4M-3M-2.5M-2M-1.5M-1.2M-0.8M-0.5M-0.2M-0M) of urea concentration, 50mM Tris, 0.5mM EDTA, 50mM NaCl, the 3mM reduced glutathion, the 1mM Sleep-promoting factor B, 10% (V/V) glycerine, 1% glycine, PBS, pH7.6), the protein denaturation liquid that dilutes is placed in the dialysis tubing, the ratio that is not more than 1: 20 in the inside and outside liquid proportional of renaturation slowly stirs the dialysis renaturation for 4 ℃.Whether separate out and what of the amount of separating out are determined best renaturation dialysis conditions according to albumen in the dialysis procedure, the dialyzate that urea concentration of replacing in about 4 hours reduces gradually, last in the PBS of pH7.6 solution dialysed overnight, change PBS solution therebetween one time, to the protein denaturation liquid renaturation of dialysing, RANKL-TNF sample district fusion rotein SDS-PAGE electrophorogram after the renaturation is seen Fig. 5, illustrates that this fusion rotein of employing aforesaid method can successful renaturation.
Foundation is the inducing culture system that the medullary cell of DIF is divided into osteoclast with M-CSF and RANKL.Get the BABL/c female SPF mouse of 6-15W, obtain medullary cell with the medullary space of irrigation with syringe mouse bones of limbs down in aseptic condition, single cell suspension is made with RPMI1640 substratum and the resuspended medullary cell of 10%FBS in 70nm cell sieve filtration back, and (slide counting cells density is 2.5 * 10
6/ mL), in 25cm
2In the culturing bottle at 37 ℃, 5%CO
2The former foster bone marrow cells in mice of being commissioned to train under the saturated humidity condition adds M-CSF and cultivate 24h after final concentration is 25ng/mL, and next day, the collecting cell suspension was the non-tack myelomonocyte of M-CSF dependency.1000rpm, the centrifugal 5min of normal temperature abandons supernatant, and PBS washes twice.With RPMI1640 substratum and 10%FBS re-suspended cell, counting and adjustment cell concn are 2.5 * 10
6/ mL is inoculated in cell respectively in 6 orifice plates and 96 orifice plates.Generate test by the osteoclast that promotes myelomonocyte to be divided into osteoclast, experiment is divided into RANKL-TNF sample district recombinant polypeptide group (the fusion rotein RTFP-1/2 that contains the M-CSF+30 μ g/mL of 25ng/mL) and natural human RANKL positive controls (the M-CSF+40ng/mL RANKL that contains 25ng/mL), every group of 12 samples, can fusion rotein is observed in TRAP dyeing stimulate myelomonocyte to be divided into osteoclast, the result shows, fusion rotein does not have the biologic activity of the promotion osteoclast generation of natural RANKL, sees Fig. 6 (a).
Set up L929 apoptosis culture system, L929 clone is the present of cytobiology teaching and research room of the Capital University of Medical Sciences, conventional recovery cell, and with RPMI1640 substratum and 10%FBS re-suspended cell, and counting adjustment cell concn is 1 * 10
6/ mL is inoculated in cell respectively in 6 orifice plates and 96 orifice plates, at 37 ℃, 5%CO
2Adherent culture 24h under the saturated humidity condition, experiment is divided into RANKL-TNF sample district recombinant polypeptide group (fusion rotein that contains 30 μ g/mL), natural humanTNF-'s cytokine group (the rhTNF-α that contains 20ng/mL), and experiment contrast group (only cultivating) with above-mentioned perfect medium, add above-mentioned fusion rotein and cytokine respectively and continue to cultivate 12h, 3 every group multiple holes of 6 orifice plates, can light microscopic is observed fusion rotein down promote the apoptotic metamorphosis of L929; Every group of 12 samples of 96 orifice plates are measured apoptosis rate with crystal violet staining assay down in the 570nm wavelength, and the result shows, compares with natural humanTNF-'s cytokine group, and fusion rotein does not have the apoptotic activity of the L929 of promotion, sees Fig. 6 (b).
Though the above-mentioned variant that experiment showed, fusion rotein for RANKL-TNF sample district does not have the osteoclasia effect of natural RANKL and the apoptosis-promoting effect of natural TNF-α, safety performance is good, can be further used in vivo test.
The experiment of embodiment 6 animal immunes
The female BABL/c mouse of fusion protein immunization 6～8w (SPF level), by body weight mouse is divided into experiment contrast group and fusion rotein RTFP-1, RTFP-2, RTFP-3 group, (the initial immunity postscript is 0d to subcutaneous abdomen multiple spot immune mouse, respectively at 21d, 42d, 152d booster immunization), every each immunizing dose of mouse is 200ug (100 μ l), complete Freund's adjuvant (CFA) emulsification of initial immunity with immunogen equivalent, booster immunization equivalent incomplete Freund's adjuvant (IFA) emulsification.Different time points (0d, 32d, 49d, 56d, 63d, 70d, 84d, 112d, 142d, 163d, 170d, 177d) eye socket detects the ability that produces neutralizing antibody in the mouse body with indirect elisa method after getting blood, use rhTNF-α (200ng/mL) and rhRANKL (200ng/mL) bag by elisa plate respectively, 4 ℃ are spent the night, and seal 1h with 1%BSA37 ℃, serum to be checked dilution in 1: 1000, the antibody of HRP mark 1: 20,000 dilution.The serum antibody titer measurement result shows, the fusion rotein group antibody generation level that contains the Th2 cell epitope is apparently higher than the experiment contrast group, and apparently higher than the fusion rotein control group (data as shown in Figure 7) of no Th2 cell epitope.
Neutralization experiment in the embodiment 7 antibody bodies
With reference to embodiment 6 described methods, 1W behind the 42d booster immunization, RTFP-2 fusion rotein group and experiment contrast group mouse tail vein give rhTNF-α (20ug/ only), and injection continuous three times, is duplicated mouse cachexy model every other day.The survival rate of mouse is respectively organized in injection back monitoring every day first, and the result shows, the survival rate of RTFP-2 fusion rotein group mouse that contains the Th2 cell epitope is apparently higher than experiment contrast group [data are shown in Fig. 8 (a)]; RTFP-2 fusion rotein and experiment contrast group mouse tail vein give rhRANKL (10ug/ only), inject 3d continuously, 3h and injection back 7d eye socket blood sampling first before injection and after the per injection, measure the serum calcium ion level, the result shows, but contains calcium level due to the RTFP-2 fusion rotein group mouse antagonism rhRANKL of Th2 cell epitope raise [data are shown in Fig. 8 (b)].
The male DBA-1 mouse of fusion protein immunization 5W (SPF level), method and immune flow process are with reference to embodiment 6.1W after the last immunity, except that experiment contrast group mouse, each organizes mouse contains the CFA of 4mg/mLBCG apart from root of the tail portion 1.5cm place intradermal immunization ox two Collagen Type VIs (CII) and equivalent emulsification (200ugCII, 100ul/ only), same procedure booster immunization (100ugCII+IFA behind the 3W, 100ul/ is only), duplicate the CIA mouse model.The sickness rate of mouse is respectively organized in monitoring every other day behind the booster immunization, and [standards of grading: 0=does not have arthritic symptom to carry out the joint scoring; 1=foot pawl or toe swollen and (or) red; 2=involve the swollen of two joints and (or) red; The plural swollen joint of 3=and (or) red; The arthritic symptom that 4=is serious involves whole sufficient pawl or toe], the swelling degree of measuring extremities joint with the vernier callipers of 0.02mm range is changed to 50d after the last immunity simultaneously; The disconnected neck of 50d is put to death mouse behind the last immunity CII, the Micro-CT tomoscan, and the bone erosion degree of mouse is respectively organized in assessment.The result shows that the RTFP-2 fusion rotein group mouse invasion rate that contains the Th2 cell epitope reduces, and disease symptoms is light, bone injury not obvious (p＜0.05, data are as shown in Figure 9).
Claims (9)
1.RANKL-TNF sample district fusion rotein, it is for RANKL-TNF sample district albumen and have the segmental fusion rotein of promiscuous Th2 cell epitope.
2. fusion rotein as claimed in claim 1 is characterized in that, described fusion rotein is: the 1) albumen of being made up of aminoacid sequence shown in SEQ ID No.2 or 4; Or, 2) aminoacid sequence shown in the SEQ ID No.2 or 4 be substituted, lack and/or increase one or several amino acid and have and 1) described albumen has the protein of same function.
3. the gene of coding claim 1 or 2 described fusion roteins.
4. gene as claimed in claim 3, its nucleotide sequence is shown in SEQ ID No.1 or 3.
5. contain claim 3 or 4 described Expression of Fusion Protein carriers.
6. the host cell that contains the described fusion rotein of claim 5.
7. method for preparing claim 1 or 2 described fusion roteins, it comprises the steps: claim 3 or 4 described gene clones are arrived expression vector, with described expression vector transformed host cell, screening positive clone, behind yeast culture and abduction delivering, separation and purification obtains this fusion rotein.
8. claim 1 or the 2 described fusion roteins application in the vaccine of preparation treatment rheumatoid arthritis.
9. vaccine for the treatment of rheumatoid arthritis, it is made for acceptable carrier on the claim 1 of effective dose or 2 described fusion roteins and the biotechnological formulation/vaccinology.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110135019 CN102241776B (en) | 2010-05-25 | 2011-05-24 | RANKL-TNF (Receptor Activator of Nuclear Factor Kappa-B Ligand-Tumour Necrosis Factor) sample region fusion protein and preparation method and application thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010181966.1 | 2010-05-25 | ||
| CN201010181966 | 2010-05-25 | ||
| CN 201110135019 CN102241776B (en) | 2010-05-25 | 2011-05-24 | RANKL-TNF (Receptor Activator of Nuclear Factor Kappa-B Ligand-Tumour Necrosis Factor) sample region fusion protein and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102241776A true CN102241776A (en) | 2011-11-16 |
| CN102241776B CN102241776B (en) | 2013-05-08 |
Family
ID=44960039
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110135019 Expired - Fee Related CN102241776B (en) | 2010-05-25 | 2011-05-24 | RANKL-TNF (Receptor Activator of Nuclear Factor Kappa-B Ligand-Tumour Necrosis Factor) sample region fusion protein and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102241776B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103060274A (en) * | 2012-12-28 | 2013-04-24 | 首都医科大学 | RANKL-TNF sample region mouse monoclonal antibody and its preparation method and use |
| CN103965357A (en) * | 2013-12-31 | 2014-08-06 | 嘉和生物药业有限公司 | Anti-human-RANKL (receptor activator of nuclear factor kb ligand) antibody |
| CN107056949A (en) * | 2017-02-10 | 2017-08-18 | 徐家科 | A kind of preparation method of RANKL TNF samples area fusion protein |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1582164A (en) * | 2001-11-07 | 2005-02-16 | 赛托斯生物技术公司 | Antigen arrays for treatment of bone disease |
-
2011
- 2011-05-24 CN CN 201110135019 patent/CN102241776B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1582164A (en) * | 2001-11-07 | 2005-02-16 | 赛托斯生物技术公司 | Antigen arrays for treatment of bone disease |
Non-Patent Citations (2)
| Title |
|---|
| 刘俊丽等: "重组骨保护素(rhOPG)药物的研究现状及应用展望", 《中国骨质疏松杂志》 * |
| 郑召岭等: "RANKL和骨保护素在类风湿关节炎中的作用", 《徐州医学院学报》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103060274A (en) * | 2012-12-28 | 2013-04-24 | 首都医科大学 | RANKL-TNF sample region mouse monoclonal antibody and its preparation method and use |
| CN103060274B (en) * | 2012-12-28 | 2013-12-11 | 首都医科大学 | RANKL-TNF sample region mouse monoclonal antibody and its preparation method and use |
| CN103965357A (en) * | 2013-12-31 | 2014-08-06 | 嘉和生物药业有限公司 | Anti-human-RANKL (receptor activator of nuclear factor kb ligand) antibody |
| CN105102482A (en) * | 2013-12-31 | 2015-11-25 | 嘉和生物药业有限公司 | Anti-human rankl antibody, humanized antibody, pharmaceutical compositions and uses thereof |
| CN103965357B (en) * | 2013-12-31 | 2016-08-17 | 嘉和生物药业有限公司 | A kind of anti-human RANKL antibody |
| CN105102482B (en) * | 2013-12-31 | 2019-02-01 | 嘉和生物药业有限公司 | A kind of anti-human RANKL antibody, its humanized antibody and their pharmaceutical composition and purposes |
| CN109517067A (en) * | 2013-12-31 | 2019-03-26 | 嘉和生物药业有限公司 | A kind of anti-human RANKL antibody, its humanized antibody and their pharmaceutical composition and purposes |
| CN109517067B (en) * | 2013-12-31 | 2021-12-03 | 嘉和生物药业有限公司 | Anti-human RANKL antibody, humanized antibody thereof, pharmaceutical composition and application thereof |
| CN107056949A (en) * | 2017-02-10 | 2017-08-18 | 徐家科 | A kind of preparation method of RANKL TNF samples area fusion protein |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102241776B (en) | 2013-05-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112745394B (en) | Recombinant human-like collagen and preparation method and application thereof | |
| CN100564517C (en) | A kind of anti-glioma peptide of scorpion and its production and application | |
| CN109153709A (en) | Nerve growth factor mutant | |
| CN113186223A (en) | Expression vector of novel coronavirus vaccine, construction method and application thereof, and vaccine | |
| CN102241776B (en) | RANKL-TNF (Receptor Activator of Nuclear Factor Kappa-B Ligand-Tumour Necrosis Factor) sample region fusion protein and preparation method and application thereof | |
| CN102370979B (en) | Building method for autovaccine by aiming at human TNF(Tumor Necrosis Factor)-alpha molecule | |
| CN106279431B (en) | A kind of pig circular ring virus subunit inactivated vaccine | |
| CN105916883B (en) | Bifunctional fusion proteins and its preparation method and application | |
| CN101214372A (en) | Construction method of protein vaccine for in vivo inducing autoantibody aiming at TNF-alpha molecule | |
| CN114349856B (en) | Fibroblast outer capsule infusion preparation and application thereof in beauty treatment and medicines | |
| CN109467599B (en) | Short peptide ATR001, monoclonal antibody prepared from short peptide and having function of preferentially regulating AT1R, and application of monoclonal antibody | |
| CN104292341A (en) | Blood coagulation factor VIII fusion protein as well as preparation method and use thereof | |
| CN101897953B (en) | Non-invasive high-penetrability epidermal growth factor and application thereof | |
| CN113372452B (en) | Echinococcus granulosus recombinant protein CTLA4-IgV-EgG1Y162 and application thereof | |
| CN101434656B (en) | Preparation and use of OPG-HSP70 fusion protein | |
| CN101475640B (en) | Conjugate, and preparation and use thereof | |
| CN101456913B (en) | Anti-tumor fusion protein and use thereof | |
| CN101544693A (en) | Recombined extrasin alpha 1 two-strand body protein and preparation method thereof | |
| CN114736296A (en) | Medicine or cosmetic prepared from fibroblast outer vesicle | |
| CN108218978A (en) | A kind of recombinant interleukin 18 and preparation method and application | |
| CN101298611B (en) | Active fragment of chlamydia proteasome sample active factor and expression method thereof | |
| CN102392041B (en) | Preparation method of recombinant human corticotropin releasing factor | |
| CN111961687A (en) | Drug target expression and purification method aiming at hypertension | |
| CN101089181A (en) | Production method of recombination human interleukin-4 | |
| CN102153644A (en) | Antigenic peptide for dimerization of epidermal growth factor receptor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130508 Termination date: 20210524 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |