CN114480503A - Gene overexpression lentivirus plasmid library marked by DNA label and preparation method and application thereof - Google Patents

Abstract

The invention relates to the field of plasmid libraries, in particular to a DNA label marked lentiviral plasmid library and a preparation method and application thereof. The lentiviral plasmid library of the invention comprises a plurality of lentiviral plasmids comprising, in order from 5 'to 3': screening a marker gene expression cassette, a gene ORF expression cassette, a universal sequence and a DNA tag sequence, wherein the DNA tag sequences on each lentiviral plasmid are different; wherein the gene ORF expression cassette contains a promoter and an ORF sequence of a gene. The lentivirus plasmid library can perform enrichment and sequencing detection on a DNA label sequence through a universal PCR primer so as to indicate a corresponding integrated gene ORF sequence, thereby realizing convenient and low-cost detection of a target gene integrated into a target cell in the same tube and performing subsequent screening experiments of various in vivo or in vitro biological function genes.

Description

Gene overexpression lentivirus plasmid library marked by DNA label and preparation method and application thereof

Technical Field

The invention relates to the field of plasmid libraries, in particular to a gene overexpression lentiviral plasmid library marked by a DNA label as well as a preparation method and application thereof.

Background

In the field of life science, gene knockout and overexpression techniques are two vital means for studying gene functions. When researchers search for unknown gene targets related to a certain biological process or function, it is often necessary to knock out or over-express multiple candidate genes on a large scale. In the traditional research mode, each gene is knocked out or over-expressed one by relying on a multi-well plate.

A screening technology based on a lentivirus plasmid library is a principle that a lentivirus carries a DNA sequence to be integrated into a host cell genome and a DNA sequencing tracking technology, and can realize knockout or overexpression screening of a plurality of genes in a single hole/single tube. This technique achieves knocking out or over-expressing as much as possible only one specific gene per cell by controlling the infection coefficient (MOI, typically MOI ═ 0.1-0.5) between lentiviral particles and the number of infected cells, so that each cell in the same tube is probabilistically infected with only one lentivirus. Then screening the target genes with enriched functionality in vitro or in vivo through the process related to the functions of the medicines or biological tissues; and finally, tracing the enriched target gene by a DNA sequencing mode. Compared with the traditional large-scale gene knockout or overexpression screening, the screening technology based on the lentiviral plasmid library pool can realize the simultaneous screening of a plurality of genes in a single tube, greatly reduces the workload and the cost, and can reduce the potential error caused by depending on a large amount of manual operation in the traditional technology. At present, the screening technology based on the lentiviral plasmid library pool is widely applied to the field of gene knockout.

Chemokines are a class of cytokines or signaling proteins secreted by cells and have the primary role of inducing directional migration of cells. Chemokine functions are mediated primarily by chemokine receptors. At present, there are at least several dozen chemokine receptors or mRNA variable spliceosomes in humans, based on the chemokine receptor genes with mRNA coding function included in NCBI. Cells expressing appropriate chemokine receptors to facilitate cell entry into target tissues are key to many in vivo studies or therapies, such as cellular immunotherapy. Because the variety of chemokine receptors and variants is wide, the actual biological function of each chemokine receptor migrating into a certain tissue or organ in a certain cell is verified one by one in an experimental animal body by a traditional screening mode, expensive cost is consumed, and huge workload is required.

There is currently no lentiviral plasmid library for overexpression of chemokine receptors. The construction of lentiviral over-expression plasmid libraries is often accomplished by reverse transcription from a library of transcripts expressed from a particular tissue or cell to obtain a cDNA library, and then constructing fragments of the cDNA library onto lentiviral plasmids. Because the genes expressed by different tissues or cells are different, the method is not suitable for constructing an overexpression library specially aiming at the chemokine receptor; moreover, because the DNA sequences of different coding genes are different, the expression abundance is greatly different and has different lengths (the DNA sequences of a large number of genes are too long), the lentivirus overexpression plasmid library constructed by the method cannot track and detect related target genes in a low-cost and high-throughput sequencing mode, and the enrichment degree of a plurality of genes in the library is excessively amplified or cannot be effectively detected due to the great difference of the abundance of different genes.

Disclosure of Invention

The invention aims to overcome the problems in the prior art and provides a lentivirus plasmid library, a preparation method and application thereof. The lentivirus plasmid library can perform enrichment and sequencing detection on a DNA label sequence through a universal PCR primer so as to indicate a corresponding integrated gene ORF sequence, thereby realizing convenient and low-cost detection of a target gene integrated into a target cell in the same tube and performing subsequent screening experiments of various in vivo or in vitro biological function genes. Meanwhile, the design and construction thought of the gene overexpression lentiviral plasmid marked by the DNA label can provide a thought for the construction of other gene overexpression lentiviral plasmid libraries in the future.

In order to achieve the above object, one aspect of the present invention provides a lentiviral plasmid library comprising a plurality of lentiviral plasmids comprising, in order from 5 'end to 3', the following elements: screening a marker gene expression cassette, a gene ORF expression cassette, a universal sequence and a DNA tag sequence, wherein the DNA tag sequences on each lentiviral plasmid are different;

wherein the gene ORF expression cassette contains a promoter and an ORF sequence of a gene.

In a second aspect, the invention provides a lentiviral backbone plasmid comprising a selectable marker gene expression cassette, a promoter for an ORF expression cassette of a gene, an ORF sequence insertion region of a gene, a universal sequence, and a DNA tag sequence insertion region.

In the present invention, the ORF sequence refers to an Open Reading Frame (ORF) sequence of a gene.

In the present invention, the DNA tag (DNA barcode) sequence refers to a DNA sequence having a length of 8-15 bp. In the invention, different ORF sequences are connected with different DNA tag sequences, and the corresponding ORF sequences can be indicated by detecting the DNA tag sequences in a DNA sequencing mode.

According to the invention, the ORF sequence, the universal sequence and the DNA tag sequence of the gene are connected to the lentivirus backbone plasmid, and when the lentivirus plasmid library is used for virus packaging, the ORF sequence of the gene carried by the lentivirus plasmid and the corresponding DNA tag sequence can be integrated into the genome of a cell along with lentivirus when cell infection is completed, the integrated DNA tag sequence can be enriched through PCR universal primers designed at two ends of the DNA tag sequence, and the enrichment degree is detected in a DNA sequencing mode, so that the enrichment level of the ORF sequence in the cell can be accurately and specifically indicated. Specifically, the beneficial effects obtained by the invention are as follows:

1. the plasmid library of the invention uses a lentivirus vector, so that ORF sequences in the library are integrated into the cell genome along with lentivirus; compared with a conventional non-integrative vector library, the ORF sequence of the lentiviral plasmid library can be stably expressed in cells for a long time, so that the in vitro or in vivo experiment monitoring can be conveniently carried out for a long time;

2. in the lentivirus plasmid library, in each lentivirus plasmid, the ORF sequence of the gene is marked by different DNA label sequences, so that the DNA label sequences and the ORF sequence are integrated into a cell genome; and the two ends of the DNA label sequence are convenient for enrichment and sequencing detection of the DNA label sequence by using a universal primer in a PCR (polymerase chain reaction) mode. Thus, ORF sequences in a lentiviral plasmid library can be indicated by simply detecting the DNA tag sequence;

3. the lentivirus backbone plasmid and the enzyme cutting sites thereof in the preferred embodiment of the invention are optimized, a plurality of restriction enzyme cutting sites are added, and unreasonable restriction enzyme cutting sites are removed, so that more interesting genes are replaced or connected into the backbone plasmid on the basis of the library, and the condition that the construction of the plasmid is not facilitated due to the fact that the gene sequence contains the existing single enzyme cutting site sequence on the plasmid is avoided or relieved.

4. In the application aspect, compared with the traditional research method, the library disclosed by the invention can be used for efficiently searching (confirming) the chemotactic factor for promoting the CAR-NK cell to infiltrate into the tumor, so that the research cost is reduced.

Drawings

FIG. 1 is a circular map of the pLenti-MG01 lentiviral backbone plasmid constructed in example 1, as delineated by Snapgene software;

FIG. 2 is a linear map of the optimized region involved in the pLenti-MG01 lentivirus backbone plasmid constructed in example 1 and a map of the restriction sites of single restriction enzymes, obtained by Snapgene software;

FIG. 3 is the DNA gel electrophoresis identification chart of pLenti-MG01 backbone plasmid after enzyme digestion in example 2;

FIG. 4 is a graph of the image of GFP fluorescence after infection of 293T cells with viral supernatant using pLenti-MG01 vector and control plasmid packaged virus, A is pLenti-MG01-GFP transfected 293T cells, brightfield; b is pLenti-MG01-GFP transfected 293T cells, bright field + green fluorescence; c is 293T cell transfected by control plasmid, and is in bright field; d is 293T cell transfected by control plasmid, bright field + green fluorescence;

FIG. 5 is a photograph showing the fluorescence images of the RFPs obtained after infecting 293T cells with the virus supernatant after the lentivirus plasmid-enveloped virus containing the ORF sequence of RFP prepared in example 3, wherein A is pLenti-MG01-RFP transfected 293T cells in bright field; b is pLenti-MG01-RFP transfected 293T cells, bright field + red fluorescence; c is 293T cell transfected by control plasmid, and is in bright field; d is 293T cell transfected by control plasmid, bright field + red fluorescence;

FIG. 6 Virus titer test A for different infection gradients of over-expressed chemokine ORF library plasmid virus concentrates: flow analysis chart of NK-92 cell infection efficiency when the using amount of the lentivirus plasmid library virus concentrated solution is 10 mu L;

b, flow analysis chart of NK-92 cell infection efficiency when the using amount of the lentivirus plasmid library virus concentrated solution is 1 mu L;

c, the using amount of the lentivirus plasmid library virus concentrated solution is 10^-1Flow analysis of NK-92 cell infection efficiency at μ L;

d, the using amount of the lentivirus plasmid library virus concentrated solution is 10^-2Flow analysis of NK-92 cell infection efficiency at μ L;

e, the using amount of the virus concentrated solution of the lentivirus plasmid library is 10^-3Flow analysis of NK-92 cell infection efficiency at μ L;

FIG. 7 construction of chemokine-overexpressing RFP-CAR-NK cells. A: proportion of RFP-CAR NK cells to infected NK cells B: ORF-GFP positive cells account for the proportion of RFP-CAR NK cells.

Detailed Description

The endpoints of the ranges and any values disclosed herein are not limited to the precise range or value, and such ranges or values should be understood to encompass values close to those ranges or values. For ranges of values, between the endpoints of each of the ranges and the individual points, and between the individual points may be combined with each other to give one or more new ranges of values, and these ranges of values should be considered as specifically disclosed herein.

Unless otherwise specified, various expression elements or sequences described herein are shown and linked in 5 'to 3' order.

In a first aspect, the present invention provides a lentiviral plasmid library comprising a plurality of lentiviral plasmids comprising, in order from 5 'to 3': screening a marker gene expression cassette, a gene ORF expression cassette, a universal sequence and a DNA tag sequence, wherein the DNA tag sequences on each lentiviral plasmid are different;

wherein the gene ORF expression cassette contains a promoter and an ORF sequence of a gene.

In some embodiments of the invention, the lentiviral backbone plasmid further comprises a cPPT/CTS element and a WPRE element, and the selectable marker gene expression cassette, a gene ORF expression cassette, a universal sequence, and a DNA tag sequence are between the cPPT/CTS element and the WPRE element. Preferably, the lentiviral backbone plasmid comprises the following elements from the 5 'cPPT/CTS end to the 3' WPRE end: a selection marker gene expression cassette, a gene ORF expression cassette, a universal sequence and a DNA tag sequence.

The promoter of the gene ORF expression cassette may be a common constitutive expression promoter. In some embodiments of the invention, the promoter of the ORF expression cassette of the gene is the EF-1 alpha promoter and/or the T7 promoter.

In some embodiments of the invention, the promoter of the ORF expression cassette of the gene is the EF-1 alpha promoter. Preferably, in order to meet the application scenario requirement of the lentivirus plasmid in vitro transcription, the promoter of the gene ORF expression cassette also comprises a T7 promoter. Further preferably, the promoter of the gene ORF expression cassette is EF-1 alpha promoter and T7 promoter, and the T7 promoter is positioned between the EF-1 alpha promoter and the ORF sequence of the gene.

In some embodiments of the invention, the selectable marker gene expression cassette comprises a CMV promoter, a GFP gene, and a puromycin gene; wherein the CMV promoter is used for promoting the transcription of a GFP gene and a puromycin gene. Preferably, the selectable marker gene expression cassette further comprises a P2A signal cleavage peptide element, wherein the P2A signal cleavage peptide element is located between the GFP gene and the puromycin gene. The lentivirus plasmid contains the screening marker gene expression cassette, can monitor the efficiency of cells infected by lentiviruses in the later period, and screens and enriches the cells infected successfully.

In some embodiments of the invention, the lentiviral plasmid library is a lentiviral plasmid library comprising an ORF sequence of a human chemokine receptor gene. Preferably, the lentiviral plasmid library is a human chemokine receptor overexpression lentiviral plasmid library labeled with a DNA tag.

In the present invention, the ORF sequence of the gene can be found at NCBI. In some embodiments of the present invention, the ORF of the genes is NM, XM, NM, XM, NM. Wherein NM _001122951.3, NM _001296.5, NM _020311.3, NM _178445.2, NM _001295.3, NM _016602.3, NM _001123041.3, NM _001164680.2, XM _017005685.1, NM _005508.5, NM _000579.4, NM _004367.6, NM _001838.4, NM _001301714.2, NM _005201.4, NM _031200.3, NM _001130910.2, NM _001171174.1, NM _000634.3, NM _001557.4, NM _001142797.2, XM _005262256.3, XM _005262257.3, NM _001348056.2, NM _001348059.2, NM _001008540.2, and NM _001716.5 are ORF sequences of human chemokine receptor genes, and the rest are ORF sequences of reference genes.

In the present invention, the universal sequence is a consensus sequence between the ORF sequence and the DNA tag sequence of the gene in the lentiviral plasmid, and is mainly used for primer design in sequencing analysis. The universal sequences are identical in the different lentiviral plasmids. In some embodiments of the invention, the universal sequence is SEQ ID NO: 209.

in some embodiments of the invention, the lentiviral plasmid library comprises all the ORF sequences of the reported human chemokine receptor genes, and the ORF sequence of each gene is labeled with a specific DNA tag, so that the in vitro or in vivo biological function related screening of the human chemokine receptor genes can be realized in a single tube by a simple sequencing mode.

In the present invention, the reference gene is a control gene as a human chemokine receptor gene, and has been reported to have a positive regulation effect or a negative regulation effect or no regulation effect on the infiltration or survival of CAR-NK or CAR-T cells in tumors in the study of cell therapy, including genes such as transcription factors and membrane proteins. In particular for negative or positive gene controls for the final sequencing screening results.

In some embodiments of the invention, the DNA tag sequence is 8-15bp, preferably 10bp in length.

In some embodiments of the invention, the DNA tag sequence is SEQ ID NO 58-200.

In some embodiments of the invention, in order to reduce the abundance error of a single ORF sequence in the library during the operation of constructing a lentiviral plasmid library, 1-4DNA tag sequences are designed specifically for the ORF sequence of each gene to improve the reliability of the library screening results. The ORF sequence of the gene can correspond to 1-4DNA tags. For example, 4 lentiviral plasmids containing the ORF sequence of NM _001122951.3 can be used, each lentiviral plasmid containing a DNA tag sequence of SEQ ID NO: 58-61.

In the present invention, the lentiviral plasmid may be prepared by a technique conventional in the art. Preferably, the lentiviral plasmid can be prepared by the following preparation method:

1) construction of lentivirus backbone plasmid: synthesizing a DNA optimization sequence, wherein the DNA optimization sequence contains a screening marker gene expression cassette, a promoter of a gene ORF expression cassette, an ORF sequence insertion region of a gene, a universal sequence and a DNA label sequence insertion region, and connecting the DNA optimization sequence to an initial plasmid pCDH-CMV-MCS to obtain a lentiviral backbone plasmid;

2) construction of lentivirus plasmid: synthesizing DNA sequences containing ORF sequences, universal sequences and DNA label sequences of the genes, and inserting the DNA sequences into the lentiviral backbone plasmid to obtain the lentiviral plasmid.

In some embodiments of the invention, in step (1), the DNA-optimized sequence further comprises a restriction enzyme cleavage site. The restriction site may be a site of a restriction enzyme commonly used in the art, and may be at least one of the sites of SbfI, XhoI, AvrII, AscI, AgeI, PmeI, BamHI, EcoRV, BstXI, NotI, EcoRI, SalI enzymes, for example. The position of the restriction enzyme on the DNA sequence can be selected by the skilled person according to the actual requirements.

In some embodiments of the present invention, the lentiviral backbone plasmid vector may further comprise sequences commonly used in the art, such as Kozak sequences that may enhance the expression of ORF sequences, Flag sequences used for detection of protein expression levels, and the like, which may be selected by one of skill in the art as desired.

In some embodiments of the invention, in step (1), the selectable marker gene expression cassette comprises a CMV promoter, a GFP gene, a P2A signal cleavage peptide element, a puromycin gene. The GFP gene may be selected conventionally in the art, and may be, for example, a CoGFP sequence, or a Kozak-GFP sequence, preferably a Kozak-CoGFP sequence, for the purpose of enhancing expression.

In some embodiments of the invention, in step (1), the promoter of the ORF expression cassette of the gene is the EF-1. alpha. promoter and/or the T7 promoter.

In some embodiments of the invention, in step (1), the constructing of the lentiviral backbone plasmid comprises: the DNA optimization sequence was ligated between SpeI and SalI on the starting plasmid.

In some preferred embodiments of the invention, the DNA-optimized sequence comprises a restriction enzyme cleavage site, a CMV promoter, a Kozak-CoGFP sequence, a P2A signal cleavage peptide element, a Puro sequence, an EF-1 alpha promoter, a T7 promoter, a Kozak sequence, an ORF sequence insertion region of a gene, a universal sequence (preferably the sequence shown in SEQ ID NO: 209), a DNA tag sequence insertion region, and a Flag sequence. Further preferably, the DNA optimization sequence is SEQ ID NO: 204.

in some embodiments of the invention, the pCDH-CMV-MCS plasmid has the sequence of SEQ ID NO: 205.

in some embodiments of the invention, the lentiviral backbone plasmid has the sequence of SEQ ID NO 206.

The inventors found in the study that the sequence of the lentiviral backbone plasmid is SEQ ID NO:206, the lentiviral backbone plasmid can meet the requirement of flexible replacement of elements in the coding region, and provides high throughput assembly for testing the combination of elements in the gene ORF expression cassette or testing the function of different genes.

In the present invention, the construction method of the lentiviral plasmid library may be a construction method which is conventional in the art. Preferably, the lentiviral plasmid library is constructed by the following construction method: and (3) uniformly mixing all the lentivirus plasmids in equal volume to obtain a lentivirus plasmid library. Preferably, the concentration of the constructed lentiviral plasmid is 0.5-1. mu.g/. mu.L.

The method is used for constructing the lentivirus plasmid library, each lentivirus plasmid is independently constructed and extracted, and is uniformly mixed into the same tube in an equal amount in the later period through plasmid concentration determination, so that compared with other gene knockout or overexpression plasmid libraries synthesized based on a chip, the content of each constituent plasmid in the library is more uniform, and the screening result in the later period is more stable and reliable.

In a second aspect, the invention provides a lentiviral backbone plasmid comprising a selectable marker gene expression cassette, a promoter for an ORF expression cassette of a gene, an ORF sequence insertion region of a gene, a universal sequence, and a DNA tag sequence insertion region.

In some embodiments of the invention, the lentiviral backbone plasmid vector further comprises a restriction enzyme site. The restriction site may be a restriction site commonly used in the art, and may be at least one of the restriction sites of SbfI, XhoI, AvrII, AscI, AgeI, PmeI, BamHI, EcoRV, BstXI, NotI, EcoRI, SalI enzymes, for example. The position of the restriction enzyme on the lentiviral backbone plasmid vector can be selected by one skilled in the art according to practical needs.

In some embodiments of the present invention, the lentiviral backbone plasmid vector may further comprise sequences commonly used in the art, such as Kozak sequences that may enhance the expression of ORF sequences, Flag sequences used for detection of protein expression levels, and the like, which may be selected by one of ordinary skill in the art as desired.

In some embodiments of the invention, the selectable marker gene expression cassette comprises a CMV promoter, a GFP gene, a P2A signal cleavage peptide element, a puromycin gene. Preferably, the GFP gene is a sequence of Kozak-GoGFP, which is routinely selected in the art.

In some embodiments of the invention, the promoter of the ORF expression cassette of the gene is the EF-1 alpha promoter and/or the T7 promoter.

In some preferred embodiments of the invention, the lentiviral backbone plasmid contains a restriction enzyme site, a CMV promoter, a Kozak-CoGFP sequence, a P2A element, a Puro sequence, an EF-1 alpha promoter, a T7 promoter, a Kozak sequence, an ORF sequence insertion region of a gene, a universal sequence (preferably the sequence shown in SEQ ID NO: 209), a DNA tag sequence insertion region, and a Flag sequence. Preferably, the lentiviral backbone plasmid has the sequence of SEQ ID NO: 206. wherein, SEQ ID NO:206, 4481-4483 th ORF sequence insertion region of the gene, 4484-4540 th universal sequence and 4541-4550 th DNA tag sequence insertion region. When the lentiviral plasmid of the lentiviral plasmid library is constructed by using the lentiviral backbone plasmid, the ORF sequence insertion region, the general sequence and the DNA tag sequence insertion region of the gene of the lentiviral backbone plasmid are cut off by enzyme digestion, and the lentiviral plasmid is prepared by connecting the lentiviral backbone plasmid with the ORF sequence insertion region, the general sequence and the DNA tag sequence of the gene.

The slow virus backbone plasmid can be used for conveniently tracking a DNA sequence integrated into a genome in a cell for a long time; on the basis of the library, when more interesting genes are connected into the skeleton plasmid, the situation that the construction of the plasmid is not facilitated due to the fact that the gene sequence contains the existing single enzyme cutting site sequence on the plasmid is avoided or alleviated; in the application aspect, compared with the traditional research method, the library has the effects of efficiently searching for the chemotactic factor for promoting the CAR-NK cell to infiltrate into the tumor and reducing the research cost.

In a third aspect, the invention provides the use of a lentiviral plasmid library as described above in cell therapy.

In some preferred embodiments of the invention, the application is in the study of cell therapy including CAR-NK cells, CAR-T, CAR-DC, CAR-macrocage, etc.

The present invention will be described in detail below by way of examples. In the following examples, unless otherwise specified, the reagents and starting materials are commercially available and the methods used are those commonly used in the art.

In example 3, the plasmid transfection complex was prepared by the following method: (1) mu.g of the plasmid was diluted with 25. mu.L of opti-MEM, and the resulting mixture was mixed well to prepare a diluted DNA solution.

(2) mu.L of PEI (MW 40000) transfection reagent (1mg/mL) was diluted with 25. mu.L of opti-MEM, mixed well to prepare a PEI dilution, and allowed to stand at room temperature for 5 min.

(3) And (3) completely adding the PEI diluent into the DNA diluent, fully and uniformly mixing by using a gun head, and standing for 15 minutes at room temperature to prepare the plasmid transfection compound.

Unless otherwise specified, the cell culture medium of the 293T cells was DMEM complete medium containing 10% FBS and 1% streptomycin. Wherein, the 1% streptomycin mixture is purchased from Solibao, cat # P1400; DMEM medium was purchased from HyClone, cat # SH30243.01B; FBS is available from Thermo, under the product number 10099141C.

Unless otherwise specified, the cell culture medium for NK-92 cells was MyeloCult supplemented with hIL-2^TMH5100 medium, hIL-2 used final concentration of 100 unit/mL. Wherein hIL-2 is available from Miltenyi, MyeloCult^TMH5100 medium was purchased from StemCell Technologies.

NK-92 cells were purchased from ATCC under the designation CRL-2407.

293T cells were purchased from ATCC under the accession number CRL-3216.

In the following examples, the general sequence is SEQ ID NO: 209:

GATATCGATTACAAGGATGACGACGATAAGTGATAAACCCGCTGACCATCAGTGTGG。

the ORF sequences are all available from the ORF library of the National Center for Biotechnology Information (NCBI) website.

Unless otherwise stated, the sequencing was carried out on pCDH-CMV-MCS plasmid, obtained from Addge corporation and having the sequence of SEQ ID NO: 205:

ACGCGTGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACCTGAAAGCGAAAGGGAAACCAGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGCACAGCAAGCGGCCACTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCTCGACGGTATCGGTTAACTTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAATTCAAAATTTTATCGATACTAGTATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTTTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGATTCTAGAGCTAGGGATCCGCTAGCCCCGGGGCGGCCGCGAATTCGTCGACAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAACGAAAATAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCATCTTATTATTCAGTATTTATAACTTGCAAAGAAATGAATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGACTTTTGCAGAGACGGCCCAAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGA

the EF-1 alpha promoter sequence is SEQ ID NO: 201:

GGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGATCCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAG

the CMV promoter sequence is SEQ ID NO: 202:

GACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT

the sequence of Kozak-CoGFP sequence-P2A signal cleavage peptide element-puromycin gene is Seq ID NO: 203: GCCACCATGGAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCAAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGGTGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGTGCTGGTGGGCAGCTTCGCCCGCACCTTCAGCCTGCGCGACGGCGGCTACTACAGCTTCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGCTGCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCCATCGCCTTCGCCAGATCCCGCGCTCAGTCGTCCAATTCTGCCGTGGACGGCACCGCCGGACCCGGCTCCACCGGATCTCGCGCAACAAACTTCTCTCTGCTGAAACAAGCCGGAGATGTCGAAGAGAATCCTGGACCGCCTAGGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGAGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA

Example 1

This example illustrates the construction of lentiviral backbone plasmids.

The DNA sequence (synthesized by Nanjing Kinshire) for synthesizing SEQ ID NO 204 is designed into a DNA optimized sequence, wherein the DNA sequence comprises restriction enzyme cutting sites, a CMV promoter, a Kozak-CoGFP sequence, a P2A signal cutting peptide element, a Puro sequence, an EF-1 alpha promoter, a T7 promoter, a Kozak sequence, an ORF sequence insertion region of a gene, a general sequence, a DNA tag sequence insertion region and a Flag sequence, and the synthesized DNA sequence is subjected to double enzyme digestion by NheI and SalI and then is connected between SpeI and SalI on a pCDH-CMV-MCS lentivirus skeleton plasmid to obtain a lentivirus skeleton plasmid which is named as pLenti-MG01 and the sequence of which is shown as SEQ ID NO 206.

SEQ ID NO:204：

GCTAGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGATTCTAGAGGACCTGCAGGAGACTCGAGTGTGCCACCATGGAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCAAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGGTGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGTGCTGGTGGGCAGCTTCGCCCGCACCTTCAGCCTGCGCGACGGCGGCTACTACAGCTTCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGCTGCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCCATCGCCTTCGCCAGATCCCGCGCTCAGTCGTCCAATTCTGCCGTGGACGGCACCGCCGGACCCGGCTCCACCGGATCTCGCGCAACAAACTTCTCTCTGCTGAAACAAGCCGGAGATGTCGAAGAGAATCCTGGACCGCCTAGGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGAGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGAGTCGGCGCGCCCCTTATACCGGTACGTATTAGTCATCGCCCATGGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGATCCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGTTTAAACTTAAGCTTGGTACCGAGCTCGGATCCGCCACCAGCGATATCGATTACAAGGATGACGACGATAAGTGATAAACCCGCTGACCATCAGTGTGGGTCTTTGTCACCATCTGACTGGGTCGCGGCCGCATTGAATTCACTGTCGAC

SEQ ID NO:206：

ACGCGTGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACCTGAAAGCGAAAGGGAAACCAGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGCACAGCAAGCGGCCACTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCTCGACGGTATCGGTTAACTTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAATTCAAAATTTTATCGATACTAGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGATTCTAGAGGACCTGCAGGAGACTCGAGTGTGCCACCATGGAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCAAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGGTGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGTGCTGGTGGGCAGCTTCGCCCGCACCTTCAGCCTGCGCGACGGCGGCTACTACAGCTTCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGCTGCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCCATCGCCTTCGCCAGATCCCGCGCTCAGTCGTCCAATTCTGCCGTGGACGGCACCGCCGGACCCGGCTCCACCGGATCTCGCGCAACAAACTTCTCTCTGCTGAAACAAGCCGGAGATGTCGAAGAGAATCCTGGACCGCCTAGGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGAGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGAGTCGGCGCGCCCCTTATACCGGTACGTATTAGTCATCGCCCATGGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGATCCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGTTTAAACTTAAGCTTGGTACCGAGCTCGGATCCGCCACCAGCGATATCGATTACAAGGATGACGACGATAAGTGATAAACCCGCTGACCATCAGTGTGGGTCTTTGTCACCATCTGACTGGGTCGCGGCCGCATTGAATTCACTGTCGACGTCAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAACGAAAATAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCATCTTATTATTCAGTATTTATAACTTGCAAAGAAATGAATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGACTTTTGCAGAGACGGCCCAAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTG

The circular map of pLenti-MG01 lentiviral backbone plasmid is shown in FIG. 1, and the linear map of the related optimized region (i.e. optimized DNA sequence) and the distribution of single restriction enzyme cutting sites in pLenti-MG01 lentiviral backbone plasmid are shown in FIG. 2.

Example 2

This example is used to verify the correctness of pLenti-MG01, and to perform DNA sequencing, DNA gel electrophoresis, enzyme digestion identification, and functional verification of each expression cassette and multiple key enzyme digestion sites on pLenti-MG 01.

1. Sequencing primers shown in Table 1 are designed, and pLenti-MG01 is subjected to amplification sequencing, wherein a PCR amplification system is shown in Table 2, and a PCR program is shown in Table 3, so that PCR amplification products are obtained.

TABLE 1

TABLE 2

Reagent	Dosage of
		Q52 XMix (from NEB Corp.)	12.5μL
MG01SP-F(10μM)	1.25μL
		MG01SP-R(10μM)	1.25μL
pLenti-MG01 plasmid (20-50 ng/. mu.L)	1μL
		ddH2O	9μL
Total amount of system	25μL

TABLE 3

The PCR amplification product was transformed into Competent Cells of Escherichia coli JM109 (see the instructions in Takara JM109 component Cells kit for the transformation method, cat # 9052), spread on ampicillin-resistant LB solid medium (ampicillin addition amount 100mg/L medium), and cultured at 37 ℃ for 15 hours. Single clones were picked up in 2mL of LB liquid medium (ampicillin resistance, 100mg/L) and cultured at 37 ℃ for 14 hours at 200rpm, and the bacterial solution was sequenced (sequencing Co., Bomeyer organism). See table 1 for sequencing primers.

2. Selecting a clone extraction plasmid with correct sequencing, further identifying the structural correctness of the constructed pLenti-MG01 vector by adopting a single-enzyme digestion mode and a double-enzyme digestion mode, and completing quality inspection through gel electrophoresis. Specifically, the method comprises the following steps:

1) single enzyme digestion verification

A BamHI digestion reaction system, a NotI digestion reaction system, a PmeI digestion reaction system and an XbaI digestion reaction system are prepared respectively according to the table 4, and digestion is carried out in water bath at 37 ℃ for 2 hours respectively.

TABLE 4

1% agarose gel was prepared, and electrophoresis was performed using 1 XTAE electrophoresis buffer at 140V for 45min, the results are shown in FIG. 3.

2) Double restriction enzyme verification

SpeI/SalI double enzyme digestion reaction system and SfiI/XhoI double enzyme digestion reaction system were prepared as shown in Table 5, and enzyme digestion was carried out in water bath at 37 ℃ for 2 hours, respectively.

TABLE 5

1% agarose gel was prepared, and electrophoresis was performed using 1 XTAE electrophoresis buffer at 140V for 45min, the results are shown in FIG. 3.

The result shows that the size of the restriction enzyme cutting band after endonuclease detection accords with the expectation, which indicates that the constructed plasmid restriction enzyme cutting detection is qualified.

Example 3

This example was used to verify the functionality of the lentiviral backbone plasmid pLenti-MG 01.

1. The backbone vector was stained to 293T cells for GFP expression detection and puromycin killing assay.

293T cells were seeded one day in 24-well plates, preferably at a cell density of around 40% at the time of transfection.

Plasmid DNA transfection was performed using PEI (MW 40000) transfection reagent at a cell density of about 40% in 24-well plates, with plasmid pcdna3.1 (purchased from tokyo kasei corporation) as a control plasmid. Specifically, the method comprises the following steps:

(1) preparing pLenti-MG01 plasmid transfection complex and control plasmid transfection complex;

(2) the pLenti-MG01 plasmid transfection complex and the control plasmid transfection complex were added to a 24-well plate inoculated with 293T cells, respectively, and pLenti-MG01 plasmid transfection complex and the control plasmid transfection complex were added to 3 wells each, 50. mu.L per well, gently mixed.

(3) After 6h of culture, the cell culture medium was changed.

(4) Puromycin (puromycin) was added at a final concentration of 1. mu.g/mL to a 24-well plate 24h after transfection.

(5) After further incubation for 72h, GFP fluorescence imaging was performed and the results are shown in figure 4.

As shown in FIG. 4, 293T cells transfected with pLenti-MG01 showed high GFP expression (FIG. 4B, cell green fluorescence is seen) and function against puromycin killing (FIG. 4A, vigorous adherent growth), whereas 293T cells transfected with the control plasmid (pcDNA3.1) showed no GFP signal (FIG. 4D, cells did not green fluorescence) and cells had been killed by puromycin (FIG. 4C, growth atrophy apoptosis).

2. Connecting a Red Fluorescent Protein (RFP) gene to a pLenti-MG01 vector to construct a pLenti-MG01-RFP lentiviral plasmid, transferring the pLenti-MG01-RFP lentiviral plasmid into 293T cells, and detecting the expression of the RFP to verify whether the function of the pLenti-MG01 vector for expressing the RFP is normal. Specifically, the method comprises the following steps:

(I) obtaining the RFP-containing lentivirus plasmid, namely pLenti-MG01-RFP lentivirus plasmid:

an RFP sequence (SEQ ID NO: 211, synthesized by Nanjing Kinshire company) is synthesized, an RFP sequence enzyme-cleaved fragment and a pLenti-MG01 vector enzyme-cleaved fragment are respectively obtained by means of BamHI and EcoRV double enzyme cleavage, and then the RFP sequence enzyme-cleaved fragment is connected to a pLenti-MG01 framework plasmid to obtain a ligation product.

SEQ ID NO：211:

GGATCCGCCACCATGGTGTCTAAGGGCGAAGAGCTGATTAAGGAGAACATGCACATGAAGCTGTACATGGAGGGCACCGTGAACAACCACCACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAGGGCACCCAGACCATGAGAATCAAGGTGGTCGAGGGCGGCCCTCTCCCCTTCGCCTTCGACATCCTGGCTACCAGCTTCATGTACGGCAGCAGAACCTTCATCAACCACACCCAGGGCATCCCCGACTTCTTTAAGCAGTCCTTCCCTGAGGGCTTCACATGGGAGAGAGTCACCACATACGAAGACGGGGGCGTGCTGACCGCTACCCAGGACACCAGCCTCCAGGACGGCTGCCTCATCTACAACGTCAAGATCAGAGGGGTGAACTTCCCATCCAACGGCCCTGTGATGCAGAAGAAAACACTCGGCTGGGAGGCCAACACCGAGATGCTGTACCCCGCTGACGGCGGCCTGGAAGGCAGAAGCGACATGGCCCTGAAGCTCGTGGGCGGGGGCCACCTGATCTGCAACTTCAAGACCACATACAGATCCAAGAAACCCGCTAAGAACCTCAAGATGCCCGGCGTCTACTATGTGGACCACAGACTGGAAAGAATCAAGGAGGCCGACAAAGAGACCTACGTCGAGCAGCACGAGGTGGCTGTGGCCAGATACTGCGACCTCCCTAGCAAACTGGGGCACAAACTTAATTGAGATATC

The cleavage system is shown in Table 6, and the ligation system is shown in Table 7.

TABLE 6

TABLE 7

The ligation products were transformed into E.coli JM109 Competent Cells (see the instructions in Takara JM109 component Cells kit for the transformation method, cat # 9052), spread on ampicillin-resistant LB solid medium (ampicillin addition amount 100mg/L medium), and cultured at 37 ℃ for 15 hours. Single clones were picked up in 2mL of LB liquid medium (ampicillin resistance, 100mg/L) and cultured at 37 ℃ and 200rpm for 14 hours, and the resulting culture was subjected to sequencing (sequencer: Bomeide organism). Sequencing primer SEQ ID NO: caattgatccggtgcctagag.

The plasmid fed back correctly after the sequencing was transferred to Escherichia coli Stabl3 competent cells, and then spread on ampicillin-resistant LB solid medium (ampicillin addition amount: 100mg/L medium), and cultured at 37 ℃ for 15 hours. The single clone is picked up to 30mL LB liquid culture medium (ampicillin resistance, 100MG/L) and cultured at 37 ℃ and 200rpm for 14 hours, the obtained bacterial liquid is centrifuged at 6000rpm for 10 minutes to collect thalli, an OMEGA plasmid miniprep kit (product number: D6950-02) is used for carrying out plasmid miniprep extraction to obtain pLenti-MG01-RFP lentiviral plasmid, the concentration of the extracted plasmid is adjusted to 1 mu g/mu L for virus packaging, and the subsequent cell transfection experiment is completed.

(II) cell transfection experiments: 293T cells were seeded one day in 24-well plates, preferably at a cell density of around 70% at the time of transfection. Plasmid DNA transfection was performed using PEI (MW 40000) transfection reagent at a cell density of about 70% in a 24-well plate, with plasmid pcdna3.1 (purchased from tsry, tokyo) as a control plasmid. Specifically, the method comprises the following steps:

(1) pLenti-MG01-RFP plasmid transfection complex and control plasmid transfection complex were prepared.

(2) The pLenti-MG01 plasmid transfection complex and the control plasmid transfection complex were added to a 24-well plate inoculated with 293T cells, respectively, and pLenti-MG01 plasmid transfection complex and the control plasmid transfection complex were added to 3 wells each, 50. mu.L per well, gently mixed.

(3) After 6 hours of culture, the cell culture medium was changed and the culture was continued for 48 hours.

(4) RFP fluorescence imaging was performed on cells in 24-well plates and the results are shown in fig. 5.

As can be seen from FIG. 5, 293T cells transfected with pLenti-MG01-RFP showed high RFP expression (FIG. 5B, cells were seen to fluoresce red), whereas 293T cells transfected with the control plasmid (pcDNA3.1) showed no RFP signal (FIG. 5D, cells were not fluoresced red).

The results of the tests show that the sequence and function of the pLenti-MG01 skeleton plasmid can reach the expected result of the library plasmid of the invention.

Example 4

This example illustrates the construction of lentiviral plasmids, and exemplifies a gene of interest as a human chemokine receptor gene.

1) The ORF sequence of the control gene was obtained from the ORF bank of the National Center for Biotechnology Information (NCBI) website (SEQ ID NO: 29-57) and the ORF sequence of the human chemokine receptor gene (SEQ ID NO: 1-28).

2) DNA tag sequences (SEQ ID NOS: 58-200) and a 57bp universal sequence were designed. Wherein the DNA tag sequence does not contain the restriction enzyme cutting site existing in pLenti-MG 01.

3) The sequence from the 5 'end to the 3' end is as follows: DNA synthesis (carried out by Nanjing Kingsler company) is carried out on the sequence of the restriction site 1, the ORF sequence, the 57bp universal sequence, the DNA tag sequence and the restriction site 2 to obtain a synthesized DNA sequence. The ORF sequence, Transcript ID, ORF name, and cleavage site 1 and cleavage site 2 are shown in Table 7, and the DNA tag sequence of each ORF sequence is shown in Table 9.

TABLE 8

TABLE 9

4) Inserting the DNA sequences synthesized in the step 3) into pLenti-MG01 plasmids respectively in an enzyme digestion connection mode to obtain lentiviral plasmids.

The enzyme digestion system is shown in Table 10, and the ligation system is shown in Table 11.

Watch 10

TABLE 11

The ligation products were transformed into E.coli JM109 Competent Cells (see the instructions in Takara JM109 component Cells kit for the transformation method, cat # 9052), spread on ampicillin-resistant LB solid medium (ampicillin addition amount 100mg/L medium), and cultured at 37 ℃ for 15 hours. Single clones were picked up in 2mL of LB liquid medium (ampicillin resistance, 100mg/L ampicillin) and cultured at 37 ℃ and 200rpm for 14 hours, and the resulting culture was subjected to sequencing (sequencer: Nanjing Kinsry). Sequencing primers SEQ ID NO 210: caattgatccggtgcctagag and SEQ ID NO 208.

The plasmid fed back correctly after sequencing was transferred to Escherichia coli Stabl3 competent cells, and then spread on ampicillin-resistant LB solid medium and cultured at 37 ℃ for 15 hours. A single clone was picked up and cultured in 30mL of LB liquid medium (ampicillin resistance, 100mg/L) at 37 ℃ and 200rpm for 14 hours, and the resulting bacterial solution was centrifuged at 6000rpm for 10 minutes to collect the cells for preparation for extraction of endotoxin-free lentiviral plasmids.

And (3) each constructed lentivirus plasmid is identified through electrophoresis detection and DNA sequencing, so that the correct plasmid is constructed for the next operation of constructing the library.

Example 5

This example serves to illustrate the construction of a lentiviral plasmid library.

The lentiviral plasmids constructed in example 4 were each subjected to a small-scale extraction using an OMEGA plasmid small-scale extraction kit (cat. No. D6950-02), and the concentration of the extracted plasmid was adjusted to 1. mu.g/. mu.L.

And (3) taking each plasmid, taking the same volume, and uniformly mixing the plasmids into a tube to obtain a DNA label labeled human chemokine receptor overexpression lentivirus plasmid library. 100 mu L of each tube of the plasmid library is subpackaged and stored in a refrigerator at the temperature of 80 ℃ below zero for the requirements of subsequent slow virus packaging and in vitro and in vivo screening experiments.

Application example

This application example is used to construct chemokine-overexpressing RFP-CAR-NK cells.

According to the method of example 5, each plasmid obtained in example 5 was pipetted at 5. mu.L and mixed in a 1.5mL centrifuge tube to obtain a lentiviral plasmid library

1. The preparation method of the virus concentrated solution of the lentivirus plasmid library comprises the following steps:

1)293T cells were plated in advance into 15cm cell culture dishes for virus packaging when the cell density was 80-90% grown.

2) And (3) virus packaging system:

solution A: Opti-MEM 3.75mL, PEI 120. mu.L

And B, liquid B: 3.75mL of Opti-MEM, 15. mu.L of PSPAX2 plasmid, 15. mu.L of pMD2.G,

lentiviral plasmid library 30. mu.L

And slowly adding the solution A into the solution B, gently mixing, and standing at room temperature for 15 minutes to obtain the library plasmid transfection complex.

3) The library plasmid transfection complex was added to a 15cm cell culture dish with 293T cells and gently mixed.

4) After 6 hours of culture, the cell culture medium of 293T cells was replaced, and after further 24 hours of culture, the virus supernatant was collected for the first time.

5) The cell culture medium was added again, and the culture was continued for 24 hours, and the virus supernatant was collected for the second time.

6) And (3) mixing the virus supernatants collected in the two steps uniformly, and concentrating the virus supernatant by ultracentrifugation (25000rpm,4 ℃ and 2 hours) to obtain a lentivirus plasmid library virus concentrate.

2. The preparation method of the CD19-CAR virus (RFP +) concentrated solution comprises the following steps:

1)293T cells were plated in advance into 15cm cell culture dishes for virus packaging when the cell density was 80-90% grown.

2) And (3) virus packaging system:

solution A: Opti-MEM 3.75mL, PEI 120. mu.L

And B, liquid B: 3.75mL of Opti-MEM, 15. mu.L of PSPAX2 plasmid, 15. mu.L of pMD2.G,

CD19-CAR(RFP⁺) Plasmid 30. mu.L

And slowly adding the solution A into the solution B, gently mixing, and standing at room temperature for 15 minutes to obtain the CAR plasmid transfection complex.

3) CAR plasmid transfection complexes were added to 15cm cell culture dishes with 293T cells and mixed gently.

4) After 6 hours of culture, the cell culture medium of 293T cells was replaced, and after further 24 hours of culture, the virus supernatant was collected for the first time.

5) The cell culture medium was added again, and the culture was continued for 24 hours, and the virus supernatant was collected for the second time.

6) The virus supernatants collected twice were mixed well and added to a virus centrifuge tube (brand: millipore cargo number: UFC910024) under 4 deg.C and 4000rpm for 60 min to obtain CD19-CAR (RFP)⁺) And (3) virus concentrated solution.

Lentivirus plasmid library virus concentrate droplet size test:

1) cell plating: inoculating NK-92 cells (purchased from ATCC) into a 24-well plate, wherein 10000 NK-92 cells are per well, and 3 multiple wells are arranged in each gradient of the dosage gradient of the virus concentrated solution;

2) the dosage gradient of the slow virus plasmid library virus concentrated solution used for infecting NK-92 cells is 10 mu L, 1 mu L and 10 mu L in sequence^-1μL，10^-2μL，10^-3μ L of whichThe induction complex MOI is 0.3;

3) sequentially adding the lentivirus plasmid library virus concentrate into NK-92 cells according to the dosage gradient of the lentivirus plasmid library virus concentrate in the step 2), infecting for 24 hours, then centrifuging for 3 minutes at 230g, removing supernatant, adding 100 mu L of cell culture medium of the NK-92 cells, culturing for 48 hours, and carrying out flow analysis on the titer of the lentivirus plasmid library virus concentrate. The results are shown in FIG. 6, which shows that the infection efficiency meets the experimental requirements, and the concentration is 10^-1mu.L represents MOI of 0.3.

Method for infecting CAR-NK cells with a virus concentrate of a lentiviral plasmid library:

1) NK-92 cells were seeded into 6-well plates at approximately 1.7 × 10 per well⁶Individual NK-92 cells;

2) calculating the use amount of the lentivirus plasmid library virus concentrated solution according to the infection complex number MOI of 0.3, adding the lentivirus plasmid library virus concentrated solution into a 6-hole plate, and replacing a new cell culture medium after infecting for 6 hours;

3) add CAR Virus (RFP) to 6-well plates⁺) The concentrate was 100. mu.L, and the cell culture medium was replaced with fresh one 24 hours after infection.

4) After 4 days of culture, the culture was continued by changing to a 10cm dish, and the infection efficiency of lentivirus was analyzed by flow analysis, and the results are shown in FIG. 7. The results of Panel A in FIG. 7 show CAR (RFP)⁺) The proportion of positive cells; panel B shows that 17.36% of CAR positive cells were positive for lentiviral plasmid library virus concentrate infection, with an MOI of 0.17: 1, showing that human chemokine-overexpressing lentiviral plasmid library virus concentrate infected CAR-NK cells with MOI in the range of 0.1-0.5 have been successfully prepared.

The CAR-NK cells prepared by the application example can be potentially applied to various CAR-NK cell tumor infiltration experimental models (such as an in-vitro CAR-NK cell infiltration model in tumor organoids, an in-vivo CAR-NK cell infiltration model for NPG mouse solid tumors and the like) so as to search for appropriate chemokine receptors and promote the CAR-NK cell infiltration to tumors.

The preferred embodiments of the present invention have been described above in detail, but the present invention is not limited thereto. Within the scope of the technical idea of the invention, many simple modifications can be made to the technical solution of the invention, including combinations of various technical features in any other suitable way, and these simple modifications and combinations should also be regarded as the disclosure of the invention, and all fall within the scope of the invention.

SEQUENCE LISTING

<110> Beijing Mg Ka technology Ltd

<120> gene overexpression lentivirus plasmid library marked by DNA label and preparation method and application thereof

<130> I73359BMG

<160> 154

<170> PatentIn version 3.5

<210> 1

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 1

gtctttgtca 10

<210> 2

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 2

gacaagtgat 10

<210> 3

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 3

aagtatgccc 10

<210> 4

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 4

ggataaccgc 10

<210> 5

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 5

gttgtccgac 10

<210> 6

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 6

cgtgtttgtt 10

<210> 7

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 7

acttccgtcg 10

<210> 8

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 8

aactccctat 10

<210> 9

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 9

tgatagaaac 10

<210> 10

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 10

gttattggac 10

<210> 11

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 11

cgcgcaccca 10

<210> 12

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 12

gttagtgtta 10

<210> 13

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 13

atcacatcgt 10

<210> 14

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 14

gttcctatgg 10

<210> 15

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 15

ttacctggta 10

<210> 16

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 16

agtatcgtct 10

<210> 17

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 17

aaccttccgt 10

<210> 18

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 18

agattccttc 10

<210> 19

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 19

aacctagtag 10

<210> 20

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 20

tatatccttg 10

<210> 21

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 21

gcattctgtc 10

<210> 22

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 22

attcttcaac 10

<210> 23

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 23

tactcagcgt 10

<210> 24

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 24

tccttggatg 10

<210> 25

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 25

ctacgacgta 10

<210> 26

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 26

cgaagtcgat 10

<210> 27

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 27

tcctagtacc 10

<210> 28

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 28

ctgatagact 10

<210> 29

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 29

ctcagatgga 10

<210> 30

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 30

ccttccgtat 10

<210> 31

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 31

gctagataga 10

<210> 32

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 32

tgtgtattcc 10

<210> 33

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 33

cgtaacgtag 10

<210> 34

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 34

ctttgtacga 10

<210> 35

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 35

atcagatgcc 10

<210> 36

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 36

gggagcgatt 10

<210> 37

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 37

aagtcaggtt 10

<210> 38

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 38

ctcattgtaa 10

<210> 39

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 39

tccaggctag 10

<210> 40

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 40

cctgtcatta 10

<210> 41

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 41

gagttccctt 10

<210> 42

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 42

gcgcaacttg 10

<210> 43

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 43

tcatttcctc 10

<210> 44

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 44

agtgatggag 10

<210> 45

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 45

ctcgtttccg 10

<210> 46

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 46

tcctttcctg 10

<210> 47

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 47

acgttgtggc 10

<210> 48

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 48

cagtaagttc 10

<210> 49

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 49

gattaaccag 10

<210> 50

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 50

ctgggcaatt 10

<210> 51

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 51

gcttctcctt 10

<210> 52

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 52

ccactcattt 10

<210> 53

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 53

tttcaacgcc 10

<210> 54

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 54

taactcaggg 10

<210> 55

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 55

tacgatttgt 10

<210> 56

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 56

tctcagtgtt 10

<210> 57

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 57

gtattccctc 10

<210> 58

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 58

tacgcctata 10

<210> 59

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 59

gagatgtccg 10

<210> 60

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 60

gctttcttca 10

<210> 61

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 61

aggttggagt 10

<210> 62

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 62

tatgcgaggc 10

<210> 63

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 63

gtatccttcc 10

<210> 64

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 64

gctcattacc 10

<210> 65

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 65

cagtctccgt 10

<210> 66

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 66

tcaatccttc 10

<210> 67

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 67

tattgggaca 10

<210> 68

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 68

tgagaacgac 10

<210> 69

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 69

tgtacccgct 10

<210> 70

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 70

cttcactctg 10

<210> 71

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 71

gtgtgttgtc 10

<210> 72

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 72

tgcaattacc 10

<210> 73

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 73

gggttgttgt 10

<210> 74

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 74

tggattcccg 10

<210> 75

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 75

ccgtgttcct 10

<210> 76

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 76

ggtggctaga 10

<210> 77

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 77

aatcacggtc 10

<210> 78

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 78

ttccgaggat 10

<210> 79

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 79

gagatgtctg 10

<210> 80

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 80

agcttacctg 10

<210> 81

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 81

ggactaagtt 10

<210> 82

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 82

tgttcccgct 10

<210> 83

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 83

ttctttgcct 10

<210> 84

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 84

tggcttcagg 10

<210> 85

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 85

cgtgtttaac 10

<210> 86

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 86

tctcagacct 10

<210> 87

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 87

cagtcgtggt 10

<210> 88

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 88

aagttcactc 10

<210> 89

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 89

tatcaaccaa 10

<210> 90

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 90

tttgtcctgt 10

<210> 91

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 91

gcgctacttc 10

<210> 92

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 92

cacgtagacc 10

<210> 93

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 93

actgatggac 10

<210> 94

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 94

ctccgaatca 10

<210> 95

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 95

ccattcaact 10

<210> 96

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 96

cagttcctca 10

<210> 97

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 97

gagtcaccaa 10

<210> 98

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 98

acagcgccgt 10

<210> 99

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 99

tacgagcagt 10

<210> 100

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 100

tcagtcagat 10

<210> 101

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 101

tagccgtttc 10

<210> 102

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 102

ttgcttaccg 10

<210> 103

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 103

gccggacgac 10

<210> 104

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 104

ctcctaccta 10

<210> 105

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 105

atatgtatca 10

<210> 106

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 106

gattcttgac 10

<210> 107

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 107

ttctgggtcc 10

<210> 108

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 108

acaatttgaa 10

<210> 109

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 109

atttccattc 10

<210> 110

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 110

accctttacc 10

<210> 111

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 111

acctttatgc 10

<210> 112

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 112

ggttactcgt 10

<210> 113

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 113

ccttggataa 10

<210> 114

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 114

tagcgagccc 10

<210> 115

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 115

cattaacggg 10

<210> 116

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 116

ggacgctttc 10

<210> 117

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 117

cacttaactc 10

<210> 118

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 118

gcgatggtag 10

<210> 119

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 119

cactgccgtc 10

<210> 120

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 120

agtatgccat 10

<210> 121

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 121

ccaaagtaag 10

<210> 122

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 122

acccgtccct 10

<210> 123

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 123

cattagagtc 10

<210> 124

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 124

gcttccgaat 10

<210> 125

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 125

cttacctagt 10

<210> 126

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 126

agtttccact 10

<210> 127

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 127

gatccctttg 10

<210> 128

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 128

aattcaaccg 10

<210> 129

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 129

gacctcattg 10

<210> 130

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 130

gtctcttggc 10

<210> 131

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 131

tgccagtatc 10

<210> 132

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 132

ctttccggtc 10

<210> 133

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 133

gtccctgcaa 10

<210> 134

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 134

gtacgcagtc 10

<210> 135

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 135

atggttcacg 10

<210> 136

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 136

catttgtctg 10

<210> 137

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 137

cttatttcct 10

<210> 138

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 138

gcactcctgc 10

<210> 139

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 139

cagcccactg 10

<210> 140

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 140

ccagctcatt 10

<210> 141

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 141

aacccaccgt 10

<210> 142

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 142

ggatgtaccg 10

<210> 143

<211> 10

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 143

gtcattgtat 10

<210> 144

<211> 212

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 144

gggcagagcg cacatcgccc acagtccccg agaagttggg gggaggggtc ggcaattgat 60

ccggtgccta gagaaggtgg cgcggggtaa actgggaaag tgatgtcgtg tactggctcc 120

gcctttttcc cgagggtggg ggagaaccgt atataagtgc agtagtcgcc gtgaacgttc 180

tttttcgcaa cgggtttgcc gccagaacac ag 212

<210> 145

<211> 584

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 145

gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta gttcatagcc 60

catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 120

acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 180

ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 240

aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 300

ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 360

tagtcatcgc tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc 420

ggtttgactc acggggattt ccaagtctcc accccattga cgtcaatggg agtttgtttt 480

ggcaccaaaa tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa 540

tgggcggtag gcgtgtacgg tgggaggtct atataagcag agct 584

<210> 146

<211> 1392

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 146

cccgccatgg agatcgagtg ccgcatcacc ggcaccctga acggcgtgga gttcgagctg 60

gtgggcggcg gagagggcac ccccaagcag ggccgcatga ccaacaagat gaagagcacc 120

aaaggcgccc tgaccttcag cccctacctg ctgagccacg tgatgggcta cggcttctac 180

cacttcggca cctaccccag cggctacgag aaccccttcc tgcacgccat caacaacggc 240

ggctacacca acacccgcat cgagaagtac gaggacggcg gcgtgctgca cgtgagcttc 300

agctaccgct acgaggccgg ccgcgtgatc ggcgacttca aggtggtggg caccggcttc 360

cccgaggaca gcgtgatctt caccgacaag atcatccgca gcaacgccac cgtggagcac 420

ctgcacccca tgggcgataa cgtgctggtg ggcagcttcg cccgcacctt cagcctgcgc 480

gacggcggct actacagctt cgtggtggac agccacatgc acttcaagag cgccatccac 540

cccagcatcc tgcagaacgg gggccccatg ttcgccttcc gccgcgtgga ggagctgcac 600

agcaacaccg agctgggcat cgtggagtac cagcacgcct tcaagacccc catcgccttc 660

gccagatccc gcgctcagtc gtccaattct gccgtggacg gcaccgccgg acccggctcc 720

accggatctc gcgcaacaaa cttctctctg ctgaaacaag ccggagatgt cgaagagaat 780

cctggaccgc ctaggaccga gtacaagccc acggtgcgcc tcgccacccg cgacgacgtc 840

cccagggccg tacgcaccct cgccgccgcg ttcgccgact accccgccac gcgccacacc 900

gtcgatccgg accgccacat cgagcgggtc accgagctgc aagaactctt cctcacgcgc 960

gtcgggctcg acatcggcaa ggtgtgggtc gcggacgacg gcgccgcggt ggcggtctgg 1020

accacgccgg agagcgtcga agcgggggcg gtgttcgccg agatcggccc gcgcatggcc 1080

gagttgagcg gttcccggct ggccgcgcag caacagatgg aaggcctcct ggcgccgcac 1140

cggcccaagg agcccgcgtg gttcctggcc accgtcggag tctcgcccga ccaccagggc 1200

aagggtctgg gcagcgccgt cgtgctcccc ggagtggagg cggccgagcg cgccggggtg 1260

cccgccttcc tggagacctc cgcgccccgc aacctcccct tctacgagcg gctcggcttc 1320

accgtcaccg ccgacgtcga ggtgcccgaa ggaccgcgca cctggtgcat gacccgcaag 1380

cccggtgcct ga 1392

<210> 147

<211> 2665

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 147

gctagcatta tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg 60

tattagtcat cgctattacc atggacattg attattgact agttattaat agtaatcaat 120

tacggggtca ttagttcata gcccatatat ggagttccgc gttacataac ttacggtaaa 180

tggcccgcct ggctgaccgc ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt 240

tcccatagta acgccaatag ggactttcca ttgacgtcaa tgggtggagt atttacggta 300

aactgcccac ttggcagtac atcaagtgta tcatatgcca agtacgcccc ctattgacgt 360

caatgacggt aaatggcccg cctggcatta tgcccagtac atgaccttat gggactttcc 420

tacttggcag tacatctacg tattagtcat cgctattacc atggtgatgc ggttttggca 480

gtacatcaat gggcgtggat agcggtttga ctcacgggga tttccaagtc tccaccccat 540

tgacgtcaat gggagtttgt tttggcacca aaatcaacgg gactttccaa aatgtcgtaa 600

caactccgcc ccattgacgc aaatgggcgg taggcgtgta cggtgggagg tctatataag 660

cagagctcgt ttagtgaacc gtcagatcgc ctggagacgc catccacgct gttttgacct 720

ccatagaaga ttctagagga cctgcaggag actcgagtgt gccaccatgg agagcgacga 780

gagcggcctg cccgccatgg agatcgagtg ccgcatcacc ggcaccctga acggcgtgga 840

gttcgagctg gtgggcggcg gagagggcac ccccaagcag ggccgcatga ccaacaagat 900

gaagagcacc aaaggcgccc tgaccttcag cccctacctg ctgagccacg tgatgggcta 960

cggcttctac cacttcggca cctaccccag cggctacgag aaccccttcc tgcacgccat 1020

caacaacggc ggctacacca acacccgcat cgagaagtac gaggacggcg gcgtgctgca 1080

cgtgagcttc agctaccgct acgaggccgg ccgcgtgatc ggcgacttca aggtggtggg 1140

caccggcttc cccgaggaca gcgtgatctt caccgacaag atcatccgca gcaacgccac 1200

cgtggagcac ctgcacccca tgggcgataa cgtgctggtg ggcagcttcg cccgcacctt 1260

cagcctgcgc gacggcggct actacagctt cgtggtggac agccacatgc acttcaagag 1320

cgccatccac cccagcatcc tgcagaacgg gggccccatg ttcgccttcc gccgcgtgga 1380

ggagctgcac agcaacaccg agctgggcat cgtggagtac cagcacgcct tcaagacccc 1440

catcgccttc gccagatccc gcgctcagtc gtccaattct gccgtggacg gcaccgccgg 1500

acccggctcc accggatctc gcgcaacaaa cttctctctg ctgaaacaag ccggagatgt 1560

cgaagagaat cctggaccgc ctaggaccga gtacaagccc acggtgcgcc tcgccacccg 1620

cgacgacgtc cccagggccg tacgcaccct cgccgccgcg ttcgccgact accccgccac 1680

gcgccacacc gtcgatccgg accgccacat cgagcgggtc accgagctgc aagaactctt 1740

cctcacgcgc gtcgggctcg acatcggcaa ggtgtgggtc gcggacgacg gcgccgcggt 1800

ggcggtctgg accacgccgg agagcgtcga agcgggggcg gtgttcgccg agatcggccc 1860

gcgcatggcc gagttgagcg gttcccggct ggccgcgcag caacagatgg aaggcctcct 1920

ggcgccgcac cggcccaagg agcccgcgtg gttcctggcc accgtcggag tctcgcccga 1980

ccaccagggc aagggtctgg gcagcgccgt cgtgctcccc ggagtggagg cggccgagcg 2040

cgccggggtg cccgccttcc tggagacctc cgcgccccgc aacctcccct tctacgagcg 2100

gctcggcttc accgtcaccg ccgacgtcga ggtgcccgaa ggaccgcgca cctggtgcat 2160

gacccgcaag cccggtgcct gagtcggcgc gccccttata ccggtacgta ttagtcatcg 2220

cccatggggc agagcgcaca tcgcccacag tccccgagaa gttgggggga ggggtcggca 2280

attgatccgg tgcctagaga aggtggcgcg gggtaaactg ggaaagtgat gtcgtgtact 2340

ggctccgcct ttttcccgag ggtgggggag aaccgtatat aagtgcagta gtcgccgtga 2400

acgttctttt tcgcaacggg tttgccgcca gaacacagct ctggctaact agagaaccca 2460

ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggtttaa 2520

acttaagctt ggtaccgagc tcggatccgc caccagcgat atcgattaca aggatgacga 2580

cgataagtga taaacccgct gaccatcagt gtgggtcttt gtcaccatct gactgggtcg 2640

cggccgcatt gaattcactg tcgac 2665

<210> 148

<211> 5760

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 148

acgcgtgtag tcttatgcaa tactcttgta gtcttgcaac atggtaacga tgagttagca 60

acatgcctta caaggagaga aaaagcaccg tgcatgccga ttggtggaag taaggtggta 120

cgatcgtgcc ttattaggaa ggcaacagac gggtctgaca tggattggac gaaccactga 180

attgccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgggtctc 240

tctggttaga ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta 300

agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact 360

ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtggcg 420

cccgaacagg gacctgaaag cgaaagggaa accagagctc tctcgacgca ggactcggct 480

tgctgaagcg cgcacggcaa gaggcgaggg gcggcgactg gtgagtacgc caaaaatttt 540

gactagcgga ggctagaagg agagagatgg gtgcgagagc gtcagtatta agcgggggag 600

aattagatcg cgatgggaaa aaattcggtt aaggccaggg ggaaagaaaa aatataaatt 660

aaaacatata gtatgggcaa gcagggagct agaacgattc gcagttaatc ctggcctgtt 720

agaaacatca gaaggctgta gacaaatact gggacagcta caaccatccc ttcagacagg 780

atcagaagaa cttagatcat tatataatac agtagcaacc ctctattgtg tgcatcaaag 840

gatagagata aaagacacca aggaagcttt agacaagata gaggaagagc aaaacaaaag 900

taagaccacc gcacagcaag cggccactga tcttcagacc tggaggagga gatatgaggg 960

acaattggag aagtgaatta tataaatata aagtagtaaa aattgaacca ttaggagtag 1020

cacccaccaa ggcaaagaga agagtggtgc agagagaaaa aagagcagtg ggaataggag 1080

ctttgttcct tgggttcttg ggagcagcag gaagcactat gggcgcagcc tcaatgacgc 1140

tgacggtaca ggccagacaa ttattgtctg gtatagtgca gcagcagaac aatttgctga 1200

gggctattga ggcgcaacag catctgttgc aactcacagt ctggggcatc aagcagctcc 1260

aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg gggatttggg 1320

gttgctctgg aaaactcatt tgcaccactg ctgtgccttg gaatgctagt tggagtaata 1380

aatctctgga acagattgga atcacacgac ctggatggag tgggacagag aaattaacaa 1440

ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga 1500

acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 1560

ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620

agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt 1680

tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg 1740

tggagagaga gacagagaca gatccattcg attagtgaac ggatctcgac ggtatcggtt 1800

aacttttaaa agaaaagggg ggattggggg gtacagtgca ggggaaagaa tagtagacat 1860

aatagcaaca gacatacaaa ctaaagaatt acaaaaacaa attacaaaat tcaaaatttt 1920

atcgatacta gtattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca 1980

tctacgtatt agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc 2040

gtggatagcg gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga 2100

gtttgttttg gcaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat 2160

tgacgcaaat gggcggtagg cgtgtacggt gggaggttta tataagcaga gctcgtttag 2220

tgaaccgtca gatcgcctgg agacgccatc cacgctgttt tgacctccat agaagattct 2280

agagctaggg atccgctagc cccggggcgg ccgcgaattc gtcgacaatc aacctctgga 2340

ttacaaaatt tgtgaaagat tgactggtat tcttaactat gttgctcctt ttacgctatg 2400

tggatacgct gctttaatgc ctttgtatca tgctattgct tcccgtatgg ctttcatttt 2460

ctcctccttg tataaatcct ggttgctgtc tctttatgag gagttgtggc ccgttgtcag 2520

gcaacgtggc gtggtgtgca ctgtgtttgc tgacgcaacc cccactggtt ggggcattgc 2580

caccacctgt cagctccttt ccgggacttt cgctttcccc ctccctattg ccacggcgga 2640

actcatcgcc gcctgccttg cccgctgctg gacaggggct cggctgttgg gcactgacaa 2700

ttccgtggtg ttgtcgggga aatcatcgtc ctttccttgg ctgctcgcct gtgttgccac 2760

ctggattctg cgcgggacgt ccttctgcta cgtcccttcg gccctcaatc cagcggacct 2820

tccttcccgc ggcctgctgc cggctctgcg gcctcttccg cgtcttcgcc ttcgccctca 2880

gacgagtcgg atctcccttt gggccgcctc cccgcctggt acctttaaga ccaatgactt 2940

acaaggcagc tgtagatctt agccactttt taaaagaaaa ggggggactg gaagggctaa 3000

ttcactccca acgaaaataa gatctgcttt ttgcttgtac tgggtctctc tggttagacc 3060

agatctgagc ctgggagctc tctggctaac tagggaaccc actgcttaag cctcaataaa 3120

gcttgccttg agtgcttcaa gtagtgtgtg cccgtctgtt gtgtgactct ggtaactaga 3180

gatccctcag acccttttag tcagtgtgga aaatctctag cagtagtagt tcatgtcatc 3240

ttattattca gtatttataa cttgcaaaga aatgaatatc agagagtgag aggaacttgt 3300

ttattgcagc ttataatggt tacaaataaa gcaatagcat cacaaatttc acaaataaag 3360

catttttttc actgcattct agttgtggtt tgtccaaact catcaatgta tcttatcatg 3420

tctggctcta gctatcccgc ccctaactcc gcccagttcc gcccattctc cgccccatgg 3480

ctgactaatt ttttttattt atgcagaggc cgaggccgcc tcggcctctg agctattcca 3540

gaagtagtga ggaggctttt ttggaggcct agacttttgc agagacggcc caaattcgta 3600

atcatggtca tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc cacacaacat 3660

acgagccgga agcataaagt gtaaagcctg gggtgcctaa tgagtgagct aactcacatt 3720

aattgcgttg cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta 3780

atgaatcggc caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc 3840

gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa 3900

ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa 3960

aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct 4020

ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac 4080

aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc 4140

gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc 4200

tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg 4260

tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga 4320

gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta acaggattag 4380

cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta 4440

cactagaagg acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag 4500

agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg 4560

caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac 4620

ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc 4680

aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag 4740

tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc 4800

agcgatctgt ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac 4860

gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc 4920

accggctcca gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg 4980

tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag 5040

tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc 5100

acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac 5160

atgatccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag 5220

aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac 5280

tgtcatgcca tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg 5340

agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaatacggg ataataccgc 5400

gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact 5460

ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg 5520

atcttcagca tcttttactt tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa 5580

tgccgcaaaa aagggaataa gggcgacacg gaaatgttga atactcatac tcttcctttt 5640

tcaatattat tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg 5700

tatttagaaa aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccacctga 5760

<210> 149

<211> 8500

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 149

acgcgtgtag tcttatgcaa tactcttgta gtcttgcaac atggtaacga tgagttagca 60

acatgcctta caaggagaga aaaagcaccg tgcatgccga ttggtggaag taaggtggta 120

cgatcgtgcc ttattaggaa ggcaacagac gggtctgaca tggattggac gaaccactga 180

attgccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgggtctc 240

tctggttaga ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta 300

agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact 360

ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtggcg 420

cccgaacagg gacctgaaag cgaaagggaa accagagctc tctcgacgca ggactcggct 480

tgctgaagcg cgcacggcaa gaggcgaggg gcggcgactg gtgagtacgc caaaaatttt 540

gactagcgga ggctagaagg agagagatgg gtgcgagagc gtcagtatta agcgggggag 600

aattagatcg cgatgggaaa aaattcggtt aaggccaggg ggaaagaaaa aatataaatt 660

aaaacatata gtatgggcaa gcagggagct agaacgattc gcagttaatc ctggcctgtt 720

agaaacatca gaaggctgta gacaaatact gggacagcta caaccatccc ttcagacagg 780

atcagaagaa cttagatcat tatataatac agtagcaacc ctctattgtg tgcatcaaag 840

gatagagata aaagacacca aggaagcttt agacaagata gaggaagagc aaaacaaaag 900

taagaccacc gcacagcaag cggccactga tcttcagacc tggaggagga gatatgaggg 960

acaattggag aagtgaatta tataaatata aagtagtaaa aattgaacca ttaggagtag 1020

cacccaccaa ggcaaagaga agagtggtgc agagagaaaa aagagcagtg ggaataggag 1080

ctttgttcct tgggttcttg ggagcagcag gaagcactat gggcgcagcc tcaatgacgc 1140

tgacggtaca ggccagacaa ttattgtctg gtatagtgca gcagcagaac aatttgctga 1200

gggctattga ggcgcaacag catctgttgc aactcacagt ctggggcatc aagcagctcc 1260

aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg gggatttggg 1320

gttgctctgg aaaactcatt tgcaccactg ctgtgccttg gaatgctagt tggagtaata 1380

aatctctgga acagattgga atcacacgac ctggatggag tgggacagag aaattaacaa 1440

ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga 1500

acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 1560

ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620

agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt 1680

tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg 1740

tggagagaga gacagagaca gatccattcg attagtgaac ggatctcgac ggtatcggtt 1800

aacttttaaa agaaaagggg ggattggggg gtacagtgca ggggaaagaa tagtagacat 1860

aatagcaaca gacatacaaa ctaaagaatt acaaaaacaa attacaaaat tcaaaatttt 1920

atcgatacta gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca 1980

tctacgtatt agtcatcgct attaccatgg acattgatta ttgactagtt attaatagta 2040

atcaattacg gggtcattag ttcatagccc atatatggag ttccgcgtta cataacttac 2100

ggtaaatggc ccgcctggct gaccgcccaa cgacccccgc ccattgacgt caataatgac 2160

gtatgttccc atagtaacgc caatagggac tttccattga cgtcaatggg tggagtattt 2220

acggtaaact gcccacttgg cagtacatca agtgtatcat atgccaagta cgccccctat 2280

tgacgtcaat gacggtaaat ggcccgcctg gcattatgcc cagtacatga ccttatggga 2340

ctttcctact tggcagtaca tctacgtatt agtcatcgct attaccatgg tgatgcggtt 2400

ttggcagtac atcaatgggc gtggatagcg gtttgactca cggggatttc caagtctcca 2460

ccccattgac gtcaatggga gtttgttttg gcaccaaaat caacgggact ttccaaaatg 2520

tcgtaacaac tccgccccat tgacgcaaat gggcggtagg cgtgtacggt gggaggtcta 2580

tataagcaga gctcgtttag tgaaccgtca gatcgcctgg agacgccatc cacgctgttt 2640

tgacctccat agaagattct agaggacctg caggagactc gagtgtgcca ccatggagag 2700

cgacgagagc ggcctgcccg ccatggagat cgagtgccgc atcaccggca ccctgaacgg 2760

cgtggagttc gagctggtgg gcggcggaga gggcaccccc aagcagggcc gcatgaccaa 2820

caagatgaag agcaccaaag gcgccctgac cttcagcccc tacctgctga gccacgtgat 2880

gggctacggc ttctaccact tcggcaccta ccccagcggc tacgagaacc ccttcctgca 2940

cgccatcaac aacggcggct acaccaacac ccgcatcgag aagtacgagg acggcggcgt 3000

gctgcacgtg agcttcagct accgctacga ggccggccgc gtgatcggcg acttcaaggt 3060

ggtgggcacc ggcttccccg aggacagcgt gatcttcacc gacaagatca tccgcagcaa 3120

cgccaccgtg gagcacctgc accccatggg cgataacgtg ctggtgggca gcttcgcccg 3180

caccttcagc ctgcgcgacg gcggctacta cagcttcgtg gtggacagcc acatgcactt 3240

caagagcgcc atccacccca gcatcctgca gaacgggggc cccatgttcg ccttccgccg 3300

cgtggaggag ctgcacagca acaccgagct gggcatcgtg gagtaccagc acgccttcaa 3360

gacccccatc gccttcgcca gatcccgcgc tcagtcgtcc aattctgccg tggacggcac 3420

cgccggaccc ggctccaccg gatctcgcgc aacaaacttc tctctgctga aacaagccgg 3480

agatgtcgaa gagaatcctg gaccgcctag gaccgagtac aagcccacgg tgcgcctcgc 3540

cacccgcgac gacgtcccca gggccgtacg caccctcgcc gccgcgttcg ccgactaccc 3600

cgccacgcgc cacaccgtcg atccggaccg ccacatcgag cgggtcaccg agctgcaaga 3660

actcttcctc acgcgcgtcg ggctcgacat cggcaaggtg tgggtcgcgg acgacggcgc 3720

cgcggtggcg gtctggacca cgccggagag cgtcgaagcg ggggcggtgt tcgccgagat 3780

cggcccgcgc atggccgagt tgagcggttc ccggctggcc gcgcagcaac agatggaagg 3840

cctcctggcg ccgcaccggc ccaaggagcc cgcgtggttc ctggccaccg tcggagtctc 3900

gcccgaccac cagggcaagg gtctgggcag cgccgtcgtg ctccccggag tggaggcggc 3960

cgagcgcgcc ggggtgcccg ccttcctgga gacctccgcg ccccgcaacc tccccttcta 4020

cgagcggctc ggcttcaccg tcaccgccga cgtcgaggtg cccgaaggac cgcgcacctg 4080

gtgcatgacc cgcaagcccg gtgcctgagt cggcgcgccc cttataccgg tacgtattag 4140

tcatcgccca tggggcagag cgcacatcgc ccacagtccc cgagaagttg gggggagggg 4200

tcggcaattg atccggtgcc tagagaaggt ggcgcggggt aaactgggaa agtgatgtcg 4260

tgtactggct ccgccttttt cccgagggtg ggggagaacc gtatataagt gcagtagtcg 4320

ccgtgaacgt tctttttcgc aacgggtttg ccgccagaac acagctctgg ctaactagag 4380

aacccactgc ttactggctt atcgaaatta atacgactca ctatagggag acccaagctg 4440

gtttaaactt aagcttggta ccgagctcgg atccgccacc agcgatatcg attacaagga 4500

tgacgacgat aagtgataaa cccgctgacc atcagtgtgg gtctttgtca ccatctgact 4560

gggtcgcggc cgcattgaat tcactgtcga cgtcaatcaa cctctggatt acaaaatttg 4620

tgaaagattg actggtattc ttaactatgt tgctcctttt acgctatgtg gatacgctgc 4680

tttaatgcct ttgtatcatg ctattgcttc ccgtatggct ttcattttct cctccttgta 4740

taaatcctgg ttgctgtctc tttatgagga gttgtggccc gttgtcaggc aacgtggcgt 4800

ggtgtgcact gtgtttgctg acgcaacccc cactggttgg ggcattgcca ccacctgtca 4860

gctcctttcc gggactttcg ctttccccct ccctattgcc acggcggaac tcatcgccgc 4920

ctgccttgcc cgctgctgga caggggctcg gctgttgggc actgacaatt ccgtggtgtt 4980

gtcggggaaa tcatcgtcct ttccttggct gctcgcctgt gttgccacct ggattctgcg 5040

cgggacgtcc ttctgctacg tcccttcggc cctcaatcca gcggaccttc cttcccgcgg 5100

cctgctgccg gctctgcggc ctcttccgcg tcttcgcctt cgccctcaga cgagtcggat 5160

ctccctttgg gccgcctccc cgcctggtac ctttaagacc aatgacttac aaggcagctg 5220

tagatcttag ccacttttta aaagaaaagg ggggactgga agggctaatt cactcccaac 5280

gaaaataaga tctgcttttt gcttgtactg ggtctctctg gttagaccag atctgagcct 5340

gggagctctc tggctaacta gggaacccac tgcttaagcc tcaataaagc ttgccttgag 5400

tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg taactagaga tccctcagac 5460

ccttttagtc agtgtggaaa atctctagca gtagtagttc atgtcatctt attattcagt 5520

atttataact tgcaaagaaa tgaatatcag agagtgagag gaacttgttt attgcagctt 5580

ataatggtta caaataaagc aatagcatca caaatttcac aaataaagca tttttttcac 5640

tgcattctag ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc tggctctagc 5700

tatcccgccc ctaactccgc ccagttccgc ccattctccg ccccatggct gactaatttt 5760

ttttatttat gcagaggccg aggccgcctc ggcctctgag ctattccaga agtagtgagg 5820

aggctttttt ggaggcctag acttttgcag agacggccca aattcgtaat catggtcata 5880

gctgtttcct gtgtgaaatt gttatccgct cacaattcca cacaacatac gagccggaag 5940

cataaagtgt aaagcctggg gtgcctaatg agtgagctaa ctcacattaa ttgcgttgcg 6000

ctcactgccc gctttccagt cgggaaacct gtcgtgccag ctgcattaat gaatcggcca 6060

acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc 6120

gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg 6180

gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa 6240

ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga 6300

cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag 6360

ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct 6420

taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg 6480

ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc 6540

ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt 6600

aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta 6660

tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac 6720

agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc 6780

ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat 6840

tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc 6900

tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt 6960

cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta 7020

aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct 7080

atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg 7140

cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga 7200

tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt 7260

atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt 7320

taatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt 7380

tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat 7440

gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc 7500

cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc 7560

cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat 7620

gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc cacatagcag 7680

aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt 7740

accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc 7800

ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa 7860

gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg 7920

aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa 7980

taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg tctaagaaac 8040

cattattatc atgacattaa cctataaaaa taggcgtatc acgaggccct ttcgtctcgc 8100

gcgtttcggt gatgacggtg aaaacctctg acacatgcag ctcccggaga cggtcacagc 8160

ttgtctgtaa gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag cgggtgttgg 8220

cgggtgtcgg ggctggctta actatgcggc atcagagcag attgtactga gagtgcacca 8280

tatgcggtgt gaaataccgc acagatgcgt aaggagaaaa taccgcatca ggcgccattc 8340

gccattcagg ctgcgcaact gttgggaagg gcgatcggtg cgggcctctt cgctattacg 8400

ccagctggcg aaagggggat gtgctgcaag gcgattaagt tgggtaacgc cagggttttc 8460

ccagtcacga cgttgtaaaa cgacggccag tgccaagctg 8500

<210> 150

<211> 26

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 150

gaatagaaga agaaggtgga gagaga 26

<210> 151

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 151

cgatgagttc cgccgtggca 20

<210> 152

<211> 57

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 152

gatatcgatt acaaggatga cgacgataag tgataaaccc gctgaccatc agtgtgg 57

<210> 153

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 153

caattgatcc ggtgcctaga g 21

<210> 154

<211> 732

<212> DNA

<213> Artificial Sequence

<220>

<223> The sequence is synthesized

<400> 154

ggatccgcca ccatggtgtc taagggcgaa gagctgatta aggagaacat gcacatgaag 60

ctgtacatgg agggcaccgt gaacaaccac cacttcaagt gcacatccga gggcgaaggc 120

aagccctacg agggcaccca gaccatgaga atcaaggtgg tcgagggcgg ccctctcccc 180

ttcgccttcg acatcctggc taccagcttc atgtacggca gcagaacctt catcaaccac 240

acccagggca tccccgactt ctttaagcag tccttccctg agggcttcac atgggagaga 300

gtcaccacat acgaagacgg gggcgtgctg accgctaccc aggacaccag cctccaggac 360

ggctgcctca tctacaacgt caagatcaga ggggtgaact tcccatccaa cggccctgtg 420

atgcagaaga aaacactcgg ctgggaggcc aacaccgaga tgctgtaccc cgctgacggc 480

ggcctggaag gcagaagcga catggccctg aagctcgtgg gcgggggcca cctgatctgc 540

aacttcaaga ccacatacag atccaagaaa cccgctaaga acctcaagat gcccggcgtc 600

tactatgtgg accacagact ggaaagaatc aaggaggccg acaaagagac ctacgtcgag 660

cagcacgagg tggctgtggc cagatactgc gacctcccta gcaaactggg gcacaaactt 720

aattgagata tc 732

Claims (10)

1. A lentiviral plasmid library, comprising a plurality of lentiviral plasmids comprising, in order from 5 'to 3': screening a marker gene expression cassette, a gene ORF expression cassette, a universal sequence and a DNA tag sequence, wherein the DNA tag sequences on each lentiviral plasmid are different;

wherein the gene ORF expression cassette contains a promoter and an ORF sequence of a gene.

2. The lentiviral plasmid library of claim 1, wherein the promoter of the gene ORF expression cassette is an EF-1 a promoter and/or a T7 promoter.

3. The lentiviral plasmid library of claim 1 or 2, wherein the selectable marker gene expression cassette comprises a CMV promoter, a GFP gene and a puromycin gene.

4. The lentiviral plasmid library of claim 3, wherein the selectable marker gene expression cassette further comprises a P2A signal cleavage peptide element, wherein the P2A signal cleavage peptide element is located between the GFP gene and the puromycin gene.

5. The lentiviral plasmid library of any one of claims 1-4, wherein the lentiviral plasmid library is a lentiviral plasmid library comprising an ORF sequence of a human chemokine receptor gene.

6. The lentiviral plasmid library of claim 5, wherein the ORF sequence of the gene is selected from the group consisting of: NM _, NM, XM, NM.

7. The lentiviral plasmid library of any one of claims 1-6, wherein the universal sequence is SEQ ID NO: 209.

8. the lentiviral plasmid library of any one of claims 1-7, wherein the DNA tag sequence is selected from the group consisting of SEQ ID NOS 58-200.

9. A lentiviral backbone plasmid comprising a selectable marker gene expression cassette, a promoter for an ORF expression cassette of a gene, an ORF sequence insertion region of a gene, a universal sequence and a DNA tag sequence insertion region;

preferably, the lentiviral backbone plasmid vector further comprises a restriction enzyme cutting site, a Kozak sequence and a Flag sequence;

preferably, the screening marker gene expression cassette contains a CMV promoter, a GFP gene, a P2A signal cleavage peptide element, a puromycin gene;

preferably, the promoter of the ORF expression cassette of the gene comprises the EF-1 alpha promoter and/or the T7 promoter;

preferably, the sequence of the lentiviral backbone plasmid is SEQ ID NO: 206.

10. use of a lentiviral plasmid library of any one of claims 1 to 8 in cell therapy.

Images