CN107012121A - Carry the structure of the stable cell lines of orthogonal tRNA/ aminoacyl tRNA synthetases - Google Patents
Carry the structure of the stable cell lines of orthogonal tRNA/ aminoacyl tRNA synthetases Download PDFInfo
- Publication number
- CN107012121A CN107012121A CN201610055542.8A CN201610055542A CN107012121A CN 107012121 A CN107012121 A CN 107012121A CN 201610055542 A CN201610055542 A CN 201610055542A CN 107012121 A CN107012121 A CN 107012121A
- Authority
- CN
- China
- Prior art keywords
- trna
- amino acid
- alpha
- seq
- natural amino
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0684—Cells of the urinary tract or kidneys
- C12N5/0686—Kidney cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/93—Ligases (6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y113/00—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13)
- C12Y113/12—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13) with incorporation of one atom of oxygen (internal monooxygenases or internal mixed function oxidases)(1.13.12)
- C12Y113/12007—Photinus-luciferin 4-monooxygenase (ATP-hydrolysing) (1.13.12.7), i.e. firefly-luciferase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y601/00—Ligases forming carbon-oxygen bonds (6.1)
- C12Y601/01—Ligases forming aminoacyl-tRNA and related compounds (6.1.1)
- C12Y601/01026—Pyrrolysine-tRNAPyl ligase (6.1.1.26)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
- C12N2840/203—Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Urology & Nephrology (AREA)
- Virology (AREA)
- Cell Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to the construction method for carrying orthogonal tRNA/ aminoacyl tRNA synthetases stable cell lines.Based on gene codon expansion technique, alpha-non-natural amino acid fixed point is introduced into protein using the tRNA/ aminoacyl tRNA synthetases of a pair of orthogonal, the invention further relates to the construction method of double slow virus carriers, carry the construction method of the orthogonal tRNA carriers of multicopy number and transfected by the stable transduction of double slow virus, plasmid stabilisation by the method for orthogonal tRNA/ aminoacyl tRNA synthetase gene stable integrations to cellular genome.The invention further relates to the application of stable cell lines, such as purposes of the expression containing alpha-non-natural amino acid destination protein.
Description
Technical field
The invention belongs to field of biological pharmacy, it is related to the orthogonal tRNA/ aminoacyl tRNAs synthesis of carrying
The construction method of enzyme stable cell lines.
Background technology
(1) gene codon expansion technique
Genetic code expansion technique is quickly grown in recent years, is using Amber stop codon
There is justice coding, by introducing corresponding orthogonal tRNA and aminoacyl tRNA synthetase, finally
Designed alpha-non-natural amino acid can be introduced into protein.According to alpha-non-natural amino acid
Property, can assign protein special function.Up to the present, this technology has been
Hundreds of alpha-non-natural amino acid is successfully pinpointed into expression in protein surface, the non-day being related to
Right amino acid include containing nitrine, alkynyl, ketone group, aldehyde radical, alkenyl, amide groups, nitro,
The diversity function group such as phosphate radical, sulfonate radical, can carry out a variety of bio-orthogonal reactions, such as：
Click chemistry, photaesthesia, glycosylation, photo-crosslinking etc. react.
(2) application of the gene codon expansion technique in pharmaceutical grade protein exploitation
The development of modern biotechnology so that the large-scale production of pharmaceutical grade protein becomes a reality,
This kind of medicinal application is also more and more in clinical quantity.Pharmaceutical grade protein refers to polypeptide and gene
Engineering medicine, monoclonal antibody and genetic engineering antibody, recombinant vaccine.With conventional small molecule
Medicine is compared, and pharmaceutical grade protein has high activity, high specificity, hypotoxicity, biological function bright
Really, the characteristics of being conducive to clinical practice.But, protein medicaments also have that its stability is poor, film
The shortcomings of permeability is poor, biological half-life is short, have impact on the treatment potentiality of pharmaceutical grade protein and faces
Bed application.It is to obtain more preferable pharmacokinetic property that native protein structure, which is transformed, or modified
A kind of effective way.Various modifications are more to start with from the character for changing recombinant protein, such as increase phase
To molecular mass, slow down proteasome degradation, reduction immunogenicity, raising biology and chemically stable
Property etc., and then improve in its internal pharmacokinetic property, extension Half-life in vivo or acceleration bodies
Release, reduction neutralizing antibody generation rate, raising patient adaptability and therapeutic effect etc..In view of changing
Numerous advantages of protein after structure or modification, recombinant mutant is carried out to protein and is dispatched workers to do on-site repairs in vivo
Decorations will also obtain increasingly being to be widely applied.The defect of first generation protein modification technology exists
In the uncontrollability to conjugation sites, so traditional method of modifying is non-fixed point non-quantitation,
It is not appropriate for quality control prepared by large-scale production.And alpha-non-natural amino acid modification technique site
Controllable advantage, has wide application prospects in protein modification art.Using antibody coupling medicine as
Example, compared with traditional decorating site uncontrollable ADC (antibody drug conjugates) medicine, position
Point specificity ADC medicines high specificity, composition be single, toxicity is low, be undoubtedly following target
Developing direction (the Tian Feng.et al.PNAS, 2014,111 of medicine:1766–1771.).
(3) bottleneck of gene codon expansion technique commercial Application
According to the type of host cell, protein expression system can be roughly divided into protokaryon, yeast,
Plant, insect and mammalian cell expression system.Compared with other systems, mammal is thin
The advantage of cellular expression system is to instruct the correct folding of protein, and there is provided complicated N-type
Glycosylation exists with accurately a variety of post translational processing functions such as O-shaped glycosylation, thus expression product
Closest to natural higher organism albumen in terms of molecular structure, physicochemical property and biological function
Matter molecule.Industrially, want to realize the high yield large-scale production of pharmaceutical grade protein, just
The height for building target gene is needed to express stable cell lines.And alpha-non-natural amino acid is applied to egg
In the exploitation of white matter medicine, a urgent problem to be solved is how that structure stable integration is orthogonal
The engineering cell of tRNA/ aminoacyl tRNA synthetases.Due to tRNA transcription and be machined with different from
Protein, therefore how to realize that orthogonal tRNA high efficiency stable expression remains an international hardly possible
Topic.The structure of the orthogonal tRNA/ aminoacyl tRNA synthetases engineering cell of stable integration is realized, will be had
Effect promotes application of the gene codon expansion technique in pharmaceutical grade protein exploitation.
Luciferase reporter gene is to detect that firefly is glimmering so that fluorescein (luciferin) is substrate
A kind of reporting system of light element enzyme (firefly luciferase) activity.Luciferase can be catalyzed
Luciferin is oxidized to oxyluciferin, during luciferin is aoxidized, can send biology
Fluorescence (bioluminescence).It may then pass through fluor tester also referred to as Chemiluminescence Apparatus
(luminometer) what is or in liquid flashing determining instrument measure luciferin oxidizing process discharged is biological glimmering
Light.Fluorescein and luciferase this bioluminescence system, can extremely sensitive, efficiently be examined
The gene order of the expression of cls gene, wherein luciferase such as SEQ ID NO:Shown in 1, its
Amino acid sequence NCBI accession number is AAP46189.
The content of the invention:
Inventor is by the thinking and research to prior art, by the tRNA of ancient methanosarcina
(tRNAPyl) (its sequence such as SEQ ID NO:Shown in 8) and pyrroles's lysyl-tRNA
Synzyme (PylRS) (its gene order such as SEQ ID NO:Shown in 9) protein
Translation system is incorporated into mammalian cell (such as HEK293T cells) genome.
Inventor is first with double slow virus systems by orthogonal pyrrolysyl-tRNA synthetase and band
The reporter gene GFP for having amber codon to be mutated is incorporated into host cell, afterwards, then profit
With the method for carrying the orthogonal tRNA plasmid linearizations stable transfection of multicopy number, by orthogonal tRNA
It is also integral with host cell, so as to obtain the orthogonal tRNA/ aminoacyl tRNA synthetases of carrying
Stable cell lines.The stable cell lines can make alpha-non-natural amino acid fixed point be inserted into purpose egg
White surface, so that the destination protein of rite-directed mutagenesis is obtained, such as mutant luciferase egg
In vain (luciferase).
Compared to other methods, advantages of the present invention may be embodied in it is following in it is one or several：
1. constructing a set of pair of slow virus system, the stable expression of double protein can be realized simultaneously；
2. construct a plasmid for carrying the orthogonal tRNA of high copy number, it is possible to achieve orthogonal
TRNA stable expression；
3. obtain the stable cell lines for carrying orthogonal tRNA/ aminoacyl tRNA synthetases；
4. utilizing the stable cell lines, non-natural can be introduced in any site of target protein
Amino acid, so that the albumen of special sex modification can only be carried out to the site by creating；
5. utilize distinctive active group on alpha-non-natural amino acid, it is possible to achieve efficiently, specifically
The modification purpose of property.
Specifically, in the specific embodiment of the present invention, in host cell HEK
Orthogonal tRNA/ aminoacyl tRNA synthetases gene is incorporated in 293T cells, mainly passes through six
Individual step：(1) viral vector 1 for carrying Orthogonal aminoacyl tRNA synthase genes is built
Number pSD31-pylRS-IRES-puro；(2) build to carry and there is amber on specific site
The viral vector of codon mutation Green fluorescent protein fusion vector 2
pSD31-GFP39TAG-IRES-hygro；(3) build and carry 12 copy number type-3
The carrier pXH-12tRNA-zeo for the orthogonal tRNA that Pol III promoters start；(4) pack
Virus 2, transduction HEK 293T in virus 1 and step (2) in step (1)
Cell, acquisition incorporates Orthogonal aminoacyl tRNA synthase genes and saltant type green fluorescence egg
The stable cell lines of white reporter gene；(5) by carrier pXH-12tRNA-zeo in step (3)
Stable cell lines after linearisation in transfection procedure (4), and it is mould using the rich Lay carried thereon
Plain resistant gene is screened；(6) alpha-non-natural amino acid, picking are added in the medium
Monoclonal with green fluorescence, and expand culture, finally give stable cell lines
HEK293-PYL。
The principle that the stable cell lines can insert alpha-non-natural amino acid on reporter gene exists
In：The saltant type tRNA of integrationPyl/ PylRS meets following relationship：(1)：Saltant type
TRNAPylThe lysyl tRNA synzyme of host cell can not be utilized, can only be mutated
The PylRS of type is acylated；(2)：The PylRS of saltant type can only be acylated tRNAPyl, no
Other tRNA, therefore, saltant type tRNA can be acylatedPylRelation between PylRS
It is orthogonality, i.e., the PylRS of saltant type can only be acylated saltant type tRNAPyl, dash forward simultaneously
The tRNA of modificationPylIt can only be acylated by the PylRS of saltant type, that is to say, that same plasmid
In saltant type tRNAPylIt is absolute mutual single-minded with PylRS.This orthogonality
Enzyme and be that only this enzyme can be non-natural amino acylating acid to this orthogonal
On tRNA, and this tRNA can only be acylated, and other tRNA can not be acylated.Obtain
The orthogonal lysyl tRNA synthase/tRNA systems obtained, make non-20 kinds of common amino acids
Lys-azido is (alternatively referred to as：NAEK it is) corresponding with amber codon, so that by non-day
Right amino acid fixed point is incorporated on reporter protein GFP or other destination proteins.Saltant type
PylRS is incorporated into stable cell lines gene using slow virus pSD31-pylRS-IRES-puro
In group, wherein, IRES is that internal ribosome enters sequence (internal ribosome entry
Site), it is usually used in polycistron gene expression (Pelletier J.et al., Nature, 1988,334：
320–325.).For example, inserting IRES sequences after target gene, selection mark is followed by
Remember gene, the so mRNA of transcription out can just express two kinds of albumen simultaneously.Utilize IRES
System, which is overexpressed target gene, 2 advantages：1. target gene shares one with marker gene and opened
Mover, it is to avoid the appearance of false positive；2.IRES translation efficiencies are less than conventional translation start bit
Point so that destination gene expression amount is higher than marker gene (Kozak M, et al., Nucleic Acids
Res,2005,33：6593–6602.)., can be simultaneously real using this pair of slow virus system
Stable overexpression of existing two albumen in host cell.
In the specific embodiment of the present invention, a set of pair of slow virus system is constructed
Unite pSD31-IRES-puro and pSD31-IRES-hygro, the two viral vectors source
In viral vector pSD31 (Zhang Jing.et al.RNA, 2007,13:1375–1383.),
The puro that sv40 promoters on pSD31 carriers are startedRGene is substituted for respectively
IRES-puroRAnd IRES-hygroRGene, has thus obtained the virus of 2 different resistances
Carrier pSD31-IRES-puro and pSD31-IRES-hygro.
In the specific embodiment of the present invention, fed the invention provides one kind
The orthogonal tRNA of stable integration method in newborn zooblast, principle is：By protokaryon
TRNA is started with suitable eukaryotic promoter and carries out expressing in series to increase integration probability.
The present invention have selected the 3rd class rna plymerase iii promoter (type-3Pol III), such
What promoter transcription sequence was relied on is the starting element of promoter itself, it is not necessary to any endogenous
Transcriptional elements (such as A- and B-box) are present in the coded sequence in downstream.It therefore, it can
Start the protokaryon tRNA for lacking internal starting element A- and B-box in eukaryotic.This hair
It is bright that the orthogonal tRNA that 12 copy number type-3Pol III promoters start is connected in series to shuttle
On carrier pXH, and eucaryon screening bleomycin resistance gene is introduced on pXH carriers, obtained
Carrier pXH-12tRNA-zeo has been arrived, by transfectional cell after the vector linearization, and it is mould with rich Lay
Element screening, separation identification monoclonal, you can obtain the stable orthogonal tRNA of expression cell.
More specifically, the invention provides：
1. Geminivirus carrier pSD31-IRES-puro and pSD31-IRES-hygro, it is combined
It is overexpressed while using achievable double protein, its principle make use of internal ribosome to enter sequence
(IRES), wherein, pSD31-IRES-puro carriers carry puromycin (puromycin) resist
Property gene, pSD31-IRES-hygro carriers carry containing hygromycin B (hygromycin) resist
Property gene, for carrying out eucaryon screening.PSD31-IRES-puro sequence such as SEQ I D NO:
Shown in 2.PSD31-IRES-hygro sequences such as SEQ ID NO:Shown in 3.
2. carry No. 1 pSD31- of viral vector of Orthogonal aminoacyl tRNA synthase genes
PylRS-IRES-puro, its sequence such as SEQ ID NO:Shown in 4.Carrier package virus
Transducer cell, is screened using puromycin afterwards, can be whole by Orthogonal aminoacyl tRNA synzyme
Close in host cell.
3. carry the Tyr39 Green fluorescent protein fusion vectors for sporting amber codon
No. 2 pSD31-GFP of viral vector39TAGTurn after-IRES-hygro, carrier package virus
Guided cell, is screened using hygromycin B, and reporter gene can be incorporated into host cell.
pSD31-GFP39TAG- IRES-hygro sequence such as SEQ ID NO:Shown in 5.
4. carry the orthogonal tRNA's that 12 copy number type-3Pol III promoters start
Transfectional cell after carrier pXH-12tRNA-zeo, the vector linearization, is screened using bleomycin,
Orthogonal tRNA can be incorporated into host cell.PXH-12tRNA-zeo sequence such as SEQ
ID NO:Shown in 6.
5. stable cell lines HEK293-PYL (is preserved in Chinese microorganism strain preservation management
Committee's common micro-organisms center, preservation date are that November 17, preserving number in 2015 are
CGMCC No：11592 cell line；Its Classification And Nomenclature behaviour HEK293T cells),
The cell line is obtained by two-wheeled viral transduction and 1 wheel plasmid stabilisation transfection, is carried orthogonal
TRNA/ aminoacyl tRNA synthetase genes, can be in destination protein using the stable cell lines
Any site of matter introduces alpha-non-natural amino acid, so that create only can carry out spy to the site
The material protein of opposite sex modification.
6. the albumen of rite-directed mutagenesis, such as firefly luciferase reporter gene luciferase,
Amino acid on its F14 position is sported alpha-non-natural amino acid, the non-natural amino
Acid is the alpha-non-natural amino acid Lys-azido (NAEK) containing azido group, and rear explanation is equal
By taking this alpha-non-natural amino acid as an example.
The system is also applied for the alpha-non-natural amino acid DiZPK containing photo-crosslinking group
Exemplarily, the mutational site can be SEQ I D NO：The luciferase of 1 coding
Any site on one or more amino acid.Preferably, the mutational site is selected from：
By SEQ I D NO：F14 of luciferase of 1 coding or other to activity influence compared with
Small site.
7. the destination protein of rite-directed mutagenesis, the sequence of the amino acid of albumen before itself and mutation
Difference is：The amino acid of N is sported NAEK, the mutating acid with
Connected mode in albumen is shown below：
By R1To R2Direction for amino acid sequence N-terminal to C-terminal direction, R1For
The 1st of albumen to N-1 amino acids residues,
R2For the N+1 amino acid residues to C-terminal of albumen, R4For
8. the destination protein of any one of the project of coding 6-7 mutation is (for example
Luciferase nucleic acid molecules).Exemplarily, the nucleic acid molecules and SEQ ID NO:1
Difference be, coding F14 or other on the less position of Activity and stabill influence
The codon of one amino acid of point is changed into amber codon by figure.
9. prepare the side of the destination protein (such as luciferase) containing alpha-non-natural amino acid
Method, including step：
(1) stable cell lines for carrying orthogonal tRNA/ aminoacyl tRNA synthetases gene are obtained
HEK293-PYL (is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms
Center, preservation date are that on November 17th, 2015, preserving number are CGMCC No：11592
Cell line；Its Classification And Nomenclature behaviour HEK293T cells).
(2) step is selected：Selection expects the one of mutation in the amino acid sequence of destination protein
Individual or multiple specific amino acids sites；
(3) gene mutation：The destination protein for corresponding to the site of selection in (2) will be encoded
The codon of amino acid sport amber codon with gene engineering method；
(4) expression vector establishment：The purpose for the mutation that (3) gene mutation step is obtained
The coded sequence of albumen is operably connected with suitable carrier, obtains mutant nucleotide sequence expression
Carrier；
(5) express：The mutant nucleotide sequence expression vector that step (4) is obtained is transfected into step
(1) the stable cell lines HEK293-PYL in, the host cell after transfecting successfully is existed
Cultivated in culture medium containing NAEK, cell is collected in reasonable time；
(6) cell lysis, destination protein of the detection containing alpha-non-natural amino acid is (for example
Luciferase) expressing quantity.
Stable cell lines HEK293-PYL of the present invention, it carries orthogonal tRNA/ ammonia
Acyl tRNA synthase genes.Exemplarily, stable cell lines of the invention are that preserving number is
CGMCC No：11592 cell line.
Brief description of the drawings：
Fig. 1：The structure of double slow virus carriers
A：Slow virus carrier pSD31 structural representations；
B：Double slow virus carrier pSD31-IRES-puro and pSD31-IRES-hygro knots
Structure schematic diagram.On the basis of pSD31, by BamHI and xbal double digestions, by sv40
Promoter and puromycin resistant genes be substituted for respectively IRES-puro and
IRES-hygro, so as to obtain being respectively provided with puromycin-resistant and Hygromycin B resistant
Geminivirus carrier；
C：Geminivirus carrier pSD31-pylRS-IRES-puro and pSD31-GFP39TAG-
IRES-hygro.PSD31-IRES-puro carriers are introduced by BamHI single endonuclease digestions
CMV promoter and Orthogonal aminoacyl tRNA synthase genes, pSD31-IRES-hygro are carried
Body introduces CMV promoter and saltant type green fluorescent protein by BamHI single endonuclease digestions
GFP genes.
Fig. 2：The structure of pXH-12tRNA-zeo carriers
A：PXH empty vectors schematic diagrames；
B：PXH-12tRNA-zeo carrier schematic diagrames.
Fig. 3：Screen the flow of stable cell lines
Carry the stable cell lines of orthogonal tRNA/ aminoacyl tRNA synthetases gene
HEK293-PYL is obtained by 3 wheel screenings, and the 1st wheel screening is first packed
PSD31-pylRS-IRES-puro is viral, HEK293T cells of transduceing, and is with concentration
0.6ug/ml puromycin is screened, and obtains expressing Orthogonal aminoacyl tRNA synzyme
After stable cell lines 1, pSD31-GFP is packed in the 2nd wheel screening again39TAG-IRES-hygro
Virus, the hygromycin for being 200ug/ml with concentration is screened, and is expressed simultaneously just
Hand over the stable cell lines of aminoacyl tRNA synthetase and reporter gene saltant type green fluorescent protein
No. 2.3rd wheel screening is transfected after plasmid pXH-12tRNA-zeo carrier linearization for enzyme restriction
Stable cell lines 2, are screened with 400ug/ml zeomycin, and in incubation
Middle addition alpha-non-natural amino acid NAEK, isolates and purifies GFP positive colonies, continues to use dosage
The zeomycin halved expands culture, finally gives stable cell lines HEK293-PYL.
Fig. 4：The identification of stable cell lines
A：The alpha-non-natural amino acid Lys-azido (NAEK) added in stable cell lines culture
Structural representation；
B：Green fluorescent protein imaging after stable cell lines plus/minus alpha-non-natural amino acid, only
Have after addition alpha-non-natural amino acid, can just make the GFP being mutated with Amber stop codon
Gene is readed over；
C：Orthogonal ammonia after Western Blot detection stable cell lines plus/minus alpha-non-natural amino acids
The expression of acyl tRNA synzyme and green fluorescent protein, is only added after alpha-non-natural amino acid,
The green fluorescent protein of total length can be just detected, is consistent with Fig. 4 B results；
D：Firefly luciferase reporter gene luciferase detection stable cell lines can be with
Alpha-non-natural amino acid is introduced in any site of target protein, luciferase readings is shown,
Add after alpha-non-natural amino acid, the active saltant type firefly fluorescence of total length can be obtained
Plain zymoprotein.
For a better understanding of the present invention, inventor is explained specific experiment with embodiment
State and illustrate, wherein the embodiment is merely to illustrate, do not limit the protection of the present invention
Scope.It is any to be included in the present invention with variant of equal value of the invention or embodiment.
Embodiment 1：The structure of double slow virus carriers and acquisition
(1) acquisition of carrier framework
Double slow virus carrier skeletons are slow virus carrier pSD31 (Zhang Jing.et al.
RNA,2007,13:1375-1383.), wherein, sv40 promoters start puromycin-resistant
Gene protein puroRExpression.
(2) SOE PCR design of primers
Inventor utilizes SOE PCR, and internal ribosome is entered into sequence (IRES) and purine is mould
The DNA of plain (puromycin) resistant gene/hygromycin B (hygromycin) resistant gene
Fragment is spliced, and is respectively obtained IRES-puro and IRES-hygro fragments, is specifically drawn
Thing is as shown in the table.
Table 1：SOE PCR primer lists
| Mutational site | Sequence (5 ' -3 ' direction) |
| IRES-hygro-for(BamHI) | CGGGATCCAATTCCGCCCCTCTC |
| IRES-hygro-middle-for: | CCCACAAGGAGACGACCTTCCATGAAAAAGCCTGAACTCACC |
| IRES-hygro-middle-rev: | GGTGAGTTCAGGCTTTTTCATGGAAGGTCGTCTCCTTGTGGG |
| IRES-hygro-rev(xbal): | GCTCTAGATCATTCCTTTGCCCTCGGAC |
(3) transformation of slow virus carrier
On the basis of pSD31, by BamHI and xbal double digestions, sv40 is started
Son and puromycin resistance gene fragments are substituted for IRES-puro and IRES-hygro respectively
Fragment, so as to obtain being respectively provided with double diseases of puromycin-resistant and Hygromycin B resistant
Poisonous carrier.
Embodiment 2：The structure of pXH-12tRNA-zeo carriers and acquisition
In order to ensure tRNA expression quantity, it is necessary to the promoter that multi-copy in tandem is expressed
- tRNA is cloned on a suitable carrier.The present invention using pXH empty vectors as skeleton,
Zeomycin-polyA sequences are incorporated into after SV40 promoters by EcoRI restriction enzyme sites
Face, makes it carry bleomycin resistance.Afterwards, SalI restriction enzyme sites are recycled to copy 12
Promoter-tRNA the sequences of shellfish are cloned on pXH-zeo carriers, in order to avoid repetitive sequence is sent out
The probability of raw restructuring, has used 4 kinds of different tRNA promoters：7sk/hu6/H1/mu6.
It finally obtained screening tRNA carrier bjmu-12t-zeo.
(1) acquisition of carrier framework
PXH-12tRNA-zeo carrier frameworks are carrier pXH, and the carrier is by PUC19
The shuttle vector that vector modification is obtained, with can be replicated in eukaryotic, molecular weight is small,
The advantages of carrying multiple cloning sites.PXH sequences such as SEQ ID NO:Shown in 7.
(2) SOE PCR design of primers
Inventor utilizes SOE PCR, by promoter (type-3Pol III) sequence and orthogonal
TRNA DNA fragmentation is spliced, and the promoter of selection is that people source 7sk starts respectively
Son, people source u6 promoters, people source H1 promoters, mouse source u6 promoters, respectively
To 7sk-tRNA, hu6-tRNA, H1-tRNA and mu6-tRNA fragment, promoter
Sequence, tRNA sequences, specific primer are as shown in the table
Table 2-1. promoters and tRNA sequences
Table 2-2.SOE-PCR gene magnification primer lists
(3) transformation of pXH carriers
On the basis of pXH carriers, by EcoRI restriction enzyme sites by zeomycin-polyA sequences
Row are incorporated into behind sv40 promoters, it is carried bleomycin resistance, are obtained pXH-zeo
Carrier.Afterwards, by carrier SalI single endonuclease digestions, promoter and tRNA fragments are used respectively
SalI/xhol isocaudarner double digestions, the promoter-tRNA sequences of 12 copies are cloned into
On pXH-zeo carriers, pXH-12tRNA-zeo carriers are obtained.
Embodiment 3：The screening of stable cell lines
(1) packaging of slow virus and transduction, comprise the following steps：
A.HEK 293T plating cells：Using culture medium A, composition (DMEM+10%FBS,
1 × NEAA, without sodium pyruvate), cell dissociation is counted, and six orifice plates are thin per hole
Born of the same parents' inoculation number is 4 × 105Cell/per hole.
B. slow virus is packed：Transfected in cell density for 70%~80%, plasmid and transfection
Reagent matches somebody with somebody such as table 3-1.6 hours after transfection, culture medium B (DMEM+3%FBS, 1 are changed into
×NEAA,With Sodium Pyruvate).Continue to cultivate.48 hours, 72 after transfection
Hour collects virus liquid, and is filtered with aperture for 0.45 μm of pvdf membrane syringe needle filter.
The plasmid proportioning of table 3-1. slow virus packaging
| Plasmid/transfection reagent | Per hole consumption |
| Opti-MEM | 200μl |
| Transfer vector | 0.72μg |
| pRSV | 0.64μg |
| VSVG | 0.32μg |
| PRRE | O.32μgl |
| Megatran 1.0 | 6ul |
C. viral transduction：Treat that the cell count of virus infection carries the previous day six orifice plates of paving, per hole
2ml virus liquids are added, Polybrene is added and make it that the concentration of Polybrene in virus liquid is
8μg/ml。
D. virus titer is determined：Using coubling dilution, infection HT1080 cell formation clones.
E. antibiotic-screening：Antibiotic-screening is can be carried out after viral transduction 24h, is screened dense
Degree will determine that wherein 293T cells puromycin is screened according to the killing curve of specific cell
Concentration is 0.6ug/ml, and hygromycin B screening concentration is 200ug/ml.Antibiotic-screening 10 days,
Until the blank group for being not added with virus liquid is all dead, the experimental group formation Dan Ke of virus liquid is added
It is grand, monoclonal expansion culture is obtained into stable cell lines.
(2) stable transfection of pXH-12tRNA-zeo carriers, comprises the following steps：
A. obtained stabilization will be screened after pXH-12t-zeo carrier linearization for enzyme restriction, in transfection (1)
Cell line.
B. liquid is changed after transfecting 6 hours, alpha-non-natural amino acid NAEK is added.
C. after transfecting 48 hours, green fluorescence is observed, liquid is changed, adds 400ug/ml's
zeomycin。
D. liquid is changed within every 3 days, until blank groups are all dead, transfection group formation is cloned.
E. GFP positive colonies are isolated and purified, the bleomycin that continuation dosage halves expands training
Support, obtain stable cell lines HEK293-PYL.
Stable cell lines HEK293-PYL, can manage from Chinese Microbiological Culture Collection and entrust
Member's meeting common micro-organisms center, preservation date is that November 17, preserving number in 2015 are
CGMCC No：11592 cell line is obtained.
Embodiment 4：The identification of stable cell lines
Contain in the stable cell lines HEK293-PYL built in the present invention and be derived from ancient methane
TRNA (the tRNA of coccusPyl) and pyrrolysyl-tRNA synthetase (pylRS),
, can with Amber stop codon (TAG) to there is justice coding in expression cell
Alpha-non-natural amino acid NAEK is set to be incorporated into albumen.Below, inventor is to NAEK's
Incorporation possibility and the production performance of mutein are detected.
1：Alpha-non-natural amino acid NAEK synthesis and identification
Alpha-non-natural amino acid Lys-azido chemosynthesis reaction formula is as follows
As described in above formula, by raw material 1 (ethylene bromohyrin) 2.3mL be dissolved in 90mL acetone with
And the mixed solution of 15mL water, NaN33.12g is added, 60 DEG C of oil bath heating backflows are anti-
Answer 20h.Room temperature is cooled to, revolving removes acetone, and absolute ether extracts (30mL × 8),
Anhydrous Na2SO4Dry, revolving removes solvent and obtains 2.62g colorless liquid products 2.
Product 2 (500mg, 5.74mmol) is added to triphosgene (1.70g, 5.74mmol)
THF (10ml) solution in.0 DEG C of stirring reaction 8h, solvent is evaporated.Residue is in vacuum
Lower dry 1h, obtains colorless oil as product 3.
By 3 be dissolved in 1.5ml THF and be slowly added to Boc-Lys-OH (1.7g,
In 1M NaOH (20ml) 6.88mmol)/THF (5ml) solution.0 DEG C of stirring is anti-
Answer 12h and be gradually warming up to room temperature.Again reaction solution is cooled to 0 DEG C and 1M with 0 DEG C
Hydrochloric acid solution reacting liquid pH value is adjusted to 2~3.Reaction solution is extracted with EtOAc
(30mL × 5), 2 × 100ml of organic layer saturated common salt water washing.Anhydrous Na2SO4
Dry organic layer, filtering, revolving remove solvent and obtain 1.65g colourless viscous liquids product 4
Without being further purified.
4 are dissolved in 15mL CH2Cl2,15mL TFA, room are slowly added dropwise under stirring
Solvent is steamed after the lower reaction 30min of temperature, remaining liq product 5mL methanol dissolves, plus
Enter 100mL ether, separate out a large amount of white solid precipitations, it is white that filtration drying obtains 1.38g
Color solid end product 5.1H NMR(D2O):δ=1.22-1.45 (m, 4H), 1.67-1.73
(m,2H),2.99(m,2H),3.38(m,2H),3.70(m,1H),4.09(m,2H).
13C NMR(D2O):δ=21.4,28.4,29.6,39.5,53.4,56.2,57.8,116.0
(TFA),153.1,162.3(TFA),172.9.HRMS:m/z calcd for C9H17N5O4
[M]+:259.1281；found:259.1283, it was demonstrated that obtained Lys-azido structures are correct.
2：It is mutated the NAEK incorporation expression of luciferase
By taking the saltant type (luciferase-Phe-14TAG) of firefly luciferase as an example：Will
The nucleic acid carrier for carrying saltant type firefly luciferase transfects the stable cell of embodiment 3
It is HEK293-PYL, while adding NAEK to final concentration 1mM, 37 DEG C, 5%CO2
Cell lysis after expressing 48 hours；
Luciferase substrate is added to cell pyrolysis liquid, fluorescence readings is detected.As a result as schemed
Shown in 4D.Add after alpha-non-natural amino acid, the active saltant type firefly of total length can be obtained
Fireworm luciferase protein.
Although with above embodiments describing the present invention, it should be appreciated that do not carrying on the back
On the premise of spirit from the present invention, the present invention further can be modified and changed,
And these modifications and variation are belonged within protection scope of the present invention.For example, the application
Although the application to stable cell lines by taking luciferase as an example is illustrated, very aobvious
So, the present invention should not be only limited to luciferase, and people in the art can be by the present invention
Alpha-non-natural amino acid is inserted suitable for any destination protein.
Claims (15)
1. a kind of any site being used in protein or peptide introduces the cell of alpha-non-natural amino acid
System, it is characterised in that the cell line carry pyrrolysyl-tRNA synthetase gene and
TRNA (tRNA from ancient methanosarcinaPyl)。
2. cell line as claimed in claim 1, it is characterised in that described tRNAPylIt is many
Promoter-the tRNA of individual copy numberPyl。
3. cell line as claimed in claim 2, it is characterised in that described tRNAPylIt is 12
The tRNA that the type-3Pol III promoters of individual copy number startPyl。
4. the cell line as any one of claim 1-3, it is characterised in that described pyrroles
Lysyl-tRNA synthase genes such as SEQ ID NO：Shown in 9.
5. the cell line as any one of claim 1-3, it is characterised in that described
tRNAPylCome from sequence such as SEQ ID NO:Carrier pXH-12tRNA-zeo shown in 6.
6. the cell line as any one of claim 1-5, it is by following steps
Obtain：
(1) in such as SEQ ID NO:Pyrroles is connected on pSD31-IRES-puro shown in 2 to rely
Aminoacyl-tRNA synthetase gene, obtains such as SEQ ID NO:The virus load of carrying shown in 4
Body pSD31-pylRS-IRES-puro；
(2) in such as SEQ ID NO:Connection is with prominent on pSD31-IRES-hygro shown in 3
The green fluorescence protein gene of change, obtains such as SEQ ID NO:Viral vector shown in 5
pSD31-GFP39TAG-IRES-hygro；
(3) the viral vector pSD31-pylRS-IRES-puro described in packaging (1) and (2)
And pSD31-GFP39TAG- IRES-hygro, HEK 293T cells of transduceing, respectively with fast
Purine mycin and hygromycin B screening, acquisition incorporate pyrrolysyl-tRNA synthetase gene
With the stable cell lines of saltant type Green fluorescent protein fusion vector；
(4) by sequence such as SEQ ID NO:Carrier pXH-12tRNA-zeo shown in 6 is linear
The stable cell lines obtained in (3) are transfected after change, and are resisted using the bleomycin carried thereon
Property gene is screened；
(5) alpha-non-natural amino acid is added in the medium, and picking carries the Dan Ke of green fluorescence
It is grand, and expand culture, finally give stable cell lines.
7. the described stable cell lines that method according to claim 6 is obtained, it is
HEK293-PYL, preserving number is CGMCC No：11592.
8. the sequence such as SEQ ID NO described in claim 6:Viral vector shown in 2,
Sequence such as SEQ ID NO described in claim 6:Viral vector shown in 3, or
Sequence such as SEQ ID NO described in claim 6:Carrier shown in 6.
9. prepared using the cell line any one of claim 1-7 and contain non-natural amino
The albumen of acid or the method for peptide, including step：
(1) one or more ammonia of mutation are expected in selection in the amino acid sequence of destination protein
Base acid site；
(2) will be selected in (1) in the nucleic acid molecules of the destination protein described in coding (1)
The codon mutation of the amino acid in the site selected is amber codon UAG；
(3) nucleic acid of the mutation obtained in (2) is operably connected with suitable carrier,
The expression vector for the nucleic acid being mutated；
(4) in the expression vector transfection claim 1-6 of the nucleic acid for the mutation for obtaining (3)
Cell line described in any one, by the host cell after transfecting successfully containing NAEK's
Cultivated in culture medium, cell is collected in reasonable time；
(5) activity of the destination protein containing alpha-non-natural amino acid is detected.
10. the amino acid quilt at least one site that method according to claim 9 is obtained
Sport the albumen or peptide of alpha-non-natural amino acid, it is characterised in that the alpha-non-natural amino acid
For the alpha-non-natural amino acid Lys-azido (NAEK) containing azido group
Or the alpha-non-natural amino acid Lys-diazirine (DiZPK) containing photo-crosslinking group
11. the albumen or peptide of rite-directed mutagenesis as claimed in claim 10, it is luciferase,
Mutational site is any one or more site upper amino acids of luciferase.
12. the albumen or peptide of rite-directed mutagenesis as claimed in claim 11, the mutational site choosing
From：By SEQ ID NO:F14 of the luciferase of sequential coding shown in 1.
13. the albumen or peptide of the rite-directed mutagenesis as any one of claim 9-12, it
The amino acid of N is sported NAEK, and N amino acids are in albumen or peptide
Connected mode is shown below：
By R1To R2Direction for amino acid sequence N-terminal to C-terminal direction, R1
For the 1st to N-1 amino acids residues,
R2For the amino acid residue of N+1 to C-terminal, R4For
14. encode any one of claim 9-12 mutain or the nucleic acid molecules of peptide.
15. the nucleic acid molecules of mutain as claimed in claim 14 or peptide, it is characterised in that
The codon for encoding alpha-non-natural amino acid is amber codon UAG.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110012018.3A CN112725282A (en) | 2016-01-27 | 2016-01-27 | Construction of Stable cell lines carrying orthogonal tRNA/aminoacyltRNA synthetases |
| CN201610055542.8A CN107012121B (en) | 2016-01-27 | 2016-01-27 | Construction of Stable cell lines carrying orthogonal tRNA/aminoacyltRNA synthetases |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610055542.8A CN107012121B (en) | 2016-01-27 | 2016-01-27 | Construction of Stable cell lines carrying orthogonal tRNA/aminoacyltRNA synthetases |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110012018.3A Division CN112725282A (en) | 2016-01-27 | 2016-01-27 | Construction of Stable cell lines carrying orthogonal tRNA/aminoacyltRNA synthetases |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107012121A true CN107012121A (en) | 2017-08-04 |
| CN107012121B CN107012121B (en) | 2021-01-26 |
Family
ID=59438847
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610055542.8A Active CN107012121B (en) | 2016-01-27 | 2016-01-27 | Construction of Stable cell lines carrying orthogonal tRNA/aminoacyltRNA synthetases |
| CN202110012018.3A Pending CN112725282A (en) | 2016-01-27 | 2016-01-27 | Construction of Stable cell lines carrying orthogonal tRNA/aminoacyltRNA synthetases |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110012018.3A Pending CN112725282A (en) | 2016-01-27 | 2016-01-27 | Construction of Stable cell lines carrying orthogonal tRNA/aminoacyltRNA synthetases |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN107012121B (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110172467A (en) * | 2019-05-24 | 2019-08-27 | 浙江大学 | It is a kind of to construct orthogonal aminoacyl-tRNA synthetase/tRNA system using chimeric design method |
| CN110835633A (en) * | 2018-08-13 | 2020-02-25 | 北京大学 | Preparation of PTC stable cell line by using optimized gene codon expansion system and application |
| CN110846311A (en) * | 2018-08-20 | 2020-02-28 | 北京大学 | Preparation of PTC stable cell line by using inhibitory tRNA system and application thereof |
| CN111849929A (en) * | 2019-04-30 | 2020-10-30 | 苏州鲲鹏生物技术有限公司 | aminoacyl-tRNA synthetase for efficiently introducing lysine derivative |
| CN111850020A (en) * | 2019-04-25 | 2020-10-30 | 苏州鲲鹏生物技术有限公司 | Introduction of unnatural amino acids in proteins using plasmid systems |
| CN114026232A (en) * | 2019-06-21 | 2022-02-08 | 波士顿学院董事会 | Enhanced platform for unnatural amino acid incorporation in mammalian cells |
| CN114250243A (en) * | 2020-09-24 | 2022-03-29 | 深圳华大生命科学研究院 | System and method for detecting aminoacyl-tRNA synthetase and tRNA activity in extreme halophilic organisms |
| CN114908066A (en) * | 2022-05-17 | 2022-08-16 | 浙江大学 | Orthogonal translation system and application thereof in restoring functional protein expression in PTC (Positive temperature coefficient) diseases by using redistributed codons |
| CN115261344A (en) * | 2022-08-29 | 2022-11-01 | 北京大学 | Ionic liquid based on unnatural amino acid, preparation method and application thereof |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111304234A (en) * | 2020-02-27 | 2020-06-19 | 江南大学 | Unnatural amino acid utilization tool suitable for bacillus subtilis |
| CN113481239A (en) * | 2021-07-01 | 2021-10-08 | 四川大学华西医院 | Method for introducing unnatural amino acid coding system into cell line through Rosa26 locus and cell line |
| CN114540308A (en) * | 2021-10-26 | 2022-05-27 | 中国农业科学院兰州兽医研究所 | Cell line for stably expressing orthogonal aminoacyl tRNA synthetase/tRNA and construction method |
| CN114107394B (en) * | 2021-11-05 | 2024-01-30 | 中国科学院精密测量科学与技术创新研究院 | Lentiviral transfer vector, pyleS expression and tRNA CUA Cell line of (C) and preparation method and application thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060166319A1 (en) * | 2004-08-13 | 2006-07-27 | Chan Michael K | Charging tRNA with pyrrolysine |
| CN102838671A (en) * | 2011-06-23 | 2012-12-26 | 北京大学 | Growth hormone with site-specific mutagenesis and site-specific decoration, preparation method and applications of growth hormone |
| CN102838663A (en) * | 2011-06-23 | 2012-12-26 | 北京大学 | Viromembrane protein with site-specific mutagenesis and site-specific decoration, preparation method and applications of viromembrane protein |
| CN104099360A (en) * | 2013-04-12 | 2014-10-15 | 北京大学 | Preparation for protein or peptide labeled by unnatural amino acid |
| CN105026574A (en) * | 2012-09-24 | 2015-11-04 | 米迪缪尼有限公司 | Cell lines |
| CN106929482A (en) * | 2015-12-31 | 2017-07-07 | 北京大学 | Influenza virus, its live vaccine of rite-directed mutagenesis and its preparation method and application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008073184A2 (en) * | 2006-10-18 | 2008-06-19 | The Scripps Research Institute | Genetic incorporation of unnatural amino acids into proteins in mammalian cells |
-
2016
- 2016-01-27 CN CN201610055542.8A patent/CN107012121B/en active Active
- 2016-01-27 CN CN202110012018.3A patent/CN112725282A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060166319A1 (en) * | 2004-08-13 | 2006-07-27 | Chan Michael K | Charging tRNA with pyrrolysine |
| CN102838671A (en) * | 2011-06-23 | 2012-12-26 | 北京大学 | Growth hormone with site-specific mutagenesis and site-specific decoration, preparation method and applications of growth hormone |
| CN102838663A (en) * | 2011-06-23 | 2012-12-26 | 北京大学 | Viromembrane protein with site-specific mutagenesis and site-specific decoration, preparation method and applications of viromembrane protein |
| CN105026574A (en) * | 2012-09-24 | 2015-11-04 | 米迪缪尼有限公司 | Cell lines |
| CN104099360A (en) * | 2013-04-12 | 2014-10-15 | 北京大学 | Preparation for protein or peptide labeled by unnatural amino acid |
| CN106929482A (en) * | 2015-12-31 | 2017-07-07 | 北京大学 | Influenza virus, its live vaccine of rite-directed mutagenesis and its preparation method and application |
Non-Patent Citations (1)
| Title |
|---|
| BLIGHT SK ET AL: "Pyrrolysine-tRNA ligase，ID: Q6WRH6", 《UNIPROTKB》 * |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110835633B (en) * | 2018-08-13 | 2021-10-01 | 北京大学 | Preparation of PTC stable cell line by using optimized gene codon expansion system and application |
| CN110835633A (en) * | 2018-08-13 | 2020-02-25 | 北京大学 | Preparation of PTC stable cell line by using optimized gene codon expansion system and application |
| CN110846311A (en) * | 2018-08-20 | 2020-02-28 | 北京大学 | Preparation of PTC stable cell line by using inhibitory tRNA system and application thereof |
| CN111850020A (en) * | 2019-04-25 | 2020-10-30 | 苏州鲲鹏生物技术有限公司 | Introduction of unnatural amino acids in proteins using plasmid systems |
| CN111850020B (en) * | 2019-04-25 | 2021-05-07 | 苏州鲲鹏生物技术有限公司 | Introduction of unnatural amino acids in proteins using plasmid systems |
| CN111849929B (en) * | 2019-04-30 | 2021-05-11 | 苏州鲲鹏生物技术有限公司 | aminoacyl-tRNA synthetase for efficiently introducing lysine derivative |
| CN111849929A (en) * | 2019-04-30 | 2020-10-30 | 苏州鲲鹏生物技术有限公司 | aminoacyl-tRNA synthetase for efficiently introducing lysine derivative |
| CN110172467A (en) * | 2019-05-24 | 2019-08-27 | 浙江大学 | It is a kind of to construct orthogonal aminoacyl-tRNA synthetase/tRNA system using chimeric design method |
| WO2020238433A1 (en) * | 2019-05-24 | 2020-12-03 | 浙江大学 | Construction of orthogonal aminoacyl-trna synthetase/trna system by using chimeric design method |
| CN114026232A (en) * | 2019-06-21 | 2022-02-08 | 波士顿学院董事会 | Enhanced platform for unnatural amino acid incorporation in mammalian cells |
| CN114250243A (en) * | 2020-09-24 | 2022-03-29 | 深圳华大生命科学研究院 | System and method for detecting aminoacyl-tRNA synthetase and tRNA activity in extreme halophilic organisms |
| CN114250243B (en) * | 2020-09-24 | 2024-05-03 | 深圳华大生命科学研究院 | System and method for detecting aminoacyl-tRNA synthetase and tRNA activity in extreme halophilic organisms |
| CN114908066A (en) * | 2022-05-17 | 2022-08-16 | 浙江大学 | Orthogonal translation system and application thereof in restoring functional protein expression in PTC (Positive temperature coefficient) diseases by using redistributed codons |
| CN114908066B (en) * | 2022-05-17 | 2024-01-23 | 杭州嵌化合生医药科技有限公司 | Orthogonal translation system and application thereof in redistribution codon recovery of functional protein expression in PTC disease |
| CN115261344A (en) * | 2022-08-29 | 2022-11-01 | 北京大学 | Ionic liquid based on unnatural amino acid, preparation method and application thereof |
| CN115261344B (en) * | 2022-08-29 | 2023-07-21 | 北京大学 | Ionic liquid based on unnatural amino acid, preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112725282A (en) | 2021-04-30 |
| CN107012121B (en) | 2021-01-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107012121A (en) | Carry the structure of the stable cell lines of orthogonal tRNA/ aminoacyl tRNA synthetases | |
| CN107022568B (en) | System for efficient multipoint insertion of unnatural amino acids in mammalian cells | |
| CN108148835A (en) | The sgRNA of CRISPR-Cas9 targeting knock out SLC30A1 genes and its specificity | |
| CN113286880A (en) | Methods and compositions for regulating a genome | |
| CN107502608A (en) | Construction method and application for sgRNA, ALDH2 gene delection cell line for knocking out people's ALDH2 genes | |
| CN107177593B (en) | Read-through of truncated proteins in early stop codon diseases using optimized gene codon expansion systems | |
| CN106479985A (en) | Application of the virus-mediated Cpf1 albumen in CRISPR/Cpf1 gene editing system | |
| CN106929482A (en) | Influenza virus, its live vaccine of rite-directed mutagenesis and its preparation method and application | |
| CN104480130B (en) | A kind of pTerm SC plasmids and its construction method and application | |
| CN107201352A (en) | A kind of beta galactosidase combination mutant with high transglycosylation and its preparation method and application | |
| CN107177592A (en) | Inhibition tRNA reads over the truncated protein in Premature stop codon disease | |
| WO2008019183A2 (en) | Biopolymer and protein production using type iii secretion systems of gram negative bacteria | |
| CN115057903A (en) | Initial capped oligonucleotide primer containing morpholine ring structure and preparation method and application thereof | |
| CN109402171A (en) | A kind of Bursaphelenchus xylophilus RNAi controlling gene and its application | |
| CN104480125B (en) | Trachinotus ovatus thioredoxin gene | |
| CN105695494A (en) | Three-cistron expression vector, preparation method and application | |
| CN104789597B (en) | A kind of vitro construction method of silkworm cytoplasmic polyhedrosis virus | |
| CN114107299B (en) | sgRNA for targeted knockout of duck cGAS gene and application thereof | |
| CN115806926A (en) | Genetically engineered strain for producing pseudouridine and construction method and application thereof | |
| CN104789598A (en) | Method for constructing recombinant bombyx mori cypovirus for expressing red fluorescence protein | |
| CN102533722B (en) | Method for improving transient expression of recombinant proteins in mammalian cells through temperature jump | |
| CN109628452A (en) | A kind of Zyxin gene shRNA and recombinant vector and application inhibiting tumor cell proliferation and migration | |
| CN105779499A (en) | Recombinant baculovirus, application thereof and vector for constructing same | |
| CN103131695A (en) | Efficient assembling method of transcription activator-like effectors (TALE) repeating region for editing silkworm genome and framework carrier thereof | |
| CN107304432A (en) | It is a kind of while expressing the method and its dedicated system of n albumen or protein protomer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |