WO2020238433A1 - Construction of orthogonal aminoacyl-trna synthetase/trna system by using chimeric design method - Google Patents

Abstract

Provided is construction of an orthogonal aminoacyl-tRNA synthetase/tRNA system by using a chimeric design method. The system transplants the universal orthogonality of eukaryotes and prokaryotes of a pyrrolysyl-tRNA synthetase/tRNA system by means of rational chimeric design, includes several chimeric tRNA synthetase/tRNA systems, such as histidine, phenylalanine, alanine and serine systems, and can be applied to prokaryotes and eukaryotes, as well as orthogonal transformation of other aminoacyl-tRNA synthetase/tRNA pairs.

Description

A chimeric design method to construct an orthogonal aminoacyl-tRNA synthetase/tRNA system Technical field

The invention belongs to the technical field of chemical biology, and specifically relates to a chimeric design method to construct an orthogonal aminoacyl-tRNA synthetase/tRNA system.

Background technique

Protein is the main substance that functions in the organism. 20 amino acids encoded by 61 codons are synthesized in the ribosome. Although the 20 kinds of amino acids endow proteins with the characteristics of participating in various physiological and biochemical activities, only a few active groups such as sulfhydryl and hydroxyl groups can be chemically manipulated. In order to better study the physiological functions of proteins, the genetic code expansion technology that can introduce other unnatural amino acids with active groups came into being. The genetic code expansion technology uses an orthogonalized aminoacyl tRNA synthetase/tRNA system to identify unnatural amino acids with different functions and decode unallocated codons (stop codons, quadruple codons, etc.) to achieve site-directed insertion of unnatural amino acids. So far, this system has achieved the insertion of more than 150 unnatural amino acids with different active groups, performing different functions, such as biological tracking and imaging, regulation of protein functions in the body, research on post-translational modifications, and proteomics Analysis and biological treatment.

In genetic code amplification technology, the core is the need for orthogonalization of aminoacyl tRNA synthetase/tRNA, which does not recognize each other with the endogenous aminoacyl tRNA synthetase and tRNA in the cell, and does not affect the normal physiological activities in the cell. Insertion of specific unnatural amino acids. There are four main orthogonal pairs of aminoacyl tRNA and tRNA commonly used so far, but only the pyrrolysyl-tRNA synthetase (PylRS)/tRNA _CUA orthogonal pair derived from Methanosarcina mazei or Methanosarcina barkeri can be universally applied. In bacteria, eukaryotic cells and individuals.

Although Pyrrolysyl-tRNA synthetase (PylRS)/tRNA _CUA orthogonal system has successfully introduced about 100 unnatural amino acids into bacteria and eukaryotic cells, it has the following problems: 1. For some unnatural amino acids The activity of amino acids is very low, which leads to high experimental cost and low signal-to-noise ratio; 2. These introduced unnatural amino acids are derivatives of lysine and phenylalanine, and it is difficult to introduce amino acids with other chemical structures. We can use the other 20 aminoacyl tRNA synthetases that naturally exist to introduce novel unnatural amino acids through evolution. However, there are many problems in this method: 1. For other aminoacyl tRNA synthetase/tRNA systems, the anticodon-binding domain of aminoacyl tRNA synthetase needs to be directed to evolve so that it can recognize unassigned codons (stop codons). , Rare codons and 4-linked codons); 2. This system does not have universal orthogonality. Those derived from bacteria can be used in eukaryotic cells, and those derived from eukaryotes can be used in bacteria. Added many restrictions to our application.

In order to overcome the above-mentioned problems, researchers have come up with different solutions. In order to improve the activity of Pyrrolysyl-tRNA synthetase (PylRS)/tRNA _CUA orthogonal system, Diter Soll and David R Liu constructed the Pyrrolysyl-tRNA synthetase of Mm and Mb two species chimeras, and used PACE (phage assisted continuous The method of evolution) modified this chimeric protein to increase its activity. From the perspective of tRNA, some researchers have performed corresponding mutagenesis on the anticodon loop, anticodon arm, and T loop to improve the efficiency of the system's insertion of unnatural amino acids. For the problem that other aminoacyl tRNA synthetase/tRNA systems are not universally orthogonal, the researchers modified E. coli to replace the TrpRS/tRNA in the E. coli genome with the TrpRS/tRNA in yeast, so that the E. coli TrpRS The /tRNA system is orthogonal to this modified E. coli strain and eukaryotes, which facilitates the selection of unnatural amino acids. Although the above solutions overcome the problems in the field of genetic code expansion to a certain extent, they do not fundamentally solve the problem of not extensive orthogonality in the natural amino acid aminoacyl tRNA synthetase.

Summary of the invention

In view of the problems existing in the prior art, the purpose of the present invention is to propose a technical solution for constructing an orthogonal aminoacyl-tRNA synthetase/tRNA system using a chimeric design method, which is not limited to the constructed chimeric histidyl-tRNA synthesis Enzyme/tRNA pair (chHisRS/chHisT), chimeric phenylalanyl-tRNA synthetase/tRNA pair (chHmPheRS/chHmPheT), chimeric seryl-tRNA synthetase/tRNA pair (chSerRS/chSerT), chimeric C Four systems of aminoacyl-tRNA synthetase/tRNA pairs (chAlaRS/chAlaT), the gene sequence of the chimeric histidyl-tRNA synthetase is shown in SEQ ID No. 3, and the chimeric phenylalanyl- The gene sequence of tRNA synthetase is shown in SEQ ID No. 4, the gene sequence of the chimeric seryl-tRNA synthetase is shown in SEQ ID No. 5, and the gene sequence of the chimeric alanyl-tRNA synthetase The gene sequence of the gene sequence is shown in SEQ ID No. 6. To be more specific, we will not use a specific mosaic system as an example, but all the mosaic systems are constructed in accordance with the following methods. At the same time, in the present invention, the E. coli expression system uses the pNEG and pBK vectors, and the animal cell expression system uses the pcDNA3.1 vector as an example, but it is not limited to these three vectors. The maps of these three vectors are shown in Figure 1.

In the described method for constructing an orthogonal aminoacyl tRNA synthetase/tRNA/system using a chimeric design method, we provide a specific method to construct and optimize a chimeric system. The steps are as follows:

S1: Construction of chimeric aminoacyl-tRNA synthetase/tRNA vector;

S2: Evaluation of chimeric aminoacyl-tRNA synthetase/tRNA activity using GFP amber inhibition efficiency in E. coli;

S3: Confirmation of amino acid insertion, including GFP expression, LC-MS and LC-MS/MS identification;

S4: Amber inhibition efficiency test of chimeric system in mammalian cell expression system;

S5: For the low-efficiency chimeric system, select the acceptor arm of the chimeric tRNA and construct a mutation library for screening.

The construction of the chimeric aminoacyl-tRNA synthetase/tRNA vector involves the following steps:

S6: Construction of chimeric tRNA vector;

S7: Construction of chimeric aminoacyl-tRNA synthetase vector.

The chimeric tRNA vector is constructed through the following steps:

S8: Design and synthesis of chimeric tRNA;

S9: Synthesis of the reporter gene GFP190TAG-His6, the sequence is shown in SEQ ID No.1;

S10: Link the chimeric tRNA and GFP190TAG-His6 to the pNEG vector, under the control of glns and pBAD promoters, respectively.

The construction of the chimeric aminoacyl-tRNA synthetase is through the following steps:

S11: Selection of tRNA binding domain from pyrrolysyl-tRNA synthetase in chimeric aminoacyl-tRNA synthetase, selection of catalytic domain of aminoacyl-tRNA synthetase; respectively connected to pBK vector. The complete sequence of the pyrrolysyl-tRNA synthetase tRNA binding domain used in the present invention is shown in SEQ ID No. 2;

S12: Synthesize connecting peptides of different lengths and types and load them between the two parts of the chimeric aminoacyl-tRNA synthetase. Types of connecting peptides: GS-rich, helix, P-rich, the sequence is shown in Table 3-1.

S13: Synthesize glns promoter, pBAD promoter, oxb20 promoter, trp promoter and insert it into pBK vector to control the expression of chimeric aminoacyl tRNA synthetase. The sequence is shown in Table 4-1.

At the same time, we provide a method to evaluate the activity of chimeric aminoacyl-tRNA synthetase/tRNA in E. coli using the inhibition efficiency of GFP amber, as follows:

S14: The pNEG vector carrying the GFP190TAG-His6 gene and chimeric tRNA and the pBK vector carrying the chimeric aminoacyl-tRNA synthetase were co-transformed into DH10B competent cells;

S15: Pick a single clone into the liquid medium, and arabinose induces gene expression;

S17: Lyse the expressed cells;

S18: Measure the fluorescence of GFP in the cell supernatant after lysis, and calculate the GFP amber inhibition efficiency of the chimeric system (Figure 4).

For the constructed chimeric aminoacyl-tRNA synthetase/tRNA system, we also provide a method to identify the correct insertion of amino acids, as follows:

S19: Mass cultivation of E. coli in S14, arabinose induces protein expression;

S20: Collect the expressed Escherichia coli, ultrasonically disrupt, and purify by affinity chromatography;

S21: Western-bloting, LC-MS and LC-MS/MS identification of purified protein.

The chimeric system available for orthogonalization in E. coli, the analysis of transfer efficiency into mammalian cells and the confirmation of orthogonality are as follows:

S22: The chimeric aminoacyl tRNA synthetase gene and the chimeric tNRA gene are transferred into the pcDNA3.1 vector;

S23: S22 plasmid and pEGFP-EGFP-191TAG-Histag co-transfect HEK 293T cells;

S24: GFP fluorescence and Western-blotting measure the efficiency of the chimeric system in mammalian cells.

For chimeric systems with low activity and orthogonality in the initial construction, we provide a library screening system based on chimeric tRNA receptor arm regions, as follows:

S25: Construct a chimeric tRNA library and clone it into the pNEG vector;

S26: Preparation of DH10B competent cells containing chimeric aminoacyl-tRNA synthetase plasmid;

S27: Electrotransform the library into the prepared competent cells, and coat a plate containing arabinose;

S28: Screen the clones with fluorescence;

S29: Confirmation of the orthogonality of chimeric tRNA;

S30: Chimeric tRNA sequencing.

The chimeric system inherits the flexibility of the pyrrolysyl-tRNA synthetase/tRNA system. It can not only use the codon UAG, but also use the UAA and UGA codons to achieve efficient site-specific introduction of amino acids, as follows:

S31: Construction of UAA system and UGA system carrier;

S32: Comparison of the efficiency of introducing amino acids in three systems.

The system of the present invention transplants the universal orthogonality of eukaryotes and prokaryotes of the pyrrolysyl-tRNA synthetase/tRNA system through rational chimeric design, including several chimeric tRNA synthetase/tRNA systems, including But not limited to histidine, phenylalanine, alanine and serine systems, the system not only has high efficiency, but also has the flexibility of the pyrrolysyl-tRNA synthetase/tRNA ^Pyl system and can be applied to prokaryotes And eukaryotes. The method can undoubtedly be applied to the orthogonal transformation of other aminoacyl-tRNA synthetase/tRNA pairs.

Description of the drawings

Figure 1 shows the plasmid map used in the present invention. In the figure, A: pBK plasmid map, B: pNEG plasmid map, C: pcDNA3.1 plasmid map, D: pEGFP-EGFP-191TAG-Histag plasmid map.

Figure 2 shows the principle diagram of the orthogonal aminoacyl-tRNA synthetase/tRNA system constructed by the chimeric design method. In the figure A: the structure of the pyrrolysyl-tRNA synthetase/RNA ^Pyl orthogonal pair (left) and the traditional The structure of the aminoacyl-tRNA synthetase/tRNA pair (right), the chimeric aminoacyl tRNA formed by fusion of the tRNA binding domain of pyrrolysyl-tRNA synthetase and the catalytic domain of traditional aminoacyl-tRNA synthetase Synthetase (chRS), chimeric tRNA (chT) is produced by replacing the pylT acceptor arm with a specific tRNA acceptor arm (middle); B: amino acid structure in this study.

Figure 3 shows the construction and efficiency determination of chimeric histidine tRNA. In the figure, A: clover structure of histidine tRNA and pyrrolysine tRNA with G-1 structure; B: clover structure of chHisT chimera It is composed of pyl T sequence and his T sequence; C: chHisRS-1 chimera structure is composed of pylRS NTD (1-149aa) and hisRS CD (1-326aa) fusion; D: GFP fluorescence intensity method to detect amber suppression efficiency .

Figure 4 shows the construction of chimeric histidyl-tRNA synthetase and the determination of corresponding efficiency and specificity. A: chHisRS chimera consists of pylRS sequence and hisRS sequence, pylRS NTD mutation carries IPYE mutation; B: GFP reporter method Analyze the amber inhibition efficiency of chHisRSs; C: Use GFP fluorescence to analyze the amber inhibition efficiency of pylRSs under the condition of 2mM Boc-L-lysine at 22℃ and 30℃. It is worth mentioning that pylRS at 30℃ The activity of chHisRS is higher than that at 22°C, while the activity of chHisRS is similar at 22°C or 30°C; D: Mass spectrometry confirmed that histidine was introduced at a specific site of GFP by chimeric histidyl-tRNA synthetase/tRNA ; E: Analyze the amber inhibition efficiency of chHisRS under different promoter conditions by GFP signal and non-denaturing polyacrylamide gel; F: use the histidyl-tRNA synthetase/tRNA complex to overlap with pyrrolysyl through tRNA -The structure of tRNA synthetase/tRNA complex is superimposed.

Figure 5 shows the test diagram of the activity and orthogonality of the chimeric histidyl-tRNA synthetase/tRNA system in cells. Figure A: The expression level of full-length GFP was detected by western to determine the inhibition of amber in mammalian cells. effectiveness. In this experiment, two plasmids were co-transfected into HEK 293T cells: one plasmid carries chimeric aminoacyl tRNA synthetase and chimeric tRNA gene, in which tRNA is divided into terminal CCA sequence and none, and the other plasmid carries GFP- 190TAG-His ₆ gene. The transfected cells were then analyzed by western analysis (A) by anti-His ₆ antibody or by fluorescence microscope (B). A plasmid that does not carry the chimeric aaRS gene served as a negative control. C: The amber inhibitory activity of chHisRS under different tRNA conditions was analyzed by the GFP reporter method.

Figure 6 shows a diagram of other chimeric systems constructed using chimeric design. Figure A: Using GFP as the reporter gene to analyze the amber inhibitory activity of chimeric aminoacyl-tRNA synthetase on corresponding chimeric tRNAs. In this figure, EC stands for Escherichia coli, H stands for humans, and H-MT stands for human mitochondria; B: GFP reporter gene analysis of the amber inhibitory activity of chPheRSs; C: mass spectrometry confirms the use of chimeric phenylalanyl-tRNA synthetase /tRNA introduces phenylalanine at a specific site of GFP; D: Use GFP reporter gene to analyze the amber inhibitory activity of chAlaRSs E: Mass spectrometry confirms that chimeric alanyl-tRNA synthetase/tRNA is at a specific site of GFP Alanine is introduced.

Figure 7 shows the molecular evolution diagram of chimeric seryl tRNA. Figure A: The general two-step method of chimeric tRNA receptor arm evolution is the combination of tRNA randomization and tRNA selection; B: GFP reporter analysis under chSerRS conditions Lower chSerTs amber suppression efficiency C: mass spectrometry analysis of serine GFP fidelity.

Figure 8 shows the clover structure of tRNA in the present invention. Figure A: The structures of pylT and hisT in the present invention. pylT has a U25C mutation to improve the efficiency of pyrrolidine. HisT has a structure of G ^-1 ; B: Histidyl-tRNA- Chimeric structures from 1 to -6, including pylT and hisT; C: Histidyl-tRNA chimeric structure in E.coli and human CUA anticodon; D: chimeric structure of other tRNAs in the present invention, chPheT, chAlaT , ChAlaT (GU) has an uncommon GU pair mutated into an AU pair; E: Chimeric serine tRNA ranges from the original -1 to the selected -2,-3, and ChSerT-2 with high amber suppression efficiency is named For chSerT.

Figure 9 shows the chimeric histidine system. In the figure, A: Coomassie brilliant blue staining analysis of purified GFP protein with histidine inserted; B: Mass spectrometry analysis to confirm the insertion of histidine in GFP; C: LC-MS/MS Analysis confirms the insertion of histidine in GFP; D: non-denaturing polyacrylamide gel electrophoresis analysis of histidine insertion of GFP protein; E: chimeric histidyl-tRNA/tRNA system with different histidines at 22℃ or 30℃ Amber suppression efficiency of acid concentration.

Figure 10 shows the structure of chimeric histidyl-tRNA synthetase. The protein complexes are fitted by tRNA overlap.

Figure 11 shows the optimization of chimeric histidine tRNA synthetase. Figure A: Overview of chHisRS linked peptides of different lengths; B: GFP reporter method and native gel fluorescence analysis of chHisRS amber inhibitory activity of different lengths; C: The GFP reporter method analyzes the amber inhibitory activity of chHisRS carrying different types of connecting peptides. In the figure, GS rich means that the connecting peptides are rich in Gly and Ser, Pro rich means that the connecting peptides are rich in Pro, and the helix means that the connecting peptide is a helical structure.

Figure 12 shows the nonsense codon suppression efficiency of the chimeric histidine system. The suppression efficiency of the GFP gene carrying three stop codons (ochre, opal and amber codon) is analyzed.

Figure 13 shows the orthogonality test of the chimeric histidine system in mammalian cells. Figures A&B and Figure 5 show the complete Western blot gel. The main text area is highlighted by a dashed box, D: GFP method was used to analyze the inhibitory activity of chHisRS on endogenous hisTs amber.

Figure 14 shows the chimeric phenylalanyl-tRNA synthetase/tRNA system. Figure A: GFP method to analyze the amber inhibitory activity of chPheRSs; B: Complete Western blot gel in Figure 5B, highlighted by a dashed box in Figure 5B ; C: Coomassie brilliant blue staining analysis of purified GFP protein; D: raw data of mass spectrometry, confirming that phenylalanine was introduced at a specific site of GFP by chimeric phenylalanyl-tRNA synthetase/tRNA; E: in Amber inhibition efficiency of the phenylalanine chimeric system at 22°C or 30°C.

Figure 15 shows the chimeric alanyl-tRNA synthetase/tRNA system. Figure A: The structure of alanine-tRNA synthetase (chAlaRS) contains pylRS sequence and alaRS sequence, and the tRNA binding domain of pylRS carries IPYE mutation; B: GFP method to analyze the amber inhibitory activity of chAlaRSs and chAlaT (GU); C: GFP method to analyze the amber inhibitory activity of chAlaRSs and chAlaT (AU). D: Figure 5D shows the complete Western blot gel, the main text area is highlighted by the dashed box; E: Coomassie brilliant blue staining analysis of the purified GFP protein; F: G mass spectrometry confirmed by chimeric alanyl- tRNA synthetase/tRNA introduces the raw data of alanine at a specific site of GFP.

Detailed ways

The present invention will be further described in detail below with reference to specific implementation cases. The following implementation cases are an explanation of the present invention, and the present invention is not limited to the following implementation cases.

Hereinafter, the present invention will be further illustrated by taking the chimeric histidine tRNA synthetase/tRNA system and the molecular evolution of chimeric serine tRNA as an example.

Example 1: Construction of chimeric histidine tRNA

In the present invention, the chimeric tRNA and the reporter gene GFP190TAG-His6 are constructed on the same plasmid and controlled by the lpp promoter and the pBAD promoter respectively. The specific construction method is as follows:

(1) Construct GFP190TAG-His6 on pNEG vector

The sequence of GFP190TAG-His6 is shown in SEQ ID No. 1. The primers pNEG-gfp-F and pNEG-gfp-R are amplified using the existing plasmid containing this gene as a template, and pNEG-gfp-vF and pNEG-gfp-vF are designed and synthesized. pNEG-gfp-vR, using the previous pNEG as template amplification vector. The agarose gel was recovered and assembled by Gibson, transformed into DH10B competent cells, and selected a single clone for sequencing to obtain the plasmid pNEG-GFP190TAG-His6;

(2) Design chimeric histidine tRNA and clone it into pNEG-GFP190TAG-His6 vector

Chimeric histidine tRNA needs to transplant the histidine tRNA acceptor arm region to pyrrolysine tRNA. In order to obtain the optimal chimeric histidine tRNA, we designed the transplanted histidine tRNA acceptor arm region The chimeric histidine tRNAs in different regions are named chHisT-1, 2, 3, 4, 5 and 6, respectively. The model diagram and detailed sequence are shown in Figures 3 and 8. Design the corresponding primers to amplify and clone into the pNEG-GFP190TAG-His6 vector constructed in the previous step. The corresponding primers are shown in Table 1-1.

Table 1-1. Primers needed to construct chimeric tRNA

Name	Sequence
GFP190TAG-F	TTTAAGAAGGAGATATACATATGGGTAAAGGAGAAGAACTTTTC
GFP190TAG-R	CCGCAAGGAATGGTGCATGCTCAATGGTGATGGTGATGATGGGGCCC
ChHisT-1-F	ATCCGTTCAGCCGGGTTAGATTCCCGGGGTTTCCCCCACTGCAGATCCTTAGCGAAAGC
ChHisT-1-R	TTAGAGTCCATTCGATCTACATGATCAGGTTTCCCGAATTCAGCGTTACAAGTATTACAC
ChHisT-2-F	ATCCGTTCAGCCGGGTTAGATTCCCGGGGTTTACCCCACTGCAGATCCTTAGCGAAAGC
ChHisT-2-R	TTAGAGTCCATTCGATCTACATGATCAGGTTTACCGAATTCAGCGTTACAAGTATTACAC
ChHisT-3-F	ATCCGTTCAGCCGGGTTAGATTCCCGGGGTCCACCCCACTGCAGATCCTTAGCGAAAGC
ChHisT-3-R	TTAGAGTCCATTCGATCTACATGATCAGGTCCACCGAATTCAGCGTTACAAGTATTACAC
ChHisT-4-F	TTAGAGTCCGTTCGATCTACATGATCATAGCCACCGAATTCAGCGTTACAAGTATTACAC
ChHisT-4-R	ATCCGTTCAGCCGGGTTAGATTCCCGGTAGCCACCCCACTGCAGATCCTTAGCGAAAGC
ChHisT-5-F	GAATTCAGCGTTACAAGTATTACACA
ChHisT-5-R	GTGGCTATGATCATGTAGATCGAACGG
ChHisT-6-F	AAGAGTCCGTTCGATCTACATG
ChHisT-6-R	AATCCGTTCAGCCGGGTTAGATTC

Example 2: Construction of chimeric histidyl-tRNA synthetase

The chimeric histidyl-tRNA synthetase is composed of two parts, one part is the tRNA binding domain of pyrrolysyl-tRNA synthetase, and the other part is the catalytic domain of histidyl-tRNA synthetase. The design is shown in Figures 2 and 3C. .

The construction of chimeric histidyl-tRNA synthetase includes the choice of pyrrolysyl-tRNA synthetase tRNA binding domain, the choice of histidyl-tRNA synthetase catalytic domain, and the choice of the fusion mode of the two.

(1) Analysis and selection of pyrrolysyl-tRNA synthetase tRNA binding domain

In the present invention, it is necessary to clone the pyrrolysyl-tRNA synthetase tRNA binding domain to the pBK vector. This tRNA binding domain can be divided into two subdomains. The N-terminal 1-149 recognizes the variable region of the corresponding tRNA And T loop, the segment 185-240 recognizes the corresponding tRNA D-stem region, and it is reported in the literature that mutations of V31I, T56P, H62Y, A100E (IPYE for short) can improve the activity of the system. Therefore, we selected four tRNA binding domain parts, namely N149, N149+185-240 (N240), N149-IPYE, N149+185-240-IPYE, and designed primers to be constructed on the pBK vector (Figure 4A).

(2) Selection of the catalytic domain of histidyl-tRNA synthetase

Next, the present invention analyzes the structure of histidyl-tRNA synthetase (Figures 3F, 4A and 10), and selects the N-terminal 326 amino acids (1-326) as the catalytic domain part of the chimeric design.

(3) Construction of chimeric histidyl-tRNA synthetase with different fusion methods

Design primers to amplify histidyl-tRNA synthetase 1-326 and connect to the N-terminus or C-terminus of the pyrrolysyl-tRNA synthetase tRNA binding domain to construct chHis-1, 2, 3, 4, and 5. And cloned into pBK vector. The corresponding primers are shown in Table 2-1.

Table 2-1. List of primers for constructing chimeric histidyl-tRNA synthetase

Name	Sequence
Pyl-N149-F	TACGCTTTGAGGAATCCCATATGGATAAGAAGCCGCTGGATG
Pyl-N149-R	GTCAGAGCTGGGGCGCTTGCAGAGGTCGGAACCGGAGAGTTC
Pyl-N205-R	GCCGCCGCTTCCGCCACCCTCGCGTTCCTCAGC
ChHisRS-1-F	GTGGCGGAAGCGGCGGCATGGCAAAAAACATTCAAGC
ChHisRS-1-R	TAGCGTTTGAAACTGCAGTTACGGATTAACGGCCTGTACTAACAATACAAGACGTTC
ChHisRS-3-F	CGCTTTGAGGAATCCCATATGGCAAAAAACATTCAAGCC
ChHisRS-3-R	TTCCGCCGCCGCTTCCGCCACCTATATCGACAACAGGATCGGCT

Example 3: Optimization of Chimeric Histidyl-tRNA Synthetase Linking Peptide

In the construction of the chimeric protein, the connecting peptide between the two chimeric fragments is very important to the activity of the chimeric molecule. In the present invention, we tested the length of the connecting peptide and the type of the connecting peptide (Figure 11) .

(1) Optimization of connecting peptide length

Design the length of the flexible connecting peptide (GS-type) 0, 6, 12, 18 and 24 amino acids, named chHisRS 4-2, -3, -4, -5 and -6 respectively, and the nucleotide sequence of the corresponding connecting peptide See Table 3-1. At the same time, the N-terminal 15 amino acids of histidine-tRNA synthetase were deleted on the basis of 0 amino acid connecting peptide, named chHisRS4-1. The primers were designed and constructed on the carrier by the Q5 site directed mutation kit (NEB), corresponding The primers are shown in Table 3-2.

(2) Construction of chimeric histidyl-tRNA synthetase with different connecting peptide types

In addition to the flexible connecting peptide (GS-type), the proline-rich connecting peptide (APAPAPAPAPAPAPAPAPAP) and the α-helix type connecting peptide (AEAAAAAAKA) are also selected in the present invention. The corresponding nucleotide sequences are shown in Table 3-1. The designed primers were constructed on the vector by the Q5 site-directed mutation kit (NEB). The corresponding primers are shown in Table 3-2.

Table 3-1. Nucleotide sequences of different connecting peptides

Table 3-2. Primers used in the construction of connecting peptides

Name	Sequence
12aa-GS-linker-F	TCTGGTGGCATGGCAAAAAACATTCAAGCC
18aa-GS-linker-F	TCTGGTGGCGGTGGCGGAAGCGGCGGTATGGCAAAAAACATTCAAGCC
24aa-GS-linker-R	ACCGCCACCAGACCCACCGCCGCCGCCGCTTCCGCCACCCTCGCGTTCCTCAG
24aa-GS-linker-F	GGCGGAAGCGGCGGTGGCGGTGGCAGCGGGGGTATGGCAAAAAACATTCAAGCC
P-rich-linker-R	GAGCAGGGGCCGGCGCTGGCGCGGGGGCCTCGCGTTCCTCAGCGTAGAT
P-rich-linker-F	CAGCGCCTGCCCCGGCACCCGCCCCCATGGCAAAAAACATTCAAGCCA
α-helix-linker-F	GCTGCAAAGGAAGCTGCAGCGAAGGCTATGGCAAAAAACATTCAAGCCA
α-helix-linker-R	GGCCTCTTTTGCAGCCGCTTCGGCCTCGCGTTCCTCAGCGTAGA

Example 4: Control optimization of chimeric histidyl-tRNA synthetase promoter

In E. coli expression system, the promoter has a great influence on enzyme activity. In order to obtain the best amino acid insertion efficiency, select glns promoter, pBAD promoter, oxb20 promoter, trp promoter promoter, the nucleotide sequence of the promoter is shown in Table 4-1. Design primers and use Gibson to assemble and insert into pBK vector , Thereby controlling the expression of chimeric histidyl-tRNA synthetase. The corresponding primers are shown in Table 4-2.

Table 4-1. Nucleotide sequences of different promoters

Table 4-2. Primers needed to construct the promoter

Name	Sequence
pBAD-F	TTTGCTGAGTTGAAGGTTATGACAACTTGACGGCTACAT
pBAD-R	CCAGCGGCTTCTTATCCATGGTTAATTCCTCCTGTTAGC
Trp-F	GTGTGGAAGCGGTCGCTTTCATAAGGAGGTCGCAAATGGATAAGAAGCCGCTGGATG
Trp-R	ATTAAACTAGTTCGATGATTAATTGTCAACAGCCCGAGGATCCTTCAACTCAGCA
Oxb20-F	TCCCGCTTATAAAAGCTGTTGTGACCGCTTGCTCTAGCCAGC
Oxb20-R	TATAACGGCGGCCGGGTAATACCGGATAGTCAATATGTTCTG

Example 5: Evaluation of the activity of different types of chimeric histidyl-tRNA synthetase/tRNA constructed by using GFP amber inhibition efficiency in E. coli to obtain the optimal chimeric histidyl-tRNA synthetase/tRNA system

In this embodiment, the chimeric histidine-tRNA synthetase plasmid and the chimeric histidine tRNA plasmid constructed in the above embodiment are co-transformed into DH10B competent cells. Transformed cells were cultured in 2xYT medium with shaking at 37°C for 1 hour, and spread on LB agar plates containing 50μg/ml kanamycin (kan) and 100μg/ml ampicillin (AMP), and cultured at 37°C for 12 hours. Cells transformed with pNEG plasmid carrying GFP-190 (TAG) and chimeric tRNA were used as negative controls. Pick 3 points from each plate to 2XYT medium, culture at 37℃ with shaking to OD600=0.8, add arabinose with a final concentration of 0.2%, induce culture at 22℃ for 14h to express protein . After the expression is over, take 1ml of the cell culture and centrifuge, remove the medium and lyse with 150μl BugBuster protein extraction reagent (Millipore). After lysis, centrifuge at 12000 rpm for 1 min, and transfer 100 μl of supernatant to 96-well culture plate (COSTAR). Use BioTek Synergy NEO2 to record the supernatant GFP signal and normalize it. Perform statistical processing on the measured data to obtain the average value and error. Through the above test, we got the following conclusions:

(1) Chimeric histidine tRNA requires a complete transplantation of histidine tRNA receptor arm (Figure 3);

(2) The tRNA binding domain of pyrrolysyl-tRNA synthetase is better at the N-terminus of the chimeric protein than at the C-terminus (Figure 4A and B);

(3) The more complete the tRNA binding domain of pyrrolysyl-tRNA synthetase, the higher the activity of the chimeric molecule. The introduction of IPYE mutations can significantly improve the activity of the chimeric molecule (Figure 4A and B);

(4) The type of connecting peptide has little effect on the activity, and the connecting peptide of 18 amino acids is the best (Figure 11B and C);

(5) The oxb20 promoter is the best in the E. coli expression system (Figure 4E).

Example 6: Confirmation of histidine insertion into a specific site of GFP protein

We have obtained the chimeric histidyl-tRNA synthetase/tRNA pair. We also need to verify the accuracy of the amino acid introduced, and the protein needs to be purified, which is confirmed by LC-MS and LC-MS/MS.

In this example, in order to express and purify the protein, DH10B cells cultured overnight were inoculated into 100 ml of fresh LB medium at a 1:100 inoculum and added with the required antibiotics, and then grown until the OD600 reached 0.8. Adding L-arabinose to a final concentration of 0.2% induces the expression of GFP (22° C., 220 rpm, 14 h). The induced cells were centrifuged at 4000 rpm at 4°C for 5 minutes, and the resulting cell pellet was resuspended in pre-cooled NTA-0 buffer (25mM Tris, 250mM NaCl, pH 8.0) and lysed by ultrasound. The lysate was centrifuged at 12,000 rpm and 4°C for 60 minutes, and the supernatant obtained was loaded to the nickel affinity chromatography chelating chromatography that was equilibrated with NTA-0 buffer in advance, and then washed with 6 times volume of NTA-0 buffer containing 50 mM imidazole . Finally, the protein was eluted with NTA-0 buffer added with 500 mM imidazole. The purified protein was analyzed by SDS-PAGE and LC-MS.

For LC-MS analysis, the purified protein was analyzed on an LCQ Deca XP MAX mass spectrometer (Thermo Fisher Science) equipped with an electrospray ionization (ESI) source and an Agilent 1200 HPLC. Separation and desalination were carried out on Agilent 300SB-C18 column (300×2.1, 150mm, 5μm). The mobile phase A was set to an aqueous solution containing 0.1% formic acid, and the mobile phase B contained 0.1% formic acid in acetonitrile, and the flow rate was set to 0.200 ml/min. Use XCalbur-Quar browser software to analyze the data. In UniDec software (version 2.6.8, University of Oxford), the core Bayesian deconvolution algorithm is used for mass deconvolution. Use ExPASy Compute pI/Mw tool (https://web.expasy.org/compute_pi/) to predict the theoretical molecular weight of the protein.

In the LC-MS/MS analysis, the protein band was cut from the gel and digested with trypsin overnight. The digested product is loaded onto the Q Exactive Orbitrap (Thermo Fisher) mass spectrometer that combines Proxeon Easy-nLC II HPLC (Thermo Fisher Science) and Proxeon nanospray sources. Use MASCOT engine (Matrix Science, London, UK; version 2.2) to search for MS/MS spectrum, and use pLabel software (version 2.4, University of Florida Herbarium) for further processing. The processing results showed that histidine was inserted into the 190 position of GFP, as shown in Figure 4D and Figure 9.

Example 7: Molecular evolution of chimeric serine tRNA

The chimeric seryl-tRNA synthetase/tRNA system constructed by the above examples has low activity. Next, the receptor arm region of the chimeric serine tRNA is modified, and the specific steps are as follows:

S25: Construct a chimeric tRNA library and clone it into the pNEG vector;

S26: Preparation of DH10B competent cells containing chimeric aminoacyl-tRNA synthetase plasmid;

S27: Electrotransform the library into the prepared competent cells, and coat a plate containing arabinose;

S28: Screen the clones with fluorescence;

S29: Confirmation of the orthogonality of chimeric tRNA;

S30: Chimeric tRNA sequencing;

More specifically, in order to build a chSerT library, select G2:C71, U3:A70, G4:C69, A5:U68, G6:C67, G7:C666 base pairs, and design primers chSerT-lib-F and chSerT-lib -R PCR random library fragments, and design primers chSerT-vF and chSerT-vR to amplify the pNEG vector. The vector and fragments are recovered by the gel recovery kit and assembled by Gibson. The assembled library plasmid was transformed into DH10B competent cells containing pBK-oxb20-chSerRS by electroporation. The transformed cells were resuscitated by adding 0.9ml SOC medium at 37°C for 1h, and then spread on LB agar plates containing 50μg/ml kanamycin, 100μg/ml ampicillin and 0.2% L-arabinose. Incubate at 37°C for 12 hours, and then at 22°C for 48 hours. Use Azure Bio.C400 to select fluorescent clones from the plate on the Cy2 channel and inoculate them on 96-well culture plates. Incubate at 37°C and 220 rpm for 10 hours, and then induce with 0.2% arabinose for 22 hours. Use BioTek Synergy NEO2 to record OD600 and GFP fluorescence (λex=490/10nm, λem=510/10nm). Pick the cells with the highest GFP/OD600 ratio and inoculate them in 2xYT medium with 100μg/ml ampicillin, and extract the plasmid with a plasmid kit. The extracted DNA was digested with BglII restriction endonuclease, the pBK-oxb20-chSerRS plasmid was removed and transformed into E. coli DH10B active cells. The pNEG plasmid containing the chSerT variant was extracted and sequenced. The comparison of the selected tRNA and the corresponding activity is shown in Figure 7. The specific primers are as follows.

Table 7-1. List of primers for chimeric serine tRNA library construction

Name	Sequence
chSerT-lib-F	TTCGCTAAGGATCTGCAGTGGCGGNNNNNCCGGGAATCTAACCCG
chSerT-lib-R	ATACTTGTAACGCTGAATTCGGNNNNNTGATCATGTAGATCGAAC
chSerT-v-F	GAATTCAGCGTTACAAGTATTACACAAAGTTTTTTATG
chSerT-v-R	CCACTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTTAAG

Example 8: Analysis of amber inhibition efficiency of chimeric histidyl-tRNA synthetase/tRNA system in mammalian cells

(1) Construction of chimeric histidyl-tRNA synthetase/tRNA mammalian expression vector

Design primers to amplify chimeric histidyl-tRNA synthetase and chimeric histidine tRNA and clone them into pcDNA3.1 vector. The empty vector map under the control of CMV and U6 promoters is shown in Figure 1. The chimeric histidine tRNA retains the CCA of the acceptor arm and does not retain both. The primers are shown in Table 8-1.

(2) Transfection of HEK 293T cells with chimeric system

The plasmid constructed above and pEGFP-EGFP190TAG-His ₆ were co-transfected into HEK 293T cells at a ratio of 1:1 (G:G) with PEI reagent.

(3) Cell fluorescence and WB analysis of transfection and inhibition efficiency

After 48 hours of transfection, the GE DV Elite Applied Precision DeltaVision system was used for fluorescence imaging analysis, and then Western blot analysis. The efficiency of the chimeric histidine tRNA with CCA attached to the end was significantly higher than without (Figures 5 and 13).

The above are only the preferred embodiments of the present invention, and do not limit the scope of the present invention. Any equivalent structure or equivalent process transformation made by using the contents of the description and drawings of the present invention, or directly or indirectly applied to other related technical fields , The same reason is included in the scope of patent protection of the present invention.

Claims (10)

1. A chimeric design method is used to construct an orthogonal aminoacyl-tRNA synthetase/tRNA system, which is characterized by the extensive orthogonality of transplanted pyrrolysyl-tRNA synthetase/tRNA pairs in eukaryotic cells and prokaryotic cells.
2. As claimed in claim 1, a chimeric design method is used to construct an orthogonal aminoacyl-tRNA synthetase/tRNA system, wherein the orthogonal chimeric system includes a chimeric histidyl-tRNA synthetase/tRNA pair , Chimeric phenylalanyl-tRNA synthetase/tRNA pair, chimeric seryl-tRNA synthetase/tRNA pair, chimeric alanyl-tRNA synthetase/tRNA pair, but not limited to these 4 chimeric systems The gene sequence of the chimeric histidyl-tRNA synthetase is shown in SEQ ID No. 3, and the gene sequence of the chimeric phenylalanyl-tRNA synthetase is shown in SEQ ID No. 4. The gene sequence of the chimeric seryl-tRNA synthetase is shown in SEQ ID No. 5, and the gene sequence of the chimeric alanyl-tRNA synthetase gene sequence is shown in SEQ ID No. 6.
3. As claimed in claim 1 or 2, a chimeric design method is used to construct an orthogonal aminoacyl-tRNA synthetase/tRNA system, wherein the orthogonal aminoacyl-tRNA synthetase/tRNA system is chimeric through The following steps are implemented:

   S1: Construction of chimeric aminoacyl-tRNA synthetase/tRNA vector;

   S2: Evaluation of chimeric aminoacyl-tRNA synthetase/tRNA activity using GFP amber inhibition efficiency in E. coli;

   S3: Confirmation of amino acid insertion, including GFP expression, LC-MS and LC-MS/MS identification;

   S4: Amber inhibition efficiency test of chimeric system in mammalian cell expression system;

   S5: For the low-efficiency chimeric system, select the acceptor arm of the chimeric tRNA and construct a mutation library for screening.
4. As claimed in claim 3, a chimeric design method is used to construct an orthogonal aminoacyl tRNA synthetase/tRNA/system, wherein the construction of the chimeric aminoacyl-tRNA synthetase/tRNA vector in S1 specifically includes :

   S6: Construction of chimeric tRNA vector;

   S7: Construction of chimeric aminoacyl-tRNA synthetase vector.
5. According to claim 4, a chimeric design method is used to construct an orthogonal aminoacyl tRNA synthetase/tRNA system, wherein the chimeric tRNA vector construction in S6 specifically includes:

   S8: Design and synthesis of chimeric tRNA;

   S9: Synthesis of the reporter gene GFP190TAG-His6;

   S10: Link the chimeric tRNA and GFP190TAG-His6 to the pNEG vector, under the control of glns and pBAD promoters, respectively.
6. As claimed in claim 4, a chimeric design method is used to construct an orthogonal aminoacyl tRNA synthetase/tRNA/system, wherein the construction of the chimeric aminoacyl-tRNA synthetase in S7 specifically includes:

   S11: Selection of tRNA binding domain from pyrrolysyl-tRNA synthetase in chimeric aminoacyl-tRNA synthetase, selection of catalytic domain of aminoacyl-tRNA synthetase; respectively connected to pBK vector;

   S12: Synthesize connecting peptides of different lengths and types and load them between the two parts of the chimeric aminoacyl-tRNA synthetase. The types of connecting peptides: GS-rich, helix, P-rich;

   S13: Synthesize glns promoter, pBAD promoter, oxb20 promoter, trp promoter and insert into pBK vector to control the expression of chimeric aminoacyl tRNA synthetase.
7. As claimed in claim 3, a chimeric design method is used to construct an orthogonal aminoacyl-tRNA synthetase/tRNA system, wherein the S2 uses GFP amber inhibition efficiency to evaluate the chimeric aminoacyl-tRNA synthetase in Escherichia coli. The activities of tRNA synthetase/tRNA specifically include:

   S14: The pNEG vector carrying the GFP190TAG-His6 gene and chimeric tRNA and the pBK vector carrying the chimeric aminoacyl-tRNA synthetase were co-transformed into DH10B competent cells;

   S15: Pick a single clone into the liquid medium, and arabinose induces gene expression;

   S17: Lyse the expressed cells;

   S18: Measure the GFP fluorescence of the cell supernatant after lysis, and calculate the GFP amber suppression efficiency of the chimeric system.
8. As claimed in claim 3, a chimeric design method is used to construct an orthogonal aminoacyl-tRNA synthetase/tRNA system, wherein the confirmation of the amino acid insertion in S3 specifically includes:

   S19: Mass cultivation of E. coli in S14, arabinose induces protein expression;

   S20: Collect the expressed Escherichia coli, ultrasonically disrupt, and purify by affinity chromatography;

   S21: Western-bloting, LC-MS and LC-MS/MS identification of purified protein.
9. As claimed in claim 3, a chimeric design method is used to construct an orthogonal aminoacyl-tRNA synthetase/tRNA system, wherein the efficiency test of the chimeric system in mammalian cells in S4 specifically includes:

   S22: The chimeric aminoacyl tRNA synthetase gene and the chimeric tNRA gene are transferred into the pcDNA3.1 vector;

   S23: The plasmid obtained from S22 and pEGFP-EGFP-191TAG-Histag were co-transfected into HEK 293T cells;

   S24: GFP fluorescence and Western-blotting measure the efficiency of the chimeric system in mammalian cells.
10. As claimed in claim 3, a chimeric design method to construct an orthogonal aminoacyl-tRNA synthetase/tRNA system, characterized in that the chimeric tRNA receptor arm region library screening system in S5 specifically includes:

    S25: Construct a chimeric tRNA library and clone it into the pNEG vector;

    S26: Preparation of DH10B competent cells containing chimeric aminoacyl-tRNA synthetase plasmid;

    S27: Electrotransform the library into the prepared competent cells, and coat a plate containing arabinose;

    S28: Screen the clones with fluorescence;

    S29: Confirmation of the orthogonality of chimeric tRNA;

    S30: Chimeric tRNA sequencing.

Images