CN111304234A - Unnatural amino acid utilization tool suitable for bacillus subtilis - Google Patents
Unnatural amino acid utilization tool suitable for bacillus subtilis Download PDFInfo
- Publication number
- CN111304234A CN111304234A CN202010124554.8A CN202010124554A CN111304234A CN 111304234 A CN111304234 A CN 111304234A CN 202010124554 A CN202010124554 A CN 202010124554A CN 111304234 A CN111304234 A CN 111304234A
- Authority
- CN
- China
- Prior art keywords
- amino acid
- unnatural amino
- expression
- bacillus subtilis
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses an unnatural amino acid utilization tool suitable for bacillus subtilis, and belongs to the field of genetic engineering. The invention uses Bacillus subtilis as an expression host, and enables the Bacillus subtilis to utilize a non-natural amino acid translation termination codon TAG by expressing specific tRNA and corresponding aminoacyltRNA synthetase for specifically recognizing the non-natural amino acid in cells. Meanwhile, a strict protein expression switch is formed in the bacillus subtilis by regulating the concentration of the unnatural amino acid, so that the effect of directionally regulating and controlling the expression strength of genes or the expression quantity of proteins is achieved. The invention lays a foundation for the application of expressing high-activity enzyme with unnatural amino acid by bacillus subtilis, reducing the escape probability of engineering bacteria and the like.
Description
Technical Field
The invention relates to an unnatural amino acid utilization tool suitable for bacillus subtilis, and belongs to the field of enzyme engineering and the field of genetic engineering.
Background
Bacillus subtilis (Bacillus subtilis) is used as a model microorganism of gram-positive bacteria, is used for laboratory research on sporulation mechanism and metabolic regulation, and is widely distributed in the nature including soil surface, water environment and animal stomach. It is a non-pathogenic microorganism, free of endotoxins, and generally recognized by the U.S. Food and Drug Administration (FDA) as a safe (GRAS) food grade microorganism. In addition, Bacillus subtilis has a number of advantages, including: the cell growth is fast, the culture time is short, the culture requirement is low, the protein secretion capacity is strong, and the method is widely applied to industrial enzyme production and biosynthesis of products with high added value. However, research on the use of unnatural amino acids remains behind for other important model organisms, such as Escherichia coli (Escherichia coli) and Saccharomyces cerevisiae (Saccharomyces cerevisiae).
Unnatural amino acids are widely applied in various important fields at present, such as improvement of enzyme activity, synthesis of unnatural proteins, use as protein expression switches and the like, however, most of previous researches are carried out in escherichia coli, and no related researches are carried out at present for realizing utilization of unnatural amino acids by bacillus subtilis. The unnatural amino acid system has great application potential in the aspects of constructing a strict protein switch, controlling protein expression quantity, preventing escape of engineering organisms and the like, so that the development of an effective unnatural amino acid utilization system in bacillus subtilis is one of the problems to be solved urgently in order to lay a foundation for the development of the fields of enzyme engineering, metabolic engineering and the like.
Disclosure of Invention
The technical problem to be solved by the invention is to provide a tool for utilizing unnatural amino acids suitable for bacillus subtilis, which is characterized in that after related genes for utilizing the unnatural amino acids are introduced into the bacillus subtilis, the bacillus subtilis can utilize specific unnatural amino acids to code a stop codon TAG, and the purpose of regulating and controlling the expression strength of the genes or the expression quantity of proteins is achieved.
It is a first object of the invention to provide an expression vector based on the regulation of an unnatural amino acid, comprising a sequence encoding a tRNA and an aminoacyltRNA synthetase gene that specifically recognizes an unnatural amino acid.
In one embodiment, the aminoacyl tRNA synthetase sequence is as set forth in SEQ ID NO. 1.
In one embodiment, the gene sequence encoding the aminoacyl tRNA synthetase is shown in SEQ ID NO.2, and the amino acid sequence of the tRNA is shown in SEQ ID NO. 3.
In one embodiment, the expression vector contains one or more sequences encoding a tRNA.
In one embodiment, the expression vector contains P43The promoter was associated with 3 copies of tRNA.
In one embodiment, the expression vector comprises the sequence shown in SEQ ID NO. 4.
The second purpose of the invention is to provide an expression system, which contains the expression vector based on the unnatural amino acid regulation and a vector or a host cell for expressing a target gene.
In one embodiment, the host cell integrates the gene of interest on the genome and inserts the stop codon TAG at a third codon after the ATG of the gene of interest.
In one embodiment, the vector for expressing the target gene is obtained by ligating the target gene to a plasmid and inserting a stop codon TAG at a third codon after ATG of the target gene.
It is a third object of the invention to provide a cell based on unnatural amino acid regulation comprising said expression vector.
In one embodiment, the cell is a bacterial or fungal cell.
In one embodiment, the cell is a recombinant bacillus subtilis.
The fourth purpose of the invention is to provide a method for constructing the expression vector, which takes pHT01 as the expression vector, expresses the aminoacyl tRNA synthetase and corresponding tRNA in bacillus subtilis, and takes pP43NMK as the expression vector to express the target gene.
In one embodiment, the Bacillus subtilis is Bacillus subtilis 168.
In one embodiment, one or more copies of tRNA are linked to the pHT 01.
In one embodiment, 3 copies of tRNA are ligated to the pHT 01.
The fifth purpose of the invention is to provide the application of the expression vector or the recombinant bacillus subtilis in regulating the expression of target protein by unnatural amino acid.
In one embodiment, the use is in the regulation of expression of a protein of interest during fermentation of recombinant Bacillus subtilis using different concentrations of unnatural amino acids.
In one embodiment, the different concentrations of the unnatural amino acid refer to concentrations of 0.001 to 3 mmol/L.
In one embodiment, the unnatural amino acids include, but are not limited to: o-methyl-tyrosine.
In one embodiment, the protein of interest includes, but is not limited to, green fluorescent protein GFP.
In one embodiment, the gene encoding the protein of interest has a stop codon TAG inserted at the third codon.
The invention also claims the expression vector based on the non-natural amino acid regulation, or the expression system based on the non-natural amino acid regulation, or the application of the cell in the fields of food and biology.
Has the advantages that: the invention provides an effect of directionally regulating and controlling the expression intensity of genes or the expression quantity of proteins by introducing unnatural amino acid utilization genes and optimizing the copy numbers of promoters and tRNA. Through fluorescent protein verification, the expression level of GFP can be controlled to be between 2500 and 44428, and the expression of GFP is related to the unnatural amino acid, so that the recombinant bacterium has the highest expression intensity under the condition of 3mM of the unnatural amino acid content and has the lowest expression intensity under the condition of not adding the unnatural amino acid. The effect of the expression vector and the expression system is also verified in the aspect of expressing functional genes, and the expression vector and the expression system have important application prospects.
Drawings
FIG. 1 shows the expression level of GFP after addition of various concentrations of unnatural amino acids.
FIG. 2 shows the growth of cells after addition of unnatural amino acids at various concentrations.
Detailed Description
GenBank accession number of Green Fluorescent Protein (GFP) is AF 324408.1.
Culturing and fermenting recombinant bacillus subtilis seeds: medium (g/L): tryptone 10, yeast powder 5 and NaCl 10.
The method for measuring the expression level of the green fluorescent protein comprises the following steps: to each well of a 96-well plate, 200. mu.L of the diluted fermentation broth was added, and the mixture was subjected to a Cytation3 cell imaging microplate detector (Berton instruments, Inc., USA) under an excitation wavelength: 488nm, emission wavelength: 523nm, gain: 60.
EXAMPLE 1 construction of recombinant plasmid
The construction method comprises the following steps:
(1) a DNA sequence encoding aminoacyl tRNA synthetase shown in SEQ ID NO.2 was synthesized, and using it as a template, a primer rh 1-tyrrs-F: 5'-aggaatgtacacATGGATGAATTTGAAATGATTAAACGCAATACCAG-3' and primer rh 1-tyrrs-R: 5'-ctttccataatTTACAGACGTTTACGGATCGGCTC-3' the fusion fragment 1 was amplified.
(2) The tRNA expression cassette (shown in SEQ ID NO. 6) was synthesized and used as a template with the primers rh 2-mutRNA-F: 5'-GTAAACGTCTGTAAattatggaaaggcgtgcctgac-3' and primer rh 2-mutRNA-R: 5'-CGTCGACTCTAGAGTAAGTGGGCAGTTTGTGGGCA-3' the fusion fragment 2 was amplified.
(3) At pHT01-P43Vector, using primer fx-pHT-F: 5'-CTGCCCACTTACTCTAGAGTCGACGtccccgg-3' and primer fx-pHT-R: 5'-CAAATTCATCCATgtgtacattcctctcttacCTATAATGGTACCGC-3' A vector fragment was amplified.
Finally, Gibbson assembly is used for assembling and constructing a whole plasmid, and pHT01-ncaas (shown as SEQ ID NO. 4) is obtained by sequencing.
Example 2 construction of genetically engineered bacteria for recombinant expression of GFP
The GFP gene is connected with a vector pP43NMK, and a TAG is inserted at a third codon behind an initiation codon ATG to construct and obtain a recombinant plasmid pP43NMK-3TAGFP shown in SEQ ID NO. 5.
The recombinant plasmid pP43NMK-3TAGFP was co-transformed with pHT01-ncaas constructed in example 1 into Bacillus subtilis 168 cells to obtain recombinant Bacillus subtilis expressing GFP protein.
Example 3 expression levels of GFP following addition of different concentrations of unnatural amino acids
The recombinant bacillus subtilis constructed in example 2 is cultured in a 96-well deep-well plate at 37 ℃ and 750rpm for 10h to obtain a seed solution, then the seed solution is transferred into 190 mul LB medium containing O-methyl-tyrosine with different concentrations by an inoculation amount of 5 percent, the final concentration of the unnatural amino acid in different wells is 0.001 mM-3 mM, six parallel controls are set for each concentration, and the culture is carried out for 45h at 37 ℃ and 750 rpm. Under the same conditions, the fluorescence intensity measured in the final fermentation broth of the control group without adding the unnatural amino acid is about 2500; and after adding 0.001, 0.005, 0.01, 0.05, 0.25, 0.5, 0.75, 1, 1.5, 2, 3mM unnatural amino acid, the average values of the fluorescence intensities were found to be 2518, 3061, 3754, 9226, 22708, 37983, 40332, 41420, 44156, 44385, 44428, respectively.
Table 1 data records of GFP expression levels after addition of different concentrations of unnatural amino acids.
Example 4
The embodiment is the same as that of example 2, except that the GFP gene was replaced with a gene essential for growth on the Bacillus subtilis genome: after murB (SEQ ID NO.7) is cultured for 15 hours under the fermentation condition, the result shows that the OD600 of the bacteria of the recombinant bacteria which adopts the expression system of the invention to express the murB gene under the environment containing different concentrations of unnatural amino acid increases along with the increase of the concentration of the unnatural amino acid.
Table 2 shows the growth of cells after addition of unnatural amino acids at various concentrations.
Comparative example 1
Seeds cultured in a 96-well deep-well plate at 37 ℃ and 750rpm for 10 hours were transferred to 190. mu.L of LB medium at an inoculum size of 5%, and six parallel controls were set without adding unnatural amino acids to the wells, and cultured at 37 ℃ and 750rpm for 45 hours. The fluorescence intensity measured in the final fermentation broth of the control without the addition of unnatural amino acid was about 2500.
Comparative example 2:
the difference from example 1 is that, without optimization of the promoter, the Bacillus subtilis primitive aminoacyltRNA promoter PtyrS was used to express aminoacyltRNA synthetase, and the recombinant strain had a fluorescence intensity of only 5800 after culturing in 1mM unnatural amino acid medium for the same time.
Comparative example 3:
the difference from example 1 is that the copy number of aminoacyl tRNA is adjusted to 1, 2, and the fluorescence intensity of the aminoacyl tRNA after culturing the aminoacyl tRNA in 1mM unnatural amino acid medium for the same time is 23347, 39749, respectively.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of south of the Yangtze river
<120> an unnatural amino acid utilization tool suitable for Bacillus subtilis
<160>7
<170>PatentIn version 3.3
<210>1
<211>306
<212>PRT
<213> Artificial sequence
<400>1
Met Asp Glu Phe Glu Met Ile Lys Arg Asn Thr Ser Glu Ile Ile Ser
1 5 10 15
Glu Glu Glu Leu Arg Glu Val Leu Lys Lys Asp Glu Lys Ser Ala Gln
20 25 30
Ile Gly Phe Glu Pro Ser Gly Lys Ile His Leu Gly His Tyr Leu Gln
35 40 45
Ile Lys Lys Met Ile Asp Leu Gln Asn Ala Gly Phe Asp Ile Ile Ile
50 55 60
Leu Leu Ala Asp Leu His Ala Tyr Leu Asn Gln Lys Gly Glu Leu Asp
65 70 75 80
Glu Ile Arg Lys Ile Gly Asp Tyr Asn Lys Lys Val Phe Glu Ala Met
85 90 95
Gly Leu Lys Ala Lys Tyr Val Tyr Gly Ser Thr Phe Gln Leu Asp Lys
100 105 110
Asp Tyr Thr Leu Asn Val Tyr Arg Leu Ala Leu Lys Thr Thr Leu Lys
115 120 125
Arg Ala Arg Arg Ser Met Glu Leu Ile Ala Arg Glu Asp Glu Asn Pro
130 135 140
Lys Val Ala Glu Val Ile Tyr Pro Ile Met Gln Val Asn Ala Ile His
145 150 155 160
Tyr Pro Gly Val Asp Val Ala Val Gly Gly Met Glu Gln Arg Lys Ile
165 170 175
His Met Leu Ala Arg Glu Leu Leu Pro Lys Lys Val Val Cys Ile His
180 185 190
Asn Pro Val Leu Thr Gly Leu Asp Gly Glu Gly Lys Met Ser Ser Ser
195 200 205
Lys Gly Asn Phe Ile Ala Val Asp Asp Ser Pro Glu Glu Ile Arg Ala
210 215 220
Lys Ile Lys Lys Ala Tyr Cys Pro Ala Gly Val Val Glu Gly Asn Pro
225 230 235 240
Ile Met Glu Ile Ala Lys Tyr Phe Leu Glu Tyr Pro Leu Thr Ile Lys
245 250 255
Arg Pro Glu Lys Phe Gly Gly Asp Leu Thr Val Asn Ser Tyr Glu Glu
260 265 270
Leu Glu Ser Leu Phe Lys Asn Lys Glu Leu His Pro Met Asp Leu Lys
275 280 285
Asn Ala Val Ala Glu Glu Leu Ile Lys Ile Leu Glu Pro Ile Arg Lys
290 295 300
Arg Leu
305
<210>2
<211>921
<212>DNA
<213> Artificial sequence
<400>2
atggatgaat ttgaaatgat taaacgcaat accagtgaaa tcattagcga ggaagagctg 60
cgcgaggtgc tgaagaagga tgagaaaagc gcccagattg gcttcgagcc gagcggtaaa 120
attcatttag gccattattt acaaattaag aaaatgattg atttacagaa tgccggcttt 180
gacatcatca ttttactggc cgatctgcat gcatatttaa accagaaagg cgagctggat 240
gaaattcgca aaatcggcga ctataacaaa aaggtgttcg aagccatggg tttaaaagcc 300
aagtacgtgt acggcagtac cttccagctg gacaaggatt acactttaaa cgtgtatcgt 360
ttagctttaa aaacaacttt aaaacgtgcc cgccgcagca tggaattaat tgcccgcgaa 420
gacgagaacc cgaaggtggc cgaggtgatt tatccgatca tgcaagtgaa cgccatccat 480
tacccgggtg tggatgttgc cgttggcggc atggaacagc gcaagattca tatgctggcc 540
cgtgaactgc tgccgaagaa ggtggtgtgc attcataacc cggtgctgac cggtttagat 600
ggcgaaggca aaatgagcag cagcaagggt aacttcatcg ccgtggacga cagtccggag 660
gagatccgcg ccaagatcaa aaaagcctac tgtccggccg gtgtggtgga aggcaacccg 720
atcatggaaa ttgccaaata ttttctggag tatcctctga ccatcaaacg cccggaaaag 780
tttggtggcg atttaaccgt gaacagctat gaagaactgg aaagtctgtt caaaaataaa 840
gaactgcatc cgatggatct gaaaaacgcc gttgccgagg aactgatcaa gattttagag 900
ccgatccgta aacgtctgta a 921
<210>3
<211>77
<212>DNA
<213> Artificial sequence
<400>3
ccggcggtag ttcagcaggg cagaacggcg gactctaaat ccgcatggcg ctggttcaaa 60
tccggcccgc cggacca 77
<210>4
<211>8480
<212>DNA
<213> Artificial sequence
<400>4
ttaagttatt ggtatgactg gttttaagcg caaaaaaagt tgctttttcg tacctattaa 60
tgtatcgttt tagaaaaccg actgtaaaaa gtacagtcgg cattatctca tattataaaa 120
gccagtcatt aggcctatct gacaattcct gaatagagtt cataaacaat cctgcatgat 180
aaccatcaca aacagaatga tgtacctgta aagatagcgg taaatatatt gaattacctt 240
tattaatgaa ttttcctgct gtaataatgg gtagaaggta attactatta ttattgatat 300
ttaagttaaa cccagtaaat gaagtccatg gaataataga aagagaaaaa gcattttcag 360
gtataggtgt tttgggaaac aatttccccg aaccattata tttctctaca tcagaaaggt 420
ataaatcata aaactctttg aagtcattct ttacaggagt ccaaatacca gagaatgttt 480
tagatacacc atcaaaaatt gtataaagtg gctctaactt atcccaataa cctaactctc 540
cgtcgctatt gtaaccagtt ctaaaagctg tatttgagtt tatcaccctt gtcactaaga 600
aaataaatgc agggtaaaat ttatatcctt cttgttttat gtttcggtat aaaacactaa 660
tatcaatttc tgtggttata ctaaaagtcg tttgttggtt caaataatga ttaaatatct 720
cttttctctt ccaattgtct aaatcaattt tattctaaaa ctagttcatt tgatatgcct 780
cctaaatttt tatctaaagt gaatttagga ggcttacttg tctgctttct tcattagaat 840
caatcctttt ttaaaagtca atattactgt aacataaata tatattttaa aaatatccca 900
ctttatccaa ttttcgtttg ttgaactaat gggtgcttta gttgaagaat aaaagaccac 960
attaaaaaat gtggtctttt gtgttttttt aaaggatttg agcgtagcga aaaatccttt 1020
tctttcttat cttgataata agggtaacta ttgccgatcg tccattccga cagcatcgcc 1080
agtcactatg gcgtgctgct agcgccattc gccattcagg ctgcgcaact gttgggaagg 1140
gcgatcggtg cgggcctctt cgctattacg ccagctggcg aaagggggat gtgctgcaag 1200
gcgattaagt tgggtaacgc cagggttttc ccagtcacga cgttgtaaaa cgacggccag 1260
tgaattcgag ctctgatagg tggtatgttt tcgcttgaac ttttaaatac agccattgaa 1320
catacggttg atttaataac tgacaaacat caccctcttg ctaaagcggc caaggacgcc 1380
gccgccgggg ctgtttgcgt tcttgccgtg atttcgtgta ccattggttt acttattttt 1440
ttgccaaggc tgtaatggct gaaaattctt acatttattt tacattttta gaaatgggcg 1500
tgaaaaaaag cgcgcgatta tgtaaaatat aaagtgatag cggtaccatt ataggtaaga 1560
gaggaatgta cacatggatg aatttgaaat gattaaacgc aataccagtg aaatcattag 1620
cgaggaagag ctgcgcgagg tgctgaagaa ggatgagaaa agcgcccaga ttggcttcga 1680
gccgagcggt aaaattcatt taggccatta tttacaaatt aagaaaatga ttgatttaca 1740
gaatgccggc tttgacatca tcattttact ggccgatctg catgcatatt taaaccagaa 1800
aggcgagctg gatgaaattc gcaaaatcgg cgactataac aaaaaggtgt tcgaagccat 1860
gggtttaaaa gccaagtacg tgtacggcag taccttccag ctggacaagg attacacttt 1920
aaacgtgtat cgtttagctt taaaaacaac tttaaaacgt gcccgccgca gcatggaatt 1980
aattgcccgc gaagacgaga acccgaaggt ggccgaggtg atttatccga tcatgcaagt 2040
gaacgccatc cattacccgg gtgtggatgt tgccgttggc ggcatggaac agcgcaagat 2100
tcatatgctg gcccgtgaac tgctgccgaa gaaggtggtg tgcattcata acccggtgct 2160
gaccggttta gatggcgaag gcaaaatgag cagcagcaag ggtaacttca tcgccgtgga 2220
cgacagtccg gaggagatcc gcgccaagat caaaaaagcc tactgtccgg ccggtgtggt 2280
ggaaggcaac ccgatcatgg aaattgccaa atattttctg gagtatcctc tgaccatcaa 2340
acgcccggaa aagtttggtg gcgatttaac cgtgaacagc tatgaagaac tggaaagtct 2400
gttcaaaaat aaagaactgc atccgatgga tctgaaaaac gccgttgccg aggaactgat 2460
caagatttta gagccgatcc gtaaacgtct gtaaattatg gaaaggcgtg cctgacaagg 2520
tgcgcctttt tgcttatgta aacacggcat tttcataaaa acaaaaaaag tttttaaaaa 2580
tgcttgacca cacgagaaca tacgtgatat agttagtctt gtcgataccc ggcggtagtt 2640
cagcagggca gaacggcgga ctctaaatcc gcatggcgct ggttcaaatc cggcccgccg 2700
gaccatattg attttaattc taatgaaaca caagcgccac ttctatttgt tcgtgaccat 2760
attgatttta attctaatga aacacaagcg ccacttctat ttgttcgtga tattataaat 2820
ctcgttgtta cggaaactgc ttcaatagag tacaagatga gaactagatt taagtcgttt 2880
gctctataga aattccgaca tctttaaccg gcggtagttc agcagggcag aacggcggac 2940
tctaaatccg catggcgctg gttcaaatcc ggcccgcgga ccatttcgtg aaccggcggt 3000
agttcagcag ggcagaacgg cggactctaa atccgcatgg cgctggttca aatccggccc 3060
gccggaccat ttcgtgaacc ggcggtagtt cagcagggca gaacggcgga ctctaaatcc 3120
gcatggcgct ggttcaaatc cggcccgcgg accatttcgt gaaccggcgg tagttcagca 3180
gggcagaacg gcggactcta aatccgcatg gcgctggttc aaatccggcc cgccggacca 3240
tttgtctttt tatgatacca agggttttga cacccttggt atttttttgt gtttattttc 3300
aaatgattta ctgcccacaa actgcccact tactctagag tcgacgtccc cggggcagcc 3360
cgcctaatga gcgggctttt ttcacgtcac gcgtccatgg agatctttgt ctgcaactga 3420
aaagtttata ccttacctgg aacaaatggt tgaaacatac gaggctaata tcggcttatt 3480
aggaatagtc cctgtactaa taaaatcagg tggatcagtt gatcagtata ttttggacga 3540
agctcggaaa gaatttggag atgacttgct taattccaca attaaattaa gggaaagaat 3600
aaagcgattt gatgttcaag gaatcacgga agaagatact catgataaag aagctctaaa 3660
actattcaat aaccttacaa tggaattgat cgaaagggtg gaaggttaat ggtacgaaaa 3720
ttaggggatc tacctagaaa gccacaaggc gataggtcaa gcttaaagaa cccttacatg 3780
gatcttacag attctgaaag taaagaaaca acagaggtta aacaaacaga accaaaaaga 3840
aaaaaagcat tgttgaaaac aatgaaagtt gatgtttcaa tccataataa gattaaatcg 3900
ctgcacgaaa ttctggcagc atccgaaggg aattcatatt acttagagga tactattgag 3960
agagctattg ataagatggt tgagacatta cctgagagcc aaaaaacttt ttatgaatat 4020
gaattaaaaa aaagaaccaa caaaggctga gacagactcc aaacgagtct gtttttttaa 4080
aaaaaatatt aggagcattg aatatatatt agagaattaa gaaagacatg ggaataaaaa 4140
tattttaaat ccagtaaaaa tatgataaga ttatttcaga atatgaagaa ctctgtttgt 4200
ttttgatgaa aaaacaaaca aaaaaaatcc acctaacgga atctcaattt aactaacagc 4260
ggccaaactg agaagttaaa tttgagaagg ggaaaaggcg gatttatact tgtatttaac 4320
tatctccatt ttaacatttt attaaacccc atacaagtga aaatcctctt ttacactgtt 4380
cctttaggtg atcgcggagg gacattatga gtgaagtaaa cctaaaagga aatacagatg 4440
aattagtgta ttatcgacag caaaccactg gaaataaaat cgccaggaag agaatcaaaa 4500
aagggaaaga agaagtttat tatgttgctg aaacggaaga gaagatatgg acagaagagc 4560
aaataaaaaa cttttcttta gacaaatttg gtacgcatat accttacata gaaggtcatt 4620
atacaatctt aaataattac ttctttgatt tttggggcta ttttttaggt gctgaaggaa 4680
ttgcgctcta tgctcaccta actcgttatg catacggcag caaagacttt tgctttccta 4740
gtctacaaac aatcgctaaa aaaatggaca agactcctgt tacagttaga ggctacttga 4800
aactgcttga aaggtacggt tttatttgga aggtaaacgt ccgtaataaa accaaggata 4860
acacagagga atccccgatt tttaagatta gacgtaaggt tcctttgctt tcagaagaac 4920
ttttaaatgg aaaccctaat attgaaattc cagatgacga ggaagcacat gtaaagaagg 4980
ctttaaaaaa ggaaaaagag ggtcttccaa aggttttgaa aaaagagcac gatgaatttg 5040
ttaaaaaaat gatggatgag tcagaaacaa ttaatattcc agaggcctta caatatgaca 5100
caatgtatga agatatactc agtaaaggag aaattcgaaa agaaatcaaa aaacaaatac 5160
ctaatcctac aacatctttt gagagtatat caatgacaac tgaagaggaa aaagtcgaca 5220
gtactttaaa aagcgaaatg caaaatcgtg tctctaagcc ttcttttgat acctggttta 5280
aaaacactaa gatcaaaatt gaaaataaaa attgtttatt acttgtaccg agtgaatttg 5340
catttgaatg gattaagaaa agatatttag aaacaattaa aacagtcctt gaagaagctg 5400
gatatgtttt cgaaaaaatc gaactaagaa aagtgcaata aactgctgaa gtatttcagc 5460
agtttttttt atttagaaat agtgaaaaaa atataatcag ggaggtatca atatttaatg 5520
agtactgatt taaatttatt tagactggaa ttaataatta acacgtagac taattaaaat 5580
ttaatgaggg ataaagagga tacaaaaata ttaatttcaa tccctattaa attttaacaa 5640
gggggggatt aaaatttaat tagaggttta tccacaagaa aagaccctaa taaaattttt 5700
actagggtta taacactgat taatttctta atgggggagg gattaaaatt taatgacaaa 5760
gaaaacaatc ttttaagaaa agcttttaaa agataataat aaaaagagct ttgcgattaa 5820
gcaaaactct ttactttttc attgacatta tcaaattcat cgatttcaaa ttgttgttgt 5880
atcataaagt taattctgtt ttgcacaacc ttttcaggaa tataaaacac atctgaggct 5940
tgttttataa actcagggtc gctaaagtca atgtaacgta gcatatgata tggtatagct 6000
tccacccaag ttagcctttc tgcttcttct gaatgttttt catatacttc catgggtatc 6060
tctaaatgat tttcctcatg tagcaaggta tgagcaaaaa gtttatggaa ttgatagttc 6120
ctctcttttt cttcaacttt tttatctaaa acaaacactt taacatctga gtcaatgtaa 6180
gcataagatg tttttccagt cataatttca atcccaaatc ttttagacag aaattctgga 6240
cgtaaatctt ttggtgaaag aattttttta tgtagcaata tatccgatac agcaccttct 6300
aaaagcgttg gtgaataggg cattttacct atctcctctc attttgtgga ataaaaatag 6360
tcatattcgt ccatctacct atcctattat cgaacagttg aactttttaa tcaaggatca 6420
gtcctttttt tcattattct taaactgtgc tcttaacttt aacaactcga tttgtttttc 6480
cagatctcga gggtaactag cctcgccgat cccgcaagag gcccggcagt caggtggcac 6540
ttttcgggga aatgtgcgcg gaacccctat ttgtttattt ttctaaatac attcaaatat 6600
gtatccgctc atgagacaat aaccctgata aatgcttcaa taatattgaa aaaggaagag 6660
tatgagtatt caacatttcc gtgtcgccct tattcccttt tttgcggcat tttgccttcc 6720
tgtttttgct cacccagaaa cgctggtgaa agtaaaagat gctgaagatc agttgggtgc 6780
acgagtgggt tacatcgaac tggatctcaa cagcggtaag atccttgaga gttttcgccc 6840
cgaagaacgt tttccaatga tgagcacttt taaagttctg ctatgtggcg cggtattatc 6900
ccgtattgac gccgggcaag agcaactcgg tcgccgcata cactattctc agaatgactt 6960
ggttgagtac tcaccagtca cagaaaagca tcttacggat ggcatgacag taagagaatt 7020
atgcagtgct gccataacca tgagtgataa cactgcggcc aacttacttc tgacaacgat 7080
cggaggaccg aaggagctaa ccgctttttt gcacaacatg ggggatcatg taactcgcct 7140
tgatcgttgg gaaccggagc tgaatgaagc cataccaaac gacgagcgtg acaccacgat 7200
gcctgtagca atggcaacaa cgttgcgcaa actattaact ggcgaactac ttactctagc 7260
ttcccggcaa caattaatag actggatgga ggcggataaa gttgcaggac cacttctgcg 7320
ctcggccctt ccggctggct ggtttattgc tgataaatct ggagccggtg agcgtgggtc 7380
tcgcggtatc attgcagcac tggggccaga tggtaagccc tcccgtatcg tagttatcta 7440
cacgacgggg agtcaggcaa ctatggatga acgaaataga cagatcgctg agataggtgc 7500
ctcactgatt aagcattggt aactgtcaga ccaagtttac tcatatatac tttagattga 7560
tttaaaactt catttttaat ttaaaaggat ctaggtgaag atcctttttg ataatctcat 7620
gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg tagaaaagat 7680
caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa 7740
accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc tttttccgaa 7800
ggtaactggc ttcagcagag cgcagatacc aaatactgtc cttctagtgt agccgtagtt 7860
aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc taatcctgtt 7920
accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact caagacgata 7980
gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt 8040
ggagcgaacg acctacaccg aactgagata cctacagcgt gagctatgag aaagcgccac 8100
gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg gaacaggaga 8160
gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg 8220
ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga gcctatggaa 8280
aaacgccagc aacgcggcct ttttacggtt cctggccttt tgctggcctt ttgctcacat 8340
gttctttcct gcgttatccc ctgattctgt ggataaccgt attaccgcct ttgagtgagc 8400
tgataccgct cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg aggaagcgga 8460
agagcgccca atacgcatgc 8480
<210>5
<211>7464
<212>DNA
<213> Artificial sequence
<400>5
tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60
cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120
ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180
accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240
attcgccattcaggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300
tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360
tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt ccttaaggaa cgtacagacg 420
gcttaaaagc ctttaaaaac gtttttaagg ggtttgtaga caaggtaaag gataaaacag 480
cacaattcca agaaaaacac gatttagaac ctaaaaagaa cgaatttgaa ctaactcata 540
accgagaggt aaaaaaagaa cgaagtcgag atcagggaat gagtttataa aataaaaaaa 600
gcacctgaaa aggtgtcttt ttttgatggt tttgaacttg ttctttctta tcttgataca 660
tatagaaata acgtcatttt tattttagtt gctgaaaggt gcgttgaagt gttggtatgt 720
atgtgtttta aagtattgaa aacccttaaa attggttgca cagaaaaacc ccatctgtta 780
aagttataag tgactaaaca aataactaaa tagatggggg tttcttttaa tattatgtgt 840
cctaatagta gcatttattc agatgaaaaa tcaagggttt tagtggacaa gacaaaaagt 900
ggaaaagtga gaccatggag agaaaagaaa atcgctaatg ttgattactt tgaacttctg 960
catattcttg aatttaaaaa ggctgaaaga gtaaaagatt gtgctgaaat attagagtat 1020
aaacaaaatc gtgaaacagg cgaaagaaag ttgtatcgag tgtggttttg taaatccagg 1080
ctttgtccaa tgtgcaactg gaggagagca atgaaacatg gcattcagtc acaaaaggtt 1140
gttgctgaag ttattaaaca aaagccaaca gttcgttggt tgtttctcac attaacagtt 1200
aaaaatgttt atgatggcga agaattaaat aagagtttgt cagatatggc tcaaggattt 1260
cgccgaatga tgcaatataa aaaaattaat aaaaatcttg ttggttttat gcgtgcaacg 1320
gaagtgacaa taaataataa agataattct tataatcagc acatgcatgt attggtatgt 1380
gtggaaccaa cttattttaa gaatacagaa aactacgtga atcaaaaaca atggattcaa 1440
ttttggaaaa aggcaatgaa attagactat gatccaaatg taaaagttca aatgattcga 1500
ccgaaaaata aatataaatc ggatatacaa tcggcaattg acgaaactgc aaaatatcct 1560
gtaaaggata cggattttat gaccgatgat gaagaaaaga atttgaaacg tttgtctgat 1620
ttggaggaag gtttacaccg taaaaggtta atctcctatg gtggtttgtt aaaagaaata 1680
cataaaaaat taaaccttga tgacacagaa gaaggcgatt tgattcatac agatgatgac 1740
gaaaaagccg atgaagatgg attttctatt attgcaatgt ggaattggga acggaaaaat 1800
tattttatta aagagtagtt caacaaacgg gccagtttgt tgaagattag atgctataat 1860
tgttattaaa aggattgaag gatgcttagg aagacgagtt attaatagct gaataagaac 1920
ggtgctctcc aaatattctt atttagaaaa gcaaatctaa aattatctga aaagggaatg 1980
agaatagtga atggaccaat aataatgact agagaagaaa gaatgaagat tgttcatgaa 2040
attaaggaac gaatattgga taaatatggg gatgatgtta aggctattgg tgtttatggc 2100
tctcttggtc gtcagactga tgggccctat tcggatattg agatgatgtg tgtcatgtca 2160
acagaggaag cagagttcag ccatgaatgg acaaccggtg agtggaaggt ggaagtgaat 2220
tttgatagcg aagagattct actagattat gcatctcagg tggaatcaga ttggccgctt 2280
acacatggtc aatttttctc tattttgccg atttatgatt caggtggata cttagagaaa 2340
gtgtatcaaa ctgctaaatc ggtagaagcc caaacgttcc acgatgcgat ttgtgccctt 2400
atcgtagaag agctgtttga atatgcaggc aaatggcgta atattcgtgt gcaaggaccg 2460
acaacatttc taccatcctt gactgtacag gtagcaatgg caggtgccat gttgattggt 2520
ctgcatcatc gcatctgtta tacgacgagc gcttcggtct taactgaagc agttaagcaa 2580
tcagatcttc cttcaggtta tgaccatctg tgccagttcg taatgtctgg tcaactttcc 2640
gactctgaga aacttctgga atcgctagag aatttctgga atgggattca ggagtggaca 2700
gaacgacacg gatatatagt ggatgtgtca aaacgcatac cattttgaac gatgacctct 2760
aataattgtt aatcatgttg gttacgtatt tattaacttc tcctagtatt agtaattatc 2820
atggctgtca tggcgcatta acggaataaa gggtgtgctt aaatcgggcc attttgcgta 2880
ataagaaaaa ggattaatta tgagcgaatt gaattaataa taaggtaata gatttacatt 2940
agaaaatgaa aggggatttt atgcgtgaga atgttacagt ctatcccggc attgccagtc 3000
ggggatatta aaaagagtat aggtttttat tgggataaag taggtttcac tttggttcac 3060
catgaagatg gattcgcagt tctaatgtgt aatgaggttc ggattcatct atgggaggca 3120
agtgatgaag gctggcgcct cgtagtaatg attcaccggt ttgtacaggt gcggagtcgt 3180
ttattgctgg tactgctagt tgccgcattg aagtagaggg aattgatgaa ttatatcaac 3240
atattaagcc tttgggcatt ttgcacccca atacatcatt aaaagatcag tggtgggatg 3300
aacgagactt tgcagtaatt gatcccgaca acaatttgat tagctttttt caacaaataa 3360
aaagctaaaa tctattatta atctgttcag caatcgggcg cgattgctga ataaaagata 3420
cgagagacct ctcttgtatc ttttttattt tgagtggttt tgtccgttac actagaaaac 3480
cgaaagacaa taaaaatttt attcttgctg agtctggctt tcggtaagct agacaaaacg 3540
gacaaaataa aaattggcaa gggtttaaag gtggagattt tttgagtgat cttctcaaaa 3600
aatactacct gtcccttgct gatttttaaa cgagcacgag agcaaaaccc ccctttgctg 3660
aggtggcaga gggcaggttt ttttgtttct tttttctcgt aaaaaaaaga aaggtcttaa 3720
aggttttatg gttttggtcg gcactgccgc gcctcgcaga gcacacactt tatgaatata 3780
aagtatagtg tgttatactt tacttggaag tggttgccgg aaagagcgaa aatgcctcac 3840
atttgtgcca cctaaaaagg agcgatttac atatgagtta tgcagtttgt agaatgcaaa 3900
aagtgaaatc agctggacta aaaggcatgc aatttcataa tcaaagagag cgaaaaagta 3960
gaacgaatga tgatattgac catgagcgaa cacgtgaaaa ttatgatttg aaaaatgata 4020
aaaatattga ttacaacgaa cgtgtcaaag aaattattga atcacaaaaa acaggtacaa 4080
gaaaaacgag gaaagatgct gttcttgtaa atgagttgct agtaacatct gaccgagatt 4140
tttttgagca actggatcct gataggtggt atgttttcgc ttgaactttt aaatacagcc 4200
attgaacata cggttgattt aataactgac aaacatcacc ctcttgctaa agcggccaag 4260
gacgccgccg ccggggctgt ttgcgttctt gccgtgattt cgtgtaccat tggtttactt 4320
atttttttgc caaggctgta atggctgaaa attcttacat ttattttaca tttttagaaa 4380
tgggcgtgaa aaaaagcgcg cgattatgta aaatataaag tgatagcggt accattatag 4440
gtaagagagg aatgtacaca tgaaatagat caaaaacaac caacaaaaaa atgaactgat 4500
tcaaagtaaa ggagaagaac ttttcactgg agttgtccca attcttgttg aattagatgg 4560
tgatgttaat gggcacaaat tttctgtcag tggagagggt gaaggtgatg caacatacgg 4620
aaaacttacc cttaaattta tttgcactac tggaaagctt cctgttcctt ggccaacact 4680
tgtcactact cttacttatg gtgttcaatg cttttcaaga tacccagatc atatgaagcg 4740
gcacgacttc ttcaagagcg ccatgcctga gggatacgtg caggagagga ccatcttctt 4800
caaggacgac gggaactaca agacacgtgc tgaagtcaag tttgagggag acaccctcgt 4860
caacagaatc gagcttaagg gaatcgattt caaggaggac ggaaacatcc tcggccacaa 4920
gttggaatac aactacaact cccacaacgt atacatcatg gcagacaaac aaaagaatgg 4980
aatcaaagtt aacttcaaaa ttagacacaa cattgaagat ggaagcgttc aactagcaga 5040
ccattatcaa caaaatactc caattggcga tggccctgtc cttttaccag acaaccatta 5100
cctgtccaca caatctgccc tttcgaaaga tcccaacgaa aagagagacc acatggtcct 5160
tcttgagttt gtaacagctg ctgggattac acatggcatg gatgaactat acaaataatg 5220
atgaaagctt ggcgtaatca tggtcatagc tgtttcctgt gtgaaattgt tatccgctca 5280
caattccaca caacatacga gccggaagca taaagtgtaa agcctggggt gcctaatgag 5340
tgagctaact cacattaatt gcgttgcgct cactgcccgc tttccagtcg ggaaacctgt 5400
cgtgccagct gcattaatga atcggccaac gcgcggggag aggcggtttg cgtattgggc 5460
gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg 5520
tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa 5580
agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg 5640
cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga 5700
ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg 5760
tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg 5820
gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc 5880
gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg 5940
gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca 6000
ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt 6060
ggcctaacta cggctacact agaagaacag tatttggtat ctgcgctctg ctgaagccag 6120
ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg 6180
gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc 6240
ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt 6300
tggtcatgag attatcaaaa aggatcttca cctagatcct tttaaattaa aaatgaagtt 6360
ttaaatcaat ctaaagtata tatgagtaaa cttggtctga cagttaccaa tgcttaatca 6420
gtgaggcacc tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg 6480
tcgtgtagat aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac 6540
cgcgagaccc acgctcaccg gctccagatt tatcagcaat aaaccagcca gccggaaggg 6600
ccgagcgcag aagtggtcct gcaactttat ccgcctccat ccagtctatt aattgttgcc 6660
gggaagctag agtaagtagt tcgccagtta atagtttgcg caacgttgtt gccattgcta 6720
caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc ggttcccaac 6780
gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc 6840
ctccgatcgt tgtcagaagt aagttggccg cagtgttatc actcatggtt atggcagcac 6900
tgcataattc tcttactgtc atgccatccg taagatgctt ttctgtgact ggtgagtact 6960
caaccaagtc attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa 7020
tacgggataa taccgcgcca catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt 7080
cttcggggcg aaaactctca aggatcttac cgctgttgag atccagttcg atgtaaccca 7140
ctcgtgcacc caactgatct tcagcatctt ttactttcac cagcgtttct gggtgagcaa 7200
aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa tgttgaatac 7260
tcatactctt cctttttcaa tattattgaa gcatttatca gggttattgt ctcatgagcg 7320
gatacatatt tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc acatttcccc 7380
gaaaagtgcc acctgacgtc taagaaacca ttattatcat gacattaacc tataaaaata 7440
ggcgtatcac gaggcccttt cgtc 7464
<210>6
<211>839
<212>DNA
<213> Artificial sequence
<400>6
attatggaaa ggcgtgcctg acaaggtgcg cctttttgct tatgtaaaca cggcattttc 60
ataaaaacaa aaaaagtttt taaaaatgct tgaccacacg agaacatacg tgatatagtt 120
agtcttgtcg atacccggcg gtagttcagc agggcagaac ggcggactct aaatccgcat 180
ggcgctggtt caaatccggc ccgccggacc atattgattt taattctaat gaaacacaag 240
cgccacttct atttgttcgt gaccatattg attttaattc taatgaaaca caagcgccac 300
ttctatttgt tcgtgatatt ataaatctcg ttgttacgga aactgcttca atagagtaca 360
agatgagaac tagatttaag tcgtttgctc tatagaaatt ccgacatctt taaccggcgg 420
tagttcagca gggcagaacg gcggactcta aatccgcatg gcgctggttc aaatccggcc 480
cgcggaccat ttcgtgaacc ggcggtagtt cagcagggca gaacggcgga ctctaaatcc 540
gcatggcgct ggttcaaatc cggcccgccg gaccatttcg tgaaccggcg gtagttcagc 600
agggcagaac ggcggactct aaatccgcat ggcgctggtt caaatccggc ccgcggacca 660
tttcgtgaac cggcggtagt tcagcagggc agaacggcgg actctaaatc cgcatggcgc 720
tggttcaaat ccggcccgcc ggaccatttg tctttttatg ataccaaggg ttttgacacc 780
cttggtattt ttttgtgttt attttcaaat gatttactgc ccacaaactg cccacttac 839
<210>7
<211>912
<212>DNA
<213> Artificial sequence
<400>7
atggagaaag tgatacagga attaaaagaa cgagaagtcg gcaaggttct tgcaaatgaa 60
ccgctcgcga atcatacaac gatgaaaatc ggcggacctg cggatgtatt ggtcattcca 120
agcagtgtgg atgctgttaa agacatcatg gacgtgatta aaaaatatga tgtgaagtgg 180
acagtcatcg gccgcggatc aaatcttctt gttttagatg aaggaattag aggcgtagtg 240
atcaagctgg gggcgggtct tgaccatttg gagcttgaag gggaacaagt aacagtcgga 300
ggcggttatt cggtggtccg ccttgctaca tcattgagca aaaaaggcct gtccggtttg 360
gaatttgctg ccggcattcc aggatcagtc ggcggagcgg tttatatgaa tgccggcgct 420
cacggttctg atatgagcga gatcctcgtc aaagcgcata ttttatttga agacggaacg 480
attgagtggc tgacaaatga gcagatggat ttcagctaca ggacatctgt actgcaaaag 540
aaacgcccgg gcgtttgcct tgaagctgtt ttgcagcttg agcagaagga taaggaatca 600
atcgttcagc aaatgcaaag caataaagac tatagaaaaa atacacagcc gtattcaagc 660
ccttgtgcgg gaagcatatt cagaaatccg cttccgaatc atgccgggaa ccttgtagaa 720
aaagcaggct tgaaaggata tcaaatcggc ggtgcaaaga tatcggagat gcacggaaac 780
ttcatcgtca atgcgggggg agcatcagca aaagatgtgc ttgatctcat tgaccatgtg 840
aaaaagacaa tccgtgaaaa atacgagatt gatatgcaca cagaggttga aatcatcggc 900
ggaaatcgct ga 912
Claims (10)
1. An expression vector regulated based on an unnatural amino acid, comprising a sequence encoding a tRNA and an aminoacyl-tRNA synthetase gene that specifically recognizes the unnatural amino acid; the sequence of the aminoacyl tRNA synthetase is shown as SEQ ID NO. 1; the tRNA sequence is shown in SEQ ID NO. 3.
2. The expression vector of claim 1, wherein the expression vector comprises one or more sequences encoding a tRNA.
3. An expression system based on unnatural amino acid regulation, comprising the expression vector of claim 1 or 2, and a vector or host cell for expressing a gene of interest.
4. The expression system of claim 3, wherein the host cell integrates the gene of interest into the genome and inserts the stop codon TAG at a third codon after the ATG of the gene of interest.
5. The expression system of claim 3, wherein the vector for expressing the target gene is obtained by ligating the target gene to a plasmid and inserting a termination codon TAG at a third codon after ATG of the target gene.
6. A cell comprising the expression vector of claim 1 or 2.
7. A method for constructing an expression vector according to claim 3 or 4, wherein the gene coding for aminoacyltRNA synthetase and the corresponding tRNA are ligated to vector pHT01, and the gene of interest is ligated to pP43 NMK.
8. Use of the expression vector of claim 1 or 2, or the expression system of any one of claims 3 to 5, or the cell of claim 6, for modulating the expression of a protein of interest with a non-natural amino acid.
9. The use of claim 8, wherein the use is the use of different concentrations of unnatural amino acids to modulate expression of a protein of interest during fermentation; such unnatural amino acids include, but are not limited to: o-methyl-tyrosine.
10. The use according to claim 8 or 9, wherein the different concentrations of the unnatural amino acid are concentrations of 0.001 to 3 mmol/L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010124554.8A CN111304234A (en) | 2020-02-27 | 2020-02-27 | Unnatural amino acid utilization tool suitable for bacillus subtilis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010124554.8A CN111304234A (en) | 2020-02-27 | 2020-02-27 | Unnatural amino acid utilization tool suitable for bacillus subtilis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111304234A true CN111304234A (en) | 2020-06-19 |
Family
ID=71154919
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010124554.8A Pending CN111304234A (en) | 2020-02-27 | 2020-02-27 | Unnatural amino acid utilization tool suitable for bacillus subtilis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111304234A (en) |
Citations (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060234339A1 (en) * | 2002-10-31 | 2006-10-19 | Shigeyuki Yokoyama | Method of expressing protein having unnatural amino acid integrated thereinto |
| US20080044886A1 (en) * | 2006-05-23 | 2008-02-21 | The Scripps Research Institute | Genetically encoded fluorescent coumarin amino acids |
| CN101400796A (en) * | 2006-03-09 | 2009-04-01 | 斯克利普斯研究院 | System for the expression of orthogonal translation components in eubacterial host cells |
| CN101516901A (en) * | 2006-09-21 | 2009-08-26 | 斯克利普斯研究院 | Genetically programmed expression of selectively sulfated proteins in eubacteria |
| US20090226963A1 (en) * | 2005-11-24 | 2009-09-10 | Riken | Method for production of protein having non-natural type amino acid integrated therein |
| CN104450746A (en) * | 2014-08-30 | 2015-03-25 | 武汉佰福泰制药有限公司 | Method for fixed-point introduction of non-natural amino acid to protein |
| CN105263962A (en) * | 2013-03-19 | 2016-01-20 | 北京盛诺基医药科技有限公司 | Antibodies and methods for treating estrogen receptor-associated diseases |
| CN106084017A (en) * | 2016-06-13 | 2016-11-09 | 浙江大学 | A kind of method integrating alpha-non-natural amino acid pPpa in escherichia coli aquaporin AQPZ |
| CN107177593A (en) * | 2016-03-10 | 2017-09-19 | 北京大学 | The truncated protein in Premature stop codon disease is readed over using the gene codon extension system of optimization |
| WO2018207077A1 (en) * | 2017-05-08 | 2018-11-15 | King Abdullah University Of Science And Technology | Genetically encoded biotin and biotin-analogs and use thereof |
| CN108823225A (en) * | 2018-05-31 | 2018-11-16 | 中国科学院理化技术研究所杭州研究院 | Expression system and the application of fatty acid modifying are directly realized by during protein translation |
| CN109370998A (en) * | 2018-11-30 | 2019-02-22 | 江南大学 | A kind of ω-transaminase mutant I215F that catalytic efficiency improves |
| CN110835633A (en) * | 2018-08-13 | 2020-02-25 | 北京大学 | Preparation of PTC stable cell line by using optimized gene codon expansion system and application |
| EP3696189A1 (en) * | 2019-02-14 | 2020-08-19 | European Molecular Biology Laboratory | Means and methods for preparing engineered target proteins by genetic code expansion in a target protein selective manner |
| CN112313336A (en) * | 2018-05-01 | 2021-02-02 | Ambrx公司 | Method for optimizing antibody expression |
| CN112725282A (en) * | 2016-01-27 | 2021-04-30 | 北京大学 | Construction of Stable cell lines carrying orthogonal tRNA/aminoacyltRNA synthetases |
-
2020
- 2020-02-27 CN CN202010124554.8A patent/CN111304234A/en active Pending
Patent Citations (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060234339A1 (en) * | 2002-10-31 | 2006-10-19 | Shigeyuki Yokoyama | Method of expressing protein having unnatural amino acid integrated thereinto |
| US20090226963A1 (en) * | 2005-11-24 | 2009-09-10 | Riken | Method for production of protein having non-natural type amino acid integrated therein |
| CN101400796A (en) * | 2006-03-09 | 2009-04-01 | 斯克利普斯研究院 | System for the expression of orthogonal translation components in eubacterial host cells |
| US20080044886A1 (en) * | 2006-05-23 | 2008-02-21 | The Scripps Research Institute | Genetically encoded fluorescent coumarin amino acids |
| CN101516901A (en) * | 2006-09-21 | 2009-08-26 | 斯克利普斯研究院 | Genetically programmed expression of selectively sulfated proteins in eubacteria |
| CN105263962A (en) * | 2013-03-19 | 2016-01-20 | 北京盛诺基医药科技有限公司 | Antibodies and methods for treating estrogen receptor-associated diseases |
| CN104450746A (en) * | 2014-08-30 | 2015-03-25 | 武汉佰福泰制药有限公司 | Method for fixed-point introduction of non-natural amino acid to protein |
| CN112725282A (en) * | 2016-01-27 | 2021-04-30 | 北京大学 | Construction of Stable cell lines carrying orthogonal tRNA/aminoacyltRNA synthetases |
| CN107177593A (en) * | 2016-03-10 | 2017-09-19 | 北京大学 | The truncated protein in Premature stop codon disease is readed over using the gene codon extension system of optimization |
| CN106084017A (en) * | 2016-06-13 | 2016-11-09 | 浙江大学 | A kind of method integrating alpha-non-natural amino acid pPpa in escherichia coli aquaporin AQPZ |
| WO2018207077A1 (en) * | 2017-05-08 | 2018-11-15 | King Abdullah University Of Science And Technology | Genetically encoded biotin and biotin-analogs and use thereof |
| CN112313336A (en) * | 2018-05-01 | 2021-02-02 | Ambrx公司 | Method for optimizing antibody expression |
| CN108823225A (en) * | 2018-05-31 | 2018-11-16 | 中国科学院理化技术研究所杭州研究院 | Expression system and the application of fatty acid modifying are directly realized by during protein translation |
| CN110835633A (en) * | 2018-08-13 | 2020-02-25 | 北京大学 | Preparation of PTC stable cell line by using optimized gene codon expansion system and application |
| CN109370998A (en) * | 2018-11-30 | 2019-02-22 | 江南大学 | A kind of ω-transaminase mutant I215F that catalytic efficiency improves |
| EP3696189A1 (en) * | 2019-02-14 | 2020-08-19 | European Molecular Biology Laboratory | Means and methods for preparing engineered target proteins by genetic code expansion in a target protein selective manner |
Non-Patent Citations (11)
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110527737B (en) | Positive plasmid molecule pYCID-1905 identified by transgenic rape and transformant of transgenic rape product and application thereof | |
| US5286636A (en) | DNA cloning vectors with in vivo excisable plasmids | |
| CN110878322B (en) | Double-plasmid system for Klebsiella pneumoniae gene editing | |
| CN101302520B (en) | Transgenic rice TT51-1 transformation event foreign vector integration site complete sequence and use thereof | |
| CN105368732B (en) | One plant of an industrial strain of S.cerevisiae strain for producing xylitol and construction method | |
| CN112266914B (en) | Strong constitutive promoter of bumblebee candida and application thereof | |
| CN104962576B (en) | A kind of flavobacterium columnare gene orientation knocks out plasmid and application | |
| CN110804559B (en) | Recombinant penicillium chrysogenum gene engineering bacterium and construction method and application thereof | |
| CN109517846A (en) | Method based on CRISPR/Cas9 system high flux construction cotton mutant library | |
| CN111235118B (en) | Human type 3 adenovirus replication-defective recombinant virus, construction method and application | |
| CN111304234A (en) | Unnatural amino acid utilization tool suitable for bacillus subtilis | |
| CN111378684B (en) | Application of thermally-induced gene editing system CRISPR-Cas12b in upland cotton | |
| CN107267538B (en) | A kind of construction method of plant plastid expression vector and application | |
| CN110117622B (en) | CRISPR/Cas gene editing system and preparation method and application thereof | |
| CN110452893B (en) | Construction and application of high-fidelity CRISPR/AsCpf1 mutant | |
| CN114540355A (en) | HHEX cartilage tissue specificity knockout mouse animal model and construction method thereof | |
| CN113151276A (en) | Zebra fish with IL-4 gene deletion | |
| CN112760241B (en) | Recombinant penicillium chrysogenum gene engineering bacterium and construction method and application thereof | |
| CN108148876B (en) | A kind of trichoderma harzianum gene knockout method | |
| KR102553935B1 (en) | Method for culturing a cell expressing a protein | |
| CN110331170A (en) | The gene expression element and its construction method of a kind of dual gRNA and application | |
| CN109777829A (en) | A kind of construction method of the sgRNA expression component of gene editing U6 promoter driving | |
| CN102649961B (en) | Aptamer sequence of hepatitis B virus (HBV) core antigen and application of nucleic aptamer sequence | |
| KR20100102075A (en) | A replication factor of lactic acid bacteria and vector comprising the same | |
| CN114317529B (en) | Random splicing method of oligonucleotide chains |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |