CN114317529B

CN114317529B - Random splicing method of oligonucleotide chains

Info

Publication number: CN114317529B
Application number: CN202111522088.XA
Authority: CN
Inventors: 夏朋延; 王硕; 朱芳蕊; 钱言
Original assignee: Peking University
Current assignee: Peking University
Priority date: 2021-12-13
Filing date: 2021-12-13
Publication date: 2023-12-01
Anticipated expiration: 2041-12-13
Also published as: CN114317529A

Abstract

The invention relates to the technical field of molecular biology, in particular to a random splicing method of an oligonucleotide chain. The random splicing method provided by the invention is to randomly splice any k oligonucleotide chains in n oligonucleotide chains into long-chain oligonucleotides by using magnetic beads as a carrier and adopting a primer group for randomly splicing the oligonucleotide chains. The method can randomly splice short-chain oligonucleotides into long-chain oligonucleotides with high efficiency, and can better ensure the randomness of the nucleotides in the short-chain oligonucleotides and the polymorphism of the sequences by reducing the length of the random sequences of the synthesized nucleotides, and then reach the length of target oligonucleotide chains by random splicing. The long-chain oligonucleotide library and the random peptide library constructed by the method have larger library capacity, higher polymorphism and better application prospect.

Description

Random splicing method of oligonucleotide chains

Technical Field

The invention relates to the technical field of molecular biology, in particular to a primer group for randomly splicing oligonucleotide chains and a random splicing method of the oligonucleotide chains.

Background

The peptide library (peptide libraries) is a collection of a large number of short peptides of specific length and differing in sequence, and includes an array of various (or a substantial portion of) amino acid sequences within the short peptides of that length. At present, screening by using a random peptide library has been widely applied to various fields such as protein-protein interaction, drug design and screening.

A more common method for synthesizing random peptide libraries is to design nucleotide palindromic sequences during long-chain DNA synthesis, wherein the first two nucleotides encoding the random nucleotide sequences are arbitrary nucleotides N (A/T/C/G), and the last nucleotide is designed to be K (G/T) based on the degeneracy of the codons. Two single strands of oligonucleotides were designed according to the conditions of the vector and cleavage site (Christian RB, zuckermann RN, kerr JM, wang L, malcolm BA. Simple methods for construction, assessment and rapid screening of peptide libraries in bacteriophage. J Mol biol.1992;227 (3): 711-718.Doi:10.1016/0022-2836 (92) 90219-a.). In PCR amplification, two oligonucleotide single strands are complementarily extended into double strands under the action of Taq enzyme. By optimizing PCR reaction conditions and parameters, the diversity of random sequence DNA (Hu Jia, gao Feng, zhu Chunbao, etc.) in constructing oligonucleotide library can be better ensured, and the construction of random sequence octapeptide library and the application thereof in a double hybridization system [ J ]. Biotechnology 2007,17 (2): 82-86.DOI: 10.3969/j.issn.1004-311X.2007.02.030.) can be better ensured.

Currently, the commercially available libraries of peptides are mainly 3 random peptide libraries provided by NEB, including 7 peptide libraries (ph.d. -7), 12 peptide libraries (ph.d. -12) and disulfide-containing cyclic 7 peptide libraries (ph.d. -C7C), wherein the ph.d. -C7C random peptide libraries display polypeptides that are flanked by one cysteine, and all peptide libraries have a capacity of over 20 hundred million clones.

There are two main methods for synthesizing random peptide libraries in vitro. The first is Split and Mix, and the method is divided into three basic steps: bisection (Split), coupling (coupler), and mixing (Mix). Firstly dividing the resin sphere into a plurality of equal parts, wherein the equal parts are the same as the amino acid types of the peptide library; secondly, coupling, wherein each part of the coupling is added with a part of specific corresponding amino acid component for complete reaction; and finally, uniformly mixing, and completely uniformly mixing all equal parts. And then re-bisected into equal numbers of aliquots as before, so that a uniform and equal amount of polypeptide mixture can be obtained. By repeating these three basic steps N times (N is the number of amino acids of a target peptide), a series of new molecules can be rapidly generated, and the number of resin balls is unchanged. Resin beads react with only One reactant at a time, each resin bead produces only One compound (One-bead-compound, one peptide). Since the reaction was complete at each time, all polypeptides in the mixture were in equal proportion. After removal of the protecting group, the polypeptide on the resin beads can be used for testing.

The second is Pre-mix, which is often synthesized using amino acid Pre-mix methods due to the limitations of the OBOC method to synthesize larger peptide libraries. In the method, amino acid used for peptide library synthesis is coupled to a batch of resin balls after being mixed in advance. Before coupling the last amino acid, the resin pellet was split into N aliquots (N equals the number of amino acid species in the peptide pool) and then each amino acid was added for reaction. This gives a sub-pool of N-terminal residue markers. Since each resin pellet is reacted with the same reagent under the same environment, the peptide library synthesized by the method contains a collection of all peptides of the sub-library on each resin pellet.

The existing random peptide library synthesis method can better ensure the richness and diversity of the short peptide library only when being applied to the generation of short peptide sequences (5-10 aa). However, the shorter peptide length results in a smaller binding site for the protein of interest and thus weaker interaction forces, which may affect overall screening efficiency and specificity. When the existing method is adopted to directly and randomly synthesize the polypeptide library with longer peptide chains, the randomness of amino acids at each position is poor due to the length limitation, the diversity of the synthesized polypeptide types can be limited, and the ideal library building screening standard is difficult to be met.

At present, the DNA splicing method mainly comprises an exonuclease method, a uracil-DNA glycosylase method, a special restriction enzyme method and a PCR technology. The main principle of the first three methods is that complementary sequences are generated on two sides of a DNA fragment or are connected through overlapping sequences, and an enzyme cutting site needs to be additionally increased, so that an additional interference sequence is introduced, and the method is not applicable to DNA splicing for the purpose of constructing a short peptide library for screening. While DNA splicing using PCR requires the design of 10-25bp complementary regions between each fragment, the length of which often exceeds the length of the oligonucleotide strand to be spliced, and thus is not suitable for multi-fragment splicing of shorter oligonucleotide strands.

Disclosure of Invention

The invention aims at providing a primer group and a kit for randomly splicing oligonucleotide chains. It is another object of the present invention to provide a method for random splicing of oligonucleotide chains and a method for constructing a random long-chain peptide library using the same.

When using organism expression to synthesize random peptide library, the synthesis of oligonucleotide chain library is key to the synthesis of random peptide library. The diversity of random sequence DNA of a random library of oligonucleotide strands determines the richness and diversity of the peptide pool. For long-chain peptide libraries, direct synthesis of random oligonucleotide chains results in poor randomness of nucleotide distribution, thereby affecting the diversity of random DNA sequences. If shorter oligonucleotide chains can be synthesized first and then spliced, the randomness of the nucleotide distribution can be better ensured. However, the invention is developed, and the common DNA recombination and splicing method in the prior art has the problems that the splicing efficiency is low, the characteristics of short fragments cannot be reserved for connection, relatively seamless connection cannot be performed (excessive interference sequences are introduced), random splicing cannot be completed in the same reaction system, blunt end connection cannot be met and the like when the method is used for connecting short-fragment (within 20 bp) oligonucleotide chains. In order to solve the above problems, the present invention has developed a highly efficient random splicing method of oligonucleotide chains. The random splicing method uses magnetic beads as a carrier, and utilizes the cooperation of primers, connectors and different DNA polymerases with specially designed composition structures to realize the higher splicing efficiency of the oligonucleotide chains.

Specifically, the invention provides the following technical scheme:

firstly, the invention provides a primer group for randomly splicing oligonucleotide chains, wherein any k oligonucleotide chains in n oligonucleotide chains are randomly spliced into long-chain oligonucleotides, the primer group comprises n multiplied by k primers, n and k are integers larger than 1, and k is less than n;

in order for each oligonucleotide strand to appear at any of the split positions of the long-chain oligonucleotides after splitting, the n×k primers are divided into n subgroups, each subgroup containing k primers, the k primers of each subgroup being as follows:

the primer of the 1 st oligonucleotide strand positioned at the 5' end of the spliced long-chain oligonucleotide sequentially comprises a reverse complementary sequence of the 1 st linker sequence and a reverse complementary sequence of the 1 st oligonucleotide strand from the 5' -3' direction;

the primer of the 2 nd oligonucleotide strand positioned at the 5 'end of the spliced long-chain oligonucleotide sequentially comprises a reverse complement sequence of the 2 nd linker or a reverse complement sequence of the 2 nd linker except for the 3' end A, a reverse complement sequence of the 2 nd oligonucleotide strand and a reverse complement sequence of the 1 st linker from the 5'-3' direction;

the primer of the ith oligonucleotide strand positioned at the 5 'end of the spliced long-chain oligonucleotide sequentially comprises a reverse complement sequence of the ith linker or a reverse complement sequence of the ith linker except for the 3' end A, a reverse complement sequence of the ith oligonucleotide strand and a reverse complement sequence of the ith-1 linker from the 5'-3' direction, wherein i is more than 2 and less than or equal to k-1, and is an integer;

the primer of the kth oligonucleotide strand located at the 5' -end of the long-chain oligonucleotide after the splicing comprises the reverse complement sequence of the kth oligonucleotide strand and the reverse complement sequence of the k-1 linker in order from the 5' -3' direction.

The positions of the above-mentioned oligonucleotide strands on the long-chain oligonucleotide after the splicing are positions in which the oligonucleotide strands are arranged in sequence from the 5'-3' direction.

The invention discovers that a linker (linker) needs to be added between any two oligonucleotide chains to complete the splicing due to the shorter length of the oligonucleotide chains, and the splicing of a plurality of short-chain oligonucleotides can be realized through the paired extension of the linker region.

For the ith oligonucleotide strand, i is more than 2 and less than or equal to k-1, if the 3' -end of the corresponding ith linker is not A, the primer sequentially comprises the reverse complement sequence of the ith linker, the reverse complement sequence of the ith oligonucleotide strand and the reverse complement sequence of the ith-1 linker from the 5' -3' direction. If the 3 '-end of the corresponding i-th linker is A, the primer comprises, in order from the 5' -3 '-end, the reverse complement of the sequence of the i-th linker except for the 3' -end A, the reverse complement of the i-th oligonucleotide strand, and the reverse complement of the i-1-th linker.

For the design of the linker between the oligonucleotide chains, the present invention has found that whether the length and sequence of the linker are identical has a significant effect on the splicing efficiency, and that when the length of the linker is less than 6nt, the correct splicing efficiency is significantly reduced, and when the length of each linker is not identical or the sequences of some of the linkers are identical, a significant reduction in the splicing efficiency is also caused.

Preferably, the length of the linker is not less than 6nt, the length of the 1 st to k-1 st linkers is the same and the sequences of the linkers are different from each other.

The above sequences are all different from each other, meaning that the sequence similarity between the linkers is not 100%.

In expressing the random peptide library, it is usually necessary to first ligate the synthesized oligonucleotide strand library to a vector, and the primer set may further comprise a sequence complementary to the vector sequence at both ends in order to facilitate ligation to the vector.

Preferably, the 3 'end of the primer of the 1 st oligonucleotide strand located at the 5' end of the long-chain oligonucleotide after splicing further comprises a sequence complementary to the vector sequence and/or the cleavage site sequence used for cloning the long-chain oligonucleotide.

The 5' end of the primer of the kth oligonucleotide strand located at the 5' end of the spliced long-chain oligonucleotide also contains a sequence overlapping with the 3' end of the primer for PCR amplification of the spliced long-chain oligonucleotide single strand to form a blunt-ended double strand.

The sequence complementary to the vector sequence and the enzyme cleavage site sequence only needs to ensure that the sequence can be connected with the vector efficiently, and the preferred complementary sequence length is 10-45bp. The complementary sequences will vary depending on the expression vector chosen.

The sequence overlapping the 3' -end of the primer for PCR amplification of the long-chain oligonucleotide single strand after the splicing is preferably 10 to 30bp, more preferably 15 to 20bp. If necessary, a stop codon may be introduced at the 3' end of the overlapping sequence.

As an embodiment of the present invention, pGADT7-Rec (vector sequence shown as SEQ ID NO. 40) was used as the vector.

The random splicing primer set can be used for splicing oligonucleotide chains with different lengths, the lengths of the oligonucleotide chains to be spliced can be the same or different, and experiments prove that the random splicing primer set at least can meet the efficient splicing of the oligonucleotide chains with the lengths of 10-20nt.

Preferably, the length of the oligonucleotide strand to be spliced is 10-20nt.

As one embodiment of the present invention, the length of the oligonucleotide strand to be spliced is 12nt.

As the number of n increases, the number of primers increases in a random-split combination manner, but the size of n does not affect the split efficiency, and therefore, there is no particular number limitation on n in the above-described primer set.

There is also no particular limitation in the number of k in the above primer set theoretically, but as the number of oligonucleotide chains used for the cleavage to form one long-chain oligonucleotide increases, the cleavage efficiency may decrease.

Proved by verification, the invention can realize the efficient splicing of at least 4 oligonucleotide chains.

In a preferred embodiment of the present invention, the sequence of the 1 st to k-1 st linkers (5 '-3' direction) is GGTGCA, GCTGCA, GGAGCA in that order, k=4.

The invention finds that the 3 connectors are more beneficial to ensuring higher splicing efficiency.

In addition to the above primers, the primer set of the present invention further comprises a Block primer which is a mixture of reverse complementary strands of n oligonucleotide strands.

The Block primer has the function of preventing double chains formed by automatic complementation of the oligonucleotide chains, avoiding that the double chains formed by automatic complementation of the oligonucleotide chains are used as templates in subsequent reactions after splicing and extending to more than 2 oligonucleotides, further preventing the possibility of continuing splicing and extending and ensuring the controllability of unidirectional splicing.

Preferably, the primer set further comprises:

f1 primer for coupling with oligo dT and ligating the spliced long-chain oligonucleotide with a vector for cloning;

the F2 primer and the R primer are used for carrying out PCR amplification on the spliced long-chain oligonucleotide single chains to form a blunt-end double chain, and are connected with a vector for cloning.

Wherein the F1 primer is used as a linker segment complementary to the vector, so that the spliced long-chain oligonucleotide can be connected with the vector for cloning the long-chain oligonucleotide; the F2 primer and the R primer are matched for use, and are used for PCR amplification of a final long-chain oligonucleotide random library, so that the spliced long-chain oligonucleotide single chain is complemented into a double-chain with a flat tail end in the PCR amplification process, and can be used for sequencing.

Preferably, the F1 primer comprises, in order from the 5'-3' direction, a reverse complement of 20-45bp upstream of the vector insertion site, and a polyA tail (preferably 10-14 bp) capable of coupling to oligo dT.

The F2 primer contains the same forward sequence as the vector 15-35bp upstream of the vector insertion site from the 5'-3' direction and can be used for sequencing.

The R primer comprises a reverse complementary sequence of 20-45bp downstream of the vector insertion site from the 5' -3' direction and 6-8 nucleotides overlapping with the primer of the kth oligonucleotide strand located at the 5' -end of the long-chain oligonucleotide after splicing.

Preferably, the F2 primer sequence is fully complementary 25-35bp before the poly A tail of the F1 primer sequence.

As one embodiment of the present invention, arbitrary 4 oligonucleotide strands were randomly spliced using 6 12nt DNA fragments (SEQ ID NOS.1-6) as the oligonucleotide strands to be spliced. The primer set for the splice comprises 24 (n×k) primers, and the sequences of the 24 primers are shown in SEQ ID NOS.13-36.

The vector used for cloning after the splicing is pGADT7-Rec, and the sequences of the F1 primer, the R primer and the F2 primer are sequentially shown as SEQ ID NO. 37-39.

On the basis of the primer set described above, the present invention provides a kit comprising the primer set for random splicing of oligonucleotide chains.

The kit described above is used for random splicing of oligonucleotide strands. The kit may also contain other reagents for random splicing of oligonucleotide strands, such as: DNA polymerase, dNTPs, klenow enzyme, reaction buffer, magnetic beads, ddH ₂ O, etc.

The invention provides application of the primer group for randomly splicing the oligonucleotide chains or the kit in construction of random oligonucleotide chain libraries or random peptide libraries.

Further, the invention provides a random splicing method of oligonucleotide chains, which uses magnetic beads as a carrier, and adopts the primer group for random splicing of the oligonucleotide chains to randomly splice any k oligonucleotide chains in n oligonucleotide chains into long-chain oligonucleotides.

Preferably, the method comprises the steps of:

(1) And (2) PCR: taking magnetic beads as a carrier, adopting an F1 primer and a first primer mixture, performing PCR under the action of high-fidelity DNA polymerase, and performing solid-liquid separation after the PCR is finished to obtain a first reaction product;

the first primer mixture is a mixture of primers of the 1 st oligonucleotide chain of each subgroup in the N subgroups, which is positioned at the 5' end of the spliced long-chain oligonucleotide;

(2) Eluting: mixing the first reaction product with a Block primer, and eluting after complementary pairing of the oligonucleotides to obtain a first eluting product; mixing the first eluting product with the Block primer, and eluting after complementary pairing of the oligonucleotides to obtain a second eluting product;

(3) Extension: on the basis of the second elution product in the step (2), adopting a Block primer and a second primer mixture, and carrying out an extension reaction under the action of Klenow enzyme by taking dNTPs as raw materials to obtain a second reaction product;

the second primer mixture is a mixture of primers of the 2 nd oligonucleotide chain of each subgroup in the N subgroups, which is positioned at the 5' end of the spliced long-chain oligonucleotide;

the present invention has found that the use of Klenow enzyme in extension can significantly improve the efficiency of splicing between oligonucleotide strands compared to other DNA polymerases;

(4) Repeating steps (2) - (3), and splicing the rest of the k oligonucleotide chains one by one, wherein in the extension step of the ith oligonucleotide chain, a Block primer and an ith primer mixture are adopted;

the ith primer mixture is a mixture of primers of an ith oligonucleotide chain of each subgroup in N subgroups, which is positioned at the 5' end of the spliced long-chain oligonucleotide, wherein i is more than 2 and less than or equal to k-1, and is an integer;

finally repeating the steps (2) - (3) to splice the kth oligonucleotide chain, and adopting a Block primer and a kth primer mixture in the extension step of the kth oligonucleotide chain;

the kth primer mixture is a mixture of primers of kth oligonucleotide chains of each subgroup N positioned at the 5' end of the spliced long-chain oligonucleotides;

(5) Eluting: after the splicing in the step (4) is finished, mixing the spliced product with a Block primer, and eluting to obtain an eluted product;

(6) And (3) taking the eluted product in the step (5) as a template, adopting an F2 primer and an R primer to carry out PCR, and recovering the PCR product to obtain the randomly spliced oligonucleotide library.

In the step (1) described above, the magnetic beads used are oligo dT-coupled magnetic beads. Preferably 25nt oligo dT is coupled.

The high-fidelity DNA polymerase may be any high-fidelity DNA polymerase, and it is only necessary to ensure that the amplified product is blunt-ended, for example: phanta Max Master Mix, etc.

The solid-liquid separation may be carried out by separating the supernatant and the precipitate using a magnetic rack, then removing the supernatant and recovering the precipitate as the first reaction product.

In the reaction system of PCR, the final concentration of the F1 primer is 0.3-0.5 mu M, and the final concentration of the first primer mixture is 0.3-0.5 mu M.

A preferred 50. Mu.l PCR reaction is as follows: 10. Mu.l of magnetic beads, 25. Mu.l of 2 XHi-Fi DNA polymerase, 0.4. Mu.M of F1 primer and 0.4. Mu.M of first primer mixture, and the reaction system is supplemented with water.

The reaction procedure of PCR includes: 94-98 deg.C, 5-30s,55 deg.C, 10-30s,72 deg.C, 10-20s,18-25 cycles.

In step (2) of the above method, the final concentration of the Block primer is 18 to 22. Mu.M. The elution is carried out by incubating for 2min at 90-95 ℃ and then incubating for 1-3min at 0-4 ℃.

In the step (3) of the above method, the final concentration of the Block primer in the extended reaction system is 1 to 3. Mu.M, and the final concentration of the primer mixture is 0.5 to 2. Mu.M.

The preferred extension reaction system is as follows (total volume 20 μl): the reaction system was made up with water by the first elution product, block primer 2. Mu.M, dNTPs 0.5mM,1 XKlenow enzyme reaction buffer, klenow enzyme 1. Mu.l, and primer mix 1. Mu.M.

Wherein the primer mixture is preferably denatured at 94℃for 2min and then incubated at 37 ℃.

The sample addition sequence of the reaction system is preferably as follows: firstly, mixing the Block primer, water and dNTPs, uniformly mixing a reaction buffer solution, incubating for 1-3min at 94 ℃, and incubating for 1-3min at 0-4 ℃.

The reaction conditions for the extension are: the reaction is carried out for 15-25min at 37 ℃.

In the step (6), the final concentration of the F2 primer and the R primer in the PCR reaction system is 0.3-0.8 mu M.

The preferred PCR reaction system is (total volume 50. Mu.L): 2 XHi-Fi DNA polymerase Mix 25. Mu.l, F2 primer 0.4. Mu.M, R primer 0.4. Mu.M, make up the reaction with water.

The preferred PCR reaction procedure is:

the reaction procedure of PCR includes: 94-98 deg.C, 5-30s,55 deg.C, 10-30s,72 deg.C, 10-20s,18-35 cycles.

The invention also provides a construction method of the random peptide library, which comprises the following steps: and (3) randomly splicing short-chain oligonucleotides encoding the short-chain peptide library by adopting the oligonucleotide chain random splicing method to obtain a random long-chain oligonucleotide library, connecting the random long-chain oligonucleotide library with a carrier, and transferring the carrier into a host cell for expression to obtain the random long-chain peptide library.

In the method for constructing the random peptide library, in the random splicing process of the oligonucleotide chains, the oligonucleotide chains to be spliced can be random oligonucleotide chains constructed in an NNK (wherein N represents any nucleotide, K represents G or T) encoding mode;

alternatively, the oligonucleotide strand to be spliced may be a random oligonucleotide strand constructed by NNK (wherein N represents any nucleotide, K represents G or T) encoding, an oligonucleotide strand corresponding to a library of preliminary screening peptides obtained by ligating a vector, expressing a library of short peptides in a host cell, and preliminary screening.

The short peptide sequences which are strongly combined with the target in the primary screening are selected for subsequent splicing, construction of a long-chain peptide library and rescreening, so that the workload of peptide library construction and screening can be reduced, the working efficiency is improved, the primary screening result is verified, and the reliability of the screening result is enhanced.

As one embodiment of the invention, the invention provides a method for constructing a 16aa random peptide library, which comprises the following steps:

(1) A 4aa random oligonucleotide chain synthesized by NNK (wherein N represents any nucleotide, K represents G or T) coding mode is adopted, and a short peptide library is expressed in host cells through a connecting carrier and is subjected to preliminary screening to obtain a preliminary screening peptide library;

(2) Synthesizing oligonucleotide chains corresponding to polypeptides in a preliminary screening peptide library, splicing by adopting a random splicing method of the oligonucleotide chains to obtain a random oligonucleotide library for encoding the random peptide library, connecting the random oligonucleotide library with a carrier, and transferring the random oligonucleotide library into a host cell for expression to obtain a 16aa random peptide library;

wherein, in the random splicing method of the oligonucleotide chains, the length of n oligonucleotide chains is 12nt, and k=4.

Compared with a random short peptide library, the 16aa random peptide library can improve screening efficiency and specificity through the interaction of multiple binding sites and target proteins.

The beneficial effects of the invention at least comprise: the primer group and the random splicing method for the random splicing of the oligonucleotide chains solve the problems that in the synthesis process of a random long-chain oligonucleotide library, certain sites have certain preference, so that the randomness of the nucleotide distribution of certain sites in the whole DNA double chain is insufficient, the polymorphism of the whole library is insufficient, the screening effect is not ideal and the like. The random splicing method of the oligonucleotide chain can randomly splice short-chain oligonucleotides into long-chain oligonucleotides with higher efficiency, well ensure the randomness and polymorphism of DNA in a short-chain oligonucleotide library by reducing the length of a direct synthesized nucleotide random sequence, and then reach the length of a target oligonucleotide chain by high-efficiency random splicing. The long-chain oligonucleotide library and the random peptide library constructed by the method have larger library capacity, and the randomness of each site and the sequence polymorphism of the library can be well ensured.

The random peptide library constructed by the random splicing method can be applied to screening of yeast double hybridization, phage display and the like, and has good application prospect.

Drawings

FIG. 1 is a schematic diagram showing the process of splicing oligonucleotide chains in example 1 of the present invention.

FIG. 2 shows the sequencing result of the insert sequence of the split positive clone in example 1 of the present invention.

FIG. 3 shows the results of electrophoresis detection of the spliced products of the invention in example 1 using a 6nt linker and comparative example 1 without the linker, wherein lanes 1 to 5 are in this order: marker, linker-free 33 cycle end products (comparative example 1), 6nt linker 20 cycle end products (example 1), 6nt linker (example 1) 33 cycle end products and 132bp positive control.

FIG. 4 shows the sequencing results of the split error clone of comparative example 2.

FIG. 5 shows the sequencing results of the split error clone of comparative example 3.

In FIGS. 4 and 5, insert num represents the number of 12nt oligonucleotide strands, insert length represents the insert length, and insert sequence represents the sequence of the sequencing result of the insert.

Detailed Description

The following examples are illustrative of the invention and are not intended to limit the scope of the invention.

The magnetic beads used in the following examples were 25nt oligo dT coupled magnetic beads, available from Invitrogen under the trade designation Dynabeads ^TM Oligo (dT) 25, cat# 61002; 2X Phanta Max Master Mix is Vazyme accession number P515-01; klenow enzyme is the 3'-5' exo-product of NEB.

Example 1 splicing of oligonucleotide strands

In this example, 6 12nt DNA fragments are used as oligonucleotide chains to be spliced, and arbitrary 4 oligonucleotide chains (named A, B, C, D) are randomly spliced, and the basic flow is as follows: taking magnetic beads as carriers, firstly connecting Smart3_RC to oligo-dT of the magnetic beads, then connecting A, B, C, D to the magnetic beads according to different arrangement sequences, and finally amplifying the spliced long-chain oligonucleotide by using an AdrecF primer and a CDSIII_RC primer. The structure of the spliced long-chain oligonucleotide is as follows: oligonucleotide strand A-1 st linker-oligonucleotide strand B-2 nd linker-oligonucleotide strand C-3 rd linker-oligonucleotide strand D, the sequences (5 '-3') of the 1 st, 2 nd and 3 rd linkers used were GGTGCA, GCTGCA, GGAGCA, respectively.

The specific random splicing method is as follows, and the main flow is as shown in fig. 1:

1. and (2) PCR: taking 10 mu l of magnetic beads, adding 50 mu l of water, uniformly mixing, washing at room temperature, and washing twice;

to the washed beads was added 2. Mu. l F1 primer (10. Mu.M), 2. Mu. l A-RC (10. Mu.M), 21. Mu. l H ₂ O,25 μl of 2 XPhanta Mix, and mixing to obtain a PCR reaction system;

the PCR reaction system was subjected to PCR as follows: the mixture is blown and evenly mixed by a liquid transfer device every 10min after the mixture is circulated for 95 ℃, 15s,55 ℃, 15s,72 ℃, 15s and 20;

after the PCR reaction is finished, uniformly blowing by a liquid transfer device, and placing the mixture on a magnetic rack at room temperature to remove the supernatant to obtain a first reaction product;

2. eluting: adding 20 μl of Block primer (20 μM) into the first reaction product obtained in step 1, mixing, incubating at 94 ℃ for 2min, standing on ice for 2min, removing supernatant on a magnetic frame, repeating Block primer elution once, and removing supernatant on the magnetic frame to obtain an eluted product;

3. extension: to the eluted product from step 2, 2. Mu.l of Block primer (20. Mu.M), 12. Mu. l H were added ₂ O, 1. Mu.l dNTPs (10 mM each), 2. Mu.l 10 XNEB Buffer 2, were uniformly blown, incubated at 94℃for 2min, then placed on ice for 2min, then 1. Mu.l Klenow (exo-, NEB) was added, finally 2. Mu.l of B-RC primer (10. Mu.M) denatured at 94℃for 2min and then incubated at 37℃was uniformly mixed, reacted at 37℃for 20min, and blown and uniformly mixed with a pipette every 10 min;

4. eluting: repeating the step 2;

5. extension: step 3 is repeated except that 2 μ l C _rc primer (10 μΜ) is used instead of b_rc primer (10 μΜ);

6. eluting: repeating step (2);

7. extension: step 3 is repeated except that 2 μ l D _rc primer (10 μΜ) is used instead of b_rc primer (10 μΜ);

8. eluting: repeating the step 2 to obtain an eluted product;

9. performing PCR (polymerase chain reaction) amplification by using the eluted product of the step 8 as a template and adopting an F2 primer and an R primer, and recovering an amplified product to obtain a randomly spliced oligonucleotide library;

wherein, the reaction system of PCR amplification is as follows (total volume 50. Mu.L): 2X Phanta Max Master Mix. Mu.l, adrecF primer 0.4. Mu.M, cds3_RC primer 0.4. Mu.M, make up the reaction with water.

The reaction procedure for PCR amplification the following PCR reaction procedure included: 95 ℃, 30s,55 ℃, 15s,72 ℃, 15s,20 cycles or 33 cycles.

In the above method, the sequences of 6 12nt oligonucleotide strands are as follows (orientation 5'-3', orientation of all primer sequences below is also 5 '-3'):

GTGGCGATTCAG；

TGGGCTAGTGAT；

CGGGTGCCGCTT；

TTGCTTGTTCAG；

AATGCTACTGGT；

CCGTGTACGGCT；

block primers are a mixture of 6 12nt oligonucleotide strands of reverse complementary oligonucleotide strands comprising the primer sequences:

CTGAATCGCCAC；

ATCACTAGCCCA；

AAGCGGCACCCG；

CTGAACAAGCAA；

ACCAGTAGCATT；

AGCCGTACACGG；

primer A-RC is a mixture of all primers (6 primers) at the 1 st oligonucleotide strand position in the 5'-3' direction of the long-chain oligonucleotide after the 6 oligonucleotide strands of 12nt are spliced;

the sequences of these 6 primers are as follows:

A_RC1:TGCACCCTGAATCGCCACGGGCCATAATGGCCACTC；

A_RC2:TGCACCATCACTAGCCCAGGGCCATAATGGCCACTC；

A_RC3:TGCACCAAGCGGCACCCGGGGCCATAATGGCCACTC；

A_RC4:TGCACCCTGAACAAGCAAGGGCCATAATGGCCACTC；

A_RC5:TGCACCACCAGTAGCATTGGGCCATAATGGCCACTC；

A_RC6:TGCACCAGCCGTACACGGGGGCCATAATGGCCACTC。

primer B-RC is a mixture of all primers (6 primers) at the 2 nd oligonucleotide strand position in the 5'-3' direction of the long-chain oligonucleotide after the 6 oligonucleotide strands of 12nt are spliced;

the sequences of these 6 primers are as follows:

B_RC1:GCAGCCTGAATCGCCACTGCACC；

B_RC2:GCAGCATCACTAGCCCATGCACC；

B_RC3:GCAGCAAGCGGCACCCGTGCACC；

B_RC4:GCAGCCTGAACAAGCAATGCACC；

B_RC5:GCAGCACCAGTAGCATTTGCACC；

B_RC6:GCAGCAGCCGTACACGGTGCACC。

primer C-RC is a mixture of all primers (6 primers) at the 3 rd oligonucleotide strand position in the 5'-3' direction of the long-chain oligonucleotide after the 6 oligonucleotide strands of 12nt are spliced;

the sequences of these 6 primers are as follows:

C_RC1:GCTCCCTGAATCGCCACTGCAGC；

C_RC2:GCTCCATCACTAGCCCATGCAGC；

C_RC3:GCTCCAAGCGGCACCCGTGCAGC；

C_RC4:GCTCCCTGAACAAGCAATGCAGC；

C_RC5:GCTCCACCAGTAGCATTTGCAGC；

C_RC6:GCTCCAGCCGTACACGGTGCAGC。

primer D_RC is a mixture of all primers (6 primers) at the 4 th oligonucleotide strand position in the 5'-3' direction of the long-chain oligonucleotide after the 6 oligonucleotide strands of 12nt were spliced.

The sequences of these 6 primers are as follows:

D_RC1:GAGGCGGCCGACATGCTACTGAATCGCCACTGCTCC；

D_RC2:GAGGCGGCCGACATGCTAATCACTAGCCCATGCTCC；

D_RC3:GAGGCGGCCGACATGCTAAAGCGGCACCCGTGCTCC；

D_RC4:GAGGCGGCCGACATGCTACTGAACAAGCAATGCTCC；

D_RC5:GAGGCGGCCGACATGCTAACCAGTAGCATTTGCTCC；

D_RC6:GAGGCGGCCGACATGCTAAGCCGTACACGGTGCTCC。

the sequence of the F1 primer is as follows:

GGGCCATAATGGCCACTCTGCGTTGATACCACTGCTTGGGTGGAAAAAAAAAAAAAAAA。

the sequences of the R primers are as follows:

GTATCGATGCCCACCCTCTAGAGGCCGAGGCGGCCGACATGCTA。

the sequence of the F2 primer is as follows:

TTCCACCCAAGCAGTGGTATCAACGCAGAGT。

comparative example 1

This comparative example provides a method for splicing oligonucleotide strands, which differs from example 1 only in that: no linker was placed between the short-chain oligonucleotides to be spliced, and the linker sequences in the primer sequences of example 1 were deleted accordingly, in the same manner as in example 1.

Comparative example 2

This comparative example provides a method for splicing oligonucleotide strands, which differs from example 1 only in that: the linker in example 1 was replaced with the following linker:

the 1 st linker is GGA, the 2 nd linker is GGA, and the 3 rd linker is GGA.

The linker sequence in each primer sequence was replaced accordingly, and the other methods were the same as in example 1.

Comparative example 3

the 1 st linker is GGGGGA, the 2 nd linker is GGGGGA, and the 3 rd linker is GGGGGA.

Experimental example

The random oligonucleotide chain library constructed in the above examples and comparative examples was subjected to detection of splicing efficiency, library capacity and polymorphism, and the specific procedures were as follows:

1. library concentration detection

The end products after the split obtained in example 1 and comparative example 1 were examined by agarose gel electrophoresis with the number of PCR amplification cycles of step 9 being 20 and 33 cycles, respectively. As shown in FIG. 3, when the comparative example 1 is free of a linker, the amplified product bands are still free of clear products for 33 cycles, indicating that no successfully spliced product can be obtained without a linker, and the splicing efficiency is 0, so that subsequent cloning and sequencing detection are not performed; whereas the split end products obtained in example 1 amplified for 20 cycles and 33 cycles each showed clear bands, indicating an end product content of around 100 ng.

Clear bands were seen for 20 cycles of amplification, calculated according to the following formula, and the capacity of the library of random oligonucleotide strands corresponding to the 16aa peptide pool obtained by splicing was approximately 8 million copies.

Where N is the number of cycles, M is the copy number, and the mass unit is ng.

The above results indicate that the random oligonucleotide strand library constructed by the random splicing method of example 1 of the present invention can meet the requirements of screening library capacity.

2. Split efficiency and polymorphism detection

The end products obtained in example 1 and each comparative example after the combination were subjected to DNA agarose gel electrophoresis, the DNA products were gel recovered and purified and cloned by connecting with a T vector, and the clones obtained were sequenced. The length of the successfully spliced long-chain oligonucleotide of example 1 should be 66nt, and thus the insert of the positive clone should be 66bp.

Wherein 20 cycles of the split end product of example 1, 33 cycles of the split end product were each randomly selected for sequencing, a total of 100 were excluded, a total of 81 clones into which the vector could not be ligated were obtained, DNA sequencing verification was performed on these 81 clones, and statistics of the results of sequencing the clones of the split end product obtained by PCR amplification of 20 cycles are shown in Table 1, wherein the mutation in the clone successfully split (insert length of 66 bp) and statistics of the proportion of each short-chain oligonucleotide to be split in all the clones successfully split are shown in Table 2; the statistics of the sequencing results of the clones of the split end products obtained in 33 cycles of PCR amplification are shown in Table 3, in which the mutation in the successfully split (insert length of 66 bp) clone and the statistics of the proportion of each short-chain oligonucleotide to be split in all the successfully split clones are shown in Table 4. The sequencing results of partially successfully spliced long-chain oligonucleotides are shown in FIG. 2.

The results show that the splicing success rate of the short-chain oligonucleotide of example 1 is 46%, indicating that the splicing method of the invention has higher splicing efficiency. In the successfully spliced clone, the occurrence rate of 6 short-chain oligonucleotide chains of 12bp is relatively average, so that the polymorphism of the long-chain oligonucleotide library is higher, and the polymorphism requirement of the oligonucleotide library in the screening of a peptide library can be met.

TABLE 1 sequencing statistics of 20 cycles of amplification of the clone of the split end product

	Clone number	Cloning number ratio (%)
			The presence of an insert	42	——
The insert length was 66bp	17	40.50％
			The insert length is 30bp	1	2.40％
The length of the insert is 48bp	7	16.60％
			Other lengths	17	40.50％

TABLE 2 statistics of successful split end product clone sequencing for 20 cycles of amplification

Note that: in Table 2, the ratio of each nucleotide in the non-mutant was the ratio of the occurrence of all the non-mutant clones, and the ratio of the mutation was the ratio of the mutation in 68 clones in total.

TABLE 3 statistics of sequencing of amplified 33 cycle split end product clones

	Clone number	Cloning number ratio (%)
			The presence of an insert	39	——
The insert length was 66bp	20	51.30
			The insert length is 30bp	2	5.10
The length of the insert is 48bp	9	23.10
			Other lengths	8	20.50

TABLE 4 statistics of successful split end product clone sequencing for 33 cycles of amplification

Note that: in Table 4, the ratio of each nucleotide in the non-mutant was the ratio of the occurrence of all the non-mutant clones, and the ratio of the mutation was the ratio of the mutation in the total 80 clones.

The split end products obtained by PCR amplification for 33 cycles of comparative examples 2 and 3 were cloned to obtain 21 and 36 clones, respectively, with fragment insertions. DNA sequencing verification was performed on these clones. Wherein, the length of the long-chain oligonucleotide after successful splicing of comparative example 2 should be 57nt, the length of the long-chain oligonucleotide after successful splicing of comparative example 3 should be 66nt, and the insert of the positive clone should be 57bp and 66bp, respectively.

The results of the sequencing statistics of the clones of comparative examples 2 and 3 are shown in FIGS. 4 and 5, and the results show that no clone satisfying 57bp and 66bp after the splicing appears in all the clones of comparative examples 2 and 3, and thus the positive rate of the splicing method of comparative examples 2 and 3 is 0.

While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.

Sequence listing

<110> university of Beijing

<120> a method for random splicing of oligonucleotide chains

<130> KHP211121626.2

<160> 40

<170> SIPOSequenceListing 1.0

<210> 1

<211> 12

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

gtggcgattc ag 12

<210> 2

<211> 12

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

tgggctagtg at 12

<210> 3

<211> 12

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

cgggtgccgc tt 12

<210> 4

<211> 12

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

ttgcttgttc ag 12

<210> 5

<211> 12

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

aatgctactg gt 12

<210> 6

<211> 12

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

ccgtgtacgg ct 12

<210> 7

<211> 12

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

ctgaatcgcc ac 12

<210> 8

<211> 12

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

atcactagcc ca 12

<210> 9

<211> 12

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

aagcggcacc cg 12

<210> 10

<211> 12

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

ctgaacaagc aa 12

<210> 11

<211> 12

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

accagtagca tt 12

<210> 12

<211> 12

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

agccgtacac gg 12

<210> 13

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

tgcaccctga atcgccacgg gccataatgg ccactc 36

<210> 14

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

tgcaccatca ctagcccagg gccataatgg ccactc 36

<210> 15

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

tgcaccaagc ggcacccggg gccataatgg ccactc 36

<210> 16

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

tgcaccctga acaagcaagg gccataatgg ccactc 36

<210> 17

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

tgcaccacca gtagcattgg gccataatgg ccactc 36

<210> 18

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

tgcaccagcc gtacacgggg gccataatgg ccactc 36

<210> 19

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 19

gcagcctgaa tcgccactgc acc 23

<210> 20

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

gcagcatcac tagcccatgc acc 23

<210> 21

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 21

gcagcaagcg gcacccgtgc acc 23

<210> 22

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 22

gcagcctgaa caagcaatgc acc 23

<210> 23

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 23

gcagcaccag tagcatttgc acc 23

<210> 24

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 24

gcagcagccg tacacggtgc acc 23

<210> 25

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 25

gctccctgaa tcgccactgc agc 23

<210> 26

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 26

gctccatcac tagcccatgc agc 23

<210> 27

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 27

gctccaagcg gcacccgtgc agc 23

<210> 28

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 28

gctccctgaa caagcaatgc agc 23

<210> 29

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 29

gctccaccag tagcatttgc agc 23

<210> 30

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 30

gctccagccg tacacggtgc agc 23

<210> 31

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 31

gaggcggccg acatgctact gaatcgccac tgctcc 36

<210> 32

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 32

gaggcggccg acatgctaat cactagccca tgctcc 36

<210> 33

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 33

gaggcggccg acatgctaaa gcggcacccg tgctcc 36

<210> 34

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 34

gaggcggccg acatgctact gaacaagcaa tgctcc 36

<210> 35

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 35

gaggcggccg acatgctaac cagtagcatt tgctcc 36

<210> 36

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 36

gaggcggccg acatgctaag ccgtacacgg tgctcc 36

<210> 37

<211> 59

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 37

gggccataat ggccactctg cgttgatacc actgcttggg tggaaaaaaa aaaaaaaaa 59

<210> 38

<211> 44

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 38

gtatcgatgc ccaccctcta gaggccgagg cggccgacat gcta 44

<210> 39

<211> 31

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 39

ttccacccaa gcagtggtat caacgcagag t 31

<210> 40

<211> 8058

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 40

tgcatgcctg caggtcgaga tccgggatcg aagaaatgat ggtaaatgaa ataggaaatc 60

aaggagcatg aaggcaaaag acaaatataa gggtcgaacg aaaaataaag tgaaaagtgt 120

tgatatgatg tatttggctt tgcggcgccg aaaaaacgag tttacgcaat tgcacaatca 180

tgctgactct gtggcggacc cgcgctcttg ccggcccggc gataacgctg ggcgtgaggc 240

tgtgcccggc ggagtttttt gcgcctgcat tttccaaggt ttaccctgcg ctaaggggcg 300

agattggaga agcaataaga atgccggttg gggttgcgat gatgacgacc acgacaactg 360

gtgtcattat ttaagttgcc gaaagaacct gagtgcattt gcaacatgag tatactagaa 420

gaatgagcca agacttgcga gacgcgagtt tgccggtggt gcgaacaata gagcgaccat 480

gaccttgaag gtgagacgcg cataaccgct agagtacttt gaagaggaaa cagcaatagg 540

gttgctacca gtataaatag acaggtacat acaacactgg aaatggttgt ctgtttgagt 600

acgctttcaa ttcatttggg tgtgcacttt attatgttac aatatggaag ggaactttac 660

acttctccta tgcacatata ttaattaaag tccaatgcta gtagagaagg ggggtaacac 720

ccctccgcgc tcttttccga tttttttcta aaccgtggaa tatttcggat atccttttgt 780

tgtttccggg tgtacaatat ggacttcctc ttttctggca accaaaccca tacatcggga 840

ttcctataat accttcgttg gtctccctaa catgtaggtg gcggagggga gatatacaat 900

agaacagata ccagacaaga cataatgggc taaacaagac tacaccaatt acactgcctc 960

attgatggtg gtacataacg aactaatact gtagccctag acttgatagc catcatcata 1020

tcgaagtttc actacccttt ttccatttgc catctattga agtaataata ggcgcatgca 1080

acttcttttc tttttttttc ttttctctct cccccgttgt tgtctcacca tatccgcaat 1140

gacaaaaaaa tgatggaaga cactaaagga aaaaattaac gacaaagaca gcaccaacag 1200

atgtcgttgt tccagagctg atgaggggta tctcgaagca cacgaaactt tttccttcct 1260

tcattcacgc acactactct ctaatgagca acggtatacg gccttccttc cagttacttg 1320

aatttgaaat aaaaaaaagt ttgctgtctt gctatcaagt ataaatagac ctgcaattat 1380

taatcttttg tttcctcgtc attgttctcg ttccctttct tccttgtttc tttttctgca 1440

caatatttca agctatacca agcatacaat caactccaag ctttgcaaag atggataaag 1500

cggaattaat tcccgagcct ccaaaaaaga agagaaaggt cgaattgggt accgccgcca 1560

attttaatca aagtgggaat attgctgata gctcattgtc cttcactttc actaacagta 1620

gcaacggtcc gaacctcata acaactcaaa caaattctca agcgctttca caaccaattg 1680

cctcctctaa cgttcatgat aacttcatga ataatgaaat cacggctagt aaaattgatg 1740

atggtaataa ttcaaaacca ctgtcacctg gttggacgga ccaaactgcg tataacgcgt 1800

ttggaatcac tacagggatg tttaatacca ctacaatgga tgatgtatat aactatctat 1860

tcgatgatga agatacccca ccaaacccaa aaaaagagat ctttaatacg actcactata 1920

gggcgagcgc cgccatggag tacccatacg acgtaccaga ttacgctcat atggccatgg 1980

aggccagtga attccaccca agcagtggta tcaacgcaga gtggccatta tggcccggga 2040

aaaaacatgt cggccgcctc ggcctctaga gggtgggcat cgatacggga tccatcgagc 2100

tcgagctgca gatgaatcgt agatactgaa aaaccccgca agttcacttc aactgtgcat 2160

cgtgcaccat ctcaatttct ttcatttata catcgttttg ccttctttta tgtaactata 2220

ctcctctaag tttcaatctt ggccatgtaa cctctgatct atagaatttt ttaaatgact 2280

agaattaatg cccatctttt ttttggacct aaattcttca tgaaaatata ttacgagggc 2340

ttattcagaa gctttggact tcttcgccag aggtttggtc aagtctccaa tcaaggttgt 2400

cggcttgtct accttgccag aaatttacga aaagatggaa aagggtcaaa tcgttggtag 2460

atacgttgtt gacacttcta aataagcgaa tttcttatga tttatgattt ttattattaa 2520

ataagttata aaaaaaataa gtgtatacaa attttaaagt gactcttagg ttttaaaacg 2580

aaaattctta ttcttgagta actctttcct gtaggtcagg ttgctttctc aggtatagca 2640

tgaggtcgct cttattgacc acacctctac cggccggtcg aaattcccct accctatgaa 2700

catattccat tttgtaattt cgtgtcgttt ctattatgaa tttcatttat aaagtttatg 2760

tacaaatatc ataaaaaaag agaatctttt taagcaagga ttttcttaac ttcttcggcg 2820

acagcatcac cgacttcggt ggtactgttg gaaccaccta aatcaccagt tctgatacct 2880

gcatccaaaa cctttttaac tgcatcttca atggccttac cttcttcagg caagttcaat 2940

gacaatttca acatcattgc agcagacaag atagtggcga tagggttgac cttattcttt 3000

ggcaaatctg gagcagaacc gtggcatggt tcgtacaaac caaatgcggt gttcttgtct 3060

ggcaaagagg ccaaggacgc agatggcaac aaacccaagg aacctgggat aacggaggct 3120

tcatcggaga tgatatcacc aaacatgttg ctggtgatta taataccatt taggtgggtt 3180

gggttcttaa ctaggatcat ggcggcagaa tcaatcaatt gatgttgaac cttcaatgta 3240

ggaaattcgt tcttgatggt ttcctccaca gtttttctcc ataatcttga agaggccaaa 3300

acattagctt tatccaagga ccaaataggc aatggtggct catgttgtag ggccatgaaa 3360

gcggccattc ttgtgattct ttgcacttct ggaacggtgt attgttcact atcccaagcg 3420

acaccatcac catcgtcttc ctttctctta ccaaagtaaa tacctcccac taattctctg 3480

acaacaacga agtcagtacc tttagcaaat tgtggcttga ttggagataa gtctaaaaga 3540

gagtcggatg caaagttaca tggtcttaag ttggcgtaca attgaagttc tttacggatt 3600

tttagtaaac cttgttcagg tctaacacta cctgtacccc atttaggacc acccacagca 3660

cctaacaaaa cggcatcagc cttcttggag gcttccagcg cctcatctgg aagtgggaca 3720

cctgtagctt cgatagcagc accaccaatt aaatgatttt cgaaatcgaa cttgacattg 3780

gaacgaacat cagaaatagc tttaagaacc ttaatggctt cggctgtgat ttcttgacca 3840

acgtggtcac ctggcaaaac gacgatcttc ttaggggcag acattagaat ggtatatcct 3900

tgaaatatat atatatattg ctgaaatgta aaaggtaaga aaagttagaa agtaagacga 3960

ttgctaacca cctattggaa aaaacaatag gtccttaaat aatattgtca acttcaagta 4020

ttgtgatgca agcatttagt catgaacgct tctctattct atatgaaaag ccggttccgg 4080

cgctctcacc tttccttttt ctcccaattt ttcagttgaa aaaggtatat gcgtcaggcg 4140

acctctgaaa ttaacaaaaa atttccagtc atcgaatttg attctgtgcg atagcgcccc 4200

tgtgtgttct cgttatgttg aggaaaaaaa taatggttgc taagagattc gaactcttgc 4260

atcttacgat acctgagtat tcccacagtt gggggatctc gactctagct agaggatcaa 4320

ttcgtaatca tgtcatagct gtttcctgtg tgaaattgtt atccgctcac aattccacac 4380

aacatacgag ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt gagctaactc 4440

acattaattg cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc gtgccagctg 4500

ataacttcgt ataatgtatg ctatacgaag ttattaggtc tgaagaggag tttacgtcca 4560

gccaagctag cttggctgca ggtcgagcgg ccgcgatccg gaacccttaa tataacttcg 4620

tataatgtat gctatacgaa gttatcagct gcattaatga atcggccaac gcgcggggag 4680

aggcggtttg cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt 4740

cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga 4800

atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg 4860

taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa 4920

aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt 4980

tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct 5040

gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct 5100

cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc 5160

cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt 5220

atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc 5280

tacagagttc ttgaagtggt ggcctaacta cggctacact agaagaacag tatttggtat 5340

ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa 5400

acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa 5460

aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga 5520

aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct 5580

tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga 5640

cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc 5700

catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg 5760

ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat 5820

aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat 5880

ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg 5940

caacgttgtt gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc 6000

attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa 6060

agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg cagtgttatc 6120

actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt 6180

ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc ggcgaccgag 6240

ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt 6300

gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag 6360

atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt ttactttcac 6420

cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc 6480

gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa gcatttatca 6540

gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aacaaatagg 6600

ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc taagaaacca ttattatcat 6660

gacattaacc tataaaaata ggcgtatcac gaggcccttt cgtctcgcgc gtttcggtga 6720

tgacggtgaa aacctctgac acatgcagct cccggagacg gtcacagctt gtctgtaagc 6780

ggatgccggg agcagacaag cccgtcaggg cgcgtcagcg ggtgttggcg ggtgtcgggg 6840

ctggcttaac tatgcggcat cagagcagat tgtactgaga gtgcaccata acgcatttaa 6900

gcataaacac gcactatgcc gttcttctca tgtatatata tatacaggca acacgcagat 6960

ataggtgcga cgtgaacagt gagctgtatg tgcgcagctc gcgttgcatt ttcggaagcg 7020

ctcgttttcg gaaacgcttt gaagttccta ttccgaagtt cctattctct agctagaaag 7080

tataggaact tcagagcgct tttgaaaacc aaaagcgctc tgaagacgca ctttcaaaaa 7140

accaaaaacg caccggactg taacgagcta ctaaaatatt gcgaataccg cttccacaaa 7200

cattgctcaa aagtatctct ttgctatata tctctgtgct atatccctat ataacctacc 7260

catccacctt tcgctccttg aacttgcatc taaactcgac ctctacattt tttatgttta 7320

tctctagtat tactctttag acaaaaaaat tgtagtaaga actattcata gagtgaatcg 7380

aaaacaatac gaaaatgtaa acatttccta tacgtagtat atagagacaa aatagaagaa 7440

accgttcata attttctgac caatgaagaa tcatcaacgc tatcactttc tgttcacaaa 7500

gtatgcgcaa tccacatcgg tatagaatat aatcggggat gcctttatct tgaaaaaatg 7560

cacccgcagc ttcgctagta atcagtaaac gcgggaagtg gagtcaggct ttttttatgg 7620

aagagaaaat agacaccaaa gtagccttct tctaacctta acggacctac agtgcaaaaa 7680

gttatcaaga gactgcatta tagagcgcac aaaggagaaa aaaagtaatc taagatgctt 7740

tgttagaaaa atagcgctct cgggatgcat ttttgtagaa caaaaaagaa gtatagattc 7800

tttgttggta aaatagcgct ctcgcgttgc atttctgttc tgtaaaaatg cagctcagat 7860

tctttgtttg aaaaattagc gctctcgcgt tgcatttttg ttttacaaaa atgaagcaca 7920

gattcttcgt tggtaaaata gcgctttcgc gttgcatttc tgttctgtaa aaatgcagct 7980

cagattcttt gtttgaaaaa ttagcgctct cgcgttgcat ttttgttcta caaaatgaag 8040

cacagatgct tcgttgct 8058

Claims

1. A primer set for random splicing of oligonucleotide chains, characterized in that any k oligonucleotide chains of n oligonucleotide chains are randomly spliced into long-chain oligonucleotides, the primer set comprises n×k primers, n and k are integers greater than 1, and k is less than n;

the n x k primers are divided into n subgroups, each subgroup containing k primers, the k primers of each subgroup being as follows:

the primer of the 1 st oligonucleotide strand positioned at the 5' end of the spliced long-chain oligonucleotide sequentially comprises a reverse complementary sequence of the 1 st linker sequence and a reverse complementary sequence of the oligonucleotide strand from the 5' -3' direction;

the primer of the 2 nd oligonucleotide strand positioned at the 5 'end of the spliced long-chain oligonucleotide sequentially comprises a reverse complement sequence of the 2 nd linker or a reverse complement sequence of the 2 nd linker except for the 3' end A, a reverse complement sequence of the oligonucleotide strand and a reverse complement sequence of the 1 st linker from the 5'-3' direction;

the primer of the ith oligonucleotide strand positioned at the 5 'end of the spliced long-chain oligonucleotide sequentially comprises a reverse complement sequence of the ith linker or a reverse complement sequence of the ith linker except for the 3' end A, the reverse complement sequence of the oligonucleotide strand and the reverse complement sequence of the ith-1 linker from the 5'-3' direction, wherein i is more than 2 and less than or equal to k-1, and is an integer;

the primer of the kth oligonucleotide strand positioned at the 5' -end of the spliced long-chain oligonucleotide sequentially comprises a reverse complement sequence of the kth oligonucleotide strand and a reverse complement sequence of the kth-1 linker from the 5' -3' -direction;

the length of the linker is more than or equal to 6nt, the lengths of the 1 st to k-1 st linkers are the same, and the sequences of the linkers are different from each other;

wherein k=4, and the sequence of the 1 st to k-1 st linkers is GGTGCA, GCTGCA, GGAGCA in sequence.

2. The primer set for random splicing of oligonucleotide strands according to claim 1, wherein the 3 '-end of the primer of the 1 st oligonucleotide strand located at the 5' -end of the long-chain oligonucleotide after splicing further contains a sequence complementary to a vector sequence and/or a cleavage site sequence for cloning the long-chain oligonucleotide;

3. The primer set for random splicing of oligonucleotide strands according to claim 1, wherein the length of the oligonucleotide strand to be spliced is 10 to 20nt.

4. A primer set for random splicing of oligonucleotide strands according to any one of claims 1 to 3, wherein the primer set further comprises a Block primer;

the Block primer is a mixture of reverse complementary strands of n oligonucleotide strands.

5. A primer set for random splicing of oligonucleotide strands according to any one of claims 1 to 3, further comprising:

the F2 primer and the R primer are used for carrying out PCR amplification on the spliced long-chain oligonucleotide single chains to form double chains with flat ends and are connected with a vector for cloning.

6. Kit, characterized in that it comprises a primer set for random splicing of oligonucleotide strands according to any one of claims 1 to 5.

7. Use of the primer set for random splicing of oligonucleotide strands according to any one of claims 1 to 5 or the kit according to claim 6 in random oligonucleotide strand library construction or random peptide library construction.

8. A random splicing method of oligonucleotide chains is characterized in that magnetic beads are used as carriers, and any k oligonucleotide chains in n oligonucleotide chains are randomly spliced into long-chain oligonucleotides by adopting the primer set for random splicing of the oligonucleotide chains according to any one of claims 1 to 5.

9. The method for random splicing of oligonucleotide strands according to claim 8, comprising the steps of:

10. The method of random splicing oligonucleotide chains according to claim 9, wherein in the step (3), the final concentration of the Block primer in the extended reaction system is 1 to 3. Mu.M, the final concentration of the primer mixture is 0.5 to 2. Mu.M,

and/or, the reaction conditions for extension are: the reaction is carried out for 15-25min at 37 ℃.

11. The method according to claim 9 or 10, wherein in the step (1), the final concentration of the F1 primer in the reaction system of PCR is 0.3 to 0.5. Mu.M, and the final concentration of the first primer mixture is 0.3 to 0.5. Mu.M;

the reaction procedure of PCR includes: 94-98 ℃, 5-30s,55 ℃, 10-30s,72 ℃, 10-20s and 18-25 cycles;

and/or the number of the groups of groups,

in the step (2), the final concentration of the Block primer is 18-22 mu M;

the elution is to incubate for 2min at 90-95 ℃ and then incubate for 1-3min at 0-4 ℃.

12. The construction method of the random long-chain peptide library is characterized by comprising the following steps of: randomly splicing short-chain oligonucleotides encoding the short-chain peptide library by adopting the method for randomly splicing the oligonucleotide chains according to any one of claims 8-11 to obtain a random long-chain oligonucleotide library, connecting the random long-chain oligonucleotide library with a carrier, and transferring the random long-chain oligonucleotide library into a host cell for expression to obtain the random long-chain peptide library.