CN114317529B - Random splicing method of oligonucleotide chains - Google Patents

Abstract

The invention relates to the technical field of molecular biology, in particular to a random splicing method of an oligonucleotide chain. The random splicing method provided by the invention is to randomly splice any k oligonucleotide chains in n oligonucleotide chains into long-chain oligonucleotides by using magnetic beads as a carrier and adopting a primer group for randomly splicing the oligonucleotide chains. The method can randomly splice short-chain oligonucleotides into long-chain oligonucleotides with high efficiency, and can better ensure the randomness of the nucleotides in the short-chain oligonucleotides and the polymorphism of the sequences by reducing the length of the random sequences of the synthesized nucleotides, and then reach the length of target oligonucleotide chains by random splicing. The long-chain oligonucleotide library and the random peptide library constructed by the method have larger library capacity, higher polymorphism and better application prospect.

Description

A method for random assembly of oligonucleotide chains

Technical field

The invention relates to the technical field of molecular biology, and specifically to a primer set for random assembly of oligonucleotide chains and a method for random assembly of oligonucleotide chains.

Background technique

Peptide libraries are a collection of a large number of short peptides of specific lengths and different sequences, which include permutations and combinations of various (or most) amino acid sequences in short peptides of this length. Currently, screening using random peptide libraries has been widely used in many fields such as protein-protein interactions, drug design and screening.

A common method for synthesizing random peptide libraries is to design nucleotide palindromic sequences during long-chain DNA synthesis, in which the first two nucleotides encoding the random nucleotide sequence are arbitrary nucleotides N (A/T/C/ G), the last nucleotide is designed as K(G/T) based on the degeneracy of codons. According to the conditions of the vector and enzyme cutting site, two oligonucleotide single strands were designed (Christian RB, Zuckermann RN, Kerr JM, Wang L, Malcolm BA. Simplified methods for construction, assessment and rapid screening of peptide libraries inbacteriophage.J Mol Biol. 1992;227(3):711-718.doi:10.1016/0022-2836(92)90219-a.). In PCR amplification, two oligonucleotide single strands are complementary extended into double strands under the action of Taq enzyme. By optimizing PCR reaction conditions and parameters, the diversity of random sequence DNA can be better ensured when constructing oligonucleotide libraries (Hu Youjia, Gao Feng, Zhu Chunbao, et al. Construction of random sequence octapeptide library and its application in two-hybrid system Applications[J]. Biotechnology, 2007, 17(2):82-86.DOI:10.3969/j.issn.1004-311X.2007.02.030.).

Currently, the commonly used peptide libraries on the market are mainly three random peptide libraries provided by NEB, including 7-peptide library (Ph.D.-7), 12-peptide library (Ph.D.-12) and peptide library containing disulfide bonds. Cyclic 7 peptide library (Ph.D.-C7C). Among them, the polypeptides displayed in the Ph.D.-C7C random peptide library have a cysteine added to both sides of the peptide. The capacity of all peptide libraries exceeds 2 billion clones.

There are two main methods for synthesizing random peptide libraries in vitro. The first is Split and Mix, which is divided into three basic steps: Split, Couple and Mix. First, divide the resin ball into equal parts, the number of equal parts is the same as the amino acid type of the peptide library; secondly, couple, add a specific corresponding amino acid component to each equal part for complete reaction; finally mix, this step Mix all equal portions thoroughly. The mixture is then re-divided into the same number of aliquots as before to obtain a homogeneous mixture of equal amounts of peptides. By repeating these three basic steps N times (N is the number of amino acids in a target peptide), a series of new molecules can be quickly generated while the number of resin beads remains unchanged. The resin beads only react with one reactant at a time, and each resin bead only produces one compound (One-bead one-compound: OBOC library, one resin bead, one peptide). Since each reaction is a complete reaction, all peptides in the mixture are in equal proportions. After the protecting groups are removed, the peptides on the resin beads are ready for testing.

The second is Pre-mix. Due to the limitations of the OBOC method for synthesizing larger peptide libraries, the amino acid premix method is commonly used to synthesize mixed peptide libraries. In this method, the amino acids used for peptide library synthesis are mixed in advance and then coupled to a batch of resin beads. Before coupling the last amino acid, the resin sphere is divided into N equal parts (N is equal to the number of amino acid species in the peptide library), and then one amino acid is added for reaction. This results in a sublibrary of N-terminal residue tags. Since each resin sphere is reacted in the same environment and with the same reagents, each resin sphere in the peptide library synthesized by this method contains a collection of all peptides in the sublibrary.

Current random peptide library synthesis methods are generally only able to better ensure the richness and diversity of short peptide libraries when applied to generate short peptide sequences (5-10aa). However, the short length of the peptide will result in a small binding site with the target protein and a weak interaction, which may affect the overall screening efficiency and specificity. When using existing methods to directly randomly synthesize peptide libraries with longer peptide chains, due to length limitations, the randomness of the amino acids at each site is poor, and the diversity of synthesized peptide types will be limited, making it difficult to meet the ideal library construction requirements. Filter criteria.

At present, DNA splicing methods mainly include exonuclease method, uracil-DNA glycosylase method, special restriction endonuclease method and PCR technology. The main principles of the first three methods are to generate complementary sequences on both sides of the DNA fragments or to connect them through overlapping sequences, which requires additional enzyme cutting sites and therefore introduces additional interference sequences. For the purpose of constructing short peptide libraries for screening DNA splicing does not apply. The use of PCR technology for DNA splicing requires the design of a 10-25 bp complementary region between each fragment. The length of this complementary region often exceeds the length of the oligonucleotide chain to be spliced, so it cannot be applied to shorter splicing methods. Multi-fragment splicing of oligonucleotide chains.

Contents of the invention

One of the objects of the present invention is to provide a primer set and kit for random assembly of oligonucleotide chains. Another object of the present invention is to provide a random assembly method of oligonucleotide chains and a method for constructing a random long chain peptide library using this method.

When using organisms to express and synthesize random peptide libraries, the synthesis of oligonucleotide chain libraries is the key to the synthesis of random peptide libraries. The diversity of the random sequence DNA of the oligonucleotide chain random library determines the richness and diversity of the peptide library. For long-chain peptide libraries, direct synthesis of random oligonucleotide chains will lead to poor randomness in nucleotide distribution, thereby affecting the diversity of random DNA sequences. If shorter oligonucleotide chains can be synthesized first and then spliced, the randomness of nucleotide distribution can be better ensured. However, during the research and development of the present invention, it was discovered that the DNA recombination and splicing methods commonly used in the prior art have low splicing efficiency when used to connect short fragments (within 20 bp) oligonucleotide chains, and cannot retain the characteristics of short fragments for connection. , unable to perform a relatively seamless connection (introducing too many interfering sequences), unable to complete random assembly in the same reaction system, unable to meet issues such as blunt-end connection. In order to solve the above problems, the present invention developed an efficient random assembly method of oligonucleotide chains. This random splicing method uses magnetic beads as carriers and utilizes the cooperation of primers, linkers and different DNA polymerases with specially designed structures to achieve high splicing efficiency of oligonucleotide chains.

Specifically, the present invention provides the following technical solutions:

First, the present invention provides a primer set for random assembly of oligonucleotide chains, which randomly assembles any k oligonucleotide chains among n oligonucleotide chains into long-chain oligonucleotides. The primer set Contains n×k primers, n and k are both integers greater than 1, and k<n;

In order to make each oligonucleotide chain appear at any splicing position of the spliced long chain oligonucleotide, the n×k primers are divided into n subgroups, each subgroup contains k primers, and each The k primers of the subgroup are as follows:

The primer of the first oligonucleotide chain located at the 5' end of the assembled long oligonucleotide contains the reverse complement sequence of the first linker sequence and the first oligonucleotide in sequence from the 5'-3' direction. The reverse complement of the acid chain;

The primer of the second oligonucleotide chain located at the 5' end of the spliced long oligonucleotide sequentially contains the reverse complement sequence of the second linker from the 5'-3' direction or the second linker minus 3' The reverse complement of the sequence other than terminal A, the reverse complement of the second oligonucleotide strand, and the reverse complement of the first linker;

The primer of the i-th oligonucleotide chain located at the 5' end of the assembled long-chain oligonucleotide sequentially contains the reverse complement sequence of the i-th linker or the i-th linker except 3' from the 5'-3' direction. The reverse complement sequence of the sequence other than terminal A, the reverse complement sequence of the i-th oligonucleotide chain and the reverse complement sequence of the i-1 linker, where 2<i≤k-1, and is an integer;

The primer of the k-th oligonucleotide chain located at the 5' end of the assembled long-chain oligonucleotide sequentially includes the reverse complementary sequence of the k-th oligonucleotide chain and the k-th oligonucleotide chain from the 5'-3' direction. 1 The reverse complement of the linker.

The position of the above-mentioned oligonucleotide chain on the combined long-chain oligonucleotide is the position of each oligonucleotide chain arranged sequentially from the 5'-3' direction.

The present invention found that due to the short length of the oligonucleotide chain, it is necessary to add a linker between any two oligonucleotide chains to complete splicing. Through the paired extension of the linker region, multiple short oligonucleotide chains can be realized. Splicing of stranded oligonucleotides.

For the i-th oligonucleotide chain, 2<i≤k-1, if the 3' end of the corresponding i-th linker is not A, then its primers include the i-th linker in sequence from the 5'-3' direction. The reverse complement sequence of , the reverse complement sequence of the i-th oligonucleotide chain and the reverse complement sequence of the i-1 linker. If the 3' end of the corresponding i-th linker is A, then its primers include the reverse complementary sequence of the i-th linker except the 3' end A, and the i-th oligonucleotide from the 5'-3' direction. The reverse complement of the acid chain and the reverse complement of the i-1th linker.

Regarding the design of the linker between each oligonucleotide chain, the present invention found that whether the length and sequence of the linker are the same has a significant impact on the splicing efficiency. When the length of the linker is less than 6 nt, the efficiency of correct splicing is significantly reduced. When the lengths of each linker are different or the sequences of some linkers are the same, the splicing efficiency will also be significantly reduced.

Preferably, the length of the above-mentioned linkers is ≥6 nt, the lengths of the 1st to k-1 linkers are the same, and the sequences of each linker are different from each other.

The fact that the above sequences are not identical to each other means that the sequence similarity between the linkers is not 100%.

When expressing a random peptide library, it is usually necessary to first connect the synthesized oligonucleotide chain library to a vector. To facilitate connection with the vector, the primers at both ends of the above primer set may also include sequences complementary to the vector sequence.

Preferably, the 3' end of the primer of the first oligonucleotide chain located at the 5' end of the assembled long-chain oligonucleotide also contains the same sequence as the vector used for cloning the long-chain oligonucleotide and/ Or a sequence that is complementary to the enzyme cleavage site sequence.

The 5' end of the primer of the k-th oligonucleotide chain located at the 5' end of the spliced long oligonucleotide also contains a primer for PCR amplification of the spliced long oligonucleotide single strand. Blunt-ended double-stranded primers have overlapping sequences at the 3' end.

The above-mentioned sequences complementary to the vector sequence and restriction site sequence only need to ensure that they can be efficiently connected to the vector. The preferred length of the complementary sequence is 10-45 bp. The complementary sequence will vary depending on the expression vector chosen.

The above-mentioned sequence overlapping with the 3' end of the primer used to PCR amplify the spliced long oligonucleotide single strand to form a blunt-ended double strand is preferably 10-30 bp, and more preferably 15-20 bp. If necessary, if a stop codon is introduced, a stop codon can be introduced at the 3' end of the overlapping sequence.

As an embodiment of the present invention, the vector used is pGADT7-Rec (the vector sequence is shown in SEQ ID NO. 40).

The random splicing primer set of the present invention can be used to splice oligonucleotide chains of different lengths. The lengths of the oligonucleotide chains to be spliced can be the same or different. It has been experimentally verified that the above random splicing primer set It can meet the efficient assembly of oligonucleotide chains with a length of at least 10-20nt.

Preferably, the length of the oligonucleotide chains to be spliced is 10-20 nt.

As an embodiment of the present invention, the length of the oligonucleotide chain to be spliced is 12nt.

As the number of n increases, the number of random splicing combinations increases, and the number of primers increases. However, the size of n does not affect the splicing efficiency. Therefore, there is no special limit on the number of n in the above primer set.

There is theoretically no special limit on the number of k in the above primer set, but as the number of oligonucleotide chains used to assemble a long oligonucleotide continues to increase, the assembly efficiency may decrease.

It has been verified that the present invention can achieve efficient splicing of at least four oligonucleotide chains.

As a preferred embodiment of the present invention, k=4, and the sequences of the 1st to k-1 linkers (5'-3' direction) are GGTGCA, GCTGCA, and GGAGCA in order.

The present invention finds that the above three connectors are more conducive to ensuring higher splicing efficiency.

In addition to the above primers, the primer set of the present invention also includes a Block primer, which is a mixture of reverse complementary strands of n oligonucleotide strands.

The function of the above-mentioned Block primer is to prevent the double strands formed by the automatic complementation of the oligonucleotide chains, and prevent the double strands formed by the automatic complementation of the oligonucleotide chains from being formed after the splicing is extended to more than two oligonucleotides. It serves as a template in the reaction, thereby preventing the possibility of continued splicing and extension, ensuring the controllability of one-way splicing.

Preferably, the primer set further includes:

F1 primer, used to couple to oligo dT and connect the assembled long-chain oligonucleotide to the vector used for cloning;

The F2 primer and the R primer are used to PCR amplify the spliced long oligonucleotide single strand to form a blunt-ended double strand, and connect it to the vector used for cloning.

Among them, the F1 primer serves as a linker fragment that is complementary to the vector, allowing the spliced long-chain oligonucleotide to be connected to the vector used for its cloning; the F2 primer and the R primer are used together to finalize the long-chain oligonucleotide. The PCR amplification of acid random libraries makes the combined long oligonucleotide single strands completed into blunt-ended double strands during the PCR amplification process, and can be used for sequencing at the same time.

Preferably, the F1 primer contains a reverse complementary sequence of 20-45 bp upstream of the vector insertion site and a polyA tail (preferably 10-14 bp) that can be coupled to oligo dT from the 5'-3' direction.

The F2 primer contains the same forward sequence as the vector 15-35 bp upstream of the vector insertion site from the 5’-3’ direction and can be used for sequencing.

The R primer contains the reverse complementary sequence 20-45 bp downstream of the vector insertion site in sequence from the 5'-3' direction and the primer of the k-th oligonucleotide chain located at the 5' end of the spliced long oligonucleotide. Overlapping 6-8 nucleotides.

Preferably, the F2 primer sequence is completely complementary to the 25-35 bp before the poly A tail of the F1 primer sequence.

As an embodiment of the present invention, six 12nt DNA fragments (SEQ ID NO. 1-6) are used as oligonucleotide chains to be assembled, and any four oligonucleotide chains are randomly assembled. The primer set used for assembly contains 24 (n×k) primers, and the sequences of the 24 primers are shown in SEQ ID NO. 13-36.

The vector used for cloning after assembly is pGADT7-Rec, and the sequences of the F1 primer, R primer and F2 primer are shown in SEQ ID NO. 37-39.

Based on the above primer set, the present invention provides a kit, which includes the primer set for random assembly of oligonucleotide chains.

The kit described above is used for random assembly of oligonucleotide chains. The kit can also contain other reagents for random assembly of oligonucleotide chains, such as: DNA polymerase, dNTPs, Klenow enzyme, reaction buffer, magnetic beads, ddH ₂ O, etc.

The present invention provides the application of the primer set for random assembly of oligonucleotide chains or the kit in the construction of a random oligonucleotide chain library or a random peptide library.

Further, the present invention provides a method for randomly assembling oligonucleotide chains. The method uses magnetic beads as carriers and uses the above-mentioned primer set for random assembly of oligonucleotide chains to combine n oligonucleotide chains. Any k oligonucleotide chains in are randomly assembled into long-chain oligonucleotides.

Preferably, the method includes the following steps:

(1) PCR: Using magnetic beads as a carrier, using F1 primer and the first primer mixture, PCR is performed under the action of high-fidelity DNA polymerase. After the PCR is completed, the first reaction product is obtained through solid-liquid separation;

The first primer mixture is a mixture of primers of the first oligonucleotide chain of each subgroup of the N subgroups located at the 5' end of the assembled long-chain oligonucleotide;

(2) Elution: Mix the first reaction product with the Block primer. After the oligonucleotides are complementary and paired, the first elution product is obtained through elution; mix the first elution product with the Block primer again. , after the oligonucleotides are complementary paired, the second elution product is obtained through elution;

(3) Extension: On the basis of the second elution product in step (2), use the Block primer and the second primer mixture, and use dNTPs as raw materials to perform an extension reaction under the action of Klenow enzyme to obtain the second reaction product;

The second primer mixture is a mixture of primers of the second oligonucleotide chain of each subgroup of the N subgroups located at the 5' end of the assembled long-chain oligonucleotide;

The present invention found that compared with other DNA polymerases, the use of Klenow enzyme during extension can significantly improve the splicing efficiency between oligonucleotide chains;

(4) Repeat steps (2)-(3) to assemble the remaining oligonucleotide chains among the k oligonucleotide chains one by one. In the extension step of the i-th oligonucleotide chain, Block primers and i primer mixture;

The i-th primer mixture is a mixture of primers of the i-th oligonucleotide chain of each subgroup of the N subgroups located at the 5' end of the assembled long-chain oligonucleotide, wherein 2<i≤k- 1, and is an integer;

Finally, repeat steps (2)-(3) to assemble the k-th oligonucleotide chain. In the extension step of the k-th oligonucleotide chain, use the Block primer and the k-th primer mixture;

The k-th primer mixture is a mixture of primers of the k-th oligonucleotide chain of each subgroup in the N subgroups located at the 5' end of the assembled long-chain oligonucleotide;

(5) Elution: After the assembly of step (4) is completed, mix the assembly product with the Block primer, and obtain the elution product through elution;

(6) Use the elution product from step (5) as a template, use F2 primer and R primer to perform PCR, recover the PCR product, and obtain a randomly assembled oligonucleotide library.

In the above-mentioned step (1), the magnetic beads used are magnetic beads coupled with oligo dT. Preference is given to coupling to oligo dT of 25 nt.

The high-fidelity DNA polymerase can be any high-fidelity DNA polymerase, as long as the amplification product has a blunt end, for example: Phanta Max Master Mix, etc.

The solid-liquid separation can use a magnetic stand to separate the supernatant and precipitate, then remove the supernatant and recover the precipitate as the first reaction product.

In the PCR reaction system, the final concentration of the F1 primer is 0.3-0.5 μM, and the final concentration of the first primer mixture is 0.3-0.5 μM.

The preferred 50 μl PCR reaction system is as follows: 10 μl magnetic beads, 25 μl 2× high-fidelity DNA polymerase, reaction buffer corresponding to high-fidelity DNA polymerase, 0.4 μM F1 primer, 0.4 μM first primer mixture, and make up the reaction system with water. .

The PCR reaction program includes: 94-98°C, 5-30s, 55°C, 10-30s, 72°C, 10-20s, 18-25 cycles.

In step (2) of the above method, the final concentration of the Block primer is 18-22 μM. For elution, incubate at 90-95°C for 2 minutes and then incubate at 0-4°C for 1-3 minutes.

In step (3) of the above method, the final concentration of the Block primer in the extension reaction system is 1-3 μM, and the final concentration of the primer mixture is 0.5-2 μM.

The preferred extension reaction system is as follows (total volume 20 μL): first elution product, 2 μM Block primer, 0.5 mM dNTPs, 1×Klenow enzyme reaction buffer, 1 μL Klenow enzyme, 1 μM primer mixture, and make up the reaction system with water.

Wherein, the primer mixture is preferably denatured at 94°C for 2 minutes and then incubated at 37°C.

The preferred order of adding the above reaction system is: first mix the Block primer, water, dNTPs, and reaction buffer, incubate at 94°C for 1-3 minutes, and then incubate at 0-4°C for 1-3 minutes.

The extended reaction conditions are: 37°C for 15-25 minutes.

In the above-mentioned step (6), the final concentration of F2 primer and R primer in the PCR reaction system is 0.3-0.8 μM.

The preferred PCR reaction system is (total volume 50 μL): 2× high-fidelity DNA polymerase Mix 25 μl, F2 primer 0.4 μM, R primer 0.4 μM, and the reaction system is supplemented with water.

The preferred PCR reaction procedure is:

The PCR reaction program includes: 94-98°C, 5-30s, 55°C, 10-30s, 72°C, 10-20s, 18-35 cycles.

The present invention also provides a method for constructing a random peptide library, which method includes the following steps: using the oligonucleotide chain random assembly method to randomly assemble short-chain oligonucleotides encoding short-chain peptide libraries to obtain random long-chain oligonucleotides. For the chain oligonucleotide library, the random long chain oligonucleotide library is connected to the vector and then transferred into host cells for expression to obtain a random long chain peptide library.

In the construction method of the random peptide library described above, in the process of random assembly of oligonucleotide chains, the oligonucleotide chain to be assembled can be NNK (where N represents any nucleotide, and K represents G or T) Random oligonucleotide chains constructed in a coding manner;

Alternatively, the oligonucleotide chain to be assembled can also be a random oligonucleotide chain constructed using NNK (where N represents any nucleotide, and K represents G or T) encoding method, connected to the vector, and in the host cell Express the short peptide library and obtain the oligonucleotide chain corresponding to the preliminary screening peptide library after preliminary screening.

By selecting short peptide sequences that have strong binding to the target in the initial screening for subsequent assembly, construction and re-screening of long-chain peptide libraries, the workload of peptide library construction and screening can be reduced, work efficiency improved, and the results of the preliminary screening can be improved. Verify and enhance the reliability of screening results.

As an embodiment of the present invention, the present invention provides a method for constructing a 16aa random peptide library, which method includes the following steps:

(1) A 4aa random oligonucleotide chain is synthesized using NNK (where N represents any nucleotide and K represents G or T) coding method, connected to a vector, and a short peptide library is expressed in host cells and subjected to preliminary screening The obtained preliminary screened peptide library;

(2) Synthesize the oligonucleotide chains corresponding to each polypeptide in the preliminary screened peptide library, and assemble them using the random assembly method of the oligonucleotide chains to obtain a random oligonucleotide library encoding the random peptide library, and combine the random oligonucleotides with After the nucleotide library is connected to the vector, it is transferred into host cells for expression to obtain a 16aa random peptide library;

Wherein, in the random assembly method of oligonucleotide chains, the length of n oligonucleotide chains is 12nt, and k=4.

Compared with random short peptide libraries, 16aa random peptide libraries can improve screening efficiency and specificity through the interaction of multiple binding sites with target proteins.

The beneficial effects of the present invention at least include: the primer set and random assembly method for random assembly of oligonucleotide chains provided by the present invention solve the problem that certain positions will appear during the synthesis of random long-chain oligonucleotide libraries. Preference leads to insufficient randomness in the distribution of nucleotides at certain sites in the overall DNA double strand, resulting in insufficient polymorphism of the overall library and unsatisfactory screening effects. The oligonucleotide chain random assembly method provided by the invention can randomly assemble short-chain oligonucleotides into long-chain oligonucleotides with higher efficiency. By reducing the length of the directly synthesized nucleotide random sequence, it can effectively It ensures the randomness and polymorphism of DNA in the short-chain oligonucleotide library, and then achieves the length of the target oligonucleotide chain through high-efficiency random assembly. The long-chain oligonucleotide library and random peptide library constructed in this way have a large library capacity, and can well ensure the randomness of each site and the sequence polymorphism of the library.

The random peptide library constructed using the random splicing method of the present invention can be used in yeast two-hybrid, phage display and other screenings, and has good application prospects.

Description of the drawings

Figure 1 is a schematic diagram of the assembly process of oligonucleotide chains in Example 1 of the present invention.

Figure 2 is the insertion sequence sequencing result of the combined positive clone in Example 1 of the present invention.

Figure 3 shows the electrophoresis detection results of the splicing products of oligonucleotides spliced using a 6nt linker in Example 1 of the present invention and without using a linker in Comparative Example 1. Lanes 1 to 5 are in order: marker, no linker 33 The final product of 3 cycles (Comparative Example 1), the final product of 20 cycles of 6nt linker (Example 1), the final product of 33 cycles of 6nt linker (Example 1) and the 132bp positive control.

Figure 4 shows the sequencing results of the incorrectly assembled clones in Comparative Example 2.

Figure 5 shows the sequencing results of the incorrectly assembled clones in Comparative Example 3.

In Figure 4 and Figure 5, insert num represents the number of 12nt oligonucleotide chains, insert length represents the length of the inserted fragment, and insert sequence represents the sequencing result sequence of the inserted fragment.

Detailed ways

The following examples are used to illustrate the invention but are not intended to limit the scope of the invention.

The magnetic beads used in the following examples are magnetic beads coupled to 25nt oligo dT, purchased from Invitrogen, the brand number is Dynabeads ^TM Oligo (dT) 25, product number: 61002; 2×Phanta Max Master Mix is Vazyme, product number is P515- Product of 01; Klenow enzyme is NEB's 3'-5'exo-product.

Example 1 Assembling of oligonucleotide chains

In this example, six 12nt DNA fragments are used as oligonucleotide chains to be assembled, and any four oligonucleotide chains (named A, B, C, D) are randomly assembled. The basic process is: using magnetic beads as Vector, first connect Smart3_RC to the oligo-dT of the magnetic beads, then connect A, B, C, and D to the magnetic beads in different order, and finally use AdrecF primer and CDSIII_RC primer to combine the assembled long-chain oligonucleotides. acid for amplification. The structure of the combined long-chain oligonucleotide is: oligonucleotide chain A-1st linker-oligonucleotide chain B-2nd linker-oligonucleotide chain C-3rd linker-oligonucleotide For nucleotide chain D, the sequences (5'-3') of the first, second and third linkers used are GGTGCA, GCTGCA and GGAGCA respectively.

The specific random stitching method is as follows, and the main process is shown in Figure 1:

1. PCR: Take 10 μl of magnetic beads, add 50 μl of water, mix well, and wash at room temperature, twice in total;

Add 2μl F1 primer (10μM), 2μl A_RC (10μM), 21μl H ₂ O, 25μl 2×Phanta Mix to the washed magnetic beads, mix well to obtain a PCR reaction system;

The PCR reaction system was subjected to PCR with the following program: 95°C, 15s, 55°C, 15s, 72°C, 15s, 20 cycles, pipetting and mixing every 10 minutes;

After the PCR reaction is completed, use a pipette to pipette evenly, place on a magnetic stand at room temperature, remove the supernatant, and obtain the first reaction product;

2. Elution: Add 20 μl Block primer (20 μM) to the first reaction product obtained in step 1, mix well, incubate at 94°C for 2 minutes, place on ice for 2 minutes, place on a magnetic stand, remove the supernatant, and repeat the Block primer wash. Strip once, place on a magnetic stand to remove the supernatant, and obtain the eluted product;

3. Extension: Add 2μl Block primer (20μM), 12μl H ₂ O, 1μl ldNTPs (10mM each), 2μl 10×NEB Buffer 2 to the elution product obtained in step 2, pipet evenly, incubate at 94°C for 2 minutes, and then Place on ice for 2 minutes, then add 1 μL of Klenow (exo-, NEB), and finally add 2 μl of B_RCprimer (10 μM) that has been denatured at 94°C for 2 minutes and incubated at 37°C, mix well, and react at 37°C for 20 minutes, using a pipette every 10 minutes. Whisk to mix;

4. Elution: Repeat step 2;

5. Extension: Repeat step 3, the only difference is that use 2μl C_RC primer (10μM) instead of B_RC primer (10μM);

6. Elution: Repeat step (2);

7. Extension: Repeat step 3, the only difference is that use 2μl D_RC primer (10μM) instead of B_RC primer (10μM);

8. Elution: Repeat step 2 to obtain the elution product;

9. Use the elution product in step 8 as a template, use F2 primer and R primer to perform PCR amplification, recover the amplification product, and obtain a randomly assembled oligonucleotide library;

Among them, the reaction system for PCR amplification is as follows (total volume 50 μL): 2×Phanta Max Master Mix 25 μl, AdrecF primer 0.4 μM, Cds3_RC primer 0.4 μM, and the reaction system is supplemented with water.

The reaction program of PCR amplification is as follows. The reaction program of PCR includes: 95℃, 30s, 55℃, 15s, 72℃, 15s, 20 cycles or 33 cycles.

In the above method, the sequences of the six 12nt oligonucleotide chains are as follows (the direction is 5’-3’, and the direction of all the following primer sequences is also 5’-3’):

GTGGCGATTCAG;

TGGGCTAGTGAT;

CGGGTGCCGCTT;

TTGCTTGTTCAG;

AATGCTACTGGT;

CCGTGTACGGCT;

Block primer is a mixture of six 12nt oligonucleotide chains and reverse complementary oligonucleotide chains. The primer sequence it contains is as follows:

CTGAATCGCCAC;

ATCACTAGCCCA;

AAGCGGCACCCG;

CTGAACAAGCAA;

ACCAGTAGCATT;

AGCCGTACACGG;

Primer A_RC is a mixture of all primers (6 primers) when the 6 12nt oligonucleotide chains are at the position of the first oligonucleotide chain in the 5’-3’ direction of the assembled long-chain oligonucleotide;

The sequences of these 6 primers are as follows:

A_RC1:TGCACCCTGAATCGCCACGGGCCATAATGGCCACTC;

A_RC2:TGCACCATCACTAGCCCAGGGCCATAATGGCCACTC;

A_RC3:TGCACCAAGCGGCACCCGGGGCCATAATGGCCACTC;

A_RC4:TGCACCCTGAACAAGCAAGGGCCATAATGGCCACTC;

A_RC5:TGCACCACCAGTAGCATTGGGCCATAATGGCCACTC;

A_RC6:TGCACCAGCCGTACACGGGGGCCATAATGGCCACTC.

Primer B_RC is a mixture of all primers (6 primers) when the 6 12nt oligonucleotide chains are at the position of the second oligonucleotide chain in the 5’-3’ direction of the assembled long-chain oligonucleotide;

The sequences of these 6 primers are as follows:

B_RC1:GCAGCCTGAATCGCCACTGCACC;

B_RC2:GCAGCATCACTAGCCCATGCACC;

B_RC3:GCAGCAAGCGGCACCCGTGCACC;

B_RC4:GCAGCCTGAACAAGCAATGCACC;

B_RC5:GCAGCACCAGTAGCATTTGCACC;

B_RC6:GCAGCAGCCGTACACGGTGCACC.

Primer C_RC is a mixture of all primers (6 primers) when the 6 12nt oligonucleotide chains are at the position of the third oligonucleotide chain in the 5’-3’ direction of the assembled long-chain oligonucleotide;

The sequences of these 6 primers are as follows:

C_RC1:GCTCCCTGAATCGCCACTGCAGC;

C_RC2:GCTCCATCACTAGCCCATGCAGC;

C_RC3:GCTCCAAGCGGCACCCGTGCAGC;

C_RC4:GCTCCCTGAACAAGCAATGCAGC;

C_RC5:GCTCCACCAGTAGCATTTGCAGC;

C_RC6:GCTCCAGCCGTACACGGTGCAGC.

Primer D_RC is a mixture of all primers (6 primers) of six 12nt oligonucleotide chains at the position of the fourth oligonucleotide chain in the 5’-3’ direction of the assembled long-chain oligonucleotide.

The sequences of these 6 primers are as follows:

D_RC1:GAGGCGGCCGACATGCTACTGAATCGCCACTGCTCC;

D_RC2:GAGGCGGCCGACATGCTAATCACTAGCCCATGCTCC;

D_RC3:GAGGCGGCCGACATGCTAAAGCGGCACCCGTGCTCC;

D_RC4:GAGGCGGCCGACATGCTACTGAACAAGCAATGCTCC;

D_RC5:GAGGCGGCCGACATGCTAACCAGTAGCATTTGCTCC;

D_RC6:GAGGCGGCCGACATGCTAAGCCGTACACGGTGCTCCC.

The sequence of the F1 primer is as follows:

GGGCCATAATGGCCACTCTGCGTTGATACCACTGCTTGGGTGGAAAAAAAAAAAAAAAA.

The sequence of the R primer is as follows:

GTATCGATGCCCACCCTCTAGAGGCCGAGGCGGCCGACATGCTA.

The sequence of the F2 primer is as follows:

TTCCACCCAAGCAGTGGTATCAACGCAGAGT.

Comparative example 1

This comparative example provides a method for assembling oligonucleotide chains. The only difference from Example 1 is that no linkers are provided between the short-chain oligonucleotides to be assembled, and each link in Example 1 is deleted accordingly. The linker sequence in the primer sequence and other methods were the same as in Example 1.

Comparative example 2

This comparative example provides a method for assembling oligonucleotide chains. The only difference from Example 1 is that the linker in Example 1 is replaced by the following linker:

The first linker is GGA, the second linker is GGA, and the third linker is GGA.

Replace the linker sequence in each primer sequence accordingly, and other methods are the same as in Example 1.

Comparative example 3

This comparative example provides a method for assembling oligonucleotide chains. The only difference from Example 1 is that the linker in Example 1 is replaced by the following linker:

The first linker is GGGGGA, the second linker is GGGGGA, and the third linker is GGGGGA.

Replace the linker sequence in each primer sequence accordingly, and other methods are the same as in Example 1.

Experimental example

The random oligonucleotide chain libraries constructed in the above examples and comparative examples were tested for assembly efficiency, library capacity and polymorphism. The specific process is as follows:

1. Library concentration detection

Agarose gel electrophoresis was used to detect the assembled final products obtained by performing PCR amplification cycles of 20 and 33 cycles in step 9 in Example 1 and Comparative Example 1, respectively. The results are shown in Figure 3. In Comparative Example 1 without a linker, there was still no clear product band after 33 cycles of amplification, indicating that a successfully assembled product could not be obtained without a linker, and the assembly efficiency was 0, so subsequent steps were not performed. Cloning and sequencing detection; clear bands can be seen in the combined final products obtained by 20 cycles and 33 cycles of amplification in Example 1, indicating that the content of the final product is about 100ng.

Calculated according to the following formula, clear bands can be seen after 20 cycles of amplification. The capacity of the random oligonucleotide chain library corresponding to the assembled 16aa peptide library is approximately 80 million copies.

Among them, N is the number of cycles, M is the copy amount, and the mass unit is ng.

The above results show that the random oligonucleotide chain library constructed using the random assembly method of Example 1 of the present invention can meet the screening library capacity requirements.

2. Splitting efficiency and polymorphism detection

The combined final products obtained in Example 1 and each comparative example were subjected to DNA agarose gel electrophoresis, the DNA products were gel recovered and purified, and ligated into a T vector for cloning, and the obtained clones were sent for sequencing. The length of the successfully assembled long-chain oligonucleotide in Example 1 should be 66 nt, therefore, the inserted fragment of the positive clone should be 66 bp.

Among them, 50 of the 20 cycles and 33 cycles of the final assembly product of Example 1 were randomly selected for sequencing, totaling 100. Clones that could not be connected to the vector were excluded, and a total of 81 clones with fragment insertion were obtained. For these 81 clones, The clones were verified by DNA sequencing. The clone sequencing results of the final splicing product obtained after 20 cycles of PCR amplification are shown in Table 1. Among them, the mutations in the clones that were successfully spliced (the length of the inserted fragment is 66 bp) and the clones to be spliced. The statistics of the proportion of short-chain oligonucleotides appearing in all successfully assembled clones are shown in Table 2; the statistics of clone sequencing results of the assembled final products obtained by 33 cycles of PCR amplification are shown in Table 3, among which, the successfully assembled ( The mutation status in clones with an insert length of 66 bp) and the statistics of the proportion of short-chain oligonucleotides to be spliced in all successfully spliced clones are shown in Table 4. The sequencing results of some successfully assembled long-chain oligonucleotides are shown in Figure 2.

The results show that the assembly efficiency of the short-chain oligonucleotide of Example 1 is 46%, indicating that the assembly method of the present invention has high assembly efficiency. Among the successfully assembled clones, the six 12bp short-chain oligonucleotide chains appear at a relatively even rate. It can be seen that the long-chain oligonucleotide library has high polymorphism and can meet the requirements for oligonucleotides during peptide library screening. Polymorphism requirements for acid libraries.

Table 1 Statistics of clone sequencing of the final assembly product after 20 cycles of amplification

Number of clones Proportion of clones (%) Insert exists 42 —— The insert length is 66bp 17 40.50% Insert length is 30bp 1 2.40% The insert length is 48bp 7 16.60% other lengths 17 40.50%

Table 2 Statistics of clone sequencing of the final product of successful assembly after 20 cycles of amplification

Note: In Table 2, the proportion of various nucleotides without mutations is the proportion of their occurrence in all clones without mutations, and the proportion with mutations is the proportion of mutations in a total of 68 clones.

Table 3 Statistics of clone sequencing of the final product of 33 cycles of amplification

Number of clones Proportion of clones (%) Insert exists 39 —— The insert length is 66bp 20 51.30 Insert length is 30bp 2 5.10 The insert length is 48bp 9 23.10 other lengths 8 20.50

Table 4 Statistics on clone sequencing of the final product of successful assembly after 33 cycles of amplification

Note: In Table 4, the proportion of various nucleotides without mutations is the proportion of their occurrence in all clones without mutations, and the proportion with mutations is the proportion of mutations in a total of 80 clones.

Comparative Examples 2 and 3 were cloned to obtain 21 and 36 clones containing fragment insertions from the combined final products obtained by 33 cycles of PCR amplification in Comparative Examples 2 and 3, respectively. These clones were verified by DNA sequencing. Among them, the length of the successfully assembled long-chain oligonucleotide of Comparative Example 2 should be 57nt, and the length of the successfully assembled long-chain oligonucleotide of Comparative Example 3 should be 66nt, and the inserted fragments of the positive clones should be respectively are 57bp and 66bp.

The statistical results of clone sequencing in Comparative Examples 2 and 3 are shown in Figures 4 and 5. The results show that none of the clones in Comparative Examples 2 and 3 have clones that match the spliced 57bp and 66bp. Therefore, Comparative Example 2 The positive rates of the splicing method of Comparative Example 3 and Comparative Example 3 are both 0.

Although the present invention has been described in detail with general descriptions and specific embodiments above, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

sequence list

<110> Peking University

<120> A method of random assembly of oligonucleotide chains

<130> KHP211121626.2

<160> 40

<170> SIPOSequenceListing 1.0

<210> 1

<211> 12

<212> DNA

<213> Artificial Sequence

<400> 1

gtggcgattc ag 12

<210> 2

<211> 12

<212> DNA

<213> Artificial Sequence

<400> 2

tgggctagtg at 12

<210> 3

<211> 12

<212> DNA

<213> Artificial Sequence

<400> 3

cgggtgccgc tt 12

<210> 4

<211> 12

<212> DNA

<213> Artificial Sequence

<400> 4

ttgcttgttc ag 12

<210> 5

<211> 12

<212> DNA

<213> Artificial Sequence

<400> 5

aatgctactg gt 12

<210> 6

<211> 12

<212> DNA

<213> Artificial Sequence

<400> 6

ccgtgtacggct 12

<210> 7

<211> 12

<212> DNA

<213> Artificial Sequence

<400> 7

ctgaatcgcc ac 12

<210> 8

<211> 12

<212> DNA

<213> Artificial Sequence

<400> 8

atcactagcc ca 12

<210> 9

<211> 12

<212> DNA

<213> Artificial Sequence

<400> 9

aagcggcacc cg 12

<210> 10

<211> 12

<212> DNA

<213> Artificial Sequence

<400> 10

ctgaacaagc aa 12

<210> 11

<211> 12

<212> DNA

<213> Artificial Sequence

<400> 11

accagtagca tt 12

<210> 12

<211> 12

<212> DNA

<213> Artificial Sequence

<400> 12

agccgtacac gg 12

<210> 13

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 13

tgcaccctga atcgccacgg gccataatgg ccactc 36

<210> 14

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 14

tgcaccatca ctagcccagg gccataatgg ccactc 36

<210> 15

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 15

tgcaccaagc ggcacccggg gccataatgg ccactc 36

<210> 16

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 16

tgcaccctga acaagcaagg gccataatgg ccactc 36

<210> 17

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 17

tgcaccacca gtagcattgg gccataatgg ccactc 36

<210> 18

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 18

tgcaccagcc gtacacgggg gccataatgg ccactc 36

<210> 19

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 19

gcagcctgaa tcgccactgc acc 23

<210> 20

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 20

gcagcatcac tagcccatgc acc 23

<210> 21

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 21

gcagcaagcg gcacccgtgc acc 23

<210> 22

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 22

gcagcctgaa caagcaatgc acc 23

<210> 23

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 23

gcagcaccag tagcatttgc acc 23

<210> 24

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 24

gcagcagccg tacacggtgc acc 23

<210> 25

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 25

gctccctgaa tcgccactgc agc 23

<210> 26

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 26

gctccatcac tagcccatgc agc 23

<210> 27

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 27

gctccaagcg gcacccgtgc agc 23

<210> 28

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 28

gctccctgaa caagcaatgc agc 23

<210> 29

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 29

gctccaccag tagcatttgc agc 23

<210> 30

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 30

gctccagccg tacacggtgc agc 23

<210> 31

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 31

gaggcggccg acatgctact gaatcgccac tgctcc 36

<210> 32

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 32

gaggcggccg acatgctaat cactagccca tgctcc 36

<210> 33

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 33

gaggcggccg acatgctaaa gcggcacccg tgctcc 36

<210> 34

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 34

gaggcggccg acatgctact gaacaagcaa tgctcc 36

<210> 35

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 35

gaggcggccg acatgctaac cagtagcatt tgctcc 36

<210> 36

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 36

gaggcggccg acatgctaag ccgtacacgg tgctcc 36

<210> 37

<211> 59

<212> DNA

<213> Artificial Sequence

<400> 37

gggccataat ggccactctg cgttgatacc actgcttggg tggaaaaaaa aaaaaaaaa 59

<210> 38

<211> 44

<212> DNA

<213> Artificial Sequence

<400> 38

gtatcgatgc ccaccctcta gaggccgagg cggccgacat gcta 44

<210> 39

<211> 31

<212> DNA

<213> Artificial Sequence

<400> 39

ttccacccaa gcagtggtat caacgcagag t 31

<210> 40

<211> 8058

<212> DNA

<213> Artificial Sequence

<400> 40

tgcatgcctg caggtcgaga tccggggatcg aagaaatgat ggtaaatgaa ataggaaatc 60

aaggagcatg aaggcaaaag acaaataa gggtcgaacg aaaaataaag tgaaaagtgt 120

tgatatgatg tatttggctt tgcggcgccg aaaaaacgag tttacgcaat tgcacaatca 180

tgctgactct gtggcggacc cgcgctcttg ccggcccggc gataacgctg ggcgtgaggc 240

tgtgcccggc ggagtttttt gcgcctgcat tttccaaggt ttaccctgcg ctaaggggcg 300

agattggaga agcaataaga atgccggttg gggttgcgat gatgacgacc acgacaactg 360

gtgtcattat ttaagttgcc gaaagaacct gagtgcattt gcaacatgag tatactagaa 420

gaatgagcca agacttgcga gacgcgagtt tgccggtggt gcgaacaata gagcgaccat 480

gaccttgaag gtgagacgcg cataaccgct agagtacttt gaagaggaaa cagcaatagg 540

gttgctacca gtataaatag acaggtacat acaacactgg aaatggttgt ctgtttgagt 600

acgctttcaa ttcatttggg tgtgcacttt attatgttac aatatggaag ggaactttac 660

acttctccta tgcacatata ttaattaaag tccaatgcta gtagagaagg ggggtaacac 720

ccctccgcgc tcttttccga tttttttcta aaccgtggaa tatttcggat atccttttgt 780

tgtttccggg tgtacaatat ggacttcctc ttttctggca accaaaccca tacatcggga 840

ttcctataat accttcgttg gtctccctaa catgtaggtg gcggagggga gatatacaat 900

agaacagata ccagacaaga cataatgggc taaacaagac tacaccaatt acactgcctc 960

attgatggtg gtacataacg aactaatact gtagccctag acttgatagc catcatcata 1020

tcgaagtttc actacccttt ttccatttgc catctattga agtaataata ggcgcatgca 1080

acttcttttc tttttttttc ttttctctct cccccgttgt tgtctcacca tatccgcaat 1140

gacaaaaaaa tgatggaaga cactaaagga aaaaattaac gacaaagaca gcaccaacag 1200

atgtcgttgt tccagagctg atgaggggta tctcgaagca cacgaaactt tttccttcct 1260

tcattcacgc acactactct ctaatgagca acggtatacg gccttccttc cagttatacttg 1320

aatttgaaat aaaaaaaagt ttgctgtctt gctatcaagt ataaatagac ctgcaattat 1380

taatcttttg tttcctcgtc attgttctcg ttccctttct tccttgtttc tttttctgca 1440

caatatttca agctatacca agcatacaat caactccaag ctttgcaaag atggataaag 1500

cggaattaat tcccgagcct ccaaaaaaga agagaaaggt cgaattgggt accgccgcca 1560

attttaatca aagtgggaat attgctgata gctcattgtc cttcactttc actaacagta 1620

gcaacggtcc gaacctcata acaactcaaa caaattctca agcgctttca caaccaattg 1680

cctcctctaa cgttcatgat aacttcatga ataatgaaat cacggctagt aaaattgatg 1740

atggtaataa ttcaaaacca ctgtcacctg gttggacgga ccaaactgcg tataacgcgt 1800

ttggaatcac tacagggatg tttaatacca ctacaatgga tgatgtatat aactatctat 1860

tcgatgatga agatacccca ccaaacccaa aaaaagagat ctttaatacg actcactata 1920

gggcgagcgc cgccatggag tacccatacg acgtaccaga ttacgctcat atggccatgg 1980

aggccagtga attccaccca agcagtggta tcaacgcaga gtggccatta tggcccggga 2040

aaaaacatgt cggccgcctc ggcctctaga gggtgggcat cgatacggga tccatcgagc 2100

tcgagctgca gatgaatcgt agatactgaa aaaccccgca agttcacttc aactgtgcat 2160

cgtgcaccat ctcaatttct ttcatttata catcgttttg ccttctttta tgtaactata 2220

ctcctctaag tttcaatctt ggccatgtaa cctctgatct atagaatttt ttaaatgact 2280

agaattaatg cccatctttt ttttggacct aaattcttca tgaaaatata ttacgagggc 2340

ttattcagaa gctttggact tcttcgccag aggtttggtc aagtctccaa tcaaggttgt 2400

cggcttgtct accttgccag aaatttacga aaagatggaa aagggtcaaa tcgttggtag 2460

atacgttgtt gacacttcta aataagcgaa tttcttatga tttatgattt ttattattaa 2520

ataagttata aaaaaaataa gtgtatacaa attttaaagt gactcttagg ttttaaaacg 2580

aaaattctta ttcttgagta actctttcct gtaggtcagg ttgctttctc aggtatagca 2640

tgaggtcgct cttattgacc acacctctac cggccggtcg aaattcccct accctatgaa 2700

catattccat tttgtaattt cgtgtcgttt ctattatgaa tttcatttat aaagtttatg 2760

tacaaatatc ataaaaaaag agaatctttt taagcaagga ttttcttaac ttcttcggcg 2820

acagcatcac cgacttcggt ggtactgttg gaaccaccta aatcaccagt tctgatacct 2880

gcatccaaaa cctttttaac tgcatcttca atggccttac cttcttcagg caagttcaat 2940

gacaatttca acatcattgc agcagacaag atagtggcga tagggttgac cttattcttt 3000

ggcaaatctg gagcagaacc gtggcatggt tcgtacaaac caaatgcggt gttcttgtct 3060

ggcaaagagg ccaaggacgc agatggcaac aaacccaagg aacctgggat aacggaggct 3120

tcatcggaga tgatatcacc aaacatgttg ctggtgatta taataccatt taggtgggtt 3180

gggttcttaa ctaggatcat ggcggcagaa tcaatcaatt gatgttgaac cttcaatgta 3240

ggaaattcgt tcttgatggt ttcctccaca gtttttctcc ataatcttga agaggccaaa 3300

acattagctt tatccaagga ccaaataggc aatggtggct catgttgtag ggccatgaaa 3360

gcggccattc ttgtgattct ttgcacttct ggaacggtgt attgttcact atcccaagcg 3420

acaccatcac catcgtcttc ctttctctta ccaaagtaaa tacctcccac taattctctg 3480

acaacaacga agtcagtacc tttagcaaat tgtggcttga ttggagataa gtctaaaaga 3540

gagtcggatg caaagttaca tggtcttaag ttggcgtaca attgaagttc tttacggatt 3600

tttagtaaac cttgttcagg tctaacacta cctgtacccc atttaggacc acccacagca 3660

cctaacaaaa cggcatcagc cttcttggag gcttccagcg cctcatctgg aagtgggaca 3720

cctgtagctt cgatagcagc accaccaatt aaatgatttt cgaaatcgaa cttgacattg 3780

gaacgaacat cagaaatagc tttaagaacc ttaatggctt cggctgtgat ttcttgacca 3840

acgtggtcac ctggcaaaac gacgatcttc ttaggggcag acattagaat ggtatatcct 3900

tgaaatatat atatatattg ctgaaatgta aaaggtaaga aaagttagaa agtaagacga 3960

ttgctaacca cctattggaa aaaacaatag gtccttaaat aatattgtca acttcaagta 4020

ttgtgatgca agcatttagt catgaacgct tctctattct atatgaaaag ccggttccgg 4080

cgctctcacc tttccttttt ctcccaattt ttcagttgaa aaaggtatat gcgtcaggcg 4140

acctctgaaa ttaacaaaaa atttccagtc atcgaatttg attctgtgcg atagcgcccc 4200

tgtgtgttct cgttatgttg aggaaaaaaa taatggttgc taagagattc gaactcttgc 4260

atcttacgat acctgagtat tcccacagtt gggggatctc gactctagct agaggatcaa 4320

ttcgtaatca tgtcatagct gtttcctgtg tgaaattgtt atccgctcac aattccacac 4380

aacatacgag ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt gagctaactc 4440

acattaattg cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc gtgccagctg 4500

ataacttcgt ataatgtatg ctatacgaag ttattaggtc tgaagaggag tttacgtcca 4560

gccaagctag cttggctgca ggtcgagcgg ccgcgatccg gaacccttaa tataacttcg 4620

tataatgtat gctatacgaa gttatcagct gcattaatga atcggccaac gcgcggggag 4680

aggcggtttg cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt 4740

cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga 4800

atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg 4860

taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa 4920

aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt 4980

tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct 5040

gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct 5100

cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc 5160

cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt 5220

atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc 5280

tacagagttc ttgaagtggt ggcctaacta cggctacact agaagaacag tatttggtat 5340

ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa 5400

acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa 5460

aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga 5520

aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct 5580

tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga 5640

cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc 5700

catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg 5760

ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat 5820

aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat 5880

ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg 5940

caacgttgtt gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc 6000

attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa 6060

agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg cagtgttatc 6120

actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt 6180

ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc ggcgaccgag 6240

ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt 6300

gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag 6360

atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt ttactttcac 6420

cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc 6480

gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa gcatttatca 6540

gggttatattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aacaaatagg 6600

ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc taagaaacca ttattatcat 6660

gacattaacc tataaaaata ggcgtatcac gaggcccttt cgtctcgcgc gtttcggtga 6720

tgacggtgaa aacctctgac acatgcagct cccggagacg gtcacagctt gtctgtaagc 6780

ggatgccggg agcagacaag cccgtcaggg cgcgtcagcg ggtgttggcg ggtgtcgggg 6840

ctggcttaac tatgcggcat cagagcagat tgtactgaga gtgcaccata acgcatttaa 6900

gcataaacac gcactatgcc gttcttctca tgtatatata tatacaggca acacgcagat 6960

ataggtgcga cgtgaacagt gagctgtatg tgcgcagctc gcgttgcatt ttcggaagcg 7020

ctcgttttcg gaaacgcttt gaagttccta ttccgaagtt cctattctct agctagaaag 7080

tataggaact tcagagcgct tttgaaaacc aaaagcgctc tgaagacgca ctttcaaaaa 7140

accaaaaacg caccggactg taacgagcta ctaaaatatt gcgaataccg cttccacaaa 7200

cattgctcaa aagtatctct ttgctatata tctctgtgct atatccctat ataacctacc 7260

catccacctt tcgctccttg aacttgcatc taaactcgac ctctacattt tttatgttta 7320

tctctagtat tactctttag acaaaaaaat tgtagtaaga actattcata gagtgaatcg 7380

aaaacaatac gaaaatgtaa acatttccta tacgtagtat atagagacaa aatagaagaa 7440

accgttcata attttctgac caatgaagaa tcatcaacgc tatcactttc tgttcacaaaa 7500

gtatgcgcaa tccacatcgg tatagaatat aatcggggat gcctttatct tgaaaaaatg 7560

cacccgcagc ttcgctagta atcagtaaac gcgggaagtg gagtcaggct ttttttatgg 7620

aagagaaaat agacaccaaa gtagccttct tctaacctta acggacctac agtgcaaaaa 7680

gttatcaaga gactgcatta tagagcgcac aaaggagaaa aaaagtaatc taagatgctt 7740

tgttagaaaa atagcgctct cgggatgcat ttttgtagaa caaaaaagaa gtatagattc 7800

tttgttggta aaatagcgct ctcgcgttgc atttctgttc tgtaaaaatg cagctcagat 7860

tctttgtttg aaaaattagc gctctcgcgt tgcatttttg ttttacaaaa atgaagcaca 7920

gattcttcgt tggtaaaata gcgctttcgc gttgcatttc tgttctgtaa aaatgcagct 7980

cagattcttt gtttgaaaaa ttagcgctct cgcgttgcat ttttgttcta caaaatgaag 8040

cacagatgct tcgttgct 8058

Claims (12)

1. A primer set for random splicing of oligonucleotide chains, characterized in that any k oligonucleotide chains of n oligonucleotide chains are randomly spliced into long-chain oligonucleotides, the primer set comprises n×k primers, n and k are integers greater than 1, and k is less than n;

the n x k primers are divided into n subgroups, each subgroup containing k primers, the k primers of each subgroup being as follows:

the primer of the 1 st oligonucleotide strand positioned at the 5' end of the spliced long-chain oligonucleotide sequentially comprises a reverse complementary sequence of the 1 st linker sequence and a reverse complementary sequence of the oligonucleotide strand from the 5' -3' direction;

the primer of the 2 nd oligonucleotide strand positioned at the 5 'end of the spliced long-chain oligonucleotide sequentially comprises a reverse complement sequence of the 2 nd linker or a reverse complement sequence of the 2 nd linker except for the 3' end A, a reverse complement sequence of the oligonucleotide strand and a reverse complement sequence of the 1 st linker from the 5'-3' direction;

the primer of the ith oligonucleotide strand positioned at the 5 'end of the spliced long-chain oligonucleotide sequentially comprises a reverse complement sequence of the ith linker or a reverse complement sequence of the ith linker except for the 3' end A, the reverse complement sequence of the oligonucleotide strand and the reverse complement sequence of the ith-1 linker from the 5'-3' direction, wherein i is more than 2 and less than or equal to k-1, and is an integer;

the primer of the kth oligonucleotide strand positioned at the 5' -end of the spliced long-chain oligonucleotide sequentially comprises a reverse complement sequence of the kth oligonucleotide strand and a reverse complement sequence of the kth-1 linker from the 5' -3' -direction;

the length of the linker is more than or equal to 6nt, the lengths of the 1 st to k-1 st linkers are the same, and the sequences of the linkers are different from each other;

wherein k=4, and the sequence of the 1 st to k-1 st linkers is GGTGCA, GCTGCA, GGAGCA in sequence.

2. The primer set for random splicing of oligonucleotide strands according to claim 1, wherein the 3 '-end of the primer of the 1 st oligonucleotide strand located at the 5' -end of the long-chain oligonucleotide after splicing further contains a sequence complementary to a vector sequence and/or a cleavage site sequence for cloning the long-chain oligonucleotide;

the 5' end of the primer of the kth oligonucleotide strand located at the 5' end of the spliced long-chain oligonucleotide also contains a sequence overlapping with the 3' end of the primer for PCR amplification of the spliced long-chain oligonucleotide single strand to form a blunt-ended double strand.

3. The primer set for random splicing of oligonucleotide strands according to claim 1, wherein the length of the oligonucleotide strand to be spliced is 10 to 20nt.

4. A primer set for random splicing of oligonucleotide strands according to any one of claims 1 to 3, wherein the primer set further comprises a Block primer;

the Block primer is a mixture of reverse complementary strands of n oligonucleotide strands.

5. A primer set for random splicing of oligonucleotide strands according to any one of claims 1 to 3, further comprising:

f1 primer for coupling with oligo dT and ligating the spliced long-chain oligonucleotide with a vector for cloning;

the F2 primer and the R primer are used for carrying out PCR amplification on the spliced long-chain oligonucleotide single chains to form double chains with flat ends and are connected with a vector for cloning.

6. Kit, characterized in that it comprises a primer set for random splicing of oligonucleotide strands according to any one of claims 1 to 5.

7. Use of the primer set for random splicing of oligonucleotide strands according to any one of claims 1 to 5 or the kit according to claim 6 in random oligonucleotide strand library construction or random peptide library construction.

8. A random splicing method of oligonucleotide chains is characterized in that magnetic beads are used as carriers, and any k oligonucleotide chains in n oligonucleotide chains are randomly spliced into long-chain oligonucleotides by adopting the primer set for random splicing of the oligonucleotide chains according to any one of claims 1 to 5.

9. The method for random splicing of oligonucleotide strands according to claim 8, comprising the steps of:

(1) And (2) PCR: taking magnetic beads as a carrier, adopting an F1 primer and a first primer mixture, performing PCR under the action of high-fidelity DNA polymerase, and performing solid-liquid separation after the PCR is finished to obtain a first reaction product;

the first primer mixture is a mixture of primers of the 1 st oligonucleotide chain of each subgroup in the N subgroups, which is positioned at the 5' end of the spliced long-chain oligonucleotide;

(2) Eluting: mixing the first reaction product with a Block primer, and eluting after complementary pairing of the oligonucleotides to obtain a first eluting product; mixing the first eluting product with the Block primer, and eluting after complementary pairing of the oligonucleotides to obtain a second eluting product;

(3) Extension: on the basis of the second elution product in the step (2), adopting a Block primer and a second primer mixture, and carrying out an extension reaction under the action of Klenow enzyme by taking dNTPs as raw materials to obtain a second reaction product;

the second primer mixture is a mixture of primers of the 2 nd oligonucleotide chain of each subgroup in the N subgroups, which is positioned at the 5' end of the spliced long-chain oligonucleotide;

(4) Repeating steps (2) - (3), and splicing the rest of the k oligonucleotide chains one by one, wherein in the extension step of the ith oligonucleotide chain, a Block primer and an ith primer mixture are adopted;

the ith primer mixture is a mixture of primers of an ith oligonucleotide chain of each subgroup in N subgroups, which is positioned at the 5' end of the spliced long-chain oligonucleotide, wherein i is more than 2 and less than or equal to k-1, and is an integer;

finally repeating the steps (2) - (3) to splice the kth oligonucleotide chain, and adopting a Block primer and a kth primer mixture in the extension step of the kth oligonucleotide chain;

the kth primer mixture is a mixture of primers of kth oligonucleotide chains of each subgroup N positioned at the 5' end of the spliced long-chain oligonucleotides;

(5) Eluting: after the splicing in the step (4) is finished, mixing the spliced product with a Block primer, and eluting to obtain an eluted product;

(6) And (3) taking the eluted product in the step (5) as a template, adopting an F2 primer and an R primer to carry out PCR, and recovering the PCR product to obtain the randomly spliced oligonucleotide library.

10. The method of random splicing oligonucleotide chains according to claim 9, wherein in the step (3), the final concentration of the Block primer in the extended reaction system is 1 to 3. Mu.M, the final concentration of the primer mixture is 0.5 to 2. Mu.M,

and/or, the reaction conditions for extension are: the reaction is carried out for 15-25min at 37 ℃.

11. The method according to claim 9 or 10, wherein in the step (1), the final concentration of the F1 primer in the reaction system of PCR is 0.3 to 0.5. Mu.M, and the final concentration of the first primer mixture is 0.3 to 0.5. Mu.M;

the reaction procedure of PCR includes: 94-98 ℃, 5-30s,55 ℃, 10-30s,72 ℃, 10-20s and 18-25 cycles;

and/or the number of the groups of groups,

in the step (2), the final concentration of the Block primer is 18-22 mu M;

the elution is to incubate for 2min at 90-95 ℃ and then incubate for 1-3min at 0-4 ℃.

12. The construction method of the random long-chain peptide library is characterized by comprising the following steps of: randomly splicing short-chain oligonucleotides encoding the short-chain peptide library by adopting the method for randomly splicing the oligonucleotide chains according to any one of claims 8-11 to obtain a random long-chain oligonucleotide library, connecting the random long-chain oligonucleotide library with a carrier, and transferring the random long-chain oligonucleotide library into a host cell for expression to obtain the random long-chain peptide library.