CN107400678A - A kind of cloning vector for efficiently purifying interaction protein - Google Patents
A kind of cloning vector for efficiently purifying interaction protein Download PDFInfo
- Publication number
- CN107400678A CN107400678A CN201710606252.2A CN201710606252A CN107400678A CN 107400678 A CN107400678 A CN 107400678A CN 201710606252 A CN201710606252 A CN 201710606252A CN 107400678 A CN107400678 A CN 107400678A
- Authority
- CN
- China
- Prior art keywords
- cloning vector
- irdr
- sequences
- protein
- sfb
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
- C07K2319/43—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a FLAG-tag
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/60—Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/90—Vectors containing a transposable element
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention discloses a kind of cloning vector for efficiently purifying interaction protein.Described cloning vector is the double-stranded circular plasmid containing IRDR L IRDR R boxes, and the IRDR L IRDR R boxes include IRDR L sequences, promoter, SFB purification tags sequence, attR1 sequences, Negative selection marker gene sequence, attR2 sequences, screening-gene sequence and IRDR R sequences.The plasmid vector of the present invention carries transposase recognition sequence, and the method based on transposase quick, safety can establish the stable strain of protein overexpression, and utilize SFB label efficiently purifying target proteins and its interaction protein, and then further be identified by mass spectral analysis.
Description
Technical field
The invention belongs to biology field, is related to a kind of cloning vector for efficiently purifying interaction protein,
The plasmid vector of stability series is overexpressed more particularly to a kind of established based on transposase and its in identification interaction protein research
Application.
Background technology
In the genomics epoch, gene function analysis is its important science of heredity branch.On cell or animal level, profit
The expression that target gene is artificially raised with over-express vector is one of important means for studying gene function.Existed at present according to gene
Cell be overexpressed it is ageing cell can be divided into turn strain wink or surely turn strain.It is steady turn strain be by exogenous origin gene integrator to cell oneself
On the genome of body, expression can be stablized by dividing foreign gene with the growth of cell, while pass through antibiotic pressurization screening, most
Obtain stablizing the cell line of expressing protein eventually.For turning strain compared to wink, surely turn strain and largely facilitate experimental study
The cost frequently transfected with reduction.Currently the method for conventional stability series structure mainly has two kinds, and one kind is to be based on viral integrase
Principle, this kind of method need it is artificial prepare virus, it is thus cumbersome, and potential safety hazard be present；Another kind is based on non-same
Source recombinates random integration, because its integration efficiency is very low, causes to screen cycle length, and exogenous sequences expression efficiency is low, thus by
Gradually it is eliminated.In recent years, a kind of transposon system for being referred to as " sleeping beauty " progresses into the visual field of researcher, and the system uses
The transposition mechanism of " shearing is pasted ", the inverted repeats (ITRS) of the terminal specific of target sequence two is identified by transposase, by target
Target sequence is integrated into host genome DNA.There is simple to operate, examination using the stable strain of transposition technology structure gene overexpression
Test the clear superiorities such as the cycle is short, efficiency is high.
In protein-interacting research field, co-immunoprecipitation combination mass-spectrometric technique (Co-IP/MS) be conventional capture with
One of technological means of bait protein interacting molecule, but its shortcoming is that false positive is more, it is difficult to quantify, it is impossible to meet big rule
The needs of mould protein research.Tandem affinity purification combination mass-spectrometric technique (TAP/MS) solves disadvantages mentioned above well, the skill
Art obtains more adjunction by being embedded in a kind of protein tag of particular design in one end of bait protein after multistep affinity purification
Particular complex under near-nature forest state, the interaction of protein can be studied under real physiological condition, in certain journey
The bottleneck of proteomics research is broken on degree.In the scientific research of reality, in order to excavate more abundant information sum
According to, using tandem affinity purification combination mass-spectrometric technique when, generally require 109The cell of the individual order of magnitude or more.It is thus a kind of
Stable overexpression plasmid vector with TAP purification tags is a strong research work in protein-interacting research field
Tool.
The content of the invention
The shortcomings that in order to overcome prior art and deficiency, primary and foremost purpose of the invention are that providing one kind is used for efficiently purifying
The cloning vector of interaction protein.The cloning vector, which is based on transposons principle, can quickly establish overexpression stability series.
Another object of the present invention is to provide application of the above-mentioned cloning vector in protein-interacting research field.
The purpose of the present invention is achieved through the following technical solutions：
A kind of cloning vector for efficiently purifying interaction protein provided by the invention, its cloning process is to be based on
Gateway technologies, the carrier contains attR1 and attR2 recombination sites, and there is one section of SFB purifying mark attR1 recombination sites upstream
Sequence is signed, Negative selection marker gene (counter-selectable marker are contained between attR1 and attR2
Gene), additionally including screening-gene.
Described cloning vector is the double-stranded circular plasmid containing IRDR-L-IRDR-R boxes, the IRDR-L-IRDR-R boxes
Including IRDR-L sequences, promoter, SFB purification tags sequence, attR1 sequences, Negative selection marker gene sequence, attR2
Sequence, screening-gene sequence and IRDR-R sequences.
Described IRDR-L sequences are SEQ ID NO：From the reverse complemental sequence of 5 ' the 9102nd~9328 bit bases of end in 1
Row；Described IRDR-R sequences are SEQ ID NO：From 5 ' the 5956th~6183 bit bases of end in 1.
Described promoter is CAG promoters, and its sequence is SEQ ID NO：From 5 ' the 1st~1132 bit bases of end in 1.
Described SFB purification tags sequence is SEQ ID NO：From 5 ' the 1172nd~1426 bit bases of end in 1.
Described attR1 sequences are SEQ ID NO：From 5 ' the 1436th~1560 bit bases of end in 1；Described attR2
Sequence is SEQ ID NO：From the reverse complementary sequence of 5 ' the 3016th~3140 bit bases of end in 1.
In the present invention, term " SFB purification tags sequence " refers to S-Flag-SBP labels, and wherein S can be with S protein
Beads combine, SBP can be combined with Streptavidin conjugated beads, Flag can be with Flag antibody bindings.
Described Negative selection marker gene refers to suicide gene ccdB, and its sequence is SEQ ID NO：From 5 ' ends in 1
2670th~2975 bit bases.
Described screening-gene includes resistance and fluorescent screening gene.
Described resistance screening gene refers to puromycin (puromycin) resistant gene, and its sequence is SEQ ID NO.1
In from 5 ' end the 3689th~4288 bit bases.
Described fluorescent screening gene refers to green fluorescent protein (GFP) gene, and its sequence is from 5 ' in SEQ ID NO.1
Hold the 4929th~5663 bit bases.
Described cloning vector pSM1.1-SFB-GFP nucleotide sequence such as SEQ ID NO：Shown in 1.
Application of the described cloning vector in protein-interacting research field.
In addition method and the application for being overexpressed stability series are established present invention also offers pSM1.1-SFB-GFP carriers, including
Following steps：
(1) target gene protein-coding region (CDS) sequence for needing to clone is obtained；
(2) upstream and downstream adapter-primer amplifying target genes are designed；
(3) Gateway BP recombining reactions are carried out with entry vector pDONR221, target gene is cloned into entry vector；
(4) entry vector with target gene and whole carrier pSM1.1-SFB-GFP are subjected to Gateway LR restructuring instead
Should, target gene is cloned on pSM1.1-SFB-GFP carriers；
(5) it is the pSM1.1-SFB-GFP carriers with target gene and transposase plasmids SB100X cotransfection hosts is thin
Born of the same parents, target gene is set to be integrated into host cell gene group；
(6) screen to obtain the stable cell strain for being overexpressed target gene using puromycin, expand culture；
(7) cell of culture, the cell lysis under non denatured state are collected, albumen is extracted in centrifugation；
(8) using affine strepavidin magnetic beads (Streptavidin conjugated beads) enrichment destination protein and its
The albumen composition of formation；
(9) with the competitive elution destination protein of biotin (Biotin) and its albumen composition；
(10) destination protein compound is further purified using S protein magnetic bead (S protein beads)；
(11) purifying destination protein sample is subjected to protein spectrum analysis.
The present invention thinking be：SFB purification tags are introduced on the plasmid vector with transposable element, construct with
Cloning vector compatible Gateway, swivel base zymotechnic and tandem affinity purification mass spectrum are integrated, there is provided a kind of fast
The new channel of speed, economic purifying interaction protein.
The present invention is had the following advantages and effect relative to prior art：
(1) plasmid vector of the invention carries transposase recognition sequence, and albumen of establishing that can easily and fast, safe crosses table
Up to stablizing strain.
(2) plasmid vector of the invention is to include puromycin (puromycin) screening resistance and green fluorescent protein
(GFP) label, it is easy to stablize the screening of strain.
(3) albumen of plasmid vector of the invention expression carries SFB labels, effective to reduce by tandem affinity purification
The combination of nonspecific proteins.
(4) method of the plasmid vector based on transposase of the invention, the target protein that can rapidly build the label containing SFB cross table
Up to stability series, and SFB label efficiently purifying target proteins and its interaction protein are utilized, and then further reflected by mass spectral analysis
It is fixed.
Brief description of the drawings
Fig. 1 is pSM1.1-SFB-GFP plasmid vector construct schematic diagrames.
Fig. 2 is to detect pSM1.1-SFB-GFP-FBXW7 by the method for Western blotting (Western Blot) to be overexpressed surely
SFB-FBXW7 expression in singling.
Fig. 3 is to be overexpressed in fluorescence microscopy Microscopic observation pSM1.1-SFB-GFP-FBXW7 in stable strain with green fluorescence
Cell proportion.
Fig. 4 is the affine series connection of the silver staining detection albumen composition with SFB-FBXW7 interactions after purification.
Fig. 5 is the affine series connection of the protein spectrum identification albumen with SFB-FBXW7 interactions after purification.
Fig. 6 is to do further experiment to the γ-catenin albumen in protein spectrum result by the method for co-immunoprecipitation
Checking.
Embodiment
With reference to embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention are unlimited
In this.
The experimental method of unreceipted actual conditions in the following example, generally according to normal condition or according to institute of manufacturer
It is recommended that condition.Unless otherwise defined, all specialties used in text are familiar with scientific words with one skilled in the art
Meaning it is identical.
The reagent and raw material not marked in the present invention are in the market purchase gained.
PSM1.1-SFB-GFP plasmid vector construct schematic diagrames described in the embodiment of the present invention, as shown in Figure 1.
Embodiment 1
The present embodiment is with E3 ubiquitin ligases FBXW7 (Gene Bank accession number：NM_001349798.1) it is target egg
In vain, using cervical cancer tumer line HeLa as model, the stable HeLa cells being overexpressed of pSM1.1-SFB-GFP-FBXW7, knot are constructed
Close albumen of the TAP/MS technical appraisement to 84 with FBXW7 interactions.
The structure of 1.1pSM1.1-SFB-GFP-FBXW7 plasmid vectors
(1) FBXW7 cloning primer sequence pDONR221-FBXW7-F and pDONR221-FBXW7-R are designed, transfers to Hua Da base
Because company synthesizes, primer sequence is as follows：
pDONR221-FBXW7-F：5′-
GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGAATCAGGAACTGCTCTCTGT-3′；
pDONR221-FBXW7-R：5′-
GGGGACCACTTTGTACAAGAAAGCTGGGTAGTATTACTTCATGTCCACATCAAAGT-3′。
(2) using cDNA library as template, using FBXW7 cloning primers as PCR primer, the albumen of FBXW7 genes is expanded
Code area, attB1-FBXW7-attB2PCR products are obtained using Qiagen PCR primer QIAquick Gel Extraction Kit purified pcr products.
(3), will using the Gateway BP reaction kits of invitrogen companies using pDONR221 as entry vector
FBXW7 is cloned into pDONR221, and sequence verification.
(4) using pSM1.1-SFB-GFP as purpose carrier, the Gateway LR reaction reagents of invitrogen companies are used
FBXW7 is cloned into pSM1.1-SFB-GFP carriers by box, and the over-express vector is named as into pSM1.1-SFB-GFP-
FBXW7。
1.2FBXW7 the stable structure for being overexpressed HeLa cells
(1) the good HeLa cells of growth conditions are chosen, is digested and counted with pancreatin, draw 2,000,000 cell kind plates extremely
In 6cm Tissue Culture Dish.
After cell is completely adherent, the μ g pSM1.1-SFB-GFP-FBXW7 of lipo2000 cotransfections 5 are used within (2) second days
With 5 μ g SB100X transposase plasmids in HeLa cells, 36 hours after transfection, using mould containing final concentration of 2 μ g/mL purine
The stable strain of the Screening of Media of element, the screening cycle is about 4 days or so.
(3) after the completion of screening, in fluorescence microscopy Microscopic observation, as shown in Figure 3：It can be seen that it is glimmering with green to be more than 95% cell
Light, show that the plasmid has very high integration efficiency.
(4) a part of cell is collected, extracts albumen, is verified through Western blotting (Western Blot), as shown in Figure 2：Should
Cell line is stably overexpressed SFB-FBXW7.
The tandem affinity purification of 1.3FBXW7 albumen compositions and identification
(1) the stable HeLa cells being overexpressed of mass propgation SFB-FBXW7, collect 109Individual cell, add 10mL NETN
Cell pyrolysis liquid, it is placed in and cracks 30 minutes on ice, 12000 leaves the heart 20 minutes, draw albumen supernatant.
(2) the affine strepavidin magnetic beads of 400 μ L (Streptavidin conjugated are added into albumen supernatant
Beads), 4 degree of shaking table rotations are incubated overnight.
(3) affine strepavidin magnetic beads are collected using magnetic frame, and magnetic bead is washed 3~5 times with NETN cell pyrolysis liquids, to go
Unless binding proteins specific.
(4) it is small using the competitive elution magnetic bead 5 of 4 degree of rotary shakers of NETN cell pyrolysis liquids containing 2mg/mL biotins
When, FBXW7 albumen and its interaction protein is dissolved in supernatant, collect supernatant, repeat elution 2-3 times, merge and collect
Supernatant.
(5) using 100 μ L 4 degree of overnight incubations of S protein magnetic bead (S protein beads) and eluent, purify again
It is enriched with FBXW7 albumen compositions.
(6) S protein magnetic bead is collected, 50 μ L 1 × SDS sample-loading buffers is added, takes sample segment to do silver staining inspection after boiling
Survey, as shown in Figure 4：Compared with control group, substantial amounts of interaction protein is enriched to after FBXW7 tandem affinity purifications.
(7) it is left sample and does protein spectrum analysis, obtains 84 interaction proteins, as a result as shown in Figure 5.
(8) FBXW7 and γ-catenin is prompted to interact according to mass spectral results, for the reliability of the result, such as
Shown in Fig. 6, we further confirm that FBXW7 and γ-catenin are implicitly present in phase interaction by foreign immunologic coprecipitation method
With result above proves plasmid pSM1.1-SFB-GFP energy efficiently purifying destination proteins of the present invention and its point of interaction
Son.
Above-described embodiment is the preferable embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any Spirit Essences without departing from the present invention with made under principle change, modification, replacement, combine, simplification,
Equivalent substitute mode is should be, is included within protection scope of the present invention.
SEQUENCE LISTING
<110>Sun Yat-sen Memorial Hospital
<120>A kind of cloning vector for efficiently purifying interaction protein
<130> 1
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 9419
<212> DNA
<213> Artificial Sequence
<220>
<223>Cloning vector pSM1.1-SFB-GFP nucleotide sequence
<220>
<221>CAG promoters
<222> (1)..(1132)
<220>
<221>SFB purification tags
<222> (1172)..(1426)
<220>
<221> attR1
<222> (1436)..(1560)
<220>
<221>Suicide gene ccdB
<222> (2670)..(2975)
<220>
<221>AttR2 reverse complementary sequence
<222> (3016)..(3140)
<220>
<221>Puromycin（puromycin）Resistant gene
<222> (3689)..(4288)
<220>
<221>Green fluorescent protein（GFP）Gene
<222> (4929)..(5663)
<220>
<221> IRDR-R
<222> (5956)..(6183)
<220>
<221>IRDR-L reverse complementary sequence
<222> (9102)..(9328)
<400> 1
ggccgctcta gcccctagtt attaatagta atcaattacg gggtcattag ttcatagccc 60
atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa 120
cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac 180
tttccattga cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca 240
agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg 300
gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt 360
agtcatcgct attaccatgg tcgaggtgag ccccacgttc tgcttcactc tccccatctc 420
ccccccctcc ccacccccaa ttttgtattt atttattttt taattatttt gtgcagcgat 480
gggggcgggg gggggggggg ggcgcgcgcc aggcggggcg gggcggggcg aggggcgggg 540
cggggcgagg cggagaggtg cggcggcagc caatcagagc ggcgcgctcc gaaagtttcc 600
ttttatggcg aggcggcggc ggcggcggcc ctataaaaag cgaagcgcgc ggcgggcggg 660
agtcgctgcg ttgccttcgc cccgtgcccc gctccgcgcc gcctcgcgcc gcccgccccg 720
gctctgactg accgcgttac tcccacaggt gagcgggcgg gacggccctt ctcctccggg 780
ctgtaattag cgcttggttt aatgacggct tgtttctttt ctgtggctgc gtgaaagcct 840
tgaggggctc cgggagggcc ccggcaggaa ggaaatgggc ggggagggcc ttcgtgcgtc 900
gccgcgccgc cgtccccttc tccctctcca gcctcggggc tgtccgcggg gggacggctg 960
ccttcggggg ggacggggca gggcggggtt cggcttctgg cgtgtgaccg gcggctctag 1020
agcctctgct aaccatgttc atgccttctt ctttttccta cagctcctgg gcaacgtgct 1080
ggttattgtg ctgtctcatc attttggcaa agaattgatt aattcgagcg aacgcgtggt 1140
accgaagccg ctagcgctac cggtcgccac catgaaagaa accgctgctg ctaaattcga 1200
acgccagcac atggacagcg gagccggcgc aggagccggc gctgacgcgc ctgactacaa 1260
agacgatgac gacaagggag attacaagga tgacgatgac aaaggcgcgt cgatggacga 1320
gaagaccacc ggctggcggg gcggccacgt ggtggagggc ctggccggcg agctggagca 1380
gctgcgggcc aggctggagc accaccctca gggccagcgg gagcccgaat tgatcacaag 1440
tttgtacaaa aaagctgaac gagaaacgta aaatgatata aatatcaata tattaaatta 1500
gattttgcat aaaaaacaga ctacataata ctgtaaaaca caacatatcc agtcactatg 1560
gcggccgcat taggcacccc aggctttaca ctttatgctt ccggctcgta taatgtgtgg 1620
attttgagtt aggatccgtc gagattttca ggagctaagg aagctaaaat ggagaaaaaa 1680
atcactggat ataccaccgt tgatatatcc caatggcatc gtaaagaaca ttttgaggca 1740
tttcagtcag ttgctcaatg tacctataac cagaccgttc agctggatat tacggccttt 1800
ttaaagaccg taaagaaaaa taagcacaag ttttatccgg cctttattca cattcttgcc 1860
cgcctgatga atgctcatcc ggaattccgt atggcaatga aagacggtga gctggtgata 1920
tgggatagtg ttcacccttg ttacaccgtt ttccatgagc aaactgaaac gttttcatcg 1980
ctctggagtg aataccacga cgatttccgg cagtttctac acatatattc gcaagatgtg 2040
gcgtgttacg gtgaaaacct ggcctatttc cctaaagggt ttattgagaa tatgtttttc 2100
gtctcagcca atccctgggt gagtttcacc agttttgatt taaacgtggc aaatatggac 2160
aacttcttcg cccccgtttt caccatgggc aaatattata cgcaaggcga caaggtgctg 2220
atgccgctgg cgattcaggt tcatcatgcc gtttgtgatg gcttccatgt cggcagaatg 2280
cttaatgaat tacaacagta ctgtgatgag tggcagggcg gggcgtaaac gcgtggatcc 2340
ggcttactaa aagccagata acagtatgcg tatttgcgcg ctgatttttg cggtataaga 2400
atatatactg atatgtatac ccgaagtatg tcaaaaagag gtatgctatg aagcagcgta 2460
ttacagtgac agttgacagc gacagctatc agttgctcaa ggcatatatg atgtcaatat 2520
ctccggtctg gtaagcacaa ccatgcagaa tgaagcccgt cgtctgcgtg ccgaacgctg 2580
gaaagcggaa aatcaggaag ggatggctga ggtcgcccgg tttattgaaa tgaacggctc 2640
ttttgctgac gagaacaggg gctggtgaaa tgcagtttaa ggtttacacc tataaaagag 2700
agagccgtta tcgtctgttt gtggatgtac agagtgatat tattgacacg cccgggcgac 2760
ggatggtgat ccccctggcc agtgcacgtc tgctgtcaga taaagtctcc cgtgaacttt 2820
acccggtggt gcatatcggg gatgaaagct ggcgcatgat gaccaccgat atggccagtg 2880
tgccggtctc cgttatcggg gaagaagtgg ctgatctcag ccaccgcgaa aatgacatca 2940
aaaacgccat taacctgatg ttctggggaa tataaatgtc aggctccctt atacacagcc 3000
agtctgcagg tcgaccatag tgactggata tgttgtgttt tacagtatta tgtagtctgt 3060
tttttatgca aaatctaatt taatatattg atatttatat cattttacgt ttctcgttca 3120
gctttcttgt acaaagtggt tgatctcgag gagttaacga attctaccgg gtaggggagg 3180
cgcttttccc aaggcagtct ggagcatgcg ctttagcagc cccgctgggc acttggcgct 3240
acacaagtgg cctctggcct cgcacacatt ccacatccac cggtaggcgc caaccggctc 3300
cgttctttgg tggccccttc gcgccacctt ctactcctcc cctagtcagg aagttccccc 3360
ccgccccgca gctcgcgtcg tgcaggacgt gacaaatgga agtagcacgt ctcactagtc 3420
tcgtgcagat ggacagcacc gctgagcaat ggaagcgggt aggcctttgg ggcagcggcc 3480
aatagcagct ttgctccttc gctttctggg ctcagaggct gggaaggggt gggtccgggg 3540
gcgggctcag gggcgggctc aggggcgggg cgggcgcccg aaggtcctcc ggaggcccgg 3600
cattctgcac gcttcaaaag cgcacgtctg ccgcgctgtt ctcctcttcc tcatctccgg 3660
gcctttcgac ctgcagccca agcttaccat gaccgagtac aagcccacgg tgcgcctcgc 3720
cacccgcgac gacgtcccca gggccgtacg caccctcgcc gccgcgttcg ccgactaccc 3780
cgccacgcgc cacaccgtcg atccggaccg ccacatcgag cgggtcaccg agctgcaaga 3840
actcttcctc acgcgcgtcg ggctcgacat cggcaaggtg tgggtcgcgg acgacggcgc 3900
cgcggtggcg gtctggacca cgccggagag cgtcgaagcg ggggcggtgt tcgccgagat 3960
cggcccgcgc atggccgagt tgagcggttc ccggctggcc gcgcagcaac agatggaagg 4020
cctcctggcg ccgcaccggc ccaaggagcc cgcgtggttc ctggccaccg tcggcgtctc 4080
gcccgaccac cagggcaagg gtctgggcag cgccgtcgtg ctccccggag tggaggcggc 4140
cgagcgcgcc ggggtgcccg ccttcctgga gacctccgcg ccccgcaacc tccccttcta 4200
cgagcggctc ggcttcaccg tcaccgccga cgtcgaggtg cccgaaggac cgcgcacctg 4260
gtgcatgacc cgcaagcccg gtgcctgacg cccgccccac gacccgcagc gcccgaccga 4320
aaggagcgca cgaccccatg catccaattc cgcccccccc ccctaacgtt actggccgaa 4380
gccgcttgga ataaggccgg tgtgcgtttg tctatatgtt attttccacc atattgccgt 4440
cttttggcaa tgtgagggcc cggaaacctg gccctgtctt cttgacgagc attcctaggg 4500
gtctttcccc tctcgccaaa ggaatgcaag gtctgttgaa tgtcgtgaag gaagcagttc 4560
ctctggaagc ttcttgaaga caaacaacgt ctgtagcgac cctttgcagg cagcggaacc 4620
ccccacctgg cgacaggtgc ctctgcggcc aaaagccacg tgtataagat acacctgcaa 4680
aggcggcaca accccagtgc cacgttgtga gttggatagt tgtggaaaga gtcaaatggc 4740
tctcctcaag cgtattcaac aaggggctga aggatgccca gaaggtaccc cattgtatgg 4800
gatctgatct ggggcctcgg tgcacatgct ttacatgtgt ttagtcgagg ttaaaaaacg 4860
tctaggcccc ccgaaccacg gggacgtggt tttcctttga aaaacacgat gataatatgg 4920
ccacaaccat ggtgagcaag ggcgaggagc tgttcaccgg ggtggtgccc atcctggtcg 4980
agctggacgg cgacgtaaac ggccacaagt tcagcgtgtc cggcgagggc gagggcgatg 5040
ccacctacgg caagctgacc ctgaagttca tctgcaccac cggcaagctg cccgtgccct 5100
ggcccaccct cgtgaccacc ctgacctacg gcgtgcagtg cttcagccgc taccccgacc 5160
acatgaagca gcacgacttc ttcaagtccg ccatgcccga aggctacgtc caggagcgca 5220
ccatcttctt caaggacgac ggcaactaca agacccgcgc cgaggtgaag ttcgagggcg 5280
acaccctggt gaaccgcatc gagctgaagg gcatcgactt caaggaggac ggcaacatcc 5340
tggggcacaa gctggagtac aactacaaca gccacaacgt ctatatcatg gccgacaagc 5400
agaagaacgg catcaaggtg aacttcaaga tccgccacaa catcgaggac ggcagcgtgc 5460
agctcgccga ccactaccag cagaacaccc ccatcggcga cggccccgtg ctgctgcccg 5520
acaaccacta cctgagcacc cagtccgccc tgagcaaaga ccccaacgag aagcgcgatc 5580
acatggtcct gctggagttc gtgaccgccg ccgggatcac tctcggcatg gacgagctgt 5640
acaagagatc tcgagctcga tgagtttgga caaaccacaa ctagaatgca gtgaaaaaaa 5700
tgctttattt gtgaaatttg tgatgctatt gctttatttg taaccattat aagctgcaat 5760
aaacaagtta acaacaacaa ttgcattcat tttatgtttc aggttcaggg ggaggtgtgg 5820
gaggtttttt aaagcaagta aaacctctac aaatgtggta cttaagaggg atcgataagg 5880
atctagcttg tggaaggcta ctcgaaatgt ttgacccaag ttaaacaatt taaaggcaat 5940
gctaccaaat actaattgag tgtatgtaaa cttctgaccc actgggaatg tgatgaaaga 6000
aataaaagct gaaatgaatc attctctcta ctattattct gatatttcac attcttaaaa 6060
taaagtggtg atcctaactg acctaagaca gggaattttt actaggatta aatgtcagga 6120
attgtgaaaa agtgagttta aatgtatttg gctaaggtgt atgtaaactt ccgacttcaa 6180
ctgtataggg atcctctagc tagagtcgac ctcgaggggg ggcccggtac ccagcttttg 6240
ttccctttag tgagggttaa tttcgagctt ggcgtaatca tggtcatagc tgtttcctgt 6300
gtgaaattgt tatccgctca caattccaca caacatacga gccggaagca taaagtgtaa 6360
agcctggggt gcctaatgag tgagctaact cacattaatt gcgttgcgct cactgcccgc 6420
tttccagtcg ggaaacctgt cgtgccagct gcattaatga atcggccaac gcgcggggag 6480
aggcggtttg cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt 6540
cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga 6600
atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg 6660
taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa 6720
aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt 6780
tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct 6840
gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct 6900
cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc 6960
cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt 7020
atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc 7080
tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat 7140
ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa 7200
acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa 7260
aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga 7320
aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct 7380
tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga 7440
cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc 7500
catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg 7560
ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat 7620
aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat 7680
ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg 7740
caacgttgtt gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc 7800
attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa 7860
agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg cagtgttatc 7920
actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt 7980
ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc ggcgaccgag 8040
ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt 8100
gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag 8160
atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt ttactttcac 8220
cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc 8280
gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa gcatttatca 8340
gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aacaaatagg 8400
ggttccgcgc acatttcccc gaaaagtgcc acctgacgcg ccctgtagcg gcgcattaag 8460
cgcggcgggt gtggtggtta cgcgcagcgt gaccgctaca cttgccagcg ccctagcgcc 8520
cgctcctttc gctttcttcc cttcctttct cgccacgttc gccggctttc cccgtcaagc 8580
tctaaatcgg gggctccctt tagggttccg atttagtgct ttacggcacc tcgaccccaa 8640
aaaacttgat tagggtgatg gttcacgtag tgggccatcg ccctgataga cggtttttcg 8700
ccctttgacg ttggagtcca cgttctttaa tagtggactc ttgttccaaa ctggaacaac 8760
actcaaccct atctcggtct attcttttga tttataaggg attttgccga tttcggccta 8820
ttggttaaaa aatgagctga tttaacaaaa atttaacgcg aattttaaca aaatattaac 8880
gcttacaatt tccattcgcc attcaggctg cgcaactgtt gggaagggcg atcggtgcgg 8940
gcctcttcgc tattacgcca gctggcgaaa gggggatgtg ctgcaaggcg attaagttgg 9000
gtaacgccag ggttttccca gtcacgacgt tgtaaaacga cggccagtga gcgcgcgtaa 9060
tacgactcac tatagggcga attggagctc ggatccctat acagttgaag tcggaagttt 9120
acatacactt aagttggagt cattaaaact cgtttttcaa ctactccaca aatttcttgt 9180
taacaaacaa tagttttggc aagtcagtta ggacatctac tttgtgcatg acacaagtca 9240
tttttccaac aattgtttac agacagatta tttcacttat aattcactgt atcacaattc 9300
cagtgggtca gaagtttaca tacactaagt tgactgtgcc tttaaacagc ttggaaaatt 9360
ccagaaaatg atgtcatggc tttagaagct tgatatccat ggaattcact agtgcgcgc 9419
<210> 2
<211> 57
<212> DNA
<213> Artificial Sequence
<220>
<223> pDONR221-FBXW7-F
<400> 2
ggggacaagt ttgtacaaaa aagcaggctt caccatgaat caggaactgc tctctgt 57
<210> 3
<211> 56
<212> DNA
<213> Artificial Sequence
<220>
<223> pDONR221-FBXW7-R
<400> 3
ggggaccact ttgtacaaga aagctgggta gtattacttc atgtccacat caaagt 56
Claims (10)
- A kind of 1. cloning vector for efficiently purifying interaction protein, it is characterised in that：Described cloning vector is the double-stranded circular plasmid containing IRDR-L-IRDR-R boxes, and the IRDR-L-IRDR-R boxes include IRDR-L sequences, promoter, SFB purification tags sequence, attR1 sequences, Negative selection marker gene sequence, attR2 sequences, Screening-gene sequence and IRDR-R sequences.
- 2. the cloning vector according to claim 1 for efficiently purifying interaction protein, it is characterised in that：Described IRDR-L sequences are SEQ ID NO：From the reverse complementary sequence of 5 ' the 9102nd~9328 bit bases of end in 1；Described IRDR-R sequences are SEQ ID NO：From 5 ' the 5956th~6183 bit bases of end in 1.
- 3. the cloning vector according to claim 1 for efficiently purifying interaction protein, it is characterised in that：Described promoter is CAG promoters.
- 4. the cloning vector according to claim 1 for efficiently purifying interaction protein, it is characterised in that：Described SFB purification tags sequence is SEQ ID NO：From 5 ' the 1172nd~1426 bit bases of end in 1.
- 5. the cloning vector according to claim 1 for efficiently purifying interaction protein, it is characterised in that：Described attR1 sequences are SEQ ID NO：From 5 ' the 1436th~1560 bit bases of end in 1；Described attR2 sequences are SEQ ID NO：From the reverse complementary sequence of 5 ' the 3016th~3140 bit bases of end in 1.
- 6. the cloning vector according to claim 1 for efficiently purifying interaction protein, it is characterised in that：Described Negative selection marker gene refers to suicide gene ccdB.
- 7. the cloning vector according to claim 1 for efficiently purifying interaction protein, it is characterised in that：Described screening-gene includes resistance and fluorescent screening gene.
- 8. the cloning vector according to claim 7 for efficiently purifying interaction protein, it is characterised in that：Described resistance screening gene refers to puromycin resistance gene；Described fluorescent screening gene refers to green fluorescence protein gene.
- A kind of 9. cloning vector pSM1.1-SFB-GFP, it is characterised in that：Described cloning vector pSM1.1-SFB-GFP core Nucleotide sequence such as SEQ ID NO：Shown in 1.
- 10. the cloning vector pSM1.1-SFB- described in cloning vector or claim 9 described in any one of claim 1~8 Applications of the GFP in protein-interacting research field.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710606252.2A CN107400678A (en) | 2017-07-24 | 2017-07-24 | A kind of cloning vector for efficiently purifying interaction protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710606252.2A CN107400678A (en) | 2017-07-24 | 2017-07-24 | A kind of cloning vector for efficiently purifying interaction protein |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107400678A true CN107400678A (en) | 2017-11-28 |
Family
ID=60401420
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710606252.2A Pending CN107400678A (en) | 2017-07-24 | 2017-07-24 | A kind of cloning vector for efficiently purifying interaction protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107400678A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109872774A (en) * | 2019-02-26 | 2019-06-11 | 湖北大学 | A method of based on protein-interacting in YESS analyzing prokaryote |
-
2017
- 2017-07-24 CN CN201710606252.2A patent/CN107400678A/en active Pending
Non-Patent Citations (5)
| Title |
|---|
| ABOULELA,M.等: "LC221389.1", 《GENBANK》 * |
| JINLONG YIN等: "CPEB1 modulates differentiation of glioma stem cells via downregulation of HES1 and SIRT1 expression", 《ONCOTARGET》 * |
| SONG,G.等: "JQ692169.1", 《GENBANK》 * |
| SPYROS PETRAKIS等: "Gateway-compatible transposon vector to genetically modify human embryonic kidney and adipose-derived stromal cells", 《BIOTECHNOLOGY JOURNAL》 * |
| 黄泽民等: "《蛋白质相互作用组学研究策略最新进展》", 《免疫学杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109872774A (en) * | 2019-02-26 | 2019-06-11 | 湖北大学 | A method of based on protein-interacting in YESS analyzing prokaryote |
| CN109872774B (en) * | 2019-02-26 | 2021-04-02 | 湖北大学 | YESS-based method for analyzing protein interaction in prokaryote |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110527737B (en) | Positive plasmid molecule pYCID-1905 identified by transgenic rape and transformant of transgenic rape product and application thereof | |
| US5286636A (en) | DNA cloning vectors with in vivo excisable plasmids | |
| CN112921054B (en) | Lentiviral vector for treating beta-thalassemia and preparation method and application thereof | |
| CN105368732B (en) | One plant of an industrial strain of S.cerevisiae strain for producing xylitol and construction method | |
| CN112266914B (en) | Strong constitutive promoter of bumblebee candida and application thereof | |
| CN113862166B (en) | Saccharomyces cerevisiae for producing naringenin | |
| CN104962576B (en) | A kind of flavobacterium columnare gene orientation knocks out plasmid and application | |
| CN110628821B (en) | Cell model and preparation method and application thereof | |
| CN111235118B (en) | Human type 3 adenovirus replication-defective recombinant virus, construction method and application | |
| CN110804559B (en) | Recombinant penicillium chrysogenum gene engineering bacterium and construction method and application thereof | |
| CN107267538B (en) | A kind of construction method of plant plastid expression vector and application | |
| CN107400678A (en) | A kind of cloning vector for efficiently purifying interaction protein | |
| CN114107369A (en) | Preparation method and application of MYC label fusion expression vector | |
| CN110452893B (en) | Construction and application of high-fidelity CRISPR/AsCpf1 mutant | |
| CN110331170A (en) | The gene expression element and its construction method of a kind of dual gRNA and application | |
| WO2005033320A1 (en) | Packaging cells for recombinant adenovirus | |
| CN113755442B (en) | Cell strain for measuring pharmaceutical activity and preparation method and application thereof | |
| CN109777829A (en) | A kind of construction method of the sgRNA expression component of gene editing U6 promoter driving | |
| CN112980799B (en) | Method for constructing KLF12 high-expression mouse and application of method in construction of folate-independent neural tube defect mouse model | |
| CN110117622B (en) | CRISPR/Cas gene editing system and preparation method and application thereof | |
| CN114317529B (en) | Random splicing method of oligonucleotide chains | |
| CN107501406A (en) | A kind of recombinant bovine beta lactoglobulin and its preparation method and application | |
| CN102649961B (en) | Aptamer sequence of hepatitis B virus (HBV) core antigen and application of nucleic aptamer sequence | |
| CN106591369A (en) | Method for targeted editing of buffalo 18S rDNA gene by virtue of adenovirus system | |
| CN110055280A (en) | A kind of cell line and its construction method and application of stable expression mCherry-tau |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171128 |
|
| RJ01 | Rejection of invention patent application after publication |