CN107267538B - A kind of construction method of plant plastid expression vector and application - Google Patents

A kind of construction method of plant plastid expression vector and application Download PDF

Info

Publication number
CN107267538B
CN107267538B CN201710436614.8A CN201710436614A CN107267538B CN 107267538 B CN107267538 B CN 107267538B CN 201710436614 A CN201710436614 A CN 201710436614A CN 107267538 B CN107267538 B CN 107267538B
Authority
CN
China
Prior art keywords
sequence
plastid
expression cassette
gene
gfp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201710436614.8A
Other languages
Chinese (zh)
Other versions
CN107267538A (en
Inventor
张江
武玉永
李圣纯
有利利
吴梦婷
常玲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hubei University
Original Assignee
Hubei University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hubei University filed Critical Hubei University
Priority to CN201710436614.8A priority Critical patent/CN107267538B/en
Publication of CN107267538A publication Critical patent/CN107267538A/en
Application granted granted Critical
Publication of CN107267538B publication Critical patent/CN107267538B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8214—Plastid transformation

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a kind of construction method of plant plastid expression vector and applications, construct gfp expression cassette and aadA expression cassette, it plasmid pBluescript II sk (+) carrier segments of removal multiple cloning sites, gfp expression cassette, aadA expression cassette, is transferred in Escherichia coli by no one step of enzyme clone technology with the homologous left homologous fragment of plastid genome and right homologous fragment this 5 segments, verifies correct carrier and be named as pYY12.It is imported in plastid genome using bronze package pYY12 Plasmid DNA, Southern blot confirms that target gene imports in plastid genome, Northern bolt shows the transcriptional level of GFP gene, laser confocal microscope confirm GFP there are positions, SDS-PAGE method analyzes the high-caliber accumulation of GFP albumen, reaches 9% of total soluble protein or so.

Description

A kind of construction method of plant plastid expression vector and application
Technical field
The invention belongs to field of biotechnology, specifically, be related to a kind of plant plastid expression vector construction method and Using.
Background technique
In recent years, plastogene transformation technology becomes one of the hot spot of plant genetic engineering research, plastogene conversion with Karyogene conversion compared to have the advantages that it is many, such as: matrilinear inheritance, high efficient expression, carrier-free sequence, without gene silencing, without position Effect, without gene contamination the advantages that, special in March, 2015 is on Sciences about the anti-colorado potato bug side long-chain dsRNA The research (Jiang Zhang, 2015) in face, it is anticipated that plastogene conversion will play important work in terms of plant plant protection With.
In recent years, clone technology develops very fast, is based particularly on the spring after the seamless connection cloning process such as rain of homologous recombination Bamboo shoot have obtained vigorous growth, such as the Creator system, the Gateway system, the univector Engineering that system, Gibson assedbly system, In-fusionTM-assembly are seamless, no enzyme clone (seamless Enzyme-free cloning, SEFC), sequence-and ligation-independent PCR cloning process, MAGIC-mating-assisted genetically integrated cloning,Multiple DNA Fragments with Short End Homologies。
Synthetic biology is just paid close attention to by people from being born certainly.The purpose of synthetic biology is oneself of simplification complexity Right biosystem is changed into simple, reliable, quality controllable module or part.With primer synthesis, gene chemical synthesis and survey The progress of the technologies such as sequence.Artificial-synthetic DNA's price declines to a great extent so that codon optimization gene, promoter and its His use of controlling element is more extensive, or even occurs completely by artificial synthesized genome.High throughput sequencing technologies it is fast Speed development, so that sequencing cost also continues to decline, constantly there is new species gene group data so that the speed of sequencing unprecedentedly improves It is disclosed.It is the committed step of design and building with new feature biology that Genetic elements menu, which is sought peace and standardized, more and more Genetic elements be fabricated and test.
The construction method of plant plastid transformation carrier has the restricted digestion position for falling homologous fragment by direct mutagenesis at present It puts to increase method (the Sugey Ramona of the restriction enzyme site in multiple cloning sites area building Plastid Transformation Vectors Sinagawa-Garc í a, 2009), the method (Johanna of Plastid Transformation Vectors is constructed also by Gateway system Gottschamel,2013)。
DNA is imported there are many methods of plastid, such as pollen tube pathway, Agrobacterium_mediated method, PEG mediated transformation Method, laser microbeam conversion method and particle bombardment, the most commonly used is particle bombardments.
Summary of the invention
The invention proposes a kind of construction method of plant plastid expression vector and application, by synthetic biology technology into The building of row multicomponent expression cassette, with no enzyme clone technology multiple component T-A clones into Escherichia coli, to save Accelerate the speed of plastid expression or the building of conversion carrier, and DNA fixed point is imported by particle bombardment by plastid base in cost-saving Because in group, and successful expression.Multiple expression casettes or dsRNA and siRNA with long-chain two-way startup minor structure are simple It is effectively assembled into a Plastid Transformation Vectors, constitutes polygenes or multilist reaches the Plastid Transformation Vectors of box structure, be plastid Genetic engineering research and application provide effective tool.
Its technical solution is as follows:
A kind of construction method of plant plastid expression vector, comprising the following steps:
Step 1, the assembling of gfp expression cassette: gfp expression cassette is origin derived from the promoter Prrn of tobacco rRNA operon and comes It is found derived from the strong promoter of the T7G10 sequence composition of T7 bacteriophage, in jellyfish Aequoreavictoria wild The variation GFP gene of type green fluorescent protein and from Escherichia coli rrnB terminator sequence form, utilize area of computer aided Design combines this 3 segment designs by gene chemical synthesis gfp expression cassette, and gfp expression cassette sequence is shown in sequence table, such as Shown in SEQ:ID:NO:1；
Step 2, the assembling of aadA expression cassette: aadA expression cassette is promoter of the origin derived from the psbA gene of Chlamydomonas reinhardtii It is PpsbA, in the same direction from the aadA gene of bacterium and from the rbcL gene termination sequence of Chlamydomonas reinhardtii and both ends Loxp sequence composition, as shown in SEQ:ID:NO:2；
Step 3, plastid homologous fragment clone: by the partial sequence of plastid genome psaB gene, rps14 gene order and The left homologous fragment of plastid of trnfM gene order composition, is made of plastid genome psbZ gene order trnfM gene order The right homologous fragment of plastid, noncoding region of the insertion point of plastid transformation between trnfM and trnG, left homologous sequence and the right side are same Source sequence is shown in sequence table, as shown in SEQ:ID:NO:3, SEQ:ID:NO:4；
The clone of step 4, coli expression carrier skeleton: for the plasmid pBluescript for removing multiple cloning sites MCS II sk (+) sequence, coli expression carrier frame sequence are shown in sequence table, such as SEQ:ID:NO:5；
Step 5, building plant plastid expression vector: the aadA that gfp expression cassette, the synthetic biology of synthesis synthesize is expressed This 5 segments of the left homologous fragment of box, plastid, the right homologous fragment of plastid and Escherichia coli conversion carrier skeleton pass through no enzyme clone skill Art (the step of Fig. 5 is exactly no enzyme clone technology) T-A clone is thin in competence into Escherichia coli Xl10-gold host strain Born of the same parents' efficiency is in 2*108It, can be correct after sequence verification to 19 positive colonies when a/μ g.
Application of the plant plastid expression vector of the present invention during DNA imports plastid.
Compared with prior art, the invention has the following advantages:
The present invention provides the construction method of a kind of one-step method plastid polygene expression vector or conversion carrier, by multiple genes Expression cassette or long-chain dsRNA or siRNA two-way startup minor structure are simply and effectively assembled into a Plastid Transformation Vectors, structure One kind is provided simply, quickly and effectively at polygenes or more expression cassette Plastid Transformation Vectors, while for the building of other carriers Construction method, and effective tool is provided for plastid gene engineering research and application.
Detailed description of the invention
Fig. 1 is gfp expression cassette structure figures；
Fig. 2 is aadA expression cassette structure figures；
Fig. 3 is left homologous fragment and right homologous fragment and foreign gene insertion point；
Fig. 4 is that plasmid pBluescript II sk (+) removal MCS figure MCS is multiple cloning sites sequence；
Fig. 5 is no enzyme clone figure；
Fig. 6 is that the bacterium colony of the fluoresced green of 5 segments connection conversion Escherichia coli positive colony figure white arrow meaning is equal For positive colony；
Fig. 7 is Plastid Transformation Vectors one-step method structure figures；
Fig. 8 is Southern blot proof diagram, and Fig. 8 a illustrates the position where probe, and also diagram uses restriction enzyme Enzyme Bgl II digestion wild-type tobacco total DNA, it is available to hybridize post-fragment size with probe comprising left and right homologous fragment and be 3491bp, the total DNA of plastid transgene tobacco plant are available to include left and right homologous fragment and spy after Bgl II digestion It is 6301bp that needle, which hybridizes post-fragment size,；Fig. 8 b is the map obtained with the Southern blot kit of digoxigenin labeled, is obtained Expected segment is arrived, wherein swimming lane 1 is that wild-type tobacco total DNA is miscellaneous with the probe of digoxigenin labeled after Bgl II digestion The signal of friendship, swimming lane 2, swimming lane 3 and swimming lane 4 are probe of the transgene tobacco total DNA after Bgl II digestion with digoxigenin labeled The signal of hybridization, swimming lane 5 are DNA Standard molecular weight markers；
Fig. 9 is seed test chart, and Nt-wt is wild-type tobacco, Nt-pYY12#1, Nt-pYY12#3 and Nt- in figure PYY12#5 is 3 strains of plastid transgene tobacco, and plastid transgene tobacco seed is trained containing spectinomycin (spec) resistance Equal normal growth in feeding base, and the then whole albefactions of wild-type tobacco seed, and wild-type tobacco seed is in the item of no spectinomycin Normal growth under part；
Figure 10 be wild-type tobacco and transgene tobacco when tissue culture room is cultivated 3 weeks and 6 weeks and hot-house culture 3 weeks with The growing state figure of plant at 6 weeks；
Figure 11 is that plastid turns gfp tobacco plant chloroplaset fluorogram, and wherein Figure 11 a is to observe at 488nm in exciting light GFP fluoresce, Figure 11 b be at exciting light 700nm Chloroplast auto-fluorescence, Figure 11 c be both overlapping after fluorogram；
Figure 12 is that plastid turns gfp plant expression total soluble protein figure, and swimming lane 1 is that Marker is protein standards molecule Amount, swimming lane 2 are 5 μ g wild-type tobacco soluble proteins, and swimming lane 3, swimming lane 4 and swimming lane 5 turn gfp genetic tobacco for 5 μ g plastids can Dissolubility albumen, swimming lane 6, swimming lane 7, swimming lane 8, swimming lane 9 and swimming lane 10 represent GFP standard protein, and swimming lane 6 is 0.1 μ g, and swimming lane 7 is 0.2 μ g, swimming lane 8 are 0.3 μ g, and swimming lane 9 is 0.4 μ g, and swimming lane 10 is 0.5 μ g.
Specific embodiment
Technical solution of the present invention is described in more detail with reference to the accompanying drawings and detailed description.
Embodiment 1
The assembling of gfp expression cassette: gfp expression cassette is origin derived from the promoter Prrn of tobacco rRNA operon and from T7 The strong promoter of the T7G10 sequence composition of bacteriophage, the wild type Green found in jellyfish Aequoreavictoria The variation GFP gene of fluorescin and from Escherichia coli rrnB terminator sequence form.This 3 are searched for by GenBank The DNA sequence dna of segment is combined them together using CAD, passes through gene chemical synthesis gfp expression cassette.Specifically set Meter is shown in Fig. 1.Gfp expression cassette sequence is shown in sequence table, sequence 1.
Embodiment 2
The assembling of aadA expression cassette: aadA expression cassette is the promoter PpsbA for the psbA gene that origin is derived from Chlamydomonas reinhardtii, comes AadA gene and the loxp sequence group in the same direction from the rbcL gene termination sequence of Chlamydomonas reinhardtii and both ends derived from bacterium At.The DNA sequence dna that this 5 segments are searched for by GenBank is combined them together using CAD, is passed through Gene chemical synthesis aadA expression cassette.Fig. 2 is shown in specific design.AadA expression cassette sequence is shown in sequence table, sequence 2.
Embodiment 3
Plastid homologous fragment clone: by the partial sequence of plastid genome psaB gene, rps14 gene order and trnfM The left homologous fragment of plastid of gene order composition, the plastid being made of plastid genome psbZ gene order trnfM gene order Right homologous fragment.The insertion point of plastid transformation is between trnfM and trnG.Design 1 couple of primer P1 (5' GCCTTGCTCTAGCTTCTTTAGGGG 3') and P2 (5'AACCCTAAAATAGTTTGGCAAAACAAG 3'), with the cigarette of extraction The total DNA of grass is that template is cloned into obtained segment on cloning vector pMD18-T by the left homologous sequence of PCR amplification, Positive colony sequencing verifying, designs 1 couple of primer P1 (5'GCCTTGCTCTAGCTTCTTTAGGGG 3') and P2 (5' AACCCTAAAATAGTTTGGCAAAACAAG 3'), using the total DNA of the tobacco of extraction as template, pass through the left homologous sequence of PCR amplification Column, obtained segment are cloned on cloning vector pMD18-T, left homologous sequence are obtained after positive colony sequencing is verified；If Count 1 couple of primer P3 (5'ACTAGTAATTAATTCCCGCCTTTCGC 3') and P4 (5'TGATTAGCGTACCCGTTGTATTTGC 3'), using the total DNA of the tobacco of extraction as template, by the left homologous sequence of PCR amplification, obtained segment is cloned into clone and is carried On body pMD18-T, right homologous sequence is obtained after positive colony sequencing is verified.Fig. 3 is shown in specific design.Left homologous sequence and the right side are same Source sequence is shown in sequence table, sequence 3 and sequence 4.
Embodiment 4
The clone of coli expression carrier skeleton: for the plasmid pBluescript II sk for going multiple cloning sites (MCS) (+) sequence.Fig. 4 is shown in specific design.Coli expression carrier frame sequence is shown in sequence table, sequence 5.
Embodiment 5
One-step method constructs plant plastid expression vector: the gfp that synthetic biology technology is synthesized using computer assisted design Expression cassette, aadA expression cassette, the left homologous fragment of plastid, the right homologous fragment of plastid and the Escherichia coli synthesized using synthetic biology This 5 segments of conversion carrier skeleton are reasonably combined.
Specific building is as follows: design pair of primers P5 (5'GAGAAGCAAATACAACGGGTACGCTAATCACCAGCTTT TGTTCCCTTTAGTGAGG3' the left homologous sequence and P6 (5'TAATAACCCCTAAAGAAGCTAGAGCAAGG of 30bp) are had CTCCAATTCGCCCTATAGTGAGTCG3'), the right homologous sequence with 30bp is with plasmid pBluescript II sk (+) Template obtains segment by the plasmid pBluescript II sk (+) of PCR amplification removal multiple cloning sites (MCS), is named as Segment 1；Design primer P7 (5'GTAATACGACTCACTATAGGGCGAATTGGAGCCTTGCTCTAGCTTCTTTAGGGG 3') Plasmid pBluescript II sk (+) sequence and P8 (5'TCCAGCTTTTGTTCCCTTTAGTGAGGGTTAA with 30bp ACCCTAAAATAGTTTGGCAAAACAA G 3') the gfp expression cassette sequence of 30bp is had, with tobacco chloroplast genomic DNA For template, left homologous sequence is cloned, is named as segment 2；Design primer P9 (5'TTCGTATAGCATACATTATACGAAGTTAT ACTAGTAATTAATTCCCGCCTTTCGC 3') aadA expression cassette sequence and P10 (5'TTAACCCTCACTAA with 30bp AGGGAACAAAAGCTGGTGATTAGCGTACCCGTTGTATTTGC 3'
) plasmid pBluescript II sk (+) sequence with 30bp, using tobacco chloroplast genomic DNA as template, Right homologous sequence is cloned, segment 3 is named as；Using the aadA expression cassette sequence of gene chemical synthesis as template, pair of primers P11 is designed (CTTCGTATAGCATACATTATACGAAGTTATAAGAAAAGTGAGCTATTAACGCGTCC 3') has the gfp table of 30bp Up to box sequence and P12 (5'AAAGCGAAAGGCGGGAATTAATTACTAGTATAACTTCGTATAATGTATGCTATA CGAAG The right homologous sequence for 3') having 30bp, obtains segment by PCR amplification, is named as segment 4；With the GFP gene table of gene chemical synthesis It is template up to box sequence, designs pair of primers P13 (5'CATCTTGTTTTGCCAAACTATTTTAGGGTTTAACCCTCACTAA AGGGAACAAAAGC3' the right homologous sequence and P14 (5'ATAGGACGCGTTAATAGCTCACTTTTCTTATA of 30bp) are had ACTTCGTATAATGTATGCTATACGAA G 3') with the aadA expression cassette sequence of 30bp segment is obtained by PCR amplification, It is named as segment 5, this 5 segments are cloned into Escherichia coli Xl10-gold by the method (see Fig. 5) of no enzyme clone ( This 5 segments are mixed in the ratio of 1:2:2:2:2, are then added in 50 microlitres of Escherichia coli Xl10-gold competent cell, Finally it is coated with corresponding antibiotic plate), in competent cell efficiency in 2*108It, can be to 19 or so sun when a/μ g or so Property clone, see Fig. 6, by phenotype, resistance and sequence verification are correct, to obtain correct plastid universal expression vector.Specifically Fig. 7 is shown in design.
Embodiment 6
Bombardment-Mediated Transformation plastid: it is extracted with extraction reagent kit (QIAGEN Inc., Valencia, CA) in qiagen plasmid Plasmid pYY12DNA removes the tender Tobacco Leaf of bombardment 4 weeks or so with 0.6 μm of bronze package DNA by particle gun (Bio-Rad) Piece, the blade after bombardment cut off 5*5mm2Size is put into the culture medium of the spectinomycin containing 0.1mg/LNAA and 500mg/L Culture finds 5 resistant buds of strong point, resistant buds is gone in root media after 1 month, extract blade total DNA and pass through Southern blot verifying 3 resistance seedlings of discovery are positive seedlings, and have reached homogeneity, see Fig. 8, after doing seed test, hair Existing wild-type tobacco seed albefaction under the conditions of 500mg/L spectinomycin, and Transgenic Tobacco Seeds are in 500mg/L spectinomycin Under the conditions of all germination and equal normal growth, show that transgenic tobacco plant has reached homogeneity, see Fig. 9, both the above inspection Survey shows that foreign gene is successfully imported into plastid genome, and reaches homogeneity.Foreign gene can be in non-resistant condition Lower stable heredity, genetically modified plants can be with normal growth and no significant difference as wild type.See Figure 10.
Embodiment 7
Gfp gene is expressed in plastid: gfp gene realizes high-caliber expression, laser confocal microscope in plastid It confirms being present in chloroplaset for GFP, sees Figure 11, reached by the expression quantity that SDS-PAGE method demonstrates GFP albumen and always may be used 9% or so of dissolubility albumen.See Figure 12.
The foregoing is only a preferred embodiment of the present invention, the scope of protection of the present invention is not limited to this, it is any ripe Know those skilled in the art within the technical scope of the present disclosure, the letter for the technical solution that can be become apparent to Altered or equivalence replacement are fallen within the protection scope of the present invention.
SEQUENCE LISTING
<110>Hubei University
<120>a kind of construction method of plant plastid expression vector and application
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 1222
<212> DNA
<213>artificial sequence
<400> 1
taaccctcac taaagggaac aaaagctgga gctccaccgc ggtggcggcc gctctagtgg 60
atcccccggg ctgcaggaat tcgatatcaa gcttatcgat accgtcgacg ctcccccgcc 120
gtcgttcaat gagaatggat aagaggctcg tgggattgac gtgagggggc agggatggct 180
atatttctgg gagcgaactc cgggcgaata cgaagcgctt ggatacggat ccaaatactg 240
cagtttaact ttaagaagga gatataccca tggtgagtaa aggagaagaa cttttcactg 300
gagttgtccc aattcttgtt gaattagatg gtgatgttaa tgggcacaaa ttttcagtca 360
gtggagaggg tgaaggtgat gcaacatacg gaaaacttac ccttaaattt atttgcacta 420
ctggaaaact acctgttccg tggccaacac ttgtcactac tttcgcgtat ggtcttcaat 480
gctttgcgag atacccagat catatgaaac agcatgactt tttcaagagt gccatgcccg 540
aaggttatgt acaggaaaga accatatttt tcaaagatga cgggaactac aagacacgtg 600
ctgaagtcaa gtttgaaggt gatacccttg ttaatagaat cgagttaaaa ggtattgatt 660
ttaaagagga tggaaacatt cttggacaca aattggaata catctataac tcacacaatg 720
tatacatcat ggcagacaaa caaaagaatg gaatcaaagt caacttcaaa attagacaca 780
acattgaaga tggaagcgtt caactagcag accattatca acaaaatact ccaattggcg 840
atggccctgt ccttttacca gacaaccatt acctgtccac acaatctgcc ctttcgaaag 900
atcccaacga aaagagagac cacatggtcc ttcttgagtt tgtaacagct gctgggatta 960
cacatggcat ggacgagctg tacaagtaaa atctagaatc aaataaaacg aaaggctcag 1020
tcgaaagact gggcctttcg ttttatctgt tgtttgtcgg tgaacgctct cctgagtagg 1080
acaaatccgc cgggagcgga tttgaacgtt gcgaagcaac ggcccggagg gtggcgggca 1140
ggacgcccgc cataaactgc caggcatcaa attaagcaga aggccatcct gacggatggc 1200
ctttttgcgt ttctacgggc cc 1222
<210> 2
<211> 1589
<212> DNA
<213>artificial sequence
<400> 2
ggtaccataa cttcgtatag catacattat acgaagttat aagaaaagtg agctattaac 60
gcgtcctatt ttaatactcc gaaggaggca gttggcaggc aactgccact gacgtcccgt 120
aagggtaagg ggacgtccac tggcgtcccg taaggggaag gggacgtagg tacataaatg 180
tgctaggtaa ctaacgtttg attttttgtg gtataatata tgtaccatgc ttttaataga 240
agcttgaatt tataaattaa aatattttta caatatttta cggagaaatt aaaactttaa 300
aaaaattaac atcatggggg aagcggtgat cgccgaagta tcgactcaac tatcagaggt 360
agttggcgtc atcgagcgcc atctcgaacc gacgttgctg gccgtacatt tgtacggctc 420
cgcagtggat ggcggcctga agccacacag tgatattgat ttgctggtta cggtgaccgt 480
aaggcttgat gaaacaacgc ggcgagcttt gatcaacgac cttttggaaa cttcggcttc 540
ccctggagag agcgagattc tccgcgctgt agaagtcacc attgttgtgc acgacgacat 600
cattccgtgg cgttatccag ctaagcgcga actgcaattt ggagaatggc agcgcaatga 660
cattcttgca ggtatcttcg agccagccac gatcgacatt gatctggcta tcttgctgac 720
aaaagcaaga gaacatagcg ttgccttggt aggtccggcg gcggaggaac tctttgatcc 780
ggttcctgaa caggatctat ttgaggcgct aaatgaaacc ttaacgctat ggaactcgcc 840
gcccgactgg gctggcgatg agcgaaatgt agtgcttacg ttgtcccgca tttggtacag 900
cgcagtaacc ggcaaaatcg cgccgaagga tgtcgctgcc gactgggcaa tggagcgcct 960
gccggcccag tatcagcccg tcatacttga agctagacag gcttatcttg gacaagaaga 1020
agatcgcttg gcctcgcgcg cagatcagtt ggaagaattt gtccactacg tgaaaggcga 1080
gatcaccaag gtagtcggca aataatgtct agggcatgca agcttgtact caagctcgta 1140
acgaaggtcg tgaccttgct cgtgaaggtg gcgacgtaat tcgttcagct tgtaaatggt 1200
ctccagaact tgctgctgca tgtgaagttt ggaaagaaat taaattcgaa tttgatacta 1260
ttgacaaact ttaattttta tttttcatga tgtttatgtg aatagcataa acatcgtttt 1320
tatttttatg gtgtttaggt taaataccta aacatcattt tacattttta aaattaagtt 1380
ctaaagttat cttttgttta aatttgcctg tctttataaa ttacgatgtg ccagaaaaat 1440
aaaatcttag ctttttatta tagaatttat ctttatgtat tatattttat aagttataat 1500
aaaagaaata gtaacatact aaagcggatg taactcaatc ggtagagtgc gatccataac 1560
ttcgtatagc atacattata cgaagttat 1589
<210> 3
<211> 1880
<212> DNA
<213>artificial sequence
<400> 3
gccttgctct agcttcttta ggggttatta cttctttggt agctcaacac atgtactctt 60
tacctgctta tgcattcata gcacaagact ttactactca agctgcatta tatacccacc 120
accaatatat cgcaggattc atcatgacag gagcttttgc tcatggagct atatttttca 180
ttagagatta caatccggag caaaatgaag ataatgtatt ggcaagaatg ttagagcata 240
aagaagctat catatctcat ttaagttggg ccagcctctt tctgggattc cataccctgg 300
gactttatgt tcataatgat gtcatgcttg cctttggcac tccggagaag caaatcttga 360
ttgaacctat atttgctcaa tggatacaat ccgctcatgg taaaacttca tatgggttcg 420
atgtactttt atcttcaacg agtggtccag cattcaatgc gggtcgaagc atctggttgc 480
cgggttggtt aaatgctgtt aatgaaaata gtaattcatt atttttaaca ataggtcctg 540
gagacttttt ggttcatcat gctattgctc ttggtttaca tacaactaca ttgatcttag 600
taaaaggtgc tttagatgca cgtggttcca agttaatgcc agataaaaag gatttcggtt 660
atagttttcc gtgcgatggc ccaggacgag gcggtacttg tgatatttcg gcatgggacg 720
cgttttattt ggcagttttt tggatgttaa atactattgg atgggttact ttttattggc 780
attggaagca catcacatta tggcagggta acgtttcaca gtttaatgaa tcttccactt 840
atttgatggg ctggttaagg gattatttat ggttaaactc ttcacaactt atcaacggat 900
ataatccttt tggtatgaat agtttatcgg tttgggcatg gatgttctta tttggacatc 960
ttgtttgggc tactggattt atgttcttaa tttcttggcg tggatattgg caggaattga 1020
ttgaaacttt agcatgggct catgaacgca cacctttggc caatttgatt cgctggagag 1080
ataaaccagt ggccctttcc attgtacaag caagattggt tggattagct cacttttctg 1140
taggttatat attcacttat gcggctttct tgattgcctc tacgtcgggc aaatttggtt 1200
aatattttta atgtgtgtat ctgcgataat ctcatttctt tcgacggaga gggggtccac 1260
cttcttctat ttctacatct aggattcgac ttgtatcatg gatactaata ggaattcaac 1320
cattatggca aggaaaagtt tgattcagag ggagaagaag aggcaaaaat tggaacagaa 1380
atatcattcg attcgtcgat cctcaaagaa agaaataagc aaggttccgt cgttgagtga 1440
caaatgggaa atttatggaa agttacaatc cccaccacgg aatagtgcac ctacacgcct 1500
tcatcgacgt tgttttttga ccggaaggcc gagagctaac tatcgagact ttggactatc 1560
cggacacata cttcgtgaaa tggttcatgc atgtttgttg ccaggagcaa caagatcaag 1620
ttggtaagga ttaacgcttc atttctattt ctatggtcga tgatcataga agccccttta 1680
ccattctgta taaatgggct attctatttg tacagatagg gtggaggggc gcatttaatc 1740
cttgtttatc tattagtttt cagttcttat cttcggcgcg gggtagagca gtttggtagc 1800
tcgcaaggct cataaccttg aggtcacggg ttcaaatcct gtctccgcaa catcttgttt 1860
tgccaaacta ttttagggtt 1880
<210> 4
<211> 664
<212> DNA
<213>artificial sequence
<400> 4
actagtaatt aattcccgcc tttcgctttt tgggggtgga aggaaaaaga aaacgtaggg 60
gagggataga atcactacac tatcacggcc aactatacca aatccttaat ttaaggatat 120
atttaatgct atttatgaaa ttaaataata aataaatagt aataaaatta ctttatcttg 180
gatcttgggc ggatagcggg aatcgaaccc gcatcttctc cttggcaaag agaaatttta 240
ccattcgacc atatccgcat ttttttgttc ttgatacaca atatgtaccc acatatatga 300
tatataaccg gatctttttt gtgcagtgcc gggacacata ttctcttcgg aacgattcca 360
attatttttt taattgtatt ctttttattc aagaagtttg acccccctct aatttttttg 420
ttttctttat ttgatttgcg ttttctttgg ggacttagat tccaatttaa tgtgtctcac 480
aaccgagaaa aattaggggg gtcattttgg ttttgggtct gcgacgaata ggttcaagag 540
atgagagaat taaggatacc caccagaaag actaatccaa tccataagga tgtaccagaa 600
aatacaacat ttttgttact tgaccagcca tcaggagaag caaatacaac gggtacgcta 660
atca 664
<210> 5
<211> 2856
<212> DNA
<213>artificial sequence
<400> 5
ccagcttttg ttccctttag tgagggttaa tttcgagctt ggcgtaatca tggtcatagc 60
tgtttcctgt gtgaaattgt tatccgctca caattccaca caacatacga gccggaagca 120
taaagtgtaa agcctggggt gcctaatgag tgagctaact cacattaatt gcgttgcgct 180
cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga atcggccaac 240
gcgcggggag aggcggtttg cgtattgggc gctcttccgc ttcctcgctc actgactcgc 300
tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt 360
tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg 420
ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg 480
agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat 540
accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta 600
ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct 660
gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc 720
ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa 780
gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg 840
taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag 900
tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt 960
gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta 1020
cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc 1080
agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca 1140
cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa 1200
cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat 1260
ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct 1320
taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt 1380
tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat 1440
ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta 1500
atagtttgcg caacgttgtt gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg 1560
gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt 1620
tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg 1680
cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg 1740
taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc 1800
ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca catagcagaa 1860
ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac 1920
cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt 1980
ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg 2040
gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa 2100
gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata 2160
aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctaaattg taagcgttaa 2220
tattttgtta aaattcgcgt taaatttttg ttaaatcagc tcatttttta accaataggc 2280
cgaaatcggc aaaatccctt ataaatcaaa agaatagacc gagatagggt tgagtgttgt 2340
tccagtttgg aacaagagtc cactattaaa gaacgtggac tccaacgtca aagggcgaaa 2400
aaccgtctat cagggcgatg gcccactacg tgaaccatca ccctaatcaa gttttttggg 2460
gtcgaggtgc cgtaaagcac taaatcggaa ccctaaaggg agcccccgat ttagagcttg 2520
acggggaaag ccggcgaacg tggcgagaaa ggaagggaag aaagcgaaag gagcgggcgc 2580
tagggcgctg gcaagtgtag cggtcacgct gcgcgtaacc accacacccg ccgcgcttaa 2640
tgcgccgcta cagggcgcgt cccattcgcc attcaggctg cgcaactgtt gggaagggcg 2700
atcggtgcgg gcctcttcgc tattacgcca gctggcgaaa gggggatgtg ctgcaaggcg 2760
attaagttgg gtaacgccag ggttttccca gtcacgacgt tgtaaaacga cggccagtga 2820
gcgcgcgtaa tacgactcac tatagggcga attgga 2856

Claims (2)

1. a kind of construction method of plant plastid expression vector, which is characterized in that carry out multicomponent by synthetic biology technology The building of expression cassette, with no enzyme clone technology multiple component T-A clones into Escherichia coli, accelerate plastid expression or The speed of the building of conversion carrier, and DNA fixed point is imported into plastid genome by particle bombardment, and successful expression；It will Multiple expression casettes are simply and effectively assembled into a Plastid Transformation Vectors, constitute polygenes or multilist reaches the matter of box structure Body conversion carrier, is studied for plastid gene engineering and application provides effective tool；The building of the plant plastid expression vector Method specifically includes the following steps:
Step 1: gfp expression cassette assembles: gfp expression cassette is promoter Prrn and source of the origin derived from tobacco rRNA operon In the T7G10 sequence strong promoter formed of T7 bacteriophage, the wild type that is found in jellyfish Aequorea victoria The variation GFP gene of green fluorescent protein and from Escherichia coli rrnB terminator sequence form, set using area of computer aided Meter combines this 3 segment designs by gene chemical synthesis gfp expression cassette, and gfp expression cassette sequence is shown in sequence table, such as SEQ Shown in ID NO:1；
Step 2: aadA expression cassette assembles: aadA expression cassette is promoter of the origin derived from the psbA gene of Chlamydomonas reinhardtii It is PpsbA, in the same direction from the aadA gene of bacterium and from the rbcL gene termination sequence of Chlamydomonas reinhardtii and both ends Loxp sequence composition, as shown in SEQ ID NO:2；
Step 3: plastid homologous fragment clone: by the partial sequence of plastid genome psaB gene, rps14 gene order and The left homologous fragment of plastid of trnfM gene order composition, is made of plastid genome psbZ gene order trnfM gene order The right homologous fragment of plastid, noncoding region of the insertion point of plastid transformation between trnfM and trnG, left homologous sequence and the right side are same Source sequence is shown in sequence table, as shown in SEQ ID NO:3, SEQ ID NO:4；
Step 4: the clone of coli expression carrier skeleton: for the plasmid pBluescript II for removing multiple cloning sites MCS Sk (+) sequence, coli expression carrier frame sequence are shown in sequence table, as shown in SEQ ID NO:5；
Step 5: building plant plastid expression vector: aadA expression cassette that the gfp expression cassette of synthesis, synthetic biology are synthesized, This 5 segments of the left homologous fragment of plastid, the right homologous fragment of plastid and Escherichia coli conversion carrier skeleton are by utilizing computer aided manufacturing Help design T-A clone into Escherichia coli Xl10-gold host strain, in competent cell efficiency in 2*108When a/μ g, energy It is correct after sequence verification to 19 positive colonies；Synthetic biology technology is synthesized using CAD Gfp expression cassette, aadA expression cassette, the left homologous fragment of plastid, the right homologous fragment of plastid and the large intestine synthesized using synthetic biology This 5 segments of Agrobacterium-transformation vector skeleton are reasonably combined；
Design pair of primers P5
5'GAGAAGCAAATACAACGGGTACGCTAATCACCAGCTTTTGTTCCCTTTAGTGAG G 3' has a left side of 30bp Homologous sequence and P6 5'TAATAACCCCTAAAGAAGCTAGAGCAAGGCTCCAATTCGCCCTATAGTGAGTCG 3', have The right homologous sequence of 30bp removes multiple cloning sites by PCR amplification with plasmid pBluescript II sk (+) for template The plasmid pBluescript II sk (+) of MCS obtains segment, is named as segment 1；
Design primer P7
5'GTAATACGACTCACTATAGGGCGAATTGGAGCCTTGCTCTAGCTTCTTTAGGGG 3' has the plasmid of 30bp PBluescript II sk (+) sequence and P8 5'TCCAGCTTTTGTTCCCTTTAGTGAGGGTTAAACCCTAAAATAGTT TGGCAAAACAAG 3' has the gfp expression cassette sequence of 30bp, and using tobacco chloroplast genomic DNA as template, clone is left homologous Sequence is named as segment 2；
Design primer P9
5'TTCGTATAGCATACATTATACGAAGTTATACTAGTAATTAATTCCCGCCTTTCG C 3' is with 30bp's AadA expression cassette sequence and P10 5'TTAACCCTCACTAAAGGGAACAAAAGCTGGTGATTAGCGTACCCGTTGTATTTG C 3' has plasmid pBluescript II sk (+) sequence of 30bp, using tobacco chloroplast genomic DNA as template, clones right same Source sequence is named as segment 3；
Using the aadA expression cassette sequence of gene chemical synthesis as template, pair of primers P11 5'CTTCGTATAGCATACATTAT is designed ACGAAGTTATAAGAAAAGTGAGCTATTAACGCGTCC 3' has the gfp expression cassette sequence and P12 5'AAAGCG of 30bp The right side homologous sequence of the AAAGGCGGGAATTAATTACTAGTATAACTTCGTATAATGTATGC TATACGAAG 3' with 30bp Column, obtain segment by PCR amplification, are named as segment 4；
Using the GFP expression casette sequence of gene chemical synthesis as template, pair of primers P13 5'CATCTTGTTTTGCCAAAC is designed TATTTTAGGGTTTAACCCTCACTAAAGGGAACAAAAGC 3' has the right homologous sequence and P14 5'ATAGGAC of 30bp GCGTTAATAGCTCACTTTTCTTATAACTTCGTATAATGTATGCTATACGAAG 3' has the aadA expression cassette sequence of 30bp Column, obtain segment by PCR amplification, are named as segment 5；
5 segments are cloned into Escherichia coli Xl10-gold by the method for no enzyme clone, and 5 segments press the ratio of 1:2:2:2:2 Example mixes, and is then added in 50 microlitres of Escherichia coli Xl10-gold competent cell, it is flat to be finally coated with corresponding antibiotic Plate.
2. application of the plant plastid expression vector described in claim 1 during DNA imports plastid.
CN201710436614.8A 2017-06-12 2017-06-12 A kind of construction method of plant plastid expression vector and application Expired - Fee Related CN107267538B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710436614.8A CN107267538B (en) 2017-06-12 2017-06-12 A kind of construction method of plant plastid expression vector and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710436614.8A CN107267538B (en) 2017-06-12 2017-06-12 A kind of construction method of plant plastid expression vector and application

Publications (2)

Publication Number Publication Date
CN107267538A CN107267538A (en) 2017-10-20
CN107267538B true CN107267538B (en) 2019-11-05

Family

ID=60066115

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710436614.8A Expired - Fee Related CN107267538B (en) 2017-06-12 2017-06-12 A kind of construction method of plant plastid expression vector and application

Country Status (1)

Country Link
CN (1) CN107267538B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109371058A (en) * 2018-11-06 2019-02-22 湖北大学 A kind of method for building up of poplar plastid expression system
CN115807021A (en) * 2022-08-01 2023-03-17 深圳大学 Method for synthesizing, assembling and testing functions of artificial chloroplast genome of chlamydomonas reinhardtii

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1276835A (en) * 1997-08-07 2000-12-13 奥本大学 Universal chloroplast integration and expression vectors, transformed plants and products thereof
CN1997743A (en) * 2004-03-03 2007-07-11 国立大学法人奈良先端科学技术大学院大学 Method for improving productivity of plant by chloroplast technology
CN102634540A (en) * 2002-07-03 2012-08-15 中佛罗里达大学 Plastid genetic engineering via somatic embryogenesis
CN103667328A (en) * 2013-12-03 2014-03-26 中国海洋大学 Construction method of porphyra yezoensis plastid genetic transformation vector

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1276835A (en) * 1997-08-07 2000-12-13 奥本大学 Universal chloroplast integration and expression vectors, transformed plants and products thereof
CN102634540A (en) * 2002-07-03 2012-08-15 中佛罗里达大学 Plastid genetic engineering via somatic embryogenesis
CN1997743A (en) * 2004-03-03 2007-07-11 国立大学法人奈良先端科学技术大学院大学 Method for improving productivity of plant by chloroplast technology
CN103667328A (en) * 2013-12-03 2014-03-26 中国海洋大学 Construction method of porphyra yezoensis plastid genetic transformation vector

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Tools for plastid transformation;Lupi, Claudio Gianpiero;《ETH Library》;19991231;第1-110页 *
一种载体构建的新方法:一步克隆法;欧阳平等;《湖北大学学报(自然科学版)》;20070630;第29卷(第2期);摘要，图1，第178-179页第1.3-2.2节，第180页第3.1-3.3节 *

Also Published As

Publication number Publication date
CN107267538A (en) 2017-10-20

Similar Documents

Publication Publication Date Title
CN110527737B (en) Positive plasmid molecule pYCID-1905 identified by transgenic rape and transformant of transgenic rape product and application thereof
CN112921054B (en) Lentiviral vector for treating beta-thalassemia and preparation method and application thereof
US5286636A (en) DNA cloning vectors with in vivo excisable plasmids
CN105368732B (en) One plant of an industrial strain of S.cerevisiae strain for producing xylitol and construction method
CN104593413A (en) Method for synthesizing secreted human serum albumin employing bombyx mori posterior silk gland
CN107267538B (en) A kind of construction method of plant plastid expression vector and application
CN104962576B (en) A kind of flavobacterium columnare gene orientation knocks out plasmid and application
CN112266914B (en) Strong constitutive promoter of bumblebee candida and application thereof
CN111235118B (en) Human type 3 adenovirus replication-defective recombinant virus, construction method and application
CN110804559B (en) Recombinant penicillium chrysogenum gene engineering bacterium and construction method and application thereof
CN110452893B (en) Construction and application of high-fidelity CRISPR/AsCpf1 mutant
CN108949800B (en) A kind of efficient convenient gene location is inserted into Genetic Transformation System of Filamentous Fungi and its application at seat
CN114540355A (en) HHEX cartilage tissue specificity knockout mouse animal model and construction method thereof
CN114107369A (en) Preparation method and application of MYC label fusion expression vector
CN109777829A (en) A kind of construction method of the sgRNA expression component of gene editing U6 promoter driving
CN110117622B (en) CRISPR/Cas gene editing system and preparation method and application thereof
CN110331170A (en) The gene expression element and its construction method of a kind of dual gRNA and application
CN107400678A (en) A kind of cloning vector for efficiently purifying interaction protein
CN112159819B (en) Method for constructing domestic silkworm strain of yellow croaker growth hormone bioreactor
CN108148876B (en) A kind of trichoderma harzianum gene knockout method
CN112760241B (en) Recombinant penicillium chrysogenum gene engineering bacterium and construction method and application thereof
KR102553935B1 (en) Method for culturing a cell expressing a protein
CN1544656A (en) Fluorescence quantitative PCR reagent kit and detection method for human respiratory syncytial virus
CN106591369A (en) Method for targeted editing of buffalo 18S rDNA gene by virtue of adenovirus system
KR101578431B1 (en) Foot-and-mouth disease virus expressing P1-protective antigen of C-EURO-SA topotype and the manufacturing methods

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20191105

Termination date: 20200612