CN107012121B

CN107012121B - Construction of Stable cell lines carrying orthogonal tRNA/aminoacyltRNA synthetases

Info

Publication number: CN107012121B
Application number: CN201610055542.8A
Authority: CN
Inventors: 周德敏; 夏青; 徐欢; 张博; 司龙龙; 杨琦; 姚天卓; 张礼和
Original assignee: Peking University
Current assignee: Peking University
Priority date: 2016-01-27
Filing date: 2016-01-27
Publication date: 2021-01-26
Anticipated expiration: 2036-01-27
Also published as: CN107012121A; CN112725282A

Abstract

The invention relates to a method for constructing a stable cell line carrying orthogonal tRNA/aminoacyltRNA synthetase. The invention also relates to a construction method of a double lentivirus vector, a construction method of an orthogonal tRNA vector carrying multiple copies, and a method for stably integrating an orthogonal tRNA/aminoacyltRNA synthetase gene into a cell genome by virtue of stable transduction and plasmid transfection of double lentiviruses. The invention further relates to the use of the stable cell lines, such as the expression of a protein of interest comprising an unnatural amino acid.

Description

Construction of Stable cell lines carrying orthogonal tRNA/aminoacyltRNA synthetases

Technical Field

The invention belongs to the field of biological pharmacy, and relates to a method for constructing a stable cell line carrying orthogonal tRNA/aminoacyl tRNA synthetase.

Background

(1) Gene codon expansion technique

In recent years, genetic code expansion technology is rapidly developed, an amber stop codon is used as a sense codon, and designed unnatural amino acid can be finally introduced into protein by introducing corresponding orthogonal tRNA and aminoacyltRNA synthetase. Depending on the nature of the unnatural amino acid, a particular function can be imparted to the protein. To date, hundreds of unnatural amino acids have been successfully expressed on the surface of protein in a site-specific manner, and the concerned unnatural amino acids include various functional groups containing azide, alkynyl, keto, aldehyde group, alkenyl, amide, nitro, phosphate, sulfonate and the like, and can perform various bio-orthogonal reactions, such as: click chemistry, light sensitivity, glycosylation, photocrosslinking, and the like.

(2) Application of gene codon expansion technology in protein drug development

The development of modern biotechnology has enabled the large-scale production of protein drugs, and the number of such drugs in clinical use is increasing. The protein medicine refers to polypeptide, gene engineering medicine, monoclonal antibody, gene engineering antibody and recombinant vaccine. Compared with the existing micromolecule drugs, the protein drug has the characteristics of high activity, strong specificity, low toxicity, clear biological function and contribution to clinical application. However, protein drugs also have the disadvantages of poor stability, poor membrane permeability, short biological half-life and the like, and influence the therapeutic potential and clinical application of protein drugs. Modification or modification of the native protein structure is an effective way to obtain better pharmacokinetic properties. Various modifications are started from changing the properties of the recombinant protein, such as increasing the relative molecular mass, slowing down the degradation of protease, reducing the immunogenicity, improving the biological and chemical stability and the like, further improving the in vivo pharmacokinetic properties, prolonging the in vivo half-life period or accelerating the in vivo release, reducing the generation rate of neutralizing antibodies, improving the adaptability of patients and improving the treatment effect and the like. In view of the many advantages of the modified or modified proteins, recombinant modification of proteins and in vitro and in vivo modifications will also be increasingly used. The first generation of protein modification technology has the defect of uncontrollable coupling sites, so the traditional modification method is non-site-specific and non-quantitative and is not suitable for quality control of large-scale production and preparation. The site of the non-natural amino acid modification technology is controllable, and the method has wide application prospect in the field of protein modification. Taking antibody-conjugated drugs as an example, compared with the traditional ADC (antibody-drug conjugate) drugs with uncontrollable modification sites, site-specific ADC drugs have strong specificity, single component and low toxicity, which is undoubtedly the development direction of future targeted drugs (Tian Feng et al PNAS,2014,111: 1766-1771.).

(3) Bottleneck of industrial application of gene codon expansion technology

Protein expression systems can be broadly classified into prokaryotic, yeast, plant, insect and mammalian cell expression systems, depending on the type of host cell. Compared with other systems, the mammalian cell expression system has the advantages of guiding the correct folding of proteins, providing various post-translational processing functions such as complex N-type glycosylation and accurate O-type glycosylation, and the like, so that the expression product is closest to the natural high biological protein molecules in terms of molecular structure, physicochemical properties and biological functions. In order to realize high-yield large-scale production of protein drugs, a high-expression stable cell line of a target gene needs to be constructed industrially. However, an urgent problem to be solved when applying unnatural amino acids to the development of protein drugs is how to construct engineered cells that stably integrate orthogonal tRNA/aminoacyltRNA synthetases. Since tRNA's transcription and processing are different from proteins, it remains an international challenge to achieve efficient and stable expression of orthogonal tRNA's. The construction of the stably integrated orthogonal tRNA/aminoacyltRNA synthetase engineering cell is realized, and the application of the gene codon expansion technology in the development of protein drugs is effectively promoted.

The luciferase reporter gene is a reporter system for detecting the activity of firefly luciferase (firefly luciferase) by using luciferin (luciferase) as a substrate. Luciferase catalyses the oxidation of luciferin to oxyluciferin, which in turn gives rise to bioluminescence (bioluminescence). The bioluminescence released during the oxidation of luciferin can then be measured by a fluorometer, also known as a chemiluminescence meter or a scintillation counter. The bioluminescent system of luciferin and luciferase can detect the expression of gene sensitively and efficiently, wherein the gene sequence of the luciferase is shown as SEQ ID NO:1, and the amino acid sequence NCBI accession number is AAP 46189.

The invention content is as follows:

the inventors have made a concession and study on the prior art that tRNA (tRNA) from Methanococcus archaea^Pyl) The protein translation systems (the sequence of which is shown in SEQ ID NO: 8) and the pyrrollysyl-tRNA synthetase (PylRS) (the gene sequence of which is shown in SEQ ID NO: 9) are integrated into the genome of a mammalian cell (e.g., HEK293T cell). The inventors first utilized the dual lentivirus system to introduce orthogonal pyrrolysineThe aminoacyl-tRNA synthetase and reporter gene GFP with amber codon mutation are integrated into host cells, and then orthogonal tRNA is integrated into host cells by a method of linear stable transfection of plasmids carrying multiple copies of orthogonal tRNA, so that a stable cell line carrying orthogonal tRNA/aminoacyltRNA synthetase is obtained. The stable cell line enables site-directed insertion of unnatural amino acids onto the surface of a protein of interest, resulting in site-directed mutagenesis of the protein of interest, e.g., a mutant luciferase protein (luciferase).

Advantages of the invention over other approaches may be realized in one or more of the following:

1. a set of double-lentivirus system is constructed, and stable expression of double proteins can be realized simultaneously;

2. a plasmid carrying the high copy number orthogonal tRNA is constructed, and the stable expression of the orthogonal tRNA can be realized;

3. obtaining a stable cell line carrying an orthogonal tRNA/aminoacyltRNA synthetase;

4. by utilizing the stable cell line, unnatural amino acid can be introduced into any site of a target protein, so that a protein which can be specifically modified only at the site is created;

5. the modification purpose of high efficiency and specificity can be realized by utilizing the specific active group on the unnatural amino acid.

Specifically, in a specific embodiment of the invention, the orthogonal tRNA/aminoacyl tRNA synthetase gene is integrated in the host cell HEK293T, essentially by six steps: (1) constructing a virus vector No. 1 pSD31-pylRS-IRES-puro carrying an orthogonal aminoacyltRNA synthetase gene; (2) construction of viral vector No. 2 pSD31-GFP carrying amber codon mutated green fluorescent protein reporter gene at specific site^39TAG-IRES-hygro; (3) constructing a vector pXH-12tRNA-zeo carrying 12 copies of orthogonal tRNA started by type-3Pol III promoter; (4) packaging the virus No. 1 in the step (1) and the virus No. 2 in the step (2), and transducing HEK293T cells to obtain a stable cell line integrating orthogonal aminoacyl tRNA synthetase genes and mutant green fluorescent protein reporter genes; (5) after the vector pXH-12tRNA-zeo in step (3) is linearizedDyeing the stable cell line in the step (4), and screening by using the bleomycin resistance gene carried on the stable cell line; (6) adding unnatural amino acid into the culture medium, selecting monoclonal with green fluorescence, and performing amplification culture to obtain the stable cell line HEK 293-PYL.

The principle that the stable cell line can insert unnatural amino acids into the reporter gene is as follows: integrated mutant tRNAs^PylPylRS satisfies the following relationship: (1): mutant tRNA^PylLysyl tRNA synthetase, which cannot be used by the host cell, can only be acylated by the mutant PylRS; (2): mutant PylRS can only acylate tRNA^PylCannot acylate other tRNA, and thus, mutant tRNA^PylThe relationship with PylRS is orthogonal, i.e., the mutant PylRS can only acylate the mutant tRNA^PylSimultaneous mutant tRNAs^PylCan be acylated only by the mutant PylRS, i.e., the mutant tRNA in the same plasmid^PylAnd PylRS are absolutely mutually exclusive. The orthogonal enzyme, and only the enzyme, can acylate the unnatural amino acid to the orthogonal tRNA, and can acylate only that tRNA, but not other tRNA's. The orthogonal lysyl tRNA synthase/tRNA system was obtained to map Lys-azido (also known as NAEK) of the non-20 common amino acids to the amber codon, thereby allowing the targeted introduction of the unnatural amino acid into the reporter GFP or other protein of interest. Mutant PylRS is integrated into the genome of stable cell lines using lentivirus pSD31-pylRS-IRES-puro, where IRES is an internal ribosome entry site commonly used for polycistronic gene expression (Pelletier J.et al, Nature,1988,334: 320-325.). For example, an IRES sequence is inserted after the gene of interest, followed by a selectable marker gene, so that the transcribed mRNA can express both proteins simultaneously. Over-expression of a gene of interest using the IRES system has 2 advantages: 1. the target gene and the marker gene share one promoter, so that the occurrence of false positive is avoided; IRES translation efficiency lower than the conventional translation initiation site, so that the expression level of the target gene is higher than that of the marker gene (Kozak M, et al, Nucleic Acids Res,2005, 33: 6593-. By using the dual-lentivirus system, the effect can be realized at the same timeBoth proteins are now stably overexpressed in the host cell.

In a specific embodiment of the invention, a set of dual lentiviral vectors, pSD31-IRES-puro and pSD31-IRES-hygro, were constructed, these two viral vectors were derived from the viral vector pSD31(Zhang Jing. et al. RNA,2007,13: 1375-1383.), puro initiated by the sv40 promoter on the pSD31 vector^RReplacement of genes by IRES-puro, respectively^RAnd IRES-hygro^RThe genes, so that 2 virus vectors of different resistances, pSD31-IRES-puro and pSD31-IRES-hygro, were obtained.

In a specific embodiment of the invention, the invention provides a method for stably integrating an orthogonal tRNA in a mammalian cell, in which the principle consists in: prokaryotic trnas are initiated with a suitable eukaryotic promoter and expressed in tandem to increase the probability of integration. The present invention selects a third class of RNA polymerase III promoter (type-3Pol III) which transcribes sequences relying on promoter elements of the promoter itself without the need for any endogenous transcription elements (e.g., A-and B-box) to be present in the downstream coding sequence. Thus, prokaryotic tRNAs lacking the internal initiation elements A-and B-box can be initiated in eukaryotic cells. The invention connects the orthogonal tRNA started by 12 copy number type-3Pol III promoters in series to a shuttle vector pXH, introduces eukaryotic screening bleomycin resistance genes on a pXH vector to obtain a vector pXH-12tRNA-zeo, transfects cells after the vector is linearized, screens the cells by bleomycin, separates and identifies monoclone, and obtains the cells for stably expressing the orthogonal tRNA.

More specifically, the present invention provides:

1. the combined use of dual viral vectors, pSD31-IRES-puro and pSD31-IRES-hygro, can achieve simultaneous over-expression of dual proteins, and the principle utilizes an Internal Ribosome Entry Sequence (IRES), wherein the pSD31-IRES-puro vector carries puromycin (puromycin) resistance gene, and the pSD31-IRES-hygro vector carries hygromycin (hygromycin) resistance gene for eukaryotic screening. The sequence of pSD31-IRES-puro is shown in SEQ ID NO: 2. The sequence of pSD31-IRES-hygro is shown in SEQ ID NO 3.

2. The virus vector 1 with the orthogonal aminoacyl tRNA synthetase gene is pSD31-pylRS-IRES-puro, and the sequence of the virus vector is shown as SEQ ID NO. 4. The vector is packaged into a virus and then transduced into cells and screened for puromycin to integrate orthogonal aminoacyl tRNA synthetases into host cells.

3. Viral vector No. 2 pSD31-GFP carrying green fluorescent protein reporter gene with Tyr39 mutated into amber codon^39TAGIRES-hygro, which transduces cells after packaging the virus, and which allows the integration of a reporter gene into the host cell using hygromycin B screening. pSD31-GFP^39TAGThe sequence of-IRES-hygro is shown in SEQ ID NO. 5.

4. Vector pXH-12tRNA-zeo carrying 12 copies of orthogonal tRNA driven by type-3Pol III promoter, which was linearized and transfected into cells and screened with bleomycin to integrate the orthogonal tRNA into host cells. pXH-12tRNA-zeo has the sequence shown in SEQ ID No. 6.

5. The cell line is HEK293-PYL (a cell line which is preserved in the general microbiological culture collection center of China Committee for culture Collection of microorganisms, has the preservation date of 2015 11-month 17 and the preservation number of CGMCC No: 11592; and is classified and named as HEK293T cells), is obtained by two rounds of virus transduction and 1 round of plasmid stable transfection, carries orthogonal tRNA/aminoacyl tRNA synthetase genes, and can introduce unnatural amino acids into any site of a target protein by utilizing the stable cell line, so that a raw material protein which can only be specifically modified at the site is created.

6. Site-directed mutant proteins, such as the firefly luciferase reporter gene luciferase, have the amino acid at position F14 mutated to an unnatural amino acid, such as the azide-containing unnatural amino acid Lys-azido (NAEK), all exemplified by the unnatural amino acid described below.

The system is also suitable for the unnatural amino acid DiZPK containing the photocrosslinking group

Illustratively, the mutation site may be SEQ id NO:1 one or more amino acids at any position of the encoded luciferase. Preferably, the mutation site is selected from: consisting of SEQ id NO:1 or other sites that have less effect on activity.

7. A site-directed mutant protein of interest which differs from the amino acid sequence of the pre-mutant protein in that: the amino acid at position N is mutated to NAEK, and the connection mode of the mutated amino acid and the protein is shown as the following formula:

from R₁To R₂In the N-terminal to C-terminal direction of the amino acid sequence, R₁Is the 1 st to the N-1 st amino acid residues of the protein,

R₂is amino acid residue from the N +1 th position to the C terminal of the protein, R₄Is composed of

8. A nucleic acid molecule encoding a mutated protein of interest according to any of items 6 to 7 (e.g. luciferase). Illustratively, the nucleic acid molecule differs from SEQ ID NO 1 in that the codon encoding one amino acid at position F14 or other sites having less influence on activity and stability is mapped to an amber codon.

9. A method for preparing a protein of interest containing an unnatural amino acid (e.g. luciferase) comprising the steps of:

(1) a stable cell line HEK293-PYL (a cell line which is preserved in the China general microbiological culture Collection center of China Committee for culture Collection of microorganisms, has the preservation date of 2015, 11 months and 17 days and the preservation number of CGMCC No: 11592 and is classified as human HEK 293T) carrying orthogonal tRNA/aminoacyltRNA synthetase genes is obtained.

(2) Selecting: selecting one or more specific amino acid sites at which mutation is desired in the amino acid sequence of the protein of interest;

(3) gene mutation: mutating the codon of the amino acid of the target protein corresponding to the selected site in the step (2) into amber codon by using a genetic engineering method;

(4) construction of an expression vector: operably connecting the coding sequence of the mutated target protein obtained in the gene mutation step (3) with a proper vector to obtain a mutant sequence expression vector;

(5) expressing: transfecting the mutant sequence expression vector obtained in the step (4) to the stable cell line HEK293-PYL obtained in the step (1), culturing the host cells successfully transfected in a culture medium containing NAEK, and collecting the cells at a proper time;

(6) the cells are lysed and the amount of the protein of interest (e.g., luciferase) containing the unnatural amino acid is measured.

The stable cell line HEK293-PYL of the invention carries orthogonal tRNA/aminoacyltRNA synthetase genes. Illustratively, the stable cell line of the invention has a preservation number of CGMCC No: 11592, in a cell line.

Description of the drawings:

FIG. 1: construction of Dual Lentiviral vectors

A: a structural schematic diagram of a lentiviral vector pSD 31;

b: schematic structure of dual lentiviral vectors pSD31-IRES-puro and pSD 31-IRES-hygro. On the basis of pSD31, through BamHI and xbal double enzyme digestion, an sv40 promoter and a puromycin resistance gene are respectively replaced by IRES-puro and IRES-hygro, so as to obtain double virus vectors with puromycin resistance and hygromycin B resistance respectively;

c: dual viral vectors pSD31-pylRS-IRES-puro and pSD31-GFP^39TAGIRES-hygro. The pSD31-IRES-puro vector is introduced into a CMV promoter and an orthogonal aminoacyl tRNA synthetase gene through single BamHI digestion, and the pSD31-IRES-hygro vector is introduced into the CMV promoter and a mutant green fluorescent protein GFP gene through single BamHI digestion.

FIG. 2: construction of pXH-12tRNA-zeo vector

A: pXH schematic representation of the blank vector;

b: pXH-12tRNA-zeo vector schematic.

FIG. 3: procedure for screening Stable cell lines

The stable cell line HEK293-PYL carrying the orthogonal tRNA/aminoacyltRNA synthetase gene is obtained by 3 rounds of screening, pSD31-pylRS-IRES-puro virus is packaged in the first round of screening, HEK293T cells are transduced, puromycin with the concentration of 0.6ug/ml is used for screening to obtain the stable cell line No. 1 expressing the orthogonal aminoacyltRNA synthetase, and pSD31-GFP is packaged in the second round of screening^39TAGIRES-hygro virus, screened with hygromycin at a concentration of 200ug/ml, to obtain stable cell line No. 2 expressing both orthogonal aminoacyl tRNA synthetase and reporter mutant green fluorescent protein. And in the 3 rd round of screening, after the plasmid pXH-12tRNA-zeo vector is subjected to enzyme digestion linearization, a stable cell line No. 2 is transfected, 400ug/ml zeomycin is used for screening, an unnatural amino acid NAEK is added in the culture process, GFP positive clones are separated and purified, the zeomycin with half of the dose is continuously used for amplification culture, and finally the stable cell line HEK293-PYL is obtained.

FIG. 4: identification of stable cell lines

A: the non-natural amino acid Lys-azido (NAEK) added in the culture of the stable cell line is a structural schematic diagram;

b: the imaging of the green fluorescent protein after adding/subtracting the unnatural amino acid into the stable cell line can ensure that the GFP gene with amber stop codon mutation can be read through only after adding the unnatural amino acid;

c: western Blot detects the expression of orthogonal aminoacyl tRNA synthetase and green fluorescent protein after adding/subtracting unnatural amino acid into a stable cell line, and the full-length green fluorescent protein can be detected only after adding the unnatural amino acid, which is consistent with the result in figure 4B;

d: the firefly luciferase reporter gene luciferase detection stable cell line can introduce unnatural amino acid into any site of target protein, luciferase reading value shows, and after the unnatural amino acid is added, the mutant firefly luciferase protein with full-length activity can be obtained.

For a better understanding of the present invention, the inventors set forth and illustrated specific tests by way of examples, which are set forth to illustrate, but are not to be construed to limit the scope of the present invention. Any equivalent variants or embodiments of the invention are included in the invention.

Example 1: construction and obtaining of double lentivirus vector

(1) Obtaining the Carrier skeleton

The double-lentiviral vector framework is a lentiviral vector pSD31(Zhang Jing. et al. RNA,2007,13: 1375-1383.), wherein the sv40 promoter promotes puromycin resistance gene protein puro^RExpression of (2).

(2) Primer design for SOE PCR

The inventors spliced DNA fragments of an Internal Ribosome Entry Sequence (IRES) and a puromycin (puromycin) resistance gene/hygromycin B (hygromycin) resistance gene by using SOE PCR to obtain IRES-puro and IRES-hygro fragments respectively, and specific primers are shown in the following table.

Table 1: SOE PCR primer List

Mutation site	Sequence (5 '-3' direction)
		IRES-hygro-for(BamHI)	CGGGATCCAATTCCGCCCCTCTC
IRES-hygro-middle-for:	CCCACAAGGAGACGACCTTCCATGAAAAAGCCTGAACTCACC
		IRES-hygro-middle-rev:	GGTGAGTTCAGGCTTTTTCATGGAAGGTCGTCTCCTTGTGGG
IRES-hygro-rev(xbal):	GCTCTAGATCATTCCTTTGCCCTCGGAC

(3) Engineering lentiviral vectors

On the basis of pSD31, through BamHI and xbal double enzyme digestion, the sv40 promoter and puromycin resistance gene fragment are respectively replaced by IRES-puro and IRES-hygro fragments, thereby obtaining double virus vectors with puromycin resistance and hygromycin B resistance respectively.

Example 2: construction and acquisition of pXH-12tRNA-zeo vector

In order to ensure the expression amount of tRNA, multiple copies of promoter-tRNA expressed in tandem need to be cloned into a suitable vector. According to the invention, an pXH blank vector is used as a framework, and a zeomycin-polyA sequence is introduced to the rear of an SV40 promoter through an EcoRI enzyme cleavage site, so that the zeomycin-resistant vector has bleomycin resistance. Thereafter, 12 copies of the promoter-tRNA sequence were cloned into the pXH-zeo vector using the SalI cleavage site, and 4 different tRNA promoters were used to avoid the possibility of recombination between the repeated sequences: 7sk/hu6/H1/mu 6. Finally, a vector bjmu-12t-zeo for screening tRNA is obtained.

(1) Obtaining the Carrier skeleton

pXH-12tRNA-zeo vector skeleton is vector pXH, which is shuttle vector obtained through the transformation of PUC19 vector and has the advantages of capacity of being replicated in eukaryotic cell, small molecular weight, multiple cloning sites, etc. pXH is shown in SEQ ID NO. 7.

(2) Primer design for SOE PCR

The inventor uses SOE PCR to splice a promoter (type-3Pol III) sequence and a DNA fragment of an orthogonal tRNA, the selected promoters are respectively a humanized 7sk promoter, a humanized u6 promoter, a humanized H1 promoter and a murine u6 promoter to respectively obtain 7sk-tRNA, hu6-tRNA, H1-tRNA and mu6-tRNA fragments, and the promoter sequence, the tRNA sequence and specific primers are shown in the following table

TABLE 2-1 promoter and tRNA sequences

TABLE 2-2 SOE-PCR Gene amplification primer List

(3) pXH transformation of vector

On the basis of an pXH vector, a zeomycin-polyA sequence is introduced behind an sv40 promoter through an EcoRI enzyme cleavage site to make the promoter have bleomycin resistance, and a pXH-zeo vector is obtained. Thereafter, the vector was digested singly with SalI, the promoter and tRNA fragments were digested doubly with SalI/xhol isocaudarner, respectively, and 12 copies of the promoter-tRNA sequence were cloned into pXH-zeo vector, thereby obtaining pXH-12tRNA-zeo vector.

Example 3: selection of Stable cell lines

(1) Lentivirus packaging and transduction comprising the steps of:

hek293T cell plating: medium A, composition (DMEM + 10% FBS,1 XNEAA, without sodium pyrolate), cell digestion counts, and cell seeding number per well of six-well plates 4X 10⁵Cells per well.

b. And (3) slow virus packaging: transfection was performed at a cell density of 70% to 80%, and the plasmid and transfection reagent formulations are given in Table 3-1. 6 hours after transfection, medium B (DMEM + 3% FBS,1 XNEAA, With Sodium Pyruvate) was changed. And (5) continuing culturing. Virus fluid was harvested 48 hours, 72 hours after transfection and filtered through a PVDF membrane needle filter with a 0.45 μm pore size.

TABLE 3-1 plasmid ratios for lentivirus packaging

Plasmid/transfection reagents	Dosage per hole
		Opti-MEM	200μl
Transfer vector	0.72μg
		pRSV	0.64μg
VSVG	0.32μg
		PRRE	O.32μgl
Megatran 1.0	6ul

c. Viral transduction: six-well plates are paved one day in advance for counting the cells infected by the virus, 2ml of virus liquid is added into each well, and Polybrene is added to ensure that the concentration of the Polybrene in the virus liquid is 8 mu g/ml.

d. And (3) virus titer determination: HT1080 cells are infected to form clones by adopting a multiple dilution method.

e. And (3) antibiotic screening: after the virus is transduced for 24h, antibiotic screening can be carried out, and the screening concentration is determined according to the killing curve of specific cells, wherein the screening concentration of the puromycin of the 293T cell is 0.6ug/ml, and the screening concentration of the hygromycin B is 200 ug/ml. And (4) screening antibiotics for 10 days until all blank groups without the virus liquid die, forming monoclone by the experiment group with the virus liquid, and performing amplification culture on the monoclone to obtain a stable cell line.

(2) pXH-12tRNA-zeo vector, comprising the steps of:

a. after the pXH-12t-zeo vector was linearized by digestion, the stable cell line obtained in (1) was selected by transfection.

b. After 6 hours of transfection, the solution was changed and the unnatural amino acid NAEK was added.

c. After 48 hours of transfection, green fluorescence was observed, the solution was changed and 400ug/ml zeomycin was added.

d. Fluid changes were made every 3 days until the blank group was completely dead and the transfected group formed clones.

e. Separating and purifying GFP positive clone, continuously using bleomycin whose dosage is halved

Culturing to obtain the stable cell line HEK 293-PYL.

The stable cell line HEK293-PYL can be obtained from the common microorganism center of China Committee for culture Collection of microorganisms, the preservation date is 2015, 11 and 17 days, and the preservation number is CGMCC No: 11592 was obtained.

Example 4: identification of stable cell lines

The stable cell line HEK293-PYL constructed in the invention contains tRNA (tRNA) derived from archaeomethanecoccus^Pyl) And pyrrolysinyl-tRNA synthetase (pylRS), which in the expressing cell, uses the amber stop codon (TAG) as the sense codon, enabling the incorporation of the unnatural amino acid NAEK into the protein. Next, the inventors examined the possibility of incorporation of NAEK and the productivity of the mutant protein.

1: synthesis and characterization of the unnatural amino acid NAEK

The chemical synthesis reaction formula of the unnatural amino acid Lys-azido is as follows

As described above, 2.3mL of the starting material 1 (2-bromoethanol) was dissolved in 90mL of acetone and 15mL of water, and NaN33.12g was added thereto, and the mixture was heated in a 60 ℃ oil bath and refluxed for 20 hours. Cooled to room temperature, the acetone removed by rotary evaporation, extracted with anhydrous ether (30 mL. times.8), anhydrous Na₂SO₄Drying, rotary evaporating to remove solvent to obtain 262g of colorless liquid product 2.

Product 2(500mg, 5.74mmol) was added to a solution of triphosgene (1.70g, 5.74mmol) in THF (10 ml). The reaction is stirred for 8h at 0 ℃ and the solvent is evaporated to dryness. The residue was dried under vacuum for 1h to give product 3 as a colorless oil.

3 was dissolved in 1.5ml THF and slowly added to a solution of Boc-Lys-OH (1.7g, 6.88mmol) in 1M NaOH (20ml)/THF (5 ml). The reaction was stirred at 0 ℃ for 12h and gradually warmed to room temperature. And cooling the reaction liquid to 0 ℃ again, and adjusting the pH value of the reaction liquid to 2-3 by using a 1M hydrochloric acid solution at 0 ℃. The reaction solution was extracted with EtOAc (30 mL. times.5), and the organic layer was washed with 2X 100mL of saturated brine. Anhydrous Na₂SO₄The organic layer was dried, filtered and the solvent removed by rotary evaporation to give 1.65g of product 4 as a colorless viscous liquid without further purification.

4 was dissolved in 15mL CH2Cl2, 15mL TFA was slowly added dropwise with stirring, the solvent was evaporated after 30min reaction at room temperature, the remaining liquid product was dissolved in 5mL methanol, 100mL diethyl ether was added to precipitate a large amount of white solid precipitate, which was filtered and dried to give 1.38g of the final product 5 as a white solid. 1H NMR (D2O) δ 1.22-1.45(M,4H),1.67-1.73(M,2H),2.99(M,2H),3.38(M,2H),3.70(M,1H),4.09(M,2H), 13C NMR (D2O) δ 21.4,28.4,29.6,39.5,53.4,56.2,57.8,116.0(TFA),153.1,162.3(TFA),172.9, HRMS M/z calcd for C9H17N5O4[ M ] +: 259.1281; 259.1283, which confirmed that the Lys-azido structure was correct.

2: NAEK incorporation expression of mutant luciferases

Taking the mutant form of firefly luciferase (luciferase-Phe-14TAG) as an example: the stable cell line HEK293-PYL of example 3 was transfected with a nucleic acid vector carrying a mutant firefly luciferase, with the addition of NAEK to a final concentration of 1mM, 37 ℃, 5% CO₂Cells were lysed 48 hours after expression;

luciferase substrate was added to the cell lysate and the fluorescence readings were detected. The results are shown in FIG. 4D. After adding unnatural amino acids, the mutant firefly luciferase protein with full-length activity can be obtained.

Although the present invention has been described in the above-mentioned embodiments, it is to be understood that the present invention may be further modified and changed without departing from the spirit of the present invention, and that such modifications and changes are within the scope of the present invention. For example, although the present application describes the use of stable cell lines by way of example of luciferase, it is clear that the invention should not be limited to luciferase alone, and one skilled in the art can insert unnatural amino acids into any protein of interest.

Claims

1. A site-directed mutagenesis protein characterized in that an amino acid at a site is mutated to an unnatural amino acid, Lys-azido (NAEK), which is an unnatural amino acid containing an azide group

The site-directed mutant protein is luciferase, and the mutant site is F14 th site of the luciferase encoded by the sequence shown in SEQ ID NO. 1.

2. The method for preparing a site-directed mutant protein according to claim 1, which comprises the steps of:

(1) selecting an amino acid site of a desired mutation in the amino acid sequence of the protein of interest;

(2) mutating the codon of the amino acid at the selected position in the step (1) into an amber codon UAG in the nucleic acid molecule for encoding the target protein in the step (1);

(3) operably linking the mutated nucleic acid obtained in (2) with a suitable vector to obtain an expression vector for the mutated nucleic acid;

(4) transfecting the expression vector of the mutated nucleic acid obtained in (3) into a cell line as described below, culturing the host cell successfully transfected in a medium containing NAEK, and collecting the cells at an appropriate time;

(5) detecting the activity of the target protein containing the unnatural amino acid;

the cell line is a cell line for introducing an unnatural amino acid at any site of a protein, wherein the cell line carries a pyrrolysinyl-tRNA synthetase gene and a tRNA derived from Methanococcus archaeus^PylWherein the pyrrollysyl-tRNA synthetase gene is shown as SEQ ID NO:9 to。

3. The method of making a site-directed mutant protein according to claim 2, wherein said tRNA is^Pylpromoter-tRNA being of multiple copy number^Pyl。

4. The method of making a site-directed mutant protein according to claim 3, wherein said tRNA is^PyltRNA initiated by 12 copy number type-3Pol III promoter^Pyl。

5. The method of making a site-directed mutant protein according to claim 2, wherein said tRNA is^PylDerived from vector pXH-12tRNA-zeo with the sequence shown in SEQ ID NO. 6.

6. The method for producing a site-directed mutant protein according to any one of claims 2 to 5, wherein the cell line is obtained by the following steps:

(1) connecting the pyrrilysinyl-tRNA synthetase gene to pSD31-IRES-puro shown as SEQ ID NO. 2 to obtain a carried virus vector pSD31-pylRS-IRES-puro shown as SEQ ID NO. 4;

(2) the green fluorescent protein gene with mutation is connected to the pSD31-IRES-hygro shown in SEQ ID NO. 3 to obtain the virus vector pSD31-GFP shown in SEQ ID NO. 5^39TAG-IRES-hygro；

(3) The viral vectors described in packages (1) and (2), pSD31-pylRS-IRES-puro and pSD31-GFP^39TAG-IRES-hygro, transduce HEK293T cells, screen with puromycin and hygromycin B, respectively, to obtain a stable cell line that integrates the pyrrollysyl-tRNA synthetase gene and the mutant green fluorescent protein reporter gene;

(4) linearizing a vector pXH-12tRNA-zeo with the sequence shown as SEQ ID NO. 6, transfecting the stable cell line obtained in the step (3), and screening by using a bleomycin resistance gene carried on the stable cell line;

(5) adding unnatural amino acid into the culture medium, selecting the monoclonal with green fluorescence, and performing expanded culture to finally obtain the stable cell line.

7. The method for preparing site-directed mutant protein according to claim 6, wherein the stable cell line is HEK293-PYL with a preservation number of CGMCC No: 11592.

8. the method of claim 2, wherein the 14 th amino acid is mutated to NAEK, and the 14 th amino acid is linked to the protein according to the following formula:

from R₁To R₂In the N-terminal to C-terminal direction of the amino acid sequence, R₁Is the 1 st to 13 th amino acid residues,

R₂is an amino acid residue from position 15 to the C-terminus, R₄Is composed of

。

9. A nucleic acid molecule encoding a site-directed mutant protein according to any one of claims 1-8.

10. The site-directed mutagenesis protein nucleic acid molecule of claim 9 wherein the codon encoding the unnatural amino acid is the amber codon, UAG.