CN106987657A - For differentiating that the primer of bovine viral diarrhea virus and bovine rota is combined and its applied - Google Patents
For differentiating that the primer of bovine viral diarrhea virus and bovine rota is combined and its applied Download PDFInfo
- Publication number
- CN106987657A CN106987657A CN201710264432.7A CN201710264432A CN106987657A CN 106987657 A CN106987657 A CN 106987657A CN 201710264432 A CN201710264432 A CN 201710264432A CN 106987657 A CN106987657 A CN 106987657A
- Authority
- CN
- China
- Prior art keywords
- primer
- sequence
- bovine
- viral diarrhea
- diarrhea virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of primer combination and its application for being used to differentiate bovine viral diarrhea virus and bovine rota.The single strand dna that the primer that the present invention is provided combines shown in the sequence 18 by sequence table is constituted, and fluorophor A is connected with 5 ' ends of the single strand dna shown in sequence 3, and fluorophor B is connected with 5 ' ends of the single strand dna shown in sequence 7.The present invention introduces fluorophor in LAMP method first, establishes identification BVDV and BRV bifluorescence RT LAMP methods, can be while two kinds of viruses of antidiastole by amplified production color observation.The double RT LAMP methods specificity that the present invention is set up is good, energy efficient amplification target gene, and to other etiology nucleic acids without amplification, sensitiveness is good, most low energy detects 100 hybrid template copy/reactions, is a kind of simplicity, quickly, the diagnostic method of low cost, it is adaptable to large-scale epidemiology survey.
Description
Technical field
The present invention relates to a kind of primer combination and its application for being used to differentiate bovine viral diarrhea virus and bovine rota.
Background technology
Bovine viral diarrhea virus (Bovine viral diarrhea disease virus, BVDV) and bull wheel shape disease
Malicious (Bovine Rotavirus, BRV) is two kinds of common bovine diarrhea viruses, and symptom is similar, it is difficult to distinguish.BVDV clinically often goes out
Now generate heat, suffer from diarrhoea, mucosa injury and toe are damaged, but most of infection BVDV ox does not show clinical symptoms with persistent infection
In the presence of the Niu Yidan of persistent infection contacts antigenic similarity antigen again will be secondary for mucous membrane disease, the death rate 100%.Continue
The ox of sexuality dye can be by the number of ways such as blood, excreta horizontal transmission virus, can also be by genital tract vertical transmission, they
Lifelong band poison, continues toxin expelling, is that cattle-raising is potentially hazardous as the important infection sources.Bovine rota infects the calf of 1-7 ages in days
Ox, can cause calf alimentary canal in disorder, be clinically characterized with vomiting, diarrhoea, dehydration and acid-base balance.Two kinds of virus senses
Serious economic loss can all be caused after dye, therefore be badly in need of setting up the quick detection skill of bovine viral diarrhoea and bovine rota
Art, the prevention and control for China BVDV and BRV provide technical support.
Conventional BVDV and BRV diagnostic method mainly has at present：Pathogen separation, serological method and molecular biology side
Method (RT-PCR and fluorescence RT-PCR).The external isothermal duplication detection technique (Loop-mediatedisothermal of ring mediation
Amplification, LAMP) the emerging nucleic acid detection technique that grows up on PCR method, breach the technology of constant-temperature amplification
Difficult point, increases when 6 primers are with efficiency, and sensitiveness is high, and specificity is good, is applied in the detection of a variety of diseases.It is multiple
LAMP is a kind of efficient LAMP forms, and a LAMP reaction can simultaneously detect, differentiate multiple pathogens.But domestic at present
Multiple LAMP method has certain limitation, it is impossible to it is determined that being positive findings caused by any cause of disease the bottom of specific to, it is impossible to
Realize antidiastole truly.
The content of the invention
It is an object of the invention to provide a kind of primer combination for being used to differentiate bovine viral diarrhea virus and bovine rota and
It is applied.
Present invention protection primer combination first, is made up of primer sets I and primer sets II；
The primer sets I is made up of primer BVDV-F3, primer BVDV-B3, primer BVDV-FIP and primer BVDV-BIP；
The primer BVDV-F3 is following (a1) or (a2)：
(a1) single strand dna shown in the sequence 1 of sequence table；
(a2) sequence 1 is had by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 1
The DNA molecular of identical function；
The primer BVDV-B3 is following (a3) or (a4)：
(a3) single strand dna shown in the sequence 2 of sequence table；
(a4) sequence 2 is had by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 2
The DNA molecular of identical function；
The primer BVDV-FIP is following (a5) or (a6)：
(a5) single strand dna shown in the sequence 3 of sequence table；
(a6) sequence 3 is had by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 3
The DNA molecular of identical function；
The primer BVDV-BIP is following (a7) or (a8)：
(a7) single strand dna shown in the sequence 4 of sequence table；
(a8) sequence 4 is had by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 4
The DNA molecular of identical function；
The primer sets II is made up of primer BRV-F3, primer BRV-B3, primer BRV-FIP and primer BRV-BIP；
The primer BRV-F3 is following (b1) or (b2)：
(b1) single strand dna shown in the sequence 5 of sequence table；
(b2) sequence 5 is had by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 5
The DNA molecular of identical function；
The primer BRV-B3 is following (b3) or (b4)：
(b3) single strand dna shown in the sequence 6 of sequence table；
(b4) sequence 6 is had by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 6
The DNA molecular of identical function；
The primer BRV-FIP is following (b5) or (b6)：
(b5) single strand dna shown in the sequence 7 of sequence table；
(b6) sequence 7 is had by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 7
The DNA molecular of identical function；
The primer BRV-BIP is following (b7) or (b8)：
(b7) single strand dna shown in the sequence 8 of sequence table；
(b8) sequence 8 is had by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 8
The DNA molecular of identical function.
5 ' the ends of the primer BVDV-FIP are connected with fluorophor A.
5 ' the ends of the primer BRV-FIP are connected with fluorophor B.
The fluorophor A can be FITC.
The fluorophor B can be CY5.5.
The purposes of the primer combination is any of following (c1) to (c6)：
(c1) bovine viral diarrhea virus and bovine rota are differentiated；
(c2) kit for differentiating bovine viral diarrhea virus and bovine rota is prepared；
(b3) detect whether pathogenic microorganism to be measured is bovine viral diarrhea virus or bovine rota；
(c4) prepare for detect pathogenic microorganism to be measured whether be bovine viral diarrhea virus or bovine rota reagent
Box；
(c5) whether bovine viral diarrhea virus and/or bovine rota are contained in detection sample to be tested；
(c6) prepare for detect in sample to be tested whether the reagent containing bovine viral diarrhea virus and/or bovine rota
Box.
The present invention also protects the application of the primer combination, is any of following (c1) to (c6)：
(c1) bovine viral diarrhea virus and bovine rota are differentiated；
(c2) kit for differentiating bovine viral diarrhea virus and bovine rota is prepared；
(b3) detect whether pathogenic microorganism to be measured is bovine viral diarrhea virus or bovine rota；
(c4) prepare for detect pathogenic microorganism to be measured whether be bovine viral diarrhea virus or bovine rota reagent
Box；
(c5) whether bovine viral diarrhea virus and/or bovine rota are contained in detection sample to be tested；
(c6) prepare for detect in sample to be tested whether the reagent containing bovine viral diarrhea virus and/or bovine rota
Box.
The present invention kit that also protection is combined containing the primer；The purposes of the kit is following (d1)-(d3)
At least one of：
(d1) bovine viral diarrhea virus and bovine rota are differentiated；
(d2) detect whether pathogenic microorganism to be measured is bovine viral diarrhea virus or bovine rota；
(d3) whether bovine viral diarrhea virus and/or bovine rota are contained in detection sample to be tested.
The present invention also protects the preparation method of the kit, including the step of each bar primer is individually packed.
The present invention also protects a kind of method for differentiating bovine viral diarrhea virus and bovine rota, comprises the following steps：Carry
Take viral nucleic acid to be measured；Using the nucleic acid as template, bifluorescence RT-LAMP, Ran Houjin are carried out using primer combination
Row is following to be judged：If being able to detect that the amplified production with the corresponding fluorescence of fluorophor A, virus to be measured are bovine viral abdomen
Diarrhea virus, if it is bovine rota enough to detect the amplified production with the corresponding fluorescence of fluorophor B, virus to be measured.
In methods described, when the fluorophor A is FITC, when the fluorophor B is CY5.5, if described expand
Increasing production thing can observe that the DNA fragmentation of green, virus to be measured are bovine viral diarrhea virus under 520nm ultraviolet light, if
The amplified production can observe that red DNA fragmentation, virus to be measured are bovine rota under 670nm ultraviolet light.
In methods described, the virus to be measured is bovine viral diarrhea virus or bovine rota.
The present invention also protects whether a kind of detection pathogenic microorganism to be measured is bovine viral diarrhea virus or bovine rota
Method, comprises the following steps：Extract the nucleic acid of pathogenic microorganism to be measured；Using the nucleic acid as template, combined using the primer
Bifluorescence RT-LAMP is carried out, is then made the following judgment：If be able to detect that with the corresponding fluorescence of fluorophor A
Amplified production, pathogenic microorganism to be measured are bovine viral diarrhea virus, if enough detected with the corresponding fluorescence of fluorophor B
Amplified production, pathogenic microorganism to be measured are bovine rota, if the expansion with the corresponding fluorescence of fluorophor A can not be detected
Increase production thing and the amplified production with the corresponding fluorescence of fluorophor B can not be detected, pathogenic microorganism to be measured is non-bovine viral
Diarrhea virus and non-bovine rota.
In methods described, when the fluorophor A is FITC, when the fluorophor B is CY5.5, if described expand
Increasing production thing can observe that the DNA fragmentation of green, pathogenic microorganism to be measured are bovine viral diarrhoeal diseases under 520nm ultraviolet light
Poison, if the amplified production can observe that red DNA fragmentation, pathogenic microorganism to be measured are under 670nm ultraviolet light
Bovine rota, if the amplified production can not observe the DNA fragmentation of green under 520nm ultraviolet light and can not be
It is non-bovine viral diarrhea virus and non-bull wheel shape that red DNA fragmentation, pathogenic microorganism to be measured are observed under 670nm ultraviolet light
Virus.
In methods described, the pathogenic microorganism to be measured is Mycoplasma bovis, bovine viral diarrhea virus, ox infectiousness nose gas
Pipe inflammation virus, foot and mouth disease virus, vesicular stomatitis virus, blue tongue virus, bovine rota or PPR virus.
Concretely Mycoplasma bovis GL-1 plants of the Mycoplasma bovis.
The bovine viral diarrhea virus concretely bovine viral diarrhea virus Oregon plants or bovine viral diarrhea
Malicious GX-041 plants (BVDV-2 types).
The foot and mouth disease virus concretely foot and mouth disease virus A types.
The vesicular stomatitis virus concretely vesicular stomatitis virus NJ types or vesicular stomatitis virus IND types.
The blue tongue virus concretely type of blue tongue virus serum 4.
Concretely bovine rota NCDV plants of the bovine rota.
Concretely PPR virus Nigeria75/1 plants of the PPR virus.
The present invention also protects a kind of whether detect in sample to be tested containing bovine viral diarrhea virus and/or bovine rota
Method, comprises the following steps：Extract the nucleic acid of sample to be tested；Using the nucleic acid as template, two are carried out using primer combination
Weight fluorescence RT-LAMP, then makes the following judgment：If being able to detect that the amplification production with the corresponding fluorescence of fluorophor A
Contain bovine viral diarrhea virus in thing, sample to be tested, if it is possible to detect the amplification production with the corresponding fluorescence of fluorophor B
Contain bovine rota in thing, sample to be tested, if it is possible to detect the amplified production with the corresponding fluorescence of fluorophor A and
If being able to detect that the amplified production with the corresponding fluorescence of fluorophor B, containing bovine viral diarrhea virus in sample to be tested
And contain bovine rota, if the amplified production with the corresponding fluorescence of fluorophor A can not be detected and can not be detected
Bovine viral diarrhea virus is not contained in amplified production, sample to be tested with the corresponding fluorescence of fluorophor B and does not contain bull wheel
Shape virus.
In methods described, when the fluorophor A is FITC, when the fluorophor B is CY5.5, if described expand
Increasing production thing can observe in the DNA fragmentation of green, sample to be tested under 520nm ultraviolet light containing bovine viral diarrhea virus,
If the amplified production can be observed under 670nm ultraviolet light contains bull wheel shape in red DNA fragmentation, sample to be tested
Virus, if the amplified production can observe the DNA fragmentation of green under 520nm ultraviolet light and can be in 670nm
Ultraviolet light under observe in red DNA fragmentation, sample to be tested containing bovine viral diarrhea virus and contain bovine rota, such as
Really described amplified production can not under 520nm ultraviolet light observe green DNA fragmentation and can not 670nm ultraviolet light
Lower observe does not contain bovine viral diarrhea virus in red DNA fragmentation, sample to be tested and does not contain bovine rota.
In methods described, the sample to be tested is in vitro animal tissue, food that for example beef, beef are processed into,
Ox internal organ, food that ox internal organ are processed into etc..
Nucleic acid described in any of the above is DNA, RNA or DNA and RNA mixture.
The nucleic acid or viral nucleic acid to be measured that sample to be tested is extracted described in any of the above are using the common extraction reagent kits of RNA/DNA
Extract obtained nucleic acid.
The initial reaction system of bifluorescence RT-LAMP described in any of the above is (25 μ L)：The μ L of template 1,10 × buffer
2.5 μ L, Bst archaeal dna polymerase 15U, AMV reverse transcriptases 20U, primer BVDV-FIP-2 40pmol, primer BVDV-BIP
40pmol, primer BRV-FIP-2 40pmol, primer BRV-BIP 40pmol, primer BVDV-F3 5pmol, primer BVDV-B3
5pmol, primer BRV-F3 5pmol, primer BRV-B3 5pmol, surplus is water.
The composition of the 10 × buffer is：Tris-HCl(pH 8.8)200mM、KCl 100mM、MgSO4 80mM、
(NH4)2SO4100mM, 1% (percent by volume) Tween 20, glycine betaine 8M, dNTPs 14M.
Bifluorescence RT-LAMP response procedures are described in any of the above：42 DEG C of 20min, 62 DEG C of 90min, 80 DEG C
5min。
The present invention introduces fluorophor in LAMP method first, establishes identification BVDV and BRV bifluorescence RT-
LAMP method, can be while two kinds of viruses of antidiastole by amplified production color observation.The double RT-LAMP side that the present invention is set up
Method specificity is good, energy efficient amplification target gene, and to other etiology nucleic acids without amplification, sensitiveness is good, and most low energy detects 100
Individual hybrid template copy/reaction, is a kind of simplicity, quickly, inexpensive diagnostic method, it is adaptable to which large-scale epidemiology is adjusted
Look into.
Brief description of the drawings
Fig. 1 is primer sets I and primer sets II schematic diagrames.
Fig. 2 is the result of embodiment 3.
Fig. 3 is the electrophoresis result of embodiment 5.
Fig. 4 is the Turbidity measurement result of embodiment 5.
Fig. 5 is the result of embodiment 6.
Embodiment
Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method, is conventional method unless otherwise specified.Test material used in following embodiments, is certainly unless otherwise specified
What routine biochemistry reagent shop was commercially available.Quantitative test in following examples, is respectively provided with three repetition experiments, as a result makes even
Average.
Each strain used in embodiment is shown in Table 1.
Table 1
10×buffer：SIGMA companies.Composition is：Tris-HCl(pH8.8)200mM、KCl 100mM、MgS04
80mM、(NH4)2SO4100mM, 1% (percent by volume) Tween 20, glycine betaine 8M, dNTPs 14M.
Bst archaeal dna polymerases：new England.
AMV reverse transcriptases：Takara.
PEASY-T1 carriers：Complete golden biochemical technology (Beijing) Co., Ltd of generation.
Bovine kidney cells (MDBK)：China Veterinery Drug Inspection Office.
Embodiment 1, the design and preparation of primer combination
A large amount of sequence analyses, comparison are carried out to obtain for differentiating bovine viral diarrhea virus (BVDV) and bovine rota
(BRV) some primers.Each primer is subjected to preliminary experiment, compares the performances such as sensitivity, specificity, is finally given for differentiating
BVDV and BRV 2 sets of primer sets.Often set primer sets are by outer primer F3, outer primer B3, inner primer FIP (Flc+F2) and inner primer
BIP (Blc+B2) is constituted.
For identifying that BVDV primer sets are made up of (5 ' → 3 ') following four primers：
BVDV-F3 (sequence 1 of sequence table)：TGCCCTTAGTAGGACTAGCA；
BVDV-B3 (sequence 2 of sequence table)：AGCACCCTATCAGGCTGTA；
BVDV-FIP (sequence 3 of sequence table)：CGAACCACTGACGACTACCCTGGGTAGCAACAGTGGTGAGTT；
BVDV-BIP (sequence 4 of sequence table)：CAAGCCTCGAGATGCCACGTCCGTTTTCACCTGAACGACC；
In primer BVDV-FIP 5 ' end connection fluorophor FITC.
For identifying that BRV primer sets are made up of (5 ' → 3 ') following four primers：
BRV-F3 (sequence 5 of sequence table)：ACTCATGTGCAATAAACGC；
BRV-B3 (sequence 6 of sequence table)：GTTTAGTAGAAACTCTATTTCAACG；
BRV-FIP (sequence 7 of sequence table)：
TCTTTCTGCATCTGGTAAAAGAGTTTAATACGCAACAATTTGAGCA；
BRV-BIP (sequence 8 of sequence table)：
CCAAGAGTGATTAATTCAGCTGACGGGTCTAAGAATCACTGGATTG；
In primer BRV-FIP 5 ' end connection fluorophor CY5.5.
For identifying that BVDV primer sets are named as primer sets I, schematic diagram is as shown in Figure 1A.
For identifying that BVDV primer sets are named as primer sets II, schematic diagram is as shown in Figure 1B.
Above-mentioned each bar primer composition primer sets are closed.
The foundation of embodiment 2, detection method
1st, the nucleic acid of sample to be tested is extracted using the common extraction reagent kits of RNA/DNA.
2nd, take the nucleic acid that step 1 is obtained as template, the primer combination prepared using embodiment 1 carries out bifluorescence RT-
LAMP。
Initial reaction system is (25 μ L)：The μ L of template 1,10 × buffer 2.5 μ L, Bst archaeal dna polymerases 15U, AMV are inverse
Transcriptase 20U, primer BVDV-FIP 40pmol, primer BVDV-BIP 40pmol, primer BRV-FIP 40pmol, primer BRV-
BIP 40pmol, primer BVDV-F3 5pmol, primer BVDV-B3 5pmol, primer BRV-F3 5pmol, primer BRV-B3
5pmol, surplus is water.
Response procedures are：42 DEG C of 20min, 62 DEG C of 90min, 80 DEG C of 5min.
3rd, the product of step 2 is taken, 1% agarose gel electrophoresis is carried out, is respectively the ultraviolet of 520nm and 670nm in wavelength
Observed under lamp.
Embodiment 3, specificity experiments
Sample to be tested is：GX-041 plants of Oregon plants of bovine viral diarrhea virus, bovine viral diarrhea virus in table 1
The mixing of NCDV plants of (BVDV-2 types), NCDV plants of bovine rota, Oregon plants of bovine viral diarrhea virus and bovine rota
Thing (mixture I), foot and mouth disease virus A types, vesicular stomatitis virus NJ types, vesicular stomatitis virus IND types, blue tongue virus blood
GL-1 plants of clear 4 type, Nigeria75/1 plants of PPR virus, infectious bovine rhinotrachetis virus and Mycoplasma bovis.
The method set up according to embodiment 2 is detected.
Setting ddH20 is used as blank control of the template as sample to be tested.
The negative control for using the nucleic acid of bovine kidney cells (MDBK) as sample to be tested is set.
As a result it is as shown in Figure 2.Fig. 2A is the electrophoretogram of 520nm passages, and band is yellow green.Fig. 2 B are 670nm passages
Electrophoresis result, band is large red.Fig. 2 C are the twin-channel electrophoresis results of 520nm and 670nm, and band is red green secondary colour.Swimming
Corresponding bovine viral diarrhea virus Oregon plants of road 1, corresponding bovine viral diarrhea virus GX-041 plants of swimming lane 2 (BVDV-2 types),
NCDV plants of corresponding bovine rota NCDV plants of swimming lane 3, corresponding bovine viral diarrhea virus Oregon plants of swimming lane 4 and bovine rota
Mixture (mixture I), the corresponding foot and mouth disease virus A types of swimming lane 5, the corresponding vesicular stomatitis virus NJ types of swimming lane 6,7 pairs of swimming lane
Answer vesicular stomatitis virus IND types, the corresponding type of blue tongue virus serum 4 of swimming lane 8, the corresponding PPR virus of swimming lane 9
Nigeria75/1 plants, the corresponding infectious bovine rhinotrachetis virus of swimming lane 10, corresponding Mycoplasma bovis GL-1 plants of swimming lane 11, swimming lane 12
Correspondence blank control, the corresponding negative control of swimming lane 13.
As a result show, the method set up using embodiment 2 only expands BVDV and BRV nucleic acid, and BVDV and BRV hybrid guided modes
Plate.The BVDV positives are in yellow green, can only be seen under 520 passages；The BRV positives take on a red color, and can only see under 670 passages；
BVDV and BRV hybrid templates are in red green secondary colour, and can be observed under 520 and 670 passages.And to other bovine virals and the moon
Property control without amplification, it is specific good.
It is prepared by embodiment 4, standard items
BVDV standard items：Double chain DNA molecule shown in the sequence 9 of sequence table is connected with pEASY-T1 carriers, weight is obtained
Group plasmid, with reference to T7 in-vitro transcription kit (Fermentas) specifications by recombinant plasmid linearization for enzyme restriction, is eliminated with DNA enzymatic
Wherein DNA pollution, in-vitro transcription is RNA, determines RNA concentration, concentration is converted into copy number according to Avgadro constant,
Obtain BVDV standard items.
BRV standard items：Double chain DNA molecule shown in the sequence 10 of sequence table is connected with pEASY-T1 carriers, weight is obtained
Group plasmid, with reference to T7 in-vitro transcription kit (Fermentas) specifications by recombinant plasmid linearization for enzyme restriction, is eliminated with DNA enzymatic
Wherein DNA pollution, in-vitro transcription is RNA, determines RNA concentration, concentration is converted into copy number according to Avgadro constant,
Obtain BRV standard items.
Embodiment 5, sensitivity experiments
1st, the copy numbers such as the 4 BVDV standard items prepared and BRV standard items will be implemented to mix, obtains mixed liquor.
2nd, ddH is used2The mixed liquor that O10 times of gradient dilution step 2 is obtained, obtains each dilution.
3rd, the dilution for obtaining step 2 is as template, and the method set up using embodiment 2 is detected.
Because the dilution factor of the dilution of use is different, following different reaction system is formed：
In reaction system 1, the initial concentration of BVDV standard items and BRV standard items is 106Copy/μ L；
In reaction system 2, the initial concentration of BVDV standard items and BRV standard items is 105Copy/μ L；
In reaction system 3, the initial concentration of BVDV standard items and BRV standard items is 104Copy/μ L；
In reaction system 4, the initial concentration of BVDV standard items and BRV standard items is 103Copy/μ L；
In reaction system 5, the initial concentration of BVDV standard items and BRV standard items is 102Copy/μ L；
In reaction system 6, the initial concentration of BVDV standard items and BRV standard items is 10 copies/μ L.
In reaction system 7, the initial concentration of BVDV standard items and BRV standard items is 1 copy/μ L.
Setting ddH2The blank control that O makees as template.
As a result it is as shown in Figure 3.Fig. 3 A are the electrophoretogram of 520nm passages, and band is yellow green.Fig. 3 B are 670nm passages
Electrophoresis result, band is large red.Fig. 3 C are the twin-channel electrophoresis results of 520nm and 670nm, and band is red green secondary colour.Swimming
Road 1-7 is corresponding in turn to reaction system 1-7, the corresponding blank control of swimming lane 8.
Reaction product is generated to the real-time turbidity figure under 650nm using real-time transmissometer loopam LA-320C, such as Fig. 4 institutes
Show.Curve 1-7 is corresponding in turn to reaction system 1-7, the corresponding blank control of curve 8.
The above results show that the method set up using embodiment 2 detects BVDV and BRV hybrid template standard items, works as detection
In system during template concentrations as little as 100 copies/μ L, BVDV and BRV can also be detected, method sensitivity is high.
Embodiment 6, interference experiment
1st, the copy numbers such as the 4 BVDV standard items prepared and BRV standard items will be implemented to mix, obtains mixed liquor.
2nd, ddH is used2The mixed liquor that O10 times of gradient dilution step 2 is obtained, obtains each dilution.
3rd, the dilution for obtaining step 2 is as template, and the method set up using embodiment 2 is detected.
Because the dilution factor of the dilution of use is different, following different reaction system is formed：
In reaction system 1, the initial concentration of BVDV standard items is 105The initial concentration of copy/μ L, BRV standard items is equal
For 102Copy/μ L；
In reaction system 2, the initial concentration of BVDV standard items is 107The initial concentration of copy/μ L, BRV standard items is equal
For 103Copy/μ L；
In reaction system 3, the initial concentration of BVDV standard items is 102The initial concentration of copy/μ L, BRV standard items is equal
For 106Copy/μ L；
In reaction system 4, the initial concentration of BVDV standard items is 103The initial concentration of copy/μ L, BRV standard items is equal
For 106Copy/μ L.
As a result it is as shown in Figure 5.Fig. 5 A are the electrophoretogram of 520nm passages, and band is yellow green.Fig. 5 B are 670nm passages
Electrophoresis result, band is large red.Fig. 5 C are the twin-channel electrophoresis results of 520nm and 670nm, and band is red green secondary colour.Swimming
Road 1-4 is corresponding in turn to reaction system 1-4.
As a result show, various concentrations hybrid standard product are detected, another template is dense when a template concentrations height
When spending relatively low, bifluorescence RT-LAMP still can be detected simultaneously by two templates, and amplification efficiency each other is not influenceed, and interference is small.
Embodiment 7, clinical sample detection
Sample to be tested is：144 parts of clinical samples (the excrement cotton swab of diarrhoea ox).
The nucleic acid of sample to be tested is extracted, is detected according to the method for embodiment 2.Positive amplification product is surveyed simultaneously
Sequence is with the correctness of the result.
Detected using the method for embodiment 2,14 parts of BVDV positive samples and 9 parts of BRV positive samples are detected altogether.Will
Positive sample is sequenced, and all positive findingses are true positives, the false positive of no non-specific amplification.
<110>Veterinary Institute of Guangxi Zhuang Autonomous Region
<120>For differentiating that the primer of bovine viral diarrhea virus and bovine rota is combined and its applied
<160> 10
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 1
tgcccttagt aggactagca 20
<210> 2
<211> 19
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 2
agcaccctat caggctgta 19
<210> 3
<211> 42
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 3
cgaaccactg acgactaccc tgggtagcaa cagtggtgag tt 42
<210> 4
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 4
caagcctcga gatgccacgt ccgttttcac ctgaacgacc 40
<210> 5
<211> 19
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 5
actcatgtgc aataaacgc 19
<210> 6
<211> 25
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 6
gtttagtaga aactctattt caacg 25
<210> 7
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 7
tctttctgca tctggtaaaa gagtttaata cgcaacaatt tgagca 46
<210> 8
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 8
ccaagagtga ttaattcagc tgacgggtct aagaatcact ggattg 46
<210> 9
<211> 228
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 9
tgcccttagt aggactagca aaacaaggag ggtagcaaca gtggtgagtt cgttggatgg 60
ctgaagccct gagtacaggg tagtcgtcag tggttcgacg ctttgtgcga caagcctcga 120
gatgccacgt ggacgagggc atgcccacag cacatcttaa cctgagcggg ggtcgttcag 180
gtgaaaacgg tttaaccaac cgctacgaat acagcctgat agggtgct 228
<210> 10
<211> 215
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 10
actcatgtgc aataaacgcg ccagctaata cgcaacaatt tgagcatatt gtacagcttc 60
gaggggtgtt gactacagct acaataactc ttttaccaga tgcagaaaga tttagttttc 120
caagagtgat taattcagct gacggagcga ctacatggta cttcaatcca gtgattctta 180
gaccaaataa cgttgaaata gagtttctac taaac 215
Claims (9)
1. primer is combined, it is made up of primer sets I and primer sets II；
The primer sets I is made up of primer BVDV-F3, primer BVDV-B3, primer BVDV-FIP and primer BVDV-BIP；
The primer BVDV-F3 is following (a1) or (a2)：
(a1) single strand dna shown in the sequence 1 of sequence table；
(a2) have by the substitution of one or several nucleotides of the process of sequence 1 and/or missing and/or addition and with sequence 1 identical
The DNA molecular of function；
The primer BVDV-B3 is following (a3) or (a4)：
(a3) single strand dna shown in the sequence 2 of sequence table；
(a4) have by the substitution of one or several nucleotides of the process of sequence 2 and/or missing and/or addition and with sequence 2 identical
The DNA molecular of function；
The primer BVDV-FIP is following (a5) or (a6)：
(a5) single strand dna shown in the sequence 3 of sequence table；
(a6) have by the substitution of one or several nucleotides of the process of sequence 3 and/or missing and/or addition and with sequence 3 identical
The DNA molecular of function；
The primer BVDV-BIP is following (a7) or (a8)：
(a7) single strand dna shown in the sequence 4 of sequence table；
(a8) have by the substitution of one or several nucleotides of the process of sequence 4 and/or missing and/or addition and with sequence 4 identical
The DNA molecular of function；
The primer sets II is made up of primer BRV-F3, primer BRV-B3, primer BRV-FIP and primer BRV-BIP；
The primer BRV-F3 is following (b1) or (b2)：
(b1) single strand dna shown in the sequence 5 of sequence table；
(b2) have by the substitution of one or several nucleotides of the process of sequence 5 and/or missing and/or addition and with sequence 5 identical
The DNA molecular of function；
The primer BRV-B3 is following (b3) or (b4)：
(b3) single strand dna shown in the sequence 6 of sequence table；
(b4) have by the substitution of one or several nucleotides of the process of sequence 6 and/or missing and/or addition and with sequence 6 identical
The DNA molecular of function；
The primer BRV-FIP is following (b5) or (b6)：
(b5) single strand dna shown in the sequence 7 of sequence table；
(b6) have by the substitution of one or several nucleotides of the process of sequence 7 and/or missing and/or addition and with sequence 7 identical
The DNA molecular of function；
The primer BRV-BIP is following (b7) or (b8)：
(b7) single strand dna shown in the sequence 8 of sequence table；
(b8) have by the substitution of one or several nucleotides of the process of sequence 8 and/or missing and/or addition and with sequence 8 identical
The DNA molecular of function.
2. primer combination as claimed in claim 1, it is characterised in that：5 ' the ends of the primer BVDV-FIP are connected with fluorescent base
Group A；5 ' the ends of the primer BRV-FIP are connected with fluorophor B.
3. primer combination as claimed in claim 2, it is characterised in that：The fluorophor A is FITC, the fluorophor B
For CY5.5.
4. the application of any described primer combinations of claim 1-3, is any of following (c1) to (c6)：
(c1) bovine viral diarrhea virus and bovine rota are differentiated；
(c2) kit for differentiating bovine viral diarrhea virus and bovine rota is prepared；
(b3) detect whether pathogenic microorganism to be measured is bovine viral diarrhea virus or bovine rota；
(c4) prepare for detect pathogenic microorganism to be measured whether be bovine viral diarrhea virus or bovine rota kit；
(c5) whether bovine viral diarrhea virus and/or bovine rota are contained in detection sample to be tested；
(c6) prepare for detect in sample to be tested whether the kit containing bovine viral diarrhea virus and/or bovine rota.
5. the kit containing any described primer combinations of claim 1-3；The purposes of the kit be following (d1)-
At least one of (d3)：
(d1) bovine viral diarrhea virus and bovine rota are differentiated；
(d2) detect whether pathogenic microorganism to be measured is bovine viral diarrhea virus or bovine rota；
(d3) whether bovine viral diarrhea virus and/or bovine rota are contained in detection sample to be tested.
6. the preparation method of kit described in claim 5, including the step of each bar primer is individually packed.
7. a kind of method for differentiating bovine viral diarrhea virus and bovine rota, comprises the following steps：Extract viral core to be measured
Acid；Using the nucleic acid as template, bifluorescence RT-LAMP is carried out using primer combination, then made the following judgment：If
It is able to detect that the amplified production with the corresponding fluorescence of fluorophor A, virus to be measured are bovine viral diarrhea virus, if enough inspections
It is bovine rota to measure the amplified production with the corresponding fluorescence of fluorophor B, virus to be measured.
8. it is a kind of detect virus whether be bovine viral diarrhea virus or bovine rota method, comprise the following steps：Extraction is treated
Survey the nucleic acid of pathogenic microorganism；Using the nucleic acid as template, bifluorescence RT-LAMP is carried out using primer combination, then
Make the following judgment：If being able to detect that the amplified production with the corresponding fluorescence of fluorophor A, pathogenic microorganism to be measured are
Bovine viral diarrhea virus, be if enough detecting the amplified production with the corresponding fluorescence of fluorophor B, pathogenic microorganism to be measured
Bovine rota, if the amplified production with the corresponding fluorescence of fluorophor A can not be detected and can not be detected with glimmering
The amplified production of the corresponding fluorescence of light group B, pathogenic microorganism to be measured is non-bovine viral diarrhea virus and non-bovine rota.
9. in a kind of detection sample to be tested whether the method containing bovine viral diarrhea virus and/or bovine rota, it is including as follows
Step：Extract the nucleic acid of sample to be tested；Using the nucleic acid as template, bifluorescence RT-LAMP is carried out using primer combination,
Then make the following judgment：If being able to detect that the amplified production with the corresponding fluorescence of fluorophor A, containing in sample to be tested
There is bovine viral diarrhea virus, if it is possible to detect the amplified production with the corresponding fluorescence of fluorophor B, contain in sample to be tested
There is bovine rota, if it is possible to detect the amplified production with the corresponding fluorescence of fluorophor A and if be able to detect that
It is containing bovine viral diarrhea virus and sick containing bull wheel shape in amplified production, sample to be tested with the corresponding fluorescence of fluorophor B
Poison, if the amplified production with the corresponding fluorescence of fluorophor A can not be detected and can not be detected with B pairs of fluorophor
Bovine viral diarrhea virus is not contained in the amplified production of the fluorescence answered, sample to be tested and does not contain bovine rota.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710264432.7A CN106987657B (en) | 2017-04-21 | 2017-04-21 | Primer combination for identifying bovine virus diarrhea virus and bovine rotavirus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710264432.7A CN106987657B (en) | 2017-04-21 | 2017-04-21 | Primer combination for identifying bovine virus diarrhea virus and bovine rotavirus and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106987657A true CN106987657A (en) | 2017-07-28 |
| CN106987657B CN106987657B (en) | 2020-06-09 |
Family
ID=59416913
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710264432.7A Active CN106987657B (en) | 2017-04-21 | 2017-04-21 | Primer combination for identifying bovine virus diarrhea virus and bovine rotavirus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106987657B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107447056A (en) * | 2017-09-29 | 2017-12-08 | 广西壮族自治区兽医研究所 | For differentiating primer set and its application of Mycoplasma bovis and infectious bovine rhinotracheitis |
| CN107699639A (en) * | 2017-11-23 | 2018-02-16 | 广西壮族自治区兽医研究所 | A kind of primer and method for differentiating bovine rota and producing intestines poison Escherichia coli |
| CN112760421A (en) * | 2021-02-10 | 2021-05-07 | 北京三元集团畜牧兽医总站 | Triple fluorescent quantitative PCR kit for simultaneously detecting bovine rotavirus, coronavirus and viral diarrhea virus and application method thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105671201A (en) * | 2016-03-03 | 2016-06-15 | 广西壮族自治区兽医研究所 | Primer combination for identifying foot-and-mouth disease virus and vesicular stomatitis virus and application thereof |
| US20160215354A1 (en) * | 2013-10-01 | 2016-07-28 | Texcell | Detection of Rare Microbiological Nucleic Acids |
| CN106191310A (en) * | 2016-07-19 | 2016-12-07 | 广西壮族自治区兽医研究所 | A kind of primer combination simultaneously differentiating 3 kinds of calf diarrhea pathogen and GeXP detection method |
-
2017
- 2017-04-21 CN CN201710264432.7A patent/CN106987657B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160215354A1 (en) * | 2013-10-01 | 2016-07-28 | Texcell | Detection of Rare Microbiological Nucleic Acids |
| CN105671201A (en) * | 2016-03-03 | 2016-06-15 | 广西壮族自治区兽医研究所 | Primer combination for identifying foot-and-mouth disease virus and vesicular stomatitis virus and application thereof |
| CN106191310A (en) * | 2016-07-19 | 2016-12-07 | 广西壮族自治区兽医研究所 | A kind of primer combination simultaneously differentiating 3 kinds of calf diarrhea pathogen and GeXP detection method |
Non-Patent Citations (3)
| Title |
|---|
| HIROKA AONUMA ET AL.: ""A single fluorescence-based LAMP reaction for identifying multiple parasites in mosquitoes"", 《EXPERIMENTAL PARASITOLOGY》 * |
| 商云鹏: ""牛病毒性腹泻病毒RT-LAMP检测方法的建立及初步应用"", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
| 范晴等: ""牛轮状病毒RT-LAMP快速检测方法的建立"", 《畜牧与兽医》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107447056A (en) * | 2017-09-29 | 2017-12-08 | 广西壮族自治区兽医研究所 | For differentiating primer set and its application of Mycoplasma bovis and infectious bovine rhinotracheitis |
| CN107447056B (en) * | 2017-09-29 | 2020-10-20 | 广西壮族自治区兽医研究所 | Complete set of primers for identifying mycoplasma bovis and infectious rhinotracheitis and application thereof |
| CN107699639A (en) * | 2017-11-23 | 2018-02-16 | 广西壮族自治区兽医研究所 | A kind of primer and method for differentiating bovine rota and producing intestines poison Escherichia coli |
| CN107699639B (en) * | 2017-11-23 | 2019-12-20 | 广西壮族自治区兽医研究所 | Primer and method for identifying bovine rotavirus and enterotoxigenic escherichia coli |
| CN112760421A (en) * | 2021-02-10 | 2021-05-07 | 北京三元集团畜牧兽医总站 | Triple fluorescent quantitative PCR kit for simultaneously detecting bovine rotavirus, coronavirus and viral diarrhea virus and application method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106987657B (en) | 2020-06-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106893787A (en) | Differentiate bifluorescence RT LAMP detection primers group, kit and its application of foot and mouth disease virus and vesicular stomatitis virus | |
| CN105671201B (en) | For identifying that the primer of foot and mouth disease virus and vesicular stomatitis virus is combined and its applied | |
| CN113502352B (en) | EMA-ddPCR primer and probe for detecting infectious ASFV and application | |
| CN107475459A (en) | Differentiate the detection method of american type PRRSV classical strainses, variation strain and new virus class NADC30 strains simultaneously | |
| CN106916906A (en) | A kind of Primer composition and its kit for detecting infectious diarrhea pathogen | |
| CN106987657A (en) | For differentiating that the primer of bovine viral diarrhea virus and bovine rota is combined and its applied | |
| CN113005226A (en) | Oligonucleotide and kit for detecting SARS-CoV-2 | |
| CN109593889A (en) | Pig Delta coronavirus detection method based on real-time fluorescent reverse transcription recombinase-mediated chain replacement nucleic acid amplification technologies | |
| CN111118211A (en) | Bovine sarcoidosis detection kit and method based on loop-mediated isothermal amplification technology | |
| CN104774969A (en) | Multi-PCR detection kit and method for identifying poultry salmonella | |
| CN113943831A (en) | Multiple fluorescent quantitative primer and probe combination capable of diagnosing three high-incidence pathogens of porcine diarrhea disease simultaneously and application thereof | |
| JP4903722B2 (en) | Method for detecting live cells in a sample by using a virus | |
| CN110157837A (en) | A kind of primer and method detecting PPR virus and blue tongue virus | |
| CN111926109B (en) | African swine fever virus fluorescence thermal convection PCR amplification primer pair, probe primer and prepared kit | |
| CN116622909A (en) | Isothermal amplification detection reagent and detection method for feline herpesvirus I type | |
| CN105969913A (en) | Primer combination and GeXP detection method for simultaneously identifying 5 bovine viral dermatitis viruses | |
| CN106191310A (en) | A kind of primer combination simultaneously differentiating 3 kinds of calf diarrhea pathogen and GeXP detection method | |
| CN114350854B (en) | Method for detecting SARS-CoV-269-70del locus based on RAA-CRISPR | |
| CN108676921A (en) | A kind of LAMP primer group and detection method and its application for aviadenovirus detection | |
| CN107447056A (en) | For differentiating primer set and its application of Mycoplasma bovis and infectious bovine rhinotracheitis | |
| CN110592269A (en) | RAA constant-temperature fluorescence detection method and reagent for grass carp hemorrhagic disease type 2 virus (GCRV-2) | |
| CN106544447A (en) | A kind of Multiple immunizations fluorescence analysiss primer, test kit and method for detecting chicken Marek's disease virus and chicken infectious anemia virus | |
| CN106929608A (en) | A kind of fluorescence PCR method and kit of specific detection rubella virus nucleic acid | |
| WO2016078215A1 (en) | Primers, probes and kit for detecting and typing five ebola virus subtypes by one-step method reverse transcription pcr | |
| CN113234866A (en) | Detection kit for synchronously detecting multiple blood circulation system pathogens and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |