CN106929608A - A kind of fluorescence PCR method and kit of specific detection rubella virus nucleic acid - Google Patents
A kind of fluorescence PCR method and kit of specific detection rubella virus nucleic acid Download PDFInfo
- Publication number
- CN106929608A CN106929608A CN201710308452.XA CN201710308452A CN106929608A CN 106929608 A CN106929608 A CN 106929608A CN 201710308452 A CN201710308452 A CN 201710308452A CN 106929608 A CN106929608 A CN 106929608A
- Authority
- CN
- China
- Prior art keywords
- rubella virus
- nucleic acid
- kit
- specific detection
- virus nucleic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of fluorescence PCR method and kit of specific detection rubella virus nucleic acid, the specific primer pair and fluorescence probe that the kit is included are as follows：Forward primer：5’‑TGCAACGTCACCACTGAACA‑3’；Reverse primer：5’‑GGACCTGGACCTCGAGTTGTC‑3’；Fluorescence probe：5’‑CCGTTCTGCAACACGCCGCA‑3’.The characteristics of kit of the present invention has sensitivity high, high specificity, efficiency high, it is possible to achieve to the qualitative detection of rubella virus, can turn into effective auxiliary detection instrument.
Description
Technical field
The invention belongs to microorganism beyond body nucleic acid detection field, and in particular to a kind of specific detection rubella virus nucleic acid
Fluorescence PCR method and kit, can carry out qualitative detection to rubella virus nucleic acid, can be as effective detection instrument.
Background technology
Rubella virus (Rubella virus, RV), is the unique member of Togaviridae rubella virus genus, people be its only
One natural reservoir (of bird flu viruses).Infection rubella to the harm of human body and less, but RV it is maximum to public health threat be that it has teratogenesis
Property.Congenital infringement can be produced after infection of pregnant women RV to baby, virus can invade fetus by vertical transmission, cause miscarriage, dead
Produce or fetal infection, it is as congenital so as to cause serious inborn defect, including cataract, deafness, heart disease or feeblemindedness
Property rubella syndrome (Congenital rubella syndromes, CRS).Although rubella virus can be by vaccine inoculation
Prevention, but once infect, clinically temporarily without specific treatment, therefore infection, laboratory diagnosis clinically to rubella virus
And its epidemiological features are extremely paid attention to.
Rubella virus is sub-thread, positive chain RNA virus, total length about 9.7kbp.The geneome RNA of RV includes two openings long
Single open reading frame (ORF), one be 5 '-near-end ORF, encode two kinds of non-structural proteins P150 and P90, participate in virus duplication；
Another is the ORF of 3 '-near-end, coding structure albumen.3 kinds of structural proteins of its coding are capsid protein C and 2 kinds of coating sugar eggs
White E1, E2, its molecular weight is respectively 33,58,42~47KD, they are the major protein antigen of RV.Epitope is primarily present
In on E1 memebrane proteins.
At present, clinical labororatory's detection uses serological test, such as ELISA, RIA and IFA, and detection specificity is anti-
Body.Serum rubella virus-IgM the positives prove recent infection, and oneself continues 2~4 months.Serum rubella virus-IgG the positives are then pointed out
Previous infection.Because rubella virus antigen source is difficult, the still difficult popularization of serological test, and also it is anti-after some population infections virus
Precursor reactant is very weak or does not produce antibody, therefore only can not accurately judge rubella virus infection situation with antibody test result, needs auxiliary
Using antigen or detection of nucleic acids result as diagnosis and the foundation for the treatment of.The nucleic acid detection method of current comparative maturity is to use fluorescence
PCR method, the method overcome Standard PCR method poor specificity, easily pollution, the shortcomings of interpretation of result operating procedure is more, use
TaqMan methods or double mark sonde methods (fluorescent quenching probe or FQ probes), i.e., hold mark one respectively at its 5 ' end and 3 '
Fluorescent reporter group and a quenching group.The specific probe of target sequence and specific PCR primer are used simultaneously, design
The probe is annealed in the range of upstream and downstream PCR primer, and genes of interest fragment is incorporated into jointly by three oligonucleotides, makes it special
The opposite sex is greatly enhanced.In the extension stage of PCR, the exonuclease activity of Taq archaeal dna polymerases 5 ' -3 ' is by fluorescent reporter group
Cut down from probe.With the increase of PCR cycle number, the quantity of free reporter group constantly increases, real-time detection from
The fluorescence signal discharged on free fluorophor, so as to carry out qualitative analysis to target sequence.PCR reactions are entered in closed system
OK, analysis result is without Kaifeng, therefore, it is to avoid the generation of PCR primer pollution.
At present, also there is fluorescence PCR method for detecting the report of rubella virus, but develop more effective, quick, accurate
Really, sensitivity is high, primer and probe of high specificity fluorescence PCR method, and this primer and probe are used for into detection reagent
Box is also the target that this area is pursued.
The content of the invention
The technical problems to be solved by the invention are to overcome the deficiencies in the prior art, there is provided a kind of specific detection rubella
The fluorescent PCR kit of malicious nucleic acid, the kit has sensitive, special and efficient feature, so that in realizing detection sample
The nucleic acid of rubella virus, realizes qualitative detection.
To solve above technical problem, the present invention is adopted the following technical scheme that：
A kind of fluorescent PCR kit of specific detection rubella virus nucleic acid, including specific primer pair and fluorescence probe,
The specific primer pair and fluorescence probe are as follows：
Forward primer：5’-TGCAACGTCACCACTGAACA-3’
Reverse primer：5’-GGACCTGGACCTCGAGTTGTC-3’
Fluorescence probe：5’-CCGTTCTGCAACACGCCGCA-3’.
The two ends of described fluorescence probe mark reporter fluorescence element or fluorescent dye, quenching group respectively.The report of mark
Fluorescein or fluorescent dye are FAM or other any fluoresceins or fluorescent dye that can be marked as probe, such as HEX,
TET、JOE、Yakima Yellow、Cy3、Cy3.5、Cy5、NED、VIC、PET、ROX、LIZ、RED、Texas Red；Base is quenched
Group for TAMRA or other it is any can be as the chemical substance of quenching group, such as Dabcyl, BHQ1, BHQ2.
Further, the kit also includes PCR reaction solutions, positive quality control product and negative quality-control product.
Further, the PCR reaction solutions composition such as including Taq enzyme, dNTP, buffer solution.
Further, described positive quality control product contains artificial synthesized sequence, and described artificial synthesized sequence is artificial conjunction
Into containing the rubella virus specific primer to the sequence of amplified production fragment.The content of the artificial synthesized sequence is：
TTGCGCGCGCATCTGGAATGGCACACAGCGCGCGTGCACCTTCTGGGCTGTCAACGCCTA
CTCCTCTGGCGGGTACGCGCAGCTGGCCTCTTACTTCAACCCTGGCGGCAGCTACTACAA
GCAGTACCACCCTACCGCGTGCGAGGTTGAACCTGCCTTCGGACACAGCGACGCGGCCTG
CTGGGGCTTCCCCACCGACACCGTGATGAGCGTGTTCGCCCTTGCTAGCTACGTCCAGCA
CCCTCACAAGACCGTCCGGGTCAAGTTCCATACAGAGACCAGGACCGTCTGGCAACTCTC
CGTTGCCGGCGTGTCGTGCAACGTCACCACTGAACACCCGTTCTGCAACACGCCGCACGG
ACAACTCGAGGTCCAGGTCCCGCCCGACCCCGGGGACCTGGTTGAGTACATTATGAATTA
CACCGGCAATCAGCAGTCCCGGTGGGGCCTCGGGAGCCCGAATTGCCACGGCCCCGATTG
GGCCTCCCCGGTTTGCCAACGCCATTCCCCTGACTGCTCGCGGCTTGTGGGGGCCACGCC
AGAGCGCCCCCGGCTGCGCCTGGTCGACGCCGACGACCCCCTGCTGCGCACTGCCCCTGG
ACCCGGCGAGGTGTGGGTCACGCCTGTCATAGGCTCTCAGGCGCGCAAGTGCGGACTCCA
CATACGCGCTGGACCGTACGGCCATGCTACCGTCGAAATGCCCGAGTGGATCCACGCCCA
CACCACCAGCGACCCCTGGCATCCACCGGGCCCCTTGGGGCTGAAGTTCAAGACAGTTCG
CCCGGTGGCCC。
Preferably, described positive quality control product is to insert described artificial synthesized containing described by pUC57 plasmid vectors
Sequence restructuring of the specific primer to amplified production fragment is obtained.
Specifically, the restructuring pUC57 vector plasmids concentration contained by the positive quality control product is 1ng/ μ L.
Further, sequence of the described negative quality-control product containing artificial synthesized mankind's house-keeping gene GAPDH Partial Fragments
Row.
Further, described negative quality-control product is to insert described artificial synthesized by pTG19-T plasmid vectors
The sequence restructuring of mankind's house-keeping gene GAPDH Partial Fragments is obtained.
Specifically, the restructuring pTG19-T vector plasmids concentration contained by described negative quality-control product is 1ng/ μ L.
Further, for expand described artificial synthesized mankind's house-keeping gene GAPDH Partial Fragments primer pair such as
Under：
Forward primer：5’-CAAAGGCCAGGCTGTAAATG-3’
Reverse primer：5’-AGAGACAAGAGGCAAGAAGG-3’.
Further, the sequence of described artificial synthesized mankind's house-keeping gene GAPDH Partial Fragments is：
CAAAGGCCAGGCTGTAAATGTCACCGGGAGGATTGGGTGTCTGGGCGCCT
CGGGGAACCTGCCCTTCTCCCCATTCCGTCTTCCGGAAACCAGATCTCCC
ACCGCACCCTGGTCTGAGGTTAAATATAGCTGCTGACCTTTCTGTAGCTG
GGGGCCTGGGCTGGGGCTCTCTCCCATCCCTTCTCCCCACACACATGCAC
TTACCTGTGCTCCCACTCCTGATTTCTGGAAAAGAGCTAGGAAGGACAGG
CAACTTGGCAAATCAAAGCCCTGGGACTAGGGGGTTAAAATACAGCTTCC
CCTCTTCCCACCCGCCCCAGTCTCTGTCCCTTTTGTAGGAGGGACTTAGA
GAAGGGGTGGGCTTGCCCTGTCCAGTTAATTTCTGACCTTTACTCCTGCC
CTTTGAGTTTGATGATGCTGAGTGTACAAGCGTTTTCTCCCTAAAGGGTG
CAGCTGAGCTAGGCAGCAGCAAGCATTCCTGGGGTGGCATAGTGGGGTGG
TGAATACCATGTACAAAGCTTGTGCCCAGACTGTGGGTGGCAGTGCCCCA
CATGGCCGCTTCTCCTGGAAGGGCTTCGTATGACTGGGGGTGTTGGGCAG
CCCTGGAGCCTTCAGTTGCAGCCATGCCTTAAGCCAGGCCAGCCTGGCAG
GGAAGCTCAAGGGAGATAAAATTCAACCTCTTGGGCCCTCCTGGGGGTAA
GGAGATGCTGCATTCGCCCTCTTAATGGGGAGGTGGCCTAGGGCTGCTCA
CATATTCTGGAGGAGCCTCCCCTCCTCATGCCTTCTTGCCTCTTGTCTCT。
According to the present invention, the reaction system of the kit is 20 μ L-50 μ L, when the reaction system of the kit is 20
μ L systems, the kit includes：The μ L of PCR reaction solutions (2x) 10, the μ L of forward primer 0.5 (10 μM of ol/mL), the μ of reverse primer 0.5
L (10 μM of ol/mL), the μ L of fluorescence probe 0.5 (10 μM of ol/mL), detected material cell, tissue, body fluid (secretion, sputum, urine
Etc.) the μ L of DNA extracts 4, sterilizing ultra-pure water add to 20 μ L；It is described when the reaction system of the kit is 50 μ L systems
Kit includes：The μ L of PCR reaction solutions (2x) 25, the μ L of forward primer 1.25 (10 μM of ol/mL), the μ L of reverse primer 1.25 (10 μM of ol/
ML), the μ L of fluorescence probe 1.25 (10 μM of ol/mL), detected material cell, tissue, body fluid (secretion, sputum, urine etc.)
DNA extract 4-10 μ L, sterilizing ultra-pure water adds to 50 μ L.
According to the present invention, the reaction time of the fluorescent PCR amplification of described kit and temperature are：50 DEG C, 2min 1
Circulation (is omitted) if PCR reaction solutions are free of UNG enzymes；95 DEG C, 2-10min (depending on the PCR reaction solutions of separate sources) 1
Individual circulation；95 DEG C, 15s, 60 DEG C, 1min, 40 circulate and collect fluorescence signal.
Another technical scheme that the present invention takes is：A kind of fluorescence PCR method of specific detection rubella virus nucleic acid, adopts
Detected with above-mentioned kit.
Due to the implementation of above-mentioned technical proposal, the present invention has the following advantages that compared with prior art：
Kit of the present invention detects by a large amount of clinical samples, can effective detection go out rubella virus, great Liang Lin
The detection of bed sample validity, large-scale use also to kit is there is provided guarantee.
Kit of the present invention, the reaction efficiency of rubella virus fluorescent PCR detection is up to 88.9%, is imitated with reaction higher
Rate.
Brief description of the drawings
Fig. 1 is the quality inspection electrophoretogram of rubella virus fluorescence PCR primer pair；
In figure, 1：Rubella virus Fluorescence PCR forward primer；2：Rubella virus Fluorescence PCR reverse primer；M：Electricity
Swimming Marker, length is followed successively by 20,24,36 (units from top to bottom：Base).
Fig. 2 schemes for the quality inspection HPLC of rubella virus fluorescent PCR probe.
Fig. 3 is that pUC57 recombinant plasmids constitute schematic diagram.
Fig. 4 is that pTG19-T plasmid vectors constitute schematic diagram.
Fig. 5 is the amplified reaction figure of positive quality control product fluorescent PCR；
Curve in figure from left to right corresponds to the concentration of positive quality control product from high to low respectively.
Fig. 6 is the corresponding canonical plotting of amplified reaction in Fig. 5.
Specific embodiment
Fluorescence PCR specific primer pair and fluorescence probe, artificial conjunction of the kit of the invention using autonomous Design
Into positive quality control product, artificial synthesized negative quality-control product, with sensitivity is high, high specificity, reaction efficiency high the characteristics of, can
To realize the qualitative detection to rubella virus, effective auxiliary detection instrument can be turned into.
With reference to specific embodiment, the present invention will be further described in detail, should illustrate that some embodiment is only used
In illustrating, of the invention rather than limitation is of the invention.
Embodiment 1：The preparation of the PCR kit of specific detection rubella virus nucleic acid
1st, the design and synthesis of specific primer pair and fluorescence probe
Using the softwares of Primer Express 3.0, with the sequences Design specific primer pair of rubella virus E 1 gene and its
Specific fluorescence probe, primer and probe synthesize by Shanghai JaRa biology Co., Ltd, are carried out on the probe of synthesis
Double fluorescence and quenching group are marked.Wherein, primer is PAGE purifying, and probe is that HPLC is purified.
The specific primer pair and probe designed are as follows：
Forward primer：5’-TGCAACGTCACCACTGAACA-3’(SEQ ID NO.1)
Reverse primer：5’-GGACCTGGACCTCGAGTTGTC-3’(SEQ ID NO.2)
Fluorescence probe：5’-CCGTTCTGCAACACGCCGCA-3’(SEQ ID NO.3).
Lyophilized powder is prepared into after primer and probe synthesis, 100 μM of concentration is then diluted to 1 × TE buffer
As mother liquor, -20 DEG C of preservations.Working solution is that mother liquor is obtained for 10 times by sterilized water dilution, is used for conventional.
Quality inspection analysis is carried out to specific primer pair and fluorescence probe, as a result as depicted in figs. 1 and 2.
2nd, the preparation of positive quality control product and negative quality-control product
The preparation of positive quality control product：Containing specific primer of the invention to the specific sequence fragment of amplified production by Nanjing
The synthesis of Jin Sirui biologies Co., Ltd, is then manually fitted into pUC57 plasmid vectors, then lead to recombinant dna gene engineering method
Cross the steps such as conversion Escherichia coli, plasmid amplification and plasmid extraction and obtain recombinant plasmid dna, this DNA is exactly examination of the present invention
Positive quality control product used in agent box, the specific sequence contained by the positive quality control product is as shown in SEQ ID NO.4.pUC57
It is as shown in Figure 3 that recombinant plasmid constitutes schematic diagram.
The preparation of negative quality-control product：It is, with mankind's house-keeping gene GAPDH genes as template, Standard PCR primer to be designed, from people
Enter performing PCR amplification in the genomic DNA of class loading cell extraction, amplified production is obtained, then with the side of recombinant dna gene engineering
Method by amplified production manual assembly to pTG19-T plasmid vectors, then by converting Escherichia coli, plasmid amplification and plasmid extraction
Recombinant plasmid dna is obtained etc. step, this DNA is exactly the negative quality-control product used in kit of the present invention, the negative matter
Specific sequence contained by control product is as shown in SEQ ID NO.7.It is as shown in Figure 4 that pTG19-T plasmid vectors constitute schematic diagram.
Wherein, the Standard PCR primer of the design during prepared by negative quality-control product is as follows：
Forward primer：5’-CAAAGGCCAGGCTGTAAATG-3’(SEQ ID NO.5)；
Reverse primer：5’-AGAGACAAGAGGCAAGAAGG-3’(SEQ ID NO.6).
3rd, PCR reaction solutions
The PCR reaction solutions composition such as including Taq enzyme, dNTP, buffer solution, it is possible to use purchased from the Fluorescence PCR of ABI companies
Mixed liquor, title isUniversal Master Mix II,with UNG。
Embodiment 2：The extraction of sample total serum IgE and reverse transcription
1st, the extraction of sample total serum IgE
Use QIAGEN companiesMini Kit (article No. 74104) RNA extracts kits, specific steps
With reference to specification.
2nd, reverse transcription reaction
The RNA of the sample that will have been extracted carries out reverse transcription reaction.Reverse transcription agents useful for same is purchased from invitrogen companies
M-MLV reverse transcriptase (article No. 28025-021).The μ L of reaction system 20.Concretely comprise the following steps：
1) 65 DEG C, 5min, ice compress, of short duration centrifugation.
2) 4 μ l 5X First-Strand Buffer, 2 μ l 0.1M DTT, 1 μ l RNaseOUT are addedTM。
3) it is slight to mix, 37 DEG C of incubation 2min.
4) 1 μ L M-MLV reverse transcriptases are added, uniform, 25 DEG C, 10min is gently blown and beaten with liquid-transfering gun.
5) 37 DEG C, 50min.
6) 70 DEG C, 15min.
7) after reaction terminates, product is put into -20 DEG C of preservations.
Embodiment 3：The making of standard curve
Positive quality control product is chosen as reference material, diluted concentration is then proceeded to 10 times of gradient dilutions five to 1 μ g/mL
Concentration, comes to 6 concentration gradients, i.e. 1 μ g/mL, 10-1μg/mL、10-2μg/mL、10-3μg/mL、10-4μg/mL、10-5μg/
mL.Then fluorescent PCR amplified reaction is carried out, with the Software Create standard curve supporting with ABI7500 instruments.Result such as Fig. 5 and
Shown in Fig. 6, and the system of instrument shows, reaction efficiency is up to 88.9%.
Embodiment 4：Rubella virus fluorescent PCR amplified reaction and interpretation of result
1st, the reaction system that fluorescent PCR amplified reaction is used as shown in table 1, is configured in special eight union of fluorescent PCR
After each system, be put into ABI7500 fluorescent PCR instruments (or other types of open quantitative fluorescent PCR instrument), prepare into
Row reaction.Experiment every time is required for configuring 1 reaction tube of positive quality control product as the negative quality-control product of positive control and
Reaction tube is used as negative control.
Table 1
| Syllabus and content | Volume (μ L) |
| PCR reaction solutions | 10 |
| Forward primer | 0.5 |
| Reverse primer | 0.5 |
| Fluorescence probe | 0.5 |
| Sterilized water | 4.5 |
| Sample to be tested | 4 |
| Amount to | 20 |
Sample to be tested in table 1 is the sample to be tested prepared by way of embodiment 2.
2nd, shown in the reaction condition table 2 that fluorescent PCR amplified reaction is used.
Table 2
3rd, interpretation of result
1) after reaction terminates, first, the selection of baseline is set to " automatic ".Threshold value (threshold) setting principle be
Threshold line is just above the peak of the amplification curve of negative quality-control product, makes its Ct value=40 or " Undetermined ".
2) after setting good threshold, whether the amplification curve for observing positive quality control product is normal S types Increasing Curve of Logarithm, and
Ct value≤37.Meet above-mentioned condition and then illustrate that this experiment reaction is normal, otherwise, it is necessary to reform.
3) result judgement.Ct value≤37, represent that the sample results are the positive, Ct values>37 or " Undetermined ", represent
The sample results are feminine gender.
Application Example
124 tissue samples being collected into are detected using kit of the present invention.124 samples are collected for clinical
Fetal tissue, be divided to two groups：Normal induced labor group (control group) 41, spontaneous abortion group (ill group) 83.According to above-mentioned reality
Apply example 2：The extraction of sample total serum IgE and the program of reverse transcription are operated, extract respectively all samples RNA and reverse transcription into
cDNA.Then according to above-described embodiment 4：Rubella virus fluorescent PCR amplified reaction and interpretation of result, are existed using kit of the present invention
ABI7500 fluorescent PCRs instrument carries out fluorescent PCR detection, as a result as shown in table 3 below.
Table 3
Can be drawn from the result in table, kit of the present invention can successfully detect rubella virus, and from normal group
From the point of view of the positive rate result of ill group, kit of the present invention can well distinguish Normal group and ill group, Liang Zheyang
Property rate ratio be 1 to 8.89, that is the infection rate of ill group rubella virus be Normal group close to 9 times, as a result
Display kit of the present invention has good sensitivity and specificity, can be used as the effective tool of detection rubella virus.Largely
The detection of clinical sample is to validity, the large-scale use of kit there is provided guarantee.
Kit of the present invention, the reaction efficiency of rubella virus is up to 88.9%, with reaction efficiency higher.
The present invention is described in detail above, its object is to allow the personage for being familiar with this art to will appreciate that this
The content of invention is simultaneously carried out, and it is not intended to limit the scope of the present invention, and the invention is not restricted to above-mentioned implementation
Example, the equivalent change or modification that all Spirit Essences of the invention are made should all be included within the scope of the present invention.
Sequence table
<110>Zhangjiagang indigo plant is revived thing Engineering Co., Ltd
<120>A kind of fluorescence PCR method and kit of specific detection rubella virus nucleic acid
<130>
<160> 7
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223>Detect the forward primer of rubella virus
<400> 1
tgcaacgtca ccactgaaca 20
<210> 2
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223>Detect the reverse primer of rubella virus
<400> 2
ggacctggac ctcgagttgt c 21
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223>Detect the fluorescence probe of rubella virus
<400> 3
ccgttctgca acacgccgca 20
<210> 4
<211> 791
<212> DNA
<213>Artificial sequence
<220>
<223>Specific sequence contained by kit positive quality control product
<400> 4
ttgcgcgcgc atctggaatg gcacacagcg cgcgtgcacc ttctgggctg tcaacgccta 60
ctcctctggc gggtacgcgc agctggcctc ttacttcaac cctggcggca gctactacaa 120
gcagtaccac cctaccgcgt gcgaggttga acctgccttc ggacacagcg acgcggcctg 180
ctggggcttc cccaccgaca ccgtgatgag cgtgttcgcc cttgctagct acgtccagca 240
ccctcacaag accgtccggg tcaagttcca tacagagacc aggaccgtct ggcaactctc 300
cgttgccggc gtgtcgtgca acgtcaccac tgaacacccg ttctgcaaca cgccgcacgg 360
acaactcgag gtccaggtcc cgcccgaccc cggggacctg gttgagtaca ttatgaatta 420
caccggcaat cagcagtccc ggtggggcct cgggagcccg aattgccacg gccccgattg 480
ggcctccccg gtttgccaac gccattcccc tgactgctcg cggcttgtgg gggccacgcc 540
agagcgcccc cggctgcgcc tggtcgacgc cgacgacccc ctgctgcgca ctgcccctgg 600
acccggcgag gtgtgggtca cgcctgtcat aggctctcag gcgcgcaagt gcggactcca 660
catacgcgct ggaccgtacg gccatgctac cgtcgaaatg cccgagtgga tccacgccca 720
caccaccagc gacccctggc atccaccggg ccccttgggg ctgaagttca agacagttcg 780
cccggtggcc c 791
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223>The forward primer of the amplification artificial synthesized fragment of negative quality-control product
<400> 5
caaaggccag gctgtaaatg 20
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223>The reverse primer of the amplification artificial synthesized fragment of negative quality-control product
<400> 6
agagacaaga ggcaagaagg 20
<210> 7
<211> 800
<212> DNA
<213>Artificial sequence
<220>
<223>Specific sequence contained by kit feminine gender quality-control product
<400> 7
caaaggccag gctgtaaatg tcaccgggag gattgggtgt ctgggcgcct cggggaacct 60
gcccttctcc ccattccgtc ttccggaaac cagatctccc accgcaccct ggtctgaggt 120
taaatatagc tgctgacctt tctgtagctg ggggcctggg ctggggctct ctcccatccc 180
ttctccccac acacatgcac ttacctgtgc tcccactcct gatttctgga aaagagctag 240
gaaggacagg caacttggca aatcaaagcc ctgggactag ggggttaaaa tacagcttcc 300
cctcttccca cccgccccag tctctgtccc ttttgtagga gggacttaga gaaggggtgg 360
gcttgccctg tccagttaat ttctgacctt tactcctgcc ctttgagttt gatgatgctg 420
agtgtacaag cgttttctcc ctaaagggtg cagctgagct aggcagcagc aagcattcct 480
ggggtggcat agtggggtgg tgaataccat gtacaaagct tgtgcccaga ctgtgggtgg 540
cagtgcccca catggccgct tctcctggaa gggcttcgta tgactggggg tgttgggcag 600
ccctggagcc ttcagttgca gccatgcctt aagccaggcc agcctggcag ggaagctcaa 660
gggagataaa attcaacctc ttgggccctc ctgggggtaa ggagatgctg cattcgccct 720
cttaatgggg aggtggccta gggctgctca catattctgg aggagcctcc cctcctcatg 780
ccttcttgcc tcttgtctct 800
Claims (10)
1. a kind of fluorescent PCR kit of specific detection rubella virus nucleic acid, including specific primer pair and fluorescence probe, its
It is characterised by, the specific primer pair and fluorescence probe are as follows：
Forward primer：5’-TGCAACGTCACCACTGAACA-3’
Reverse primer：5’-GGACCTGGACCTCGAGTTGTC-3’
Fluorescence probe：5’-CCGTTCTGCAACACGCCGCA-3’.
2. the fluorescent PCR kit of specific detection rubella virus nucleic acid according to claim 1, it is characterised in that：Institute
The two ends of the fluorescence probe stated mark reporter fluorescence element or fluorescent dye, quenching group respectively.
3. the fluorescent PCR kit of specific detection rubella virus nucleic acid according to claim 2, it is characterised in that：Institute
The reporter fluorescence element or fluorescent dye stated are to include FAM or other any fluoresceins that can be marked as probe or fluorescence dye
Material；Described quenching group be include TAMRA or other it is any can be as the chemical substance of quenching group.
4. the fluorescent PCR kit of specific detection rubella virus nucleic acid according to claim 1, it is characterised in that institute
The kit stated also includes PCR reaction solutions, positive quality control product and negative quality-control product.
5. the fluorescent PCR kit of specific detection rubella virus nucleic acid according to claim 4, it is characterised in that institute
The positive quality control product stated contains artificial synthesized sequence, and described artificial synthesized sequence is artificial synthesized specific containing the rubella virus
The sequence of primer pair amplifies product fragment.
6. the fluorescent PCR kit of specific detection rubella virus nucleic acid according to claim 5, it is characterised in that：Institute
The artificial synthesized sequence contained by positive quality control product stated is：
TTGCGCGCGCATCTGGAATGGCACACAGCGCGCGTGCACCTTCTGGGCTGTCAACGCCTA
CTCCTCTGGCGGGTACGCGCAGCTGGCCTCTTACTTCAACCCTGGCGGCAGCTACTACAA
GCAGTACCACCCTACCGCGTGCGAGGTTGAACCTGCCTTCGGACACAGCGACGCGGCCTG
CTGGGGCTTCCCCACCGACACCGTGATGAGCGTGTTCGCCCTTGCTAGCTACGTCCAGCA
CCCTCACAAGACCGTCCGGGTCAAGTTCCATACAGAGACCAGGACCGTCTGGCAACTCTC
CGTTGCCGGCGTGTCGTGCAACGTCACCACTGAACACCCGTTCTGCAACACGCCGCACGG
ACAACTCGAGGTCCAGGTCCCGCCCGACCCCGGGGACCTGGTTGAGTACATTATGAATTA
CACCGGCAATCAGCAGTCCCGGTGGGGCCTCGGGAGCCCGAATTGCCACGGCCCCGATTG
GGCCTCCCCGGTTTGCCAACGCCATTCCCCTGACTGCTCGCGGCTTGTGGGGGCCACGCC
AGAGCGCCCCCGGCTGCGCCTGGTCGACGCCGACGACCCCCTGCTGCGCACTGCCCCTGG
ACCCGGCGAGGTGTGGGTCACGCCTGTCATAGGCTCTCAGGCGCGCAAGTGCGGACTCCA
CATACGCGCTGGACCGTACGGCCATGCTACCGTCGAAATGCCCGAGTGGATCCACGCCCA
CACCACCAGCGACCCCTGGCATCCACCGGGCCCCTTGGGGCTGAAGTTCAAGACAGTTCG
CCCGGTGGCCC。
7. the fluorescent PCR kit of specific detection rubella virus nucleic acid according to claim 4, it is characterised in that：Institute
The negative quality-control product stated contains the sequence of artificial synthesized mankind's house-keeping gene GAPDH Partial Fragments.
8. the PCR kit of specific detection rubella virus nucleic acid according to claim 7, it is characterised in that：For expanding
The primer pair for increasing described artificial synthesized mankind's house-keeping gene GAPDH Partial Fragments is as follows：
Forward primer：5’-CAAAGGCCAGGCTGTAAATG-3’
Reverse primer：5’-AGAGACAAGAGGCAAGAAGG-3’.
9. the fluorescent PCR kit of specific detection rubella virus nucleic acid according to claim 7, it is characterised in that：Institute
The sequence of the artificial synthesized mankind's house-keeping gene GAPDH Partial Fragments stated is：
CAAAGGCCAGGCTGTAAATGTCACCGGGAGGATTGGGTGTCTGGGCGCCT
CGGGGAACCTGCCCTTCTCCCCATTCCGTCTTCCGGAAACCAGATCTCCC
ACCGCACCCTGGTCTGAGGTTAAATATAGCTGCTGACCTTTCTGTAGCTG
GGGGCCTGGGCTGGGGCTCTCTCCCATCCCTTCTCCCCACACACATGCAC
TTACCTGTGCTCCCACTCCTGATTTCTGGAAAAGAGCTAGGAAGGACAGG
CAACTTGGCAAATCAAAGCCCTGGGACTAGGGGGTTAAAATACAGCTTCC
CCTCTTCCCACCCGCCCCAGTCTCTGTCCCTTTTGTAGGAGGGACTTAGA
GAAGGGGTGGGCTTGCCCTGTCCAGTTAATTTCTGACCTTTACTCCTGCC
CTTTGAGTTTGATGATGCTGAGTGTACAAGCGTTTTCTCCCTAAAGGGTG
CAGCTGAGCTAGGCAGCAGCAAGCATTCCTGGGGTGGCATAGTGGGGTGG
TGAATACCATGTACAAAGCTTGTGCCCAGACTGTGGGTGGCAGTGCCCCA
CATGGCCGCTTCTCCTGGAAGGGCTTCGTATGACTGGGGGTGTTGGGCAG
CCCTGGAGCCTTCAGTTGCAGCCATGCCTTAAGCCAGGCCAGCCTGGCAG
GGAAGCTCAAGGGAGATAAAATTCAACCTCTTGGGCCCTCCTGGGGGTAA
GGAGATGCTGCATTCGCCCTCTTAATGGGGAGGTGGCCTAGGGCTGCTCA
CATATTCTGGAGGAGCCTCCCCTCCTCATGCCTTCTTGCCTCTTGTCTCT。
10. a kind of fluorescence PCR method of specific detection rubella virus nucleic acid, is wanted using any one of claim 1~9 right
Described kit is asked to be detected.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710308452.XA CN106929608A (en) | 2017-05-04 | 2017-05-04 | A kind of fluorescence PCR method and kit of specific detection rubella virus nucleic acid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710308452.XA CN106929608A (en) | 2017-05-04 | 2017-05-04 | A kind of fluorescence PCR method and kit of specific detection rubella virus nucleic acid |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106929608A true CN106929608A (en) | 2017-07-07 |
Family
ID=59430582
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710308452.XA Pending CN106929608A (en) | 2017-05-04 | 2017-05-04 | A kind of fluorescence PCR method and kit of specific detection rubella virus nucleic acid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106929608A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110964855A (en) * | 2019-12-21 | 2020-04-07 | 武汉百泰基因工程有限公司 | Fluorescence quantitative PCR kit for detecting rubella virus |
| CN110982940A (en) * | 2019-12-30 | 2020-04-10 | 广州市疾病预防控制中心 | Composition and kit for detecting nucleic acid of measles virus, rubella virus and mumps virus based on melting curve |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013177524A1 (en) * | 2012-05-25 | 2013-11-28 | Accugenomics, Inc. | Nucleic acid amplification and use thereof |
| CN104120166A (en) * | 2013-04-24 | 2014-10-29 | 王宝恒 | Method and kit for detecting mutation of PDS gene 2168A>G by using fluorescence PCR technology |
| CN105950787A (en) * | 2016-06-06 | 2016-09-21 | 重庆威斯腾生物医药科技有限责任公司 | TORCH detection parallel probes, gene chip, kit and detection method |
| CN106048086A (en) * | 2016-06-06 | 2016-10-26 | 重庆威斯腾生物医药科技有限责任公司 | Parallel-connection probes, gene chip, kit and method for rubella virus detection |
-
2017
- 2017-05-04 CN CN201710308452.XA patent/CN106929608A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013177524A1 (en) * | 2012-05-25 | 2013-11-28 | Accugenomics, Inc. | Nucleic acid amplification and use thereof |
| CN104120166A (en) * | 2013-04-24 | 2014-10-29 | 王宝恒 | Method and kit for detecting mutation of PDS gene 2168A>G by using fluorescence PCR technology |
| CN105950787A (en) * | 2016-06-06 | 2016-09-21 | 重庆威斯腾生物医药科技有限责任公司 | TORCH detection parallel probes, gene chip, kit and detection method |
| CN106048086A (en) * | 2016-06-06 | 2016-10-26 | 重庆威斯腾生物医药科技有限责任公司 | Parallel-connection probes, gene chip, kit and method for rubella virus detection |
Non-Patent Citations (2)
| Title |
|---|
| KIYOKO OKAMOTO等: ""Development of a novel TaqMan real-time PCR assay for detecting rubella virus RNA"", 《JOURNAL OF VIROLOGICAL METHODS》 * |
| 蒲小蓉: ""Real-time PCR 检测风疹病毒方法学的建立及初步应用"", 《中国优秀硕士学位论文全文数据库医药卫生科技辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110964855A (en) * | 2019-12-21 | 2020-04-07 | 武汉百泰基因工程有限公司 | Fluorescence quantitative PCR kit for detecting rubella virus |
| CN110982940A (en) * | 2019-12-30 | 2020-04-10 | 广州市疾病预防控制中心 | Composition and kit for detecting nucleic acid of measles virus, rubella virus and mumps virus based on melting curve |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110551853B (en) | Triple PCR detection primer and kit for rapidly distinguishing African swine fever virus wild strain and gene deletion strain | |
| CN106916907A (en) | The fluorescence PCR method and kit of a kind of specific detection herpes simplex virus I, II type nucleic acid | |
| CN107012237A (en) | A kind of fluorescence PCR method and kit of specific detection gondii nucleic acid | |
| CN108220480B (en) | RPA fluorescent quantitative primer pair, probe and kit for specific detection of HPV18 | |
| CN110229932B (en) | African swine fever virus nucleic acid extraction-free fluorescent isothermal amplification detection kit | |
| CN108504778B (en) | Kit that is a kind of while detecting porcine circovirus 2 type and porcine pseudorabies virus and application | |
| CN110106285A (en) | A kind of dual isothermal nucleic acid amplification method containing internal reference of 3 type adenovirus hominis of quick detection | |
| CN107034309A (en) | The real-time fluorescence RPA kits of quick detection PRV, test strips RPA kits and application thereof | |
| CN103898195A (en) | Helicobacter pylori drug resistance nucleic acid detection kit | |
| CN110055353A (en) | A kind of dual isothermal nucleic acid amplification method containing internal reference of 7 type adenovirus of quick detection | |
| CN113025726A (en) | Primer, probe, kit and method for visual rapid detection of schistosoma japonicum nucleic acid by LFD-RPA | |
| CN103789455B (en) | Group of real-time fluorescent QRT-PCR primers capable of detecting cattle, sheep akabane virus by one-step method, probe and usage method thereof | |
| CN106929608A (en) | A kind of fluorescence PCR method and kit of specific detection rubella virus nucleic acid | |
| CN112501358B (en) | Primer probe combination and kit for detecting 9 children digestive tract pathogens | |
| CN104593524B (en) | Nucleic acid detection kit for rapidly detecting respiratory syncytial virus A and B and application thereof | |
| CN111471800B (en) | Kit for detecting novel coronavirus and amplification primer composition thereof | |
| CN110938708B (en) | Kit for detecting H7N9 avian influenza virus based on isothermal amplification technology and application thereof | |
| CN103409554B (en) | Nucleic acid detection kit for rapidly detecting measles virus/rubella virus | |
| CN112813202A (en) | Fluorescent RT-PCR (reverse transcription-polymerase chain reaction) detection reagent and method for coxsackievirus A16 and enterovirus 71 | |
| CN110643740A (en) | Real-time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection primer, probe and detection kit for Palimam serogroup virus | |
| CN112029910B (en) | Nucleic acid detection method for SARS-CoV-2 virus | |
| CN110438264A (en) | Utilize the method for double real-time fluorescence quantitative RT-PCR detection Porcine epidemic diarrhea virus and Type B pig enterovirus | |
| CN108315476A (en) | A kind of RPA fluorescent quantitations primer pair, probe, kit and method for detecting HPV18 | |
| CN108950072A (en) | A kind of Porcine epidemic diarrhea virus fluorescence LAMP primer group, kit and detection method | |
| CN111334613B (en) | RPA primer pair, probe, kit and detection method for detecting canine adenovirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |