CN103898195A

CN103898195A - Helicobacter pylori drug resistance nucleic acid detection kit

Info

Publication number: CN103898195A
Application number: CN201210570029.4A
Authority: CN
Inventors: 郜恒骏; 魏赵延; 张可浩; 张新; 盛海辉
Original assignee: SHANGHAI OUTDO BIOTECH CO Ltd
Current assignee: SHANGHAI OUTDO BIOTECH CO Ltd
Priority date: 2012-12-25
Filing date: 2012-12-25
Publication date: 2014-07-02

Abstract

The present invention discloses a helicobacter pylori drug resistance nucleic acid detection kit, and belongs to the technical field of bacterial detection. The detection kit comprises: a PCR reaction solution, a helicobacter pylori reaction solution and water. The present invention further discloses a use method for adopting the kit to detect helicobacter pylori drug resistance. The helicobacter pylori drug resistance nucleic acid detection kit can concurrently perform SNP detection on loci 2142 and 2143 of helicobacter pylori 23S in the same reaction tube, and has advantages of strong specificity, high sensitivity, simple operation, strong repeatability, rapid and objective detection result, and the likes.

Description

Hp Drug Resistance kit for detecting nucleic acid

Technical field

The present invention relates to a kind of Hp Drug Resistance detection kit, belong to the detection technique field of bacterium.

Background technology

The various diseases such as helicobacter pylori (Hp) and Stomach duodenum are closely related, it is the important paathogenic factor of the disease such as peptide ulceration, chronic atrophic gastritis, also be the initiation factor that cancer of the stomach develops, also have certain relation with generation, the development of gastric MALT lymphoma.Eradicate Hp and can promote ulcer healing, reduce ulcer recurrence, reduce cancer of the stomach probability of occurrence, partial function maldigestion patient also can therefrom benefit.

From gastritis sufferer's gastric mucosa, be separated to after helicobacter pylori first since nineteen eighty-threes such as Australian scholar Marshall, through the development of more than 20 years, about the research of helicobacter pylori clinical detection has obtained rapid progress.Up to now, mainly contain rapid urease test, microbial culture, biopsy specimen section statining, directly picture dyeing and polymerase chain reaction (PCR), carbon 13, carbon 14 breathalyses, immunoassay, the methods such as urea excretion test.

Real-Time Fluorescent Quantitative PCR Technique (Real-time quantitative Polymerase Chain Reaction is called for short Real Time PCR) is the nucleic acid quantification technology growing up in qualitative PCR technical foundation.Real-Time Fluorescent Quantitative PCR Technique was released by Applied biosystems company of the U.S. in 1996, in PCR reaction system, add fluorophor, utilize the whole PCR process of fluorescent signal accumulation Real-Time Monitoring, make each circulation become " visible ", finally by Ct value and typical curve, the initial concentration of the DNA in sample (cDNA) is carried out to quantitative method.The elementary object of RealTime PCR is accurately to measure and differentiate very micro-specific nucleic acid, thereby can realize the content quantitative to original object gene by monitoring CT value.The advantage of real-time fluorescence quantitative PCR method maximum is quantitative larger error after having overcome terminal PCR method and entering plateau or the period of saturation of crying, and realizes the accurate quantification of DNA/RNA.

This experiment uses Real-Time Fluorescent Quantitative PCR Technique to infect and resistance for detection of Hp, has the features such as level of automation is high, pollution-free, real-time and accurate.

Summary of the invention

It is a kind of Hp Drug Resistance detection kit that main purpose of the present invention provides, and this test kit has the advantage such as high specificity, sensitivity height.

In order to achieve the above object, the present invention has adopted such technical scheme:

Hp Drug Resistance detection kit, comprises following component: PCR reaction solution, helicobacter pylori reaction solution, water.

Wherein, described helicobacter pylori reaction solution comprises following 4 groups of components:

(1) Auele Specific Primer of a pair of detection helicobacter pylori, its base sequence is respectively shown in SEQ ID No.1 and SEQ ID No.2;

Article (2) one, detect helicobacter pylori wild-type probe, its base sequence is respectively shown in SEQ ID No.3, and wherein, SEQ ID No.3 5 ' end is marked with fluorescence report group, and 3 ' end is marked with fluorescent quenching group;

Article (3) one, detect helicobacter pylori 2142 site SNP probes, its base sequence is respectively shown in SEQ ID No.3, and wherein, SEQ ID No.3 5 ' end is marked with fluorescence report group, and 3 ' end is marked with fluorescent quenching group;

Article (4) one, detect helicobacter pylori 2143 site mutation probes, its base sequence is respectively shown in SEQ ID No.3, and wherein, SEQ ID No.3 5 ' end is marked with fluorescence report group, and 3 ' end is marked with fluorescent quenching group;

The present invention gropes and optimizes the proportioning ratio of above-mentioned primer and probe, test-results is found, proportioning ratios different between them have significant difference for specificity and the susceptibility of detected result, the present invention finds by high-throughout shaker test, above-mentioned primer and probe, under following proportioning, have optimum detection effect:

Detecting the primer of helicobacter pylori and the proportioning of probe is respectively: SEQ ID No.1:SEQ ID No.2:SEQ ID No.3:SEQ ID No.4:SEQ ID No.5=500nM:500nM:400nM:300nM:300nM.

Table 1 helicobacter pylori primer probe

Table 2 helicobacter pylori reaction solution component

In order to reach better detection effect, in test kit of the present invention, also can contain Helicobacter pylori reference material.

Another object of the present invention is to provide the using method of test kit of the present invention in helicobacter pylori detection kit, comprising:

(1) DNA of extraction sample

(2) prepare following component: reaction solution 12.5 ul, detection kit reaction solution 4 ul, water 3.5 ul, DNA sample 5 ul.

(3) pcr amplification: carry out pcr amplification according to following program

(4) result is judged: in FAM passage, fluorescence curve is " S " type curve and CT≤35.0, is judged as helicobacter pylori wild-type; Without the amplification of typical case's " S " type or CT >=35.0, be judged as helicobacter pylori negative; In VIC passage, fluorescence curve is " S " type curve and CT≤35.0, is judged as helicobacter pylori 2142 site mutations; In ROX passage, fluorescence curve is " S " type curve and CT≤35.0, is judged as helicobacter pylori 2143 site mutations.

Before detection, elder generation to sample extraction DNA, adds sample to be measured in ready PCR reaction tubes augmentation detection in fluorescent quantitative PCR instrument according to conventional DNA extraction method.After amplification finishes, judge whether Hp Drug Resistance according to fluorescence curve.

Hp Drug Resistance kit for detecting nucleic acid of the present invention can carry out the 2142 and 2143 site SNP detections of helicobacter pylori 23S by same reaction tubes simultaneously, high specificity, highly sensitive, also has the advantages such as easy and simple to handle, repeatability is strong, detected result is quick and objective.

Accompanying drawing explanation:

Fig. 1 test kit of the present invention detects the graphic representation of 4 groups of samples.

Fig. 2 test kit of the present invention detects the sensitivity test result of helicobacter pylori 2142 site mutations.

Fig. 3 test kit of the present invention detects the sensitivity test result of helicobacter pylorus bacterial type 2143 site mutations.

Embodiment

Further describe the present invention below in conjunction with specific embodiment, advantage and disadvantage of the present invention will be more clear along with description.But these embodiment are only exemplary, scope of the present invention are not formed to any restriction.It will be understood by those skilled in the art that lower without departing from the spirit and scope of the present invention and can the details of technical solution of the present invention and form be modified or be replaced, but these modifications and replacement all fall within the scope of protection of the present invention.

The detection test of test example 1 test kit clinical sample of the present invention

1 sample process (DNA extraction)

1.1 pour tissue into liquid nitrogen, clay into power, and add 10ml dissociating buffer.

1.2 add 1ml 10% SDS, mix, and now sample becomes very thickness.

1.3 add 50ul or 1mg Proteinase K, and 37 ℃ of insulation 1-2 hour, disintegrate until organize completely.

1.4 add 1ml 5mol/L NaCl, mix the centrifugal several seconds of 5000rpm.

1.5 get supernatant liquor in new centrifuge tube, use equal-volume phenol: chloroform: primary isoamyl alcohol (25:24:1) extracting.After layering, centrifugal 5 minutes of 3000rpm.

1.6 get upper strata water to clean centrifuge tube, add 2 times of volume ether extractions (operating in ventilation situation).

1.7 remove upper strata ether, retain lower floor's water.

1.8 add 1/10 volume 3mol/L NaAc, and 2 times of volume dehydrated alcohols are put upside down mixed precipitation DNA.Static 10-20 minute under room temperature, DNA precipitation forms white floss.Go out DNA with glass rod hook and precipitate, in 70% ethanol, after rinsing, on thieving paper, blot, be dissolved in 1ml TE-20 ℃ of preservations.

2 reagent are prepared

3 pcr amplification programs

4 interpretations of result: 4 clinical sample concrete outcomes are as follows:

Test example 2 test kit sensitivity test of the present invention result

Helicobacter pylori 2142 site mutation plasmids and helicobacter pylori 2142 site mutation plasmids are carried out to 10 times of doubling dilutions, and experimental result shows that this test kit has good sensitivity, and CT value reduces and changes in gradient (Fig. 2, Fig. 3) with concentration.Test-results shows, test kit of the present invention has the responsive type of height for the detection of helicobacter pylori 2142 sites and 2143 site mutations.

Sequence table

Bo Aobangke bio tech ltd, Chinese Medicine city, medicine city, <110> Taizhou

<120> Hp Drug Resistance kit for detecting nucleic acid

<130>

<160>

<170> PatentIn version 3.5

<210> 1

<211> 22

<212> DNA

<213> artificial sequence

<400> 1

CAGTGAAATTGTAGTGGAGGTG 22

<210> 2

<211> 18

<212> DNA

<213> artificial sequence

<400> 2

AAAGCCTCCCACCTATCC c 18

<210> 3

<211> 18

<212> DNA

<213> artificial sequence

<400> 3

GCAAGACGGAAAGACCCC 18

<210> 4

<211> 17

<212> DNA

<213> artificial sequence

<400> 4

GCAAGACGGGAAGACCC 17

<210> 5

<211> 17

<212> DNA

<213> artificial sequence

<400> 5

CAAGACGGAGAGACCCC 17

Claims

1. a Hp Drug Resistance kit for detecting nucleic acid,, it is characterized in that, comprise following component: PCR reaction solution, helicobacter pylori reaction solution and water.

2. according to Hp Drug Resistance kit for detecting nucleic acid claimed in claim 1, it is characterized in that, described helicobacter pylori reaction solution is by following component (1), component (2), and component (3) and component (4) composition:

Component (1): the Auele Specific Primer of a pair of detection helicobacter pylori, its base sequence is respectively shown in SEQ ID No.1 and SEQ ID No.2;

Component (2): one is detected helicobacter pylori wild-type probe, and its base sequence is respectively shown in SEQ ID No.3, wherein, SEQ ID No.3 5 ' end is marked with fluorescence report group, and 3 ' end is marked with fluorescent quenching group;

Component (3): one is detected the probe of helicobacter pylori 2142 site SNP, and its base sequence is respectively shown in SEQ ID No.4, wherein, SEQ ID No.4 5 ' end is marked with fluorescence report group, and 3 ' end is marked with fluorescent quenching group;

Component (4): one is detected the probe of helicobacter pylori 2143 site SNP, and its base sequence is respectively shown in SEQ ID No.5, wherein, SEQ ID No.5 5 ' end is marked with fluorescence report group, and 3 ' end is marked with fluorescent quenching group;

3. according to Hp Drug Resistance kit for detecting nucleic acid claimed in claim 2, it is characterized in that: described fluorescence report group comprises FAM, HEX, ROX fluorescence report group; Described fluorescent quenching group comprises BHQ1 fluorescent quenching group.

4. according to Hp Drug Resistance kit for detecting nucleic acid claimed in claim 2, it is characterized in that component (1), component (2), component (3) and component

SEQ ID No.1:SEQ ID No.2: SEQ ID No.3: SEQ ID No.4: SEQ ID No.5=500nM: 500nM: 400nM: 300nM: 300nM。