CN107447056A - For differentiating primer set and its application of Mycoplasma bovis and infectious bovine rhinotracheitis - Google Patents
For differentiating primer set and its application of Mycoplasma bovis and infectious bovine rhinotracheitis Download PDFInfo
- Publication number
- CN107447056A CN107447056A CN201710904818.XA CN201710904818A CN107447056A CN 107447056 A CN107447056 A CN 107447056A CN 201710904818 A CN201710904818 A CN 201710904818A CN 107447056 A CN107447056 A CN 107447056A
- Authority
- CN
- China
- Prior art keywords
- primer
- sequence
- mycoplasma bovis
- virus
- fluorophor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses for differentiating that the primer of Mycoplasma bovis and infectious bovine rhinotracheitis is combined and its applied.Conserved genetic sequences of the invention according to MB and IBRV, design and synthesize two sets of specificity LAMP primers, in 5 ' end mark fluorescent groups of every inner primer, MB and IBRV bifluorescence LAMP methods are established, by observing the i.e. diagnosable MB and IBRV of amplified production color.It is experimentally confirmed：The method of the present invention is easy, quick, high sensitivity, specificity is good, and reproducible, cost is low, great amount of samples can be detected simultaneously, and with other cattle disease substance no cross reactions, clinical detection and epidemiology survey available for MB and IBRV, not only facilitate the popularity for understanding Mycoplasma bovis and infectious bovine rhinotrachetis, its potential hazard to China's cattle-raising is assessed, the also formulation for China's Mycoplasma bovis and infectious bovine rhinotrachetis prevention and control scheme provides foundation.
Description
Technical field
The invention belongs to biological field, and in particular to for differentiating the primer set of Mycoplasma bovis and infectious bovine rhinotracheitis
And its application.
Background technology
Mycoplasma bovis (Mycoplasma bovis, MB) and infectious bovine rhinotrachetis virus (Infectious bovine
Rhinotracheitis virus, IBRV) it is two kinds of common main pathogens of ox breathing syndrome, it is to endanger cattle-raising the most
One of serious disease, govern the development of global cattle-raising.Infectious bovine rhinotrachetis virus (bovine herpesvirus
I, IBRV) mainly cause disease, the China such as Niu Gaore, rhinitis, expiratory dyspnea and dam miscarriage to be classified as two class animal epidemics.
IBRV belongs to exotic disease in China, caused by overseas introduction.Mycoplasma bovis (Mycoplasma bovis, MB) mainly causes
Ox expiratory dyspnea, asthma, cough, while can also cause arthritis, mammitis, genital tract inflammation, keratoconjunctivitis, otitis etc..MB
Break out it is nearly all relevant with transport, cows after infection morbidity or young ox latent infection be difficult be eliminated, infected cattle branch
The ox of substance can carry the pathogen several months, in addition the several years and turn into an infection sources.As many other herpesvirals, IBRV
Often have subclinical infection, when running into communicable disease, transport or corticosteroid stress when IBRV can recur, mixed with MB
Secondary bacterial bronchitis is infected, calamitous death can be caused.There are some researches show, contacted before IBRV can make ox to MB more
Add susceptible.Two kinds of sick clinical condition states are similar to be difficult to differentiate between, and frequent mixed infection, so usually because can not obtain in time just
True diagnosis and effective treatment, and cause very big economic loss.Therefore preventing and treating of the antidiastole to ox breathing syndrome shows
It must be even more important.Currently mainly there are virus purification, serum neutralization, Elisa and PCR etc. to the diagnostic method of both cattle disease substances
Method, but both at home and abroad also without the report of two weighing methods about Mycoplasma bovis and infectious bovine rhinotrachetis.
Ring mediation external isothermal duplication detection technique (Loop-mediated isothermal amplification,
LAMP) it is the emerging nucleic acid detection technique that grows up on PCR method, breaches the technological difficulties of constant-temperature amplification, 6 primers
Increase during with efficiency, sensitiveness is high, and specificity is good, is applied in the detection of a variety of diseases.At present, domestic multiple LAMP
Method has certain limitation, it is impossible to is not really to anticipate it is determined that being the result caused by any positive reaction the bottom of specific to
Antidiastole in justice.
The content of the invention
It is an object of the present invention to provide it is a kind of be used to differentiating Mycoplasma bovis and infectious bovine rhinotrachetis virus into
Cover primer.
Provided by the present invention for differentiating the primer set of Mycoplasma bovis and infectious bovine rhinotrachetis virus by for reflecting
Determine the primer sets of Mycoplasma bovis and for identifying that the primer sets of Mycoplasma bovis form；
The primer sets for being used to identify Mycoplasma bovis are by primer MB-F3, primer MB-B3, primer MB-FIP and primer MB-
BIP is formed；
It is described be used to identifying the primer sets of infectious bovine rhinotrachetis virus by primer I BRV-F3, primer I BRV-B3, draw
Thing IBRV-FIP and primer I BRV-BIP compositions；
The primer MB-F3 is a1) or a2)：
A1) the single strand dna in sequence table shown in sequence 1；
A2 sequence 1 by 1 or the substitution of several nucleotides and/or missing and/or addition and) had into phase with sequence 1
The DNA molecular of congenerous；
The primer MB-B3 is a3) or a4)：
A3) the single strand dna in sequence table shown in sequence 2；
A4 sequence 2 by 1 or the substitution of several nucleotides and/or missing and/or addition and) had into phase with sequence 2
The DNA molecular of congenerous；
The primer MB-FIP is a5) or a6)：
A5) the single strand dna in sequence table shown in sequence 3；
A6 sequence 3 by 1 or the substitution of several nucleotides and/or missing and/or addition and) had into phase with sequence 3
The DNA molecular of congenerous；
The primer MB-BIP is a7) or a8)：
A7) the single strand dna in sequence table shown in sequence 4；
A8 sequence 4 by 1 or the substitution of several nucleotides and/or missing and/or addition and) had into phase with sequence 4
The DNA molecular of congenerous；
The primer I BRV-F3 is a9) or a10)：
A9) the single strand dna in sequence table shown in sequence 5；
A10 sequence 5 by 1 or the substitution of several nucleotides and/or missing and/or addition and) had into phase with sequence 5
The DNA molecular of congenerous；
The primer I BRV-B3 is a11) or a12)：
A11) the single strand dna in sequence table shown in sequence 6；
A12 sequence 6 by 1 or the substitution of several nucleotides and/or missing and/or addition and) had into phase with sequence 6
The DNA molecular of congenerous；
The primer I BRV-FIP is a13) or a14)：
A13) the single strand dna in sequence table shown in sequence 7；
A14 sequence 7 by 1 or the substitution of several nucleotides and/or missing and/or addition and) had into phase with sequence 7
The DNA molecular of congenerous；
The primer I BRV-BIP is a15) or a16)：
A15) the single strand dna in sequence table shown in sequence 8；
A16 sequence 8 by 1 or the substitution of several nucleotides and/or missing and/or addition and) had into phase with sequence 8
The DNA molecular of congenerous.
In above-mentioned primer set, 5 ' the end connection fluorophor A of the primer MB-FIP；The 5 ' of the primer I BRV-FIP
Connection fluorophor B, the fluorophor A and fluorophor B are different fluorophors at end.Specifically, the fluorophor A
Can be fluorophor CY5.5；The fluorophor B can be fluorophor FITC.
It is a further object to provide following b1) or b2) shown in product：
B1 the PCR reagent) containing any described primer set in claims 1 to 3；
B2) containing any described primer set or b1 in claims 1 to 3) described in PCR reagent kit.
The preparation method of mentioned reagent box falls within protection scope of the present invention.The preparation method of the kit includes will
The step of above-mentioned each bar primer is individually packed.
Third object of the present invention is to provide the new application of above-mentioned primer set or the said goods.
The invention provides above-mentioned primer set or the said goods in following c1)~c6) in it is any in application：
C1 Mycoplasma bovis and infectious bovine rhinotrachetis virus) are differentiated；
C2 the product for differentiating Mycoplasma bovis and infectious bovine rhinotrachetis virus) is prepared；
C3) detect whether pathogenic microorganism to be measured is Mycoplasma bovis or infectious bovine rhinotrachetis virus；
C4) prepare and detect whether pathogenic microorganism to be measured is Mycoplasma bovis or the product of infectious bovine rhinotrachetis virus；
C5) whether detection testing sample infects Mycoplasma bovis and/or infectious bovine rhinotrachetis virus；
C6) prepare whether detection testing sample infects Mycoplasma bovis and/or the product of infectious bovine rhinotrachetis virus.
Fourth object of the present invention is to provide a kind of method for differentiating Mycoplasma bovis and infectious bovine rhinotrachetis virus.
The method provided by the invention for differentiating Mycoplasma bovis and infectious bovine rhinotrachetis virus comprises the following steps：
Using viral nucleic acid to be measured as template, duplex fluorescent PCR is carried out using above-mentioned primer set, obtains PCR primer；Root
Differentiate Mycoplasma bovis and infectious bovine rhinotrachetis virus according to the PCR primer：
If being able to detect that the amplified production with fluorescence corresponding to fluorophor A, virus to be measured is Mycoplasma bovis；
If being able to detect that the amplified production with fluorescence corresponding to fluorophor B, virus to be measured is ox infectiousness nose
Bronchitis virus.
In methods described, when the fluorophor A is fluorophor CY5.5；The fluorophor B is fluorophor FITC
When, if the amplified production can observe red DNA fragmentation under 670nm ultraviolet light, virus to be measured is ox branch
Substance, if the amplified production can observe the DNA fragmentation of green under 520nm ultraviolet light, virus to be measured is ox
Infectious bovine rhinotracheitis virus.
In methods described, the virus to be measured is Mycoplasma bovis or infectious bovine rhinotrachetis virus.
The 5th purpose of the present invention is to provide whether a kind of detection pathogenic microorganism to be measured is Mycoplasma bovis or Niu Chuanran
The method of property rhinotracheitis virus.
Whether detection pathogenic microorganism to be measured provided by the invention is Mycoplasma bovis or infectious bovine rhinotrachetis virus
Method comprises the following steps：Using the nucleic acid of pathogenic microorganism to be measured as template, bifluorescence RT- is carried out using above-mentioned primer set
PCR, obtain PCR primer；Judge whether pathogenic microorganism to be measured is Mycoplasma bovis or ox infectiousness nose gas according to the PCR primer
The scorching virus of pipe：
If being able to detect that the amplified production with fluorescence corresponding to fluorophor A, pathogenic microorganism to be measured is ox branch
Substance；
If being able to detect that the amplified production with fluorescence corresponding to fluorophor B, pathogenic microorganism to be measured passes for ox
Metachromia rhinotracheitis virus；
If it is unable to detect that with the amplified production of fluorescence corresponding to fluorophor A and can not detects with fluorescent base
The amplified production of fluorescence corresponding to group B, then pathogenic microorganism to be measured is non-Mycoplasma bovis and non-infectious bovine rhinotrachetis virus.
In methods described, when the fluorophor A is fluorophor CY5.5；The fluorophor B is fluorophor FITC
When, if the amplified production can observe red DNA fragmentation, pathogenic microorganism to be measured under 670nm ultraviolet light
For Mycoplasma bovis, if the amplified production can observe the DNA fragmentation of green, disease to be measured under 520nm ultraviolet light
Pathogenic microorganism is infectious bovine rhinotrachetis virus, if the amplified production can not be under 670nm ultraviolet light it was observed that red
The DNA fragmentation of color and the DNA fragmentation that green can not be observed under 520nm ultraviolet light, then pathogenic microorganism to be measured is non-ox
Mycoplasma and non-infectious bovine rhinotrachetis virus.
The pathogenic microorganism to be measured is Mycoplasma bovis MB, infectious bovine rhinotrachetis virus IBRV, foot and mouth disease virus
FMDV, vesicular stomatitis virus VSV, blue tongue virus BTV, PPR virus PPRV, bovine viral diarrhea virus BVDV,
Bovine rota BRV or enterotoxigenic escherichia coil ETEC.
The Mycoplasma bovis MB concretely GL-1 strains, BS-1 strains and NN-1 strains；
The infectious bovine rhinotrachetis virus IBRV concretely 67 plants of Barta Nu and BK125 strains；
The foot and mouth disease virus FMDV concretely A types, the O-shaped and types of Asina 1；
The vesicular stomatitis virus VSV concretely NJ types and IND types；
The blue tongue virus BTV concretely 4 types, 8 types, 9 types, 15 types, 17 types and 18 types；
The bovine viral diarrhea virus BVDV concretely Oregon CV24 types, NADL types and AV68 types；
The bovine rota BRV is specifically as follows NCDV types and 014 type；
Concretely 1676 plants of the enterotoxigenic escherichia coil ETEC, 1751 plants and B41 strains.
Final object of the present invention is to provide whether a kind of detection testing sample infects Mycoplasma bovis and/or Niu Chuanran
The method of property rhinotracheitis virus.
Whether detection testing sample provided by the invention infects the side of Mycoplasma bovis and/or infectious bovine rhinotrachetis virus
Method comprises the following steps：Using the nucleic acid of pathogenic microorganism to be measured as template, duplex fluorescent PCR is carried out using above-mentioned primer set,
Obtain PCR primer；Judge whether testing sample infects Mycoplasma bovis and/or infectious bovine rhinotrachetis according to the PCR primer
Virus：
If being able to detect that the amplified production with fluorescence corresponding to fluorophor A, testing sample infection Mycoplasma bovis；
If being able to detect that the amplified production with fluorescence corresponding to fluorophor B, testing sample infected cattle infectiousness
Rhinotracheitis virus；
If it is able to detect that with the amplified production of fluorescence corresponding to fluorophor A and is able to detect that with fluorophor
The amplified production of fluorescence corresponding to B, then testing sample simultaneously infect Mycoplasma bovis and infectious bovine rhinotrachetis virus；
If it is unable to detect that with the amplified production of fluorescence corresponding to fluorophor A and can not detects with fluorescent base
The amplified production of fluorescence corresponding to B is rolled into a ball, then testing sample is uninfected by Mycoplasma bovis and infectious bovine rhinotrachetis virus.
In methods described, when the fluorophor A is fluorophor CY5.5；The fluorophor B is fluorophor FITC
When, if the amplified production can observe red DNA fragmentation, testing sample infected cattle under 670nm ultraviolet light
Mycoplasma, if the amplified production can observe the DNA fragmentation of green, testing sample sense under 520nm ultraviolet light
Contaminate infectious bovine rhinotrachetis virus, if the amplified production observed under 670nm ultraviolet light red DNA fragmentation and
The DNA fragmentation of green is observed under 520nm ultraviolet light, then testing sample infects Mycoplasma bovis and ox infectiousness nose gas simultaneously
The scorching virus of pipe, if the amplified production can not observe red DNA fragmentation under 670nm ultraviolet light and can not be
The DNA fragmentation of green is observed under 520nm ultraviolet light, then testing sample is uninfected by Mycoplasma bovis and infectious bovine rhinotrachetis
Virus.
The testing sample is in vitro animal tissue, such as product for being processed into of beef, beef etc..The present invention's
In specific embodiment, the testing sample is nose of an ox mucus.
In any of the above-described methods described, the nucleic acid is DNA, RNA or DNA and RNA mixture.In the specific of the present invention
In embodiment, the nucleic acid of viral, the described pathogenic microorganism to be measured to be measured and the testing sample is to be extracted by RNA/DNA
Kit extracts obtained nucleic acid.
In any of the above-described methods described, the reaction system (25 μ L) of the duplex fluorescent PCR is：μ L of template 1,10 ×
μ L of buffer 2.5, Bst archaeal dna polymerases 15U, primer MB-FIP 40pmol, primer MB-BIP 40pmol, primer I BRV-
FIP 40pmol, primer I BRV-BIP 40pmol, primer MB-F3 5pmol, primer MB-B3 5pmol, primer I BRV-F3
5pmol and primer I BRV-B3 5pmol, surplus are water.Response procedures are as follows：62 DEG C are reacted 90 minutes, and 80 DEG C of effect 5min are whole
Only react.
The present invention designs and synthesizes two sets of specificity LAMP primers, at every according to MB and IBRV conserved genetic sequences
5 ' end mark fluorescent groups of inner primer, establish MB and IBRV bifluorescence LAMP methods, by observing amplified production color
I.e. diagnosable MB and IBRV.It is experimentally confirmed：The method of the present invention is easy, quick, and (most low energy detects 100 to high sensitivity
Individual hybrid template copy/reaction), specificity is good, and reproducible, cost is low, can detect great amount of samples simultaneously, and with other cattle diseases
Substance no cross reaction.125 parts of samples are detected using this method, the infection rate that MB infection rate is 44.8%, IBRV is
13.6%, 2 kinds of cause of disease mixed infection rates are 1.6%；Compared with the substance fluorescent quantitative PCR detection method that OIE recommends, this is double
The sensitiveness of LAMP method is 94.4%~96.6%, and specificity is 100%.The method of the present invention is faced available for MB's and IBRV
Bed detection and epidemiology survey, not only facilitate the popularity for understanding Mycoplasma bovis and infectious bovine rhinotrachetis, assess
Its potential hazard to China's cattle-raising, the also formulation for China's Mycoplasma bovis and infectious bovine rhinotrachetis prevention and control scheme provide
Foundation.
Brief description of the drawings
Fig. 1 is bifluorescence LAMP primer schematic diagram.
Fig. 2 is double LAMP specificity experiments result.Fig. 2A is 520nm fluorescence channel electrophoretograms；Fig. 2 B are 670nm fluorescence
Passage electrophoretogram；Fig. 2 C are 520nm and 670nm binary channels electrophoretogram.Wherein, swimming lane 1：MB；Swimming lane 2：IBRV；Swimming lane 3：MB
+IBRV；Swimming lane 4~11 is respectively：FMDV, VSV, BTV, PPRV, BVDV, BRV, ETEC and negative control.
Fig. 3 is bifluorescence LAMP sensitivity experiments results.Fig. 3 A are 520nm fluorescence channel electrophoretograms；Fig. 3 B are 670nm
Fluorescence channel electrophoretogram；Fig. 3 C are 520nm and 670nm binary channels electrophoretogram.Swimming lane 1~7：106~1 copy/μ l (PMD-
18T-MB and PMD-18T-IBRV mixing plasmid standard), swimming lane 8：Negative control.
Fig. 4 is the real-time turbidity figure of bifluorescence LAMP sensitiveness.Curve 1~7：106~1 copy/μ l (PMD-18T-MB and
PMD-18T-IBRV mixing plasmid standard), curve 8：Negative control.
Fig. 5 is double LAMP interference result of the test.1~swimming lane of swimming lane 6 distinguishes 1~sample of counter sample 6.Sample 1：MB
(108copies/μL)+IBRV(104copies/μL)；Sample 2：MB(104copies/μL)+IBRV(108copies/μL)；Sample
Product 3：MB(107copies/μL)+IBRV(103copies/μL)；Sample 4：MB(104copies/μL)+IBRV(107copies/
μL)；Sample 5：MB(106copies/μL)+IBRV(102copies/μL)；Sample 6：MB(102copies/μL)+IBRV
(106copies/μL)。
Embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
Material used, reagent etc., unless otherwise specified, are commercially obtained in following embodiments.
Quantitative test in following embodiments, it is respectively provided with and repeats to test three times, results averaged.
LAMP DNA cloning kit and the real-time transmissometers of Loopamp LA-320C in following embodiments are purchased from Japan
Rong Yan companies；RNA/DNA extraction agents box, reverse transcription reagent box and small amount plasmid extraction kit are purchased from Quan Shi King Companies；
PremixTaq PCR kits and PMD-18T carriers are purchased from Dalian treasured biotech firm；Bst archaeal dna polymerases are purchased from new
England companies；The nucleic acid determination instrument of NanoDrop 2000 is purchased from ThermoFisher Scientific companies of the U.S.；Polychrome is glimmering
Photoimaging analysis system is purchased from BIO-RAD companies of the U.S..
10 × buffer formulas in following embodiments are as follows：200Mm Tris-HCl (pH 8.8), 100mM KCl,
80mM MgSO4, 100mM (NH4)2SO4, 1% (volume fraction) Tween 20,8M glycine betaines and 14m dNTPs.
The O-shaped inactivation of viruses of FMDV, FMDV A types inactivation of viruses, the type inactivation of viruses of FMDV Asia I in following embodiments,
VSV NJ types inactivation of viruses, VSV IND types inactivation of viruses, the type inactivation of viruses of BTV 4, the type inactivation of viruses of BTV 8, the types of BTV 9 go out
Live virus, the type inactivation of viruses of BTV 15, the type inactivation of viruses of BTV 17, the type inactivation of viruses of BTV 18 and PPRV vaccine strains are recorded in
Document " Qin Min, Zou Fengcai, Yang Yunqing, waits blue tongue diseases, aftosa, PPR and vesicular stomatitis multiplex PCR detection side
Foundation [J] the animal medicines progress of method, 2015,36 (9):In 18-22. ", by Yunnan, Entry-Exit Inspection and Quarantine Bureau give, the public
It can be obtained from Veterinary Institute of Guangxi Zhuang Autonomous Region, the biomaterial is only attached most importance to used in the related experiment of duplicate invention, can not
Used as other purposes.
MB/NN-1 and MB/GL-1 in following embodiments are recorded in document " Tao Li, Li Jun, Pang Guanlong, etc. Guang Xinan
The pathogen separation of the doubtful Mycoplasma bovis pneumonia in peaceful city and PCR identifications, HEILONGJIANG ANIMAL SCIENCE AND VETERINARY MEDICINE, 08 month 2015：It is public in 169. "
Crowd can be obtained from Veterinary Institute of Guangxi Zhuang Autonomous Region, and the biomaterial is only attached most importance to used in the related experiment of duplicate invention, no
It can be used as other purposes.
MB/BS-1 in following embodiments is recorded in document " Ma Chunxia, Li Jun, Qin Yong etc., cattle respiratory disease syndrome
The Analysis On The Pathogens of case, Chinese animal and veterinary, 2015,42 (9)：In 2481-2486. ", the public can be from Guangxi Zhuang Autonomous Region beast
Cure research institute to obtain, the biomaterial is only attached most importance to used in the related experiment of duplicate invention, can not be used as other purposes.
It is as follows at strain and purchase in following embodiments：
BVDV Reference strains Oregon CV24 strains (BVDV-1 types)：China Veterinery Drug Inspection Office, article No.：AV69.
BVDV Reference strains NADL strains (BVDV-1 types)：China Veterinery Drug Inspection Office, article No.：AV67.
BVDV Reference strains yak strain AV68 (BVDV-1 types)：China Veterinery Drug Inspection Office, article No.：AV68.
BRV Reference strains NCDV (BRV/NCDV)：China Veterinery Drug Inspection Office, article No.：AV51.
BRV Reference strains BRV014 (BRV/014)：China Veterinery Drug Inspection Office, article No.：AV52.
IBRV/BK125 strains：Chinese veterinary microorganism culture presevation administrative center, article No.：AV21.
67 plants of IBRV/Barta Nu, Chinese veterinary microorganism culture presevation administrative center, article No.：AV20.
ETEC-1676：China Veterinery Drug Inspection Office, article No.：212.
ETEC-1751：China Veterinery Drug Inspection Office, article No.：214.
ETEC-B41：China Veterinery Drug Inspection Office, article No.：215.
Embodiment 1, the primer combination for differentiating Mycoplasma bovis and infectious bovine rhinotracheitis
Listed IBRV gB genes and MB Uvrc gene orders on Genebank are downloaded, is carried out using MEGA 5.0
Conservative and homology analysis, the good region of conservative is chosen, with primer5.0 and Primer explore V4 Software for Design 2
Cover LAMP specific primer groups：For identifying the primer sets of Mycoplasma bovis and primer sets for identifying Mycoplasma bovis.Often set draws
Thing group includes 4 primers：Outer primer F3 and B3, inner primer FIP (F1c+F2) and BIP (B1c+B2).5 ' ends of every inner primer
Mark fluorescent group：IBRV-FIP flag F ITC fluorescence, in green under 520nm wavelength；MB-FIP marks CY5.5 fluorescence,
Taken on a red color under 670nm wavelength.
For identifying the primer sets of Mycoplasma bovis by primer MB-F3, primer MB-B3, primer MB-FIP and primer MB-BIP
Composition, primer MB-FIP 5 ' end mark fluorescent group CY5.5；
For identifying the primer sets of infectious bovine rhinotracheitis by primer I BRV-F3, primer I BRV-B3, primer I BRV-FIP
Formed with primer I BRV-BIP, primer I BRV-FIP 5 ' end mark fluorescent group FITC；
Above-mentioned each bar primer sequence is as shown in table 1.All primers synthesize by Dalian treasured biotech firm.
Primer MB-F3, primer MB-B3, primer MB-FIP, primer MB-BIP, primer I BRV-F3, primer I BRV-B3, draw
Thing IBRV-FIP and primer I BRV-BIP forms the primer set for differentiating Mycoplasma bovis and infectious bovine rhinotracheitis.
Table 1 is primer sequence
| Primer | Sequence (5 ' -3 ') | Way of purification |
| MB-F3 | CCTGTCGGAGTTGCAATTGTT (sequence 1) | HPLC |
| MB-B3 | CGGTCAACTTCAACTTGAATTTG (sequence 2) | HPLC |
| MB-FIP | CY5.5-TACCGCCATCAGCTATAACTAAGTCATGAGCGCAGTGCTGATGTTG (sequence 3) | HPLC |
| MB-BIP | TCCCTGTTATTGGATTAGTAAAAAACATATCTAGGTCAATTAAGGCTTTGG (sequence 4) | HPLC |
| IBRV-F3 | GGACGATGTGTACACGGC (sequence 5) | HPLC |
| IBRV-B3 | CTCGATCTGCTGGAAGCG (sequence 6) | HPLC |
| IBRV-FIP | FITC-TCGTACGGGTACACCGAGCGTACCGCACGGGCACCT (sequence 7) | HPLC |
| IBRV-BIP | TACATGTCGCCCTTTTACGGGCCCGGCGAGTAGCTGGT (sequence 8) | HPLC |
Embodiment 2, the method for differentiating Mycoplasma bovis and infectious bovine rhinotracheitis
1st, the extraction of nucleic acid
Using RNA/DNA extraction agents box with reference to kit specification, the RNA/DNA of testing sample is extracted.To extract
The RNA arrived is template, and carrying out reverse transcription using reverse transcription reagent box obtains cDNA.
2nd, bifluorescence LAMP
The cDNA or DNA obtained using step 1, using the primer set designed in embodiment 1, utilizes LAMP DNA as template
Amplification kit carries out bifluorescence LAMP, obtains PCR primer.
Bifluorescence LAMP reaction systems (25 μ L) are：μ L of DNA profiling 1, the μ L of 10 × buffer 2.5, Bst DNA polymerizations
Enzyme 15U, primer MB-FIP 40pmol, primer MB-BIP 40pmol, primer I BRV-FIP 40pmol, primer I BRV-BIP
40pmol, primer MB-F3 5pmol, primer MB-B3 5pmol, primer I BRV-F3 5pmol and primer I BRV-B3 5pmol,
Surplus is water.
Each component in PCR reaction systems is well mixed rearmounted 62 DEG C of thermostat and reacted 90 minutes, and 80 DEG C of effect 5min are whole
Only react.
3rd, product detection
The PCR primer in step 2 is taken to carry out 1% agarose gel electrophoresis, respectively in the purple that wavelength is 520nm and 670nm
Observed under outer lamp.
Embodiment 3, specific detection
First, testing sample
Testing sample in specific detection experiment is as shown in table 2.
Table 2 is bifluorescence LAMP specific outcomes
Note：GVRI:Guangxi veterinary institute；YNCIQ:Yunnan Exit-Entry Quaratine detection office；CVCC:Chinese veterinary drug supervision
Institute；LVRI:Lanzhou animal doctor studies
2nd, bifluorescence LAMP
Respectively with MB (GL-1 strains, BS-1 strains and NN-1 strains), IBRV (67 plants of Barta Nu and BK125 strains), MB (NN-1
Strain) with IBRV (67 plants of Barta Nu) mixed in equal amounts sample (MB+IBRV), FMDV (A types, the O-shaped and types of Asina 1), VSV
(NJ types and IND types), BTV (4 types, 8 types, 9 types, 15 types, 17 types and 18 types), PPRV, BVDV (Oregon CV24 types, NADL types
With AV68 types) and BRV (NCDV types and 014 type) cDNA and ETEC (1676 plants, 1751 plants and B41 strains) DNA be template, press
Detected according to the detection method in embodiment 2, verify its specificity.Using the genome NDA of healthy ox as negative control.
As a result as shown in table 2 and Fig. 2.Fig. 2A is 520nm fluorescence channel electrophoretograms；Fig. 2 is 670nm fluorescence channel electrophoresis
Figure；Fig. 2 C are 520nm and 670nm binary channels electrophoretogram.Swimming lane 1：MB (NN-1 strains)；Swimming lane 2：IBRV(Barta Nu 67
Strain)；Swimming lane 3：MB+IBRV；Swimming lane 4~11 is respectively：FMDV (A types), VSV (NJ types), BTV (4 type), PPRV, BVDV
(Oregon CV24), BRV (014), ETEC (B41) and negative control.
It can be seen that from table 2 and Fig. 2：Only MB, IBRV and MB and IBRV are mixed using the detection method in embodiment 2
Closing sample has amplification.Wherein, the MB positives take on a red color, and only can be observed under 670nm passages, and IBRV is positive in green, only exists
It can be observed under 520nm passages.And it is feminine gender to the testing result of other bovine virals and negative control.Illustrate in embodiment 2
Primer combination specificity it is good.
Embodiment 4, sensitivity experiments
First, the preparation of standard items
1st, the preparation of recombinant plasmid
DNA molecular (MB outer primers MB-B3 and MB-F3 pcr amplification product) shown in sequence 9 is cloned into PMD-18T
Carrier, obtain PMD-18T-MB recombinant plasmids.
DNA molecular (IBRV outer primers IBRV-F3 and IBRV-B3 pcr amplification product) shown in sequence 10 is cloned into
PMD-18T carriers, obtain PMD-18T-IBRV recombinant plasmids.
2nd, the preparation of standard items
Plasmid is extracted from the recombinant bacterium of the recombinant plasmid prepared containing step 1 using small amount plasmid extraction kit respectively
PMD-18T-MB and PMD-18T-IBRV, plasmid concentration is determined through the nucleic acid determination instrument of NanoDrop 2000, and according to A Fujiade
Plasmid concentration is converted to copy number, copy number (copies/ μ L)=plasmid concentration (g/ μ L) × 10 by sieve constant-9×6.02×
1023/ 660 × 2692 (plasmid total lengths), respectively obtain MB standard items and IBRV standard items.
3rd, the preparation of the standard items of various concentrations
Use ddH2MB standard items and IBRV standard items are made 10 times of gradient dilutions by O respectively, respectively obtain final concentration of 1 × 108
Copy/μ L, 1 × 107Copy/μ L, 1 × 106Copy/μ L, 1 × 105Copy/μ L, 1 × 104Copy/μ L, 1 × 103Copy/μ L, 1
×102Copy/μ L, 1 × 101Copy/μ L and 1 copy/μ L MB standard solutions and IBRV standard solutions.
2nd, sensitivity Detection
1st, the preparation of testing sample
The MB standard solutions of isoconcentration and IBRV standard solutions are mixed in equal volume respectively, respectively obtain concentration as 1
×108Copy/μ L, 1 × 107Copy/μ L, 1 × 106Copy/μ L, 1 × 105Copy/μ L, 1 × 104Copy/μ L, 1 × 103Copy
Shellfish/μ L, 1 × 102Copy/μ L, 1 × 101Copy/μ L and 1 copy/μ L mixing plasmid standard solution.
2nd, using the mixing plasmid standard solution of the various concentrations in step 1 as template, according to the detection side in embodiment 2
Method is detected.Using the genomic DNA of healthy ox as negative control.
Testing result is as shown in Figure 3.Fig. 3 A are 520nm fluorescence channel electrophoretograms；Fig. 3 B are 670nm fluorescence channel electrophoresis
Figure；Fig. 3 C are 520nm and 670nm binary channels electrophoretogram.Swimming lane 1~7：106~1 copy/μ L (PMD-18T-MB and PMD-
18T-IBRV mixing plasmid standard), swimming lane 8：Negative control.Reaction product is used into the real-time turbidity of Loopamp LA-320C
Instrument generates real-time turbidity figure.As a result it is as shown in Figure 4.Curve 1~7：106~1 copy/μ L (PMD-18T-MB and PMD-18T-
IBRV mixing plasmid standard), curve 8：Negative control.The above results show：Specific purpose band brightness is with template copy
Number gradients reduction and equimultiple decline, the sensitivity of detection method of the invention is up to 100 copies/μ L, high sensitivity.
Embodiment 5, interference experiment
First, the preparation of testing sample
The MB standard solutions of various concentrations and IBRV standard solutions are mixed in equal volume, obtain the mixing of various concentrations
Plasmid standard solution.Specific preparation method is as follows：
It is 1 × 10 by concentration8Copy/μ L MB standard solutions are 1 × 10 with concentration4Copies/ μ L IBRV standard items
Solution mixes, and obtains sample 1；
It is 1 × 10 by concentration4Copy/μ L MB standard solutions are 1 × 10 with concentration8Copies/ μ L IBRV standard items
Solution mixes, and obtains sample 2；
It is 1 × 10 by concentration7Copy/μ L MB standard solutions are 1 × 10 with concentration3Copies/ μ L IBRV standard items
Solution mixes, and obtains sample 3；
It is 1 × 10 by concentration4Copy/μ L MB standard solutions are 1 × 10 with concentration7Copies/ μ L IBRV standard items
Solution mixes, and obtains sample 4；
It is 1 × 10 by concentration6Copy/μ L MB standard solutions are 1 × 10 with concentration2Copies/ μ L IBRV standard items
Solution mixes, and obtains sample 5；
It is 1 × 10 by concentration2Copy/μ L MB standard solutions are 1 × 10 with concentration6Copies/ μ L IBRV standard items
Solution mixes, and obtains sample 6.
2nd, interference detects
It is template with 1~sample of sample 6 in step 1, is detected according to the detection method in embodiment 2.With health
The genomic DNA of ox is negative control.
Testing result is as shown in Figure 5.Fig. 5 A are 520nm fluorescence channel electrophoretograms；Fig. 5 B are 670nm fluorescence channel electrophoresis
Figure；Fig. 5 C are 520nm and 670nm binary channels electrophoretogram.1~swimming lane of swimming lane 6 distinguishes 1~sample of counter sample 6.As a result table
It is bright：The mixing plasmid standard solution of MB standard items and IBRV standard items to various concentrations, when a template concentrations are high and another
When one template concentrations is relatively low, detection method of the invention still can be detected simultaneously by two templates, not influence to expand effect each other
Rate, interference are small.
The detection of embodiment 6, clinical sample
First, clinical sample
Testing sample is that 125 parts of nose mucus swabs from Guangxi various regions cattle farm were gathered between 2014 to 2016.Partly
Sample comes from the calf of typical ox breathing syndrome, is embodied in body temperature rise, spiritual poor, anorexia, and drink is intended to increase,
Flow clear tears or purulence nasal mucus, the violent symptom such as cough, part infected cattle also occurs having loose bowels or the symptom such as arthroncus.
2nd, clinical sample detects
125 parts of nose mucus swabs are eluted with double distilled water, detected according to the method in embodiment 2, referring concurrently to
Document " ABRIL C, ENGELS M, LIMAN A, et al.Both viral and host factors contribute to
neurovirulence of bovine herpesviruses 1and 5in interferon receptor-deficient
mice.J.Virol.2004,78:3644-3653. " and " Sachse K, Salam HS, Diller R, et al.Use of a
novel real-time PCR technique to monitor and quantitate Mycoplasma bovis
infection in cattle herds with mastitis and respiratory disease.Vet J.2010,
10；186(3):Method in 299-303. " is detected with MB fluorescent PCRs and IBRV fluorescent PCRs.
As a result as shown in table 3 (numerical value represents testing result for positive sample number in table).As a result show：With the present invention
The bifluorescence LAMP detection method of foundation detects to 125 parts of clinical samples, and detection altogether obtains Mycoplasma bovis positive
56 parts, infection rate 44.8%；17 parts of infectious bovine rhinotrachetis positive, infection rate 13.6%；Mycoplasma bovis and ox
2 parts of infectious bovine rhinotracheitis mixed infection sample, mixed infection rate are 1.6%.Compared with fluorescent quantitative PCR detection method, inspection
The Sensitivity and Specificity for surveying MB is respectively 96.6% (56/58), 100% (65/65, true negative sample number is 125-60=
65) Sensitivity and Specificity for, detecting IBRV is respectively 94.4% (17/18), 100% (105/105, true negative sample number is
125-20=105).Illustrate that the bifluorescence LAMP clinical detections effect of the present invention is good.
Table 3 is clinical sample testing result
Sequence table
<110>Veterinary Institute of Guangxi Zhuang Autonomous Region
<120>For differentiating primer set and its application of Mycoplasma bovis and infectious bovine rhinotracheitis
<160>10
<170>PatentIn version 3.5
<210>1
<211>21
<212>DNA
<213>Artificial sequence (Artificial Sequence)
<400>1
cctgtcggag ttgcaattgt t 21
<210>2
<211>23
<212>DNA
<213>Artificial sequence (Artificial Sequence)
<400>2
cggtcaactt caacttgaat ttg 23
<210>3
<211>46
<212>DNA
<213>Artificial sequence (Artificial Sequence)
<400>3
taccgccatc agctataact aagtcatgag cgcagtgctg atgttg 46
<210>4
<211>51
<212>DNA
<213>Artificial sequence (Artificial Sequence)
<400>4
tccctgttat tggattagta aaaaacatat ctaggtcaat taaggctttg g 51
<210>5
<211>18
<212>DNA
<213>Artificial sequence (Artificial Sequence)
<400>5
ggacgatgtg tacacggc 18
<210>6
<211>18
<212>DNA
<213>Artificial sequence (Artificial Sequence)
<400>6
ctcgatctgc tggaagcg 18
<210>7
<211>36
<212>DNA
<213>Artificial sequence (Artificial Sequence)
<400>7
tcgtacgggt acaccgagcg taccgcacgg gcacct 36
<210>8
<211>38
<212>DNA
<213>Artificial sequence (Artificial Sequence)
<400>8
tacatgtcgc ccttttacgg gcccggcgag tagctggt 38
<210>9
<211>368
<212>DNA
<213>Artificial sequence (Artificial Sequence)
<400>9
cctgtcggag ttgcaattgt ttatactaat ggaattaaaa acaaaagctt atatagaaaa 60
tttaatttag aagctttaaa tgagcgcagt gctgatgttg aatatattaa gcaatcaatt 120
tctaaatttt ttagtagcaa caaaaacact aaagattatg acttagttat agctgatggc 180
ggtatacaac aagttaatga agctaaaaaa acgcttaaaa cgcttaatat aaacatccct 240
gttattggat tagtaaaaaa tgagtttcac aaaaccaaag ccttaattga cctagatatg 300
aatgaaattc atattaatga cttagaacta tacaactact tagttcaaat tcaagttgaa 360
gttgaccg 368
<210>10
<211>220
<212>DNA
<213>Artificial sequence (Artificial Sequence)
<400>10
ggacgatgtg tacacggcgc tgggctcggc ggggctctac cgcacgggca cctctgtgaa 60
ctgcatcgtg gaagaagtgg aggcgcgctc ggtgtacccg tacgactcgt tcgcgctctc 120
gaccggggac attatctaca tgtcgccctt ttacgggctg cgcgagggcg cgcaccgcga 180
gcacaccagc tactcgccgg agcgcttcca gcagatcgag 220
Claims (8)
1. for differentiating Mycoplasma bovis and the primer set of infectious bovine rhinotrachetis virus, it is by for identifying Mycoplasma bovis
Primer sets and the primer sets composition for identifying Mycoplasma bovis；
The primer sets for being used to identify Mycoplasma bovis are by primer MB-F3, primer MB-B3, primer MB-FIP and primer MB-BIP
Composition；
The primer sets for being used to identify infectious bovine rhinotrachetis virus are by primer I BRV-F3, primer I BRV-B3, primer
IBRV-FIP and primer I BRV-BIP compositions；
The primer MB-F3 is a1) or a2)：
A1) the single strand dna in sequence table shown in sequence 1；
A2 sequence 1 by 1 or the substitution of several nucleotides and/or missing and/or addition and) had into identical work(with sequence 1
The DNA molecular of energy；
The primer MB-B3 is a3) or a4)：
A3) the single strand dna in sequence table shown in sequence 2；
A4 sequence 2 by 1 or the substitution of several nucleotides and/or missing and/or addition and) had into identical work(with sequence 2
The DNA molecular of energy；
The primer MB-FIP is a5) or a6)：
A5) the single strand dna in sequence table shown in sequence 3；
A6 sequence 3 by 1 or the substitution of several nucleotides and/or missing and/or addition and) had into identical work(with sequence 3
The DNA molecular of energy；
The primer MB-BIP is a7) or a8)：
A7) the single strand dna in sequence table shown in sequence 4；
A8 sequence 4 by 1 or the substitution of several nucleotides and/or missing and/or addition and) had into identical work(with sequence 4
The DNA molecular of energy；
The primer I BRV-F3 is a9) or a10)：
A9) the single strand dna in sequence table shown in sequence 5；
A10 sequence 5 by 1 or the substitution of several nucleotides and/or missing and/or addition and) had into identical work(with sequence 5
The DNA molecular of energy；
The primer I BRV-B3 is a11) or a12)：
A11) the single strand dna in sequence table shown in sequence 6；
A12 sequence 6 by 1 or the substitution of several nucleotides and/or missing and/or addition and) had into identical work(with sequence 6
The DNA molecular of energy；
The primer I BRV-FIP is a13) or a14)：
A13) the single strand dna in sequence table shown in sequence 7；
A14 sequence 7 by 1 or the substitution of several nucleotides and/or missing and/or addition and) had into identical work(with sequence 7
The DNA molecular of energy；
The primer I BRV-BIP is a15) or a16)：
A15) the single strand dna in sequence table shown in sequence 8；
A16 sequence 8 by 1 or the substitution of several nucleotides and/or missing and/or addition and) had into identical work(with sequence 8
The DNA molecular of energy.
2. primer set according to claim 1, it is characterised in that：
5 ' the end connection fluorophor A of the primer MB-FIP；
5 ' the end connection fluorophor B of the primer I BRV-FIP.
3. primer set according to claim 2, it is characterised in that：
5 ' the end connection fluorophor CY5.5 of the primer MB-FIP；
5 ' the end connection fluorophor FITC of the primer I BRV-FIP.
4. following b1) or b2) shown in product：
B1 the PCR reagent) containing any described primer set in claims 1 to 3；
B2) containing any described primer set or b1 in claims 1 to 3) described in PCR reagent kit.
5. any described primer set or product described in claim 4 are in following c1 in claims 1 to 3)~c6) in appoint
A kind of application in：
C1 Mycoplasma bovis and infectious bovine rhinotrachetis virus) are differentiated；
C2 the product for differentiating Mycoplasma bovis and infectious bovine rhinotrachetis virus) is prepared；
C3) detect whether pathogenic microorganism to be measured is Mycoplasma bovis or infectious bovine rhinotrachetis virus；
C4) prepare and detect whether pathogenic microorganism to be measured is Mycoplasma bovis or the product of infectious bovine rhinotrachetis virus；
C5) whether detection testing sample infects Mycoplasma bovis and/or infectious bovine rhinotrachetis virus；
C6) prepare whether detection testing sample infects Mycoplasma bovis and/or the product of infectious bovine rhinotrachetis virus.
6. a kind of method for differentiating Mycoplasma bovis and infectious bovine rhinotrachetis virus, comprises the following steps：
Using viral nucleic acid to be measured as template, duplex fluorescent PCR is carried out using the primer set described in claim 1, obtains PCR
Product；Mycoplasma bovis and infectious bovine rhinotrachetis virus are differentiated according to the PCR primer：
If being able to detect that the amplified production with fluorescence corresponding to fluorophor A, virus to be measured is Mycoplasma bovis；
If being able to detect that the amplified production with fluorescence corresponding to fluorophor B, virus to be measured is ox infectious rhinotracheitis
Scorching virus.
7. it is a kind of detect pathogenic microorganism to be measured whether be Mycoplasma bovis or infectious bovine rhinotrachetis virus method, including such as
Lower step：Using the nucleic acid of pathogenic microorganism to be measured as template, bifluorescence is carried out using the primer set described in claim 1
RT-PCR, obtain PCR primer；Judge whether pathogenic microorganism to be measured is Mycoplasma bovis or ox infectiousness according to the PCR primer
Rhinotracheitis virus：
If being able to detect that the amplified production with fluorescence corresponding to fluorophor A, pathogenic microorganism to be measured is Mycoplasma bovis；
If being able to detect that the amplified production with fluorescence corresponding to fluorophor B, pathogenic microorganism to be measured is ox infectiousness
Rhinotracheitis virus；
If it is unable to detect that with the amplified production of fluorescence corresponding to fluorophor A and can not detects with fluorophor B
The amplified production of corresponding fluorescence, then pathogenic microorganism to be measured is non-Mycoplasma bovis and non-infectious bovine rhinotrachetis virus.
8. a kind of method for detecting testing sample and whether infecting Mycoplasma bovis and/or infectious bovine rhinotrachetis virus, including such as
Lower step：Using the nucleic acid of pathogenic microorganism to be measured as template, bifluorescence is carried out using the primer set described in claim 1
PCR, obtain PCR primer；Judge whether testing sample infects Mycoplasma bovis and/or ox infectiousness nose gas according to the PCR primer
The scorching virus of pipe：
If being able to detect that the amplified production with fluorescence corresponding to fluorophor A, testing sample infection Mycoplasma bovis；
If being able to detect that the amplified production with fluorescence corresponding to fluorophor B, testing sample infected cattle infectiousness nose gas
The scorching virus of pipe；
If it is able to detect that with the amplified production of fluorescence corresponding to fluorophor A and is able to detect that with B pairs of fluorophor
The amplified production for the fluorescence answered, then testing sample simultaneously infect Mycoplasma bovis and infectious bovine rhinotrachetis virus；
If it is unable to detect that with the amplified production of fluorescence corresponding to fluorophor A and can not detects with fluorophor B
The amplified production of corresponding fluorescence, then testing sample be uninfected by Mycoplasma bovis and infectious bovine rhinotrachetis virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710904818.XA CN107447056B (en) | 2017-09-29 | 2017-09-29 | Complete set of primers for identifying mycoplasma bovis and infectious rhinotracheitis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710904818.XA CN107447056B (en) | 2017-09-29 | 2017-09-29 | Complete set of primers for identifying mycoplasma bovis and infectious rhinotracheitis and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107447056A true CN107447056A (en) | 2017-12-08 |
| CN107447056B CN107447056B (en) | 2020-10-20 |
Family
ID=60497473
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710904818.XA Active CN107447056B (en) | 2017-09-29 | 2017-09-29 | Complete set of primers for identifying mycoplasma bovis and infectious rhinotracheitis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107447056B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116103447A (en) * | 2023-03-02 | 2023-05-12 | 北京芯之悦生物技术中心(有限合伙) | LAMP primer combination, typing and application for detecting five pathogens of bovine respiratory system |
| CN116254373A (en) * | 2023-03-01 | 2023-06-13 | 宁夏大学 | RPA primer pair, kit and detection method for detecting bovine rhinotracheitis virus |
| CN117778598A (en) * | 2023-11-29 | 2024-03-29 | 宁夏农林科学院动物科学研究所(宁夏草畜工程技术研究中心) | LAMP primer group for detecting mycoplasma bovis and detection method thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754911A (en) * | 2017-03-22 | 2017-05-31 | 广西壮族自治区兽医研究所 | Primer sets and its application for identifying Mycoplasma bovis, bovine viral diarrhea virus and infectious bovine rhinotrachetis virus |
| CN106868215A (en) * | 2017-03-22 | 2017-06-20 | 广西壮族自治区兽医研究所 | Primer sets and its application for identifying Mycoplasma bovis and infectious bovine rhinotrachetis virus |
| CN106893787A (en) * | 2017-04-20 | 2017-06-27 | 广西壮族自治区兽医研究所 | Differentiate bifluorescence RT LAMP detection primers group, kit and its application of foot and mouth disease virus and vesicular stomatitis virus |
| CN106987657A (en) * | 2017-04-21 | 2017-07-28 | 广西壮族自治区兽医研究所 | For differentiating that the primer of bovine viral diarrhea virus and bovine rota is combined and its applied |
-
2017
- 2017-09-29 CN CN201710904818.XA patent/CN107447056B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754911A (en) * | 2017-03-22 | 2017-05-31 | 广西壮族自治区兽医研究所 | Primer sets and its application for identifying Mycoplasma bovis, bovine viral diarrhea virus and infectious bovine rhinotrachetis virus |
| CN106868215A (en) * | 2017-03-22 | 2017-06-20 | 广西壮族自治区兽医研究所 | Primer sets and its application for identifying Mycoplasma bovis and infectious bovine rhinotrachetis virus |
| CN106893787A (en) * | 2017-04-20 | 2017-06-27 | 广西壮族自治区兽医研究所 | Differentiate bifluorescence RT LAMP detection primers group, kit and its application of foot and mouth disease virus and vesicular stomatitis virus |
| CN106987657A (en) * | 2017-04-21 | 2017-07-28 | 广西壮族自治区兽医研究所 | For differentiating that the primer of bovine viral diarrhea virus and bovine rota is combined and its applied |
Non-Patent Citations (3)
| Title |
|---|
| SACHIN S. PAWAR ET AL: "Rapid detection of bovine herpesvirus 1 in bovine semen by loop-mediated isothermal amplification (LAMP) assay", 《ARCH VIROL》 * |
| YUMIKO HIGA ET AL: "An improved loop-mediated isothermal amplification assay for the detection of Mycoplasma bovis", 《J. VET. MED. SCI.》 * |
| 侯轩等: "牛支原体的环介导等温扩增快速检测技术研究", 《农业生物技术学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116254373A (en) * | 2023-03-01 | 2023-06-13 | 宁夏大学 | RPA primer pair, kit and detection method for detecting bovine rhinotracheitis virus |
| CN116103447A (en) * | 2023-03-02 | 2023-05-12 | 北京芯之悦生物技术中心(有限合伙) | LAMP primer combination, typing and application for detecting five pathogens of bovine respiratory system |
| CN117778598A (en) * | 2023-11-29 | 2024-03-29 | 宁夏农林科学院动物科学研究所(宁夏草畜工程技术研究中心) | LAMP primer group for detecting mycoplasma bovis and detection method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107447056B (en) | 2020-10-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| Lorusso et al. | Analysis of bluetongue serotype 3 spread in Tunisia and discovery of a novel strain related to the bluetongue virus isolated from a commercial sheep pox vaccine | |
| Koutna et al. | Identification of spring viraemia of carp virus (SVCV) by combined RT-PCR and nested PCR | |
| WO2018014614A1 (en) | Primer combination for simultaneously identifying 8 bovine pathogens, and gexp assay method | |
| CN103160615B (en) | Multiple PCR primer used for simultaneously detecting infectious Bovine Rhinotracheitis virus and akabane virus as well as its design method | |
| Luan et al. | Development of a real-time quantitative RT-PCR to detect REV contamination in live vaccine | |
| CN108796131A (en) | Visualization differentiates bifluorescence RT-LAMP detections group, kit and its application of foot and mouth disease virus and blue tongue virus | |
| CN107447056A (en) | For differentiating primer set and its application of Mycoplasma bovis and infectious bovine rhinotracheitis | |
| CN106893787A (en) | Differentiate bifluorescence RT LAMP detection primers group, kit and its application of foot and mouth disease virus and vesicular stomatitis virus | |
| CN111876527A (en) | African swine fever virus wild strain and vaccine strain identification and detection kit | |
| CN109486972A (en) | A kind of CPA primer sets for detecting pseudomonas aeruginosa, CPA nucleic acid test strip kit and its application | |
| CN107034316A (en) | The system and its special LAMP primer of 6 boars virus are detected simultaneously | |
| CN106754911A (en) | Primer sets and its application for identifying Mycoplasma bovis, bovine viral diarrhea virus and infectious bovine rhinotrachetis virus | |
| CN110408727A (en) | A kind of CPA primer sets, CPA nucleic acid test strip kit and its application detecting J subgroup avian leucosis virus | |
| CN104946753A (en) | Specificity primer pair for cow mycoplasma detection, detection kit, as well as using method and application of detection kit | |
| CN101392299B (en) | Equine influenza detection kit and detection method | |
| CN102586487B (en) | Double fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit for duck hepatitis virus I and Muscovy duck parvovirus | |
| CN100402663C (en) | Nucleotide sequence for detecting newcastle disease virus, kit and detection method thereof | |
| CN102337250B (en) | Infectious bovine rhinotracheitis virus strain and preparation method and application thereof | |
| CN106987657A (en) | For differentiating that the primer of bovine viral diarrhea virus and bovine rota is combined and its applied | |
| CN106636468A (en) | Primer combination capable of identifying enterovirus type 71 and application of primer combination | |
| Kim et al. | Validation of a novel one-step reverse transcription polymerase chain reaction method for detecting viral haemorrhagic septicaemia virus | |
| KR101411412B1 (en) | Primer for the diagnosis of the new influenza a virus, probe, kit comprising same, and diagnosis method using the kit | |
| KR101729977B1 (en) | Compositions for detecting swine influenza virus and method for detecting swine influenza virus using the same | |
| WO2021255787A1 (en) | Sars-cov-2 detection primer set, sars-cov-2 testing method, and sars-cov-2 test reagent and test kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |