KR101411412B1 - Primer for the diagnosis of the new influenza a virus, probe, kit comprising same, and diagnosis method using the kit - Google Patents

Abstract

The present invention relates to a method for diagnosing a H1N1 subtype virus of a type A influenza A type H1N1 subtype virus (2009 H1N1 influenza virus) using a primer and a probe specific to the gene of the 2009 H1N1 influenza virus, using the primer and the probe, More particularly, the present invention relates to a diagnostic kit comprising a primer, an internal control and a primer for simultaneously diagnosing a gene of the H1N1 subtype virus of a swine influenza type A by a polymerase chain reaction, and a diagnostic method using the kit. Using the primers and probes of the present invention, it is possible to quickly and accurately detect new influenza A type H1N1 subtype virus without cross-reacting with existing human influenza A type H1N1 virus, A dried kit can be manufactured in which the skill of the inspector is not required.

Description

Primer for the diagnosis of new influenza type A virus, a probe, a kit containing the same, and a diagnostic method using the kit {PRIMER FOR THE DIAGNOSIS OF THE NEW INFLUENZA A VIRUS, PROBE, KIT COMPRISING SAME, AND DIAGNOSIS METHOD USING THE KIT}

The present invention uses a kit including oligonucleotides for diagnosis of a new human influenza A type H1N1 subtype virus, a primer, a probe, and an internal control thereof, and based on a real-time polymerase chain reaction, the new influenza A type H1N1 subtype virus It relates to a virus detection method that can be used to diagnose the presence or absence of infection.

The influenza virus is a representative virus that causes respiratory diseases in the human body and is largely divided into type A and type B. Since it was first discovered in Mexico in the spring of 2009, the worldwide swine flu is a human influenza type A. The subtype is HA (hemagglutinin) protein type 1 (H1) and NA (neuraminidase) protein type 1 (N1). It is an Influenza A (H1N1) virus (hereinafter, the swine influenza A virus is referred to as '2009 H1N1 influenza virus'). The 2009 H1N1 influenza virus is a virus in which the genetic material of influenza viruses derived from humans, pigs, and birds is mixed. Pigs are called "mixing vessels" and are often mixed with the genes of influenza virus to create new strains. In some cases, it was first named swine influenza, but there is no evidence that it has been directly transmitted from infected pigs to humans or from infected people to pigs or is related to swine, so the World Health Organization (WHO) swine influenza A (H1N1). I decided to call it. As a result of analyzing the base sequence of the 2009 H1N1 influenza virus, once the HA gene has a sequence that infects humans, it is possible to infect humans, and there is no dibasic amino acid in the HA gene, which is a characteristic of a highly pathogenic virus, and amantadine. (amantadine) and rimantadine drug resistance genes. In addition, the NS1 and PB2 genes were also found to be viruses that did not have pathogenic mutations, and it was analyzed that the possibility of high pathogenicity was not high.

According to the WHO report, the infection status of the 2009 H1N1 influenza virus was about 10,000 cases reported in 40 countries, including Korea, until May 19, 2009, and about 80 people died. In Korea, 4 confirmed patients were reported, and no death cases were reported. The World Health Organization has designated the pandemic stage 5 as a pandemic, and governments have declared a state of emergency and are trying to control the spread of the virus around the world. In Korea, the Ministry of Health, Welfare and Family Affairs and the Centers for Disease Control and Prevention stipulate that if a patient or suspected patient with the 2009 H1N1 influenza virus is detected, it is required to immediately report and report it.

The 2009 H1N1 influenza virus is transmitted through the respiratory tract, and is known to be highly infectious than the existing influenza A virus. The symptoms of infection are similar to those of colds such as high fever and cough, just like those of the existing influenza virus. To spread the infection, personal hygiene such as washing your hands and wearing a mask can help prevent the spread. For the treatment of infection, the use of antiviral drugs such as Tamiflu or Relenza is recommended.

Fast and accurate detection is required for rapid treatment of patients infected with the 2009 H1N1 influenza virus. WHO recommends a conventional culture method and a diagnostic method using real-time polymerase chain reaction for confirmation of infection. Virus cultivation method requires a lot of time and skilled experts, and has the disadvantage that false negatives are likely to occur, so real-time polymerase chain reaction diagnostics can be considered suitable for the primary diagnostic purpose. The 2009 H1N1 influenza virus was cultured from infected patients and subjected to gene sequence analysis, and several types of subtypes have been reported. In order to minimize the possibility of false negative, it is necessary to design primers and probes to detect all subtypes of 2009 H1N1 influenza virus reported to date. Recently, the US CDC has disclosed real-time polymerase chain reaction protocols, primers, and probe sequences that cannot be used for commercial purposes, but can be used for detection of 2009 H1N1 influenza virus in related institutions and hospitals. As a result of bioinformatics sequence analysis, only a few of the reported subtypes can be detected with primers and probes published by the US CDC, and in many cases, they could not be detected theoretically. In addition, the 2009 H1N1 influenza virus detection protocol announced by the US CDC requires mixing and dispensing several types of solutions in the early stages of the reaction, so there is a high possibility of an incorrect result judgment due to an inspector's error during the test process. In addition, since the product is in the form of a solution, it is difficult to store and use for a long period of time. For the above reasons, since it is difficult to effectively test a large number of people using the above kit, there is a need to develop primers and probes that are more effective and capable of detecting as many subtypes as possible.

Accordingly, the present inventors designed a novel primer and probe specific for the 2009 H1N1 influenza virus, and performed real-time polymerase chain reaction using the primers, probes, and kits containing the same, compared to the previous methods. Influenza virus RNA can be detected quickly and accurately, and by drying the polymerase chain reaction mixture required for the reaction, it was confirmed that the storage period can be improved while maintaining the performance equal to the mixture solution in a solution state, and the present invention was completed. I did.

The present invention was conceived by the above necessity, and an object of the present invention is to provide a primer and a probe for diagnosing 2009 H1N1 influenza virus RNA used in real-time polymerase chain reaction.

Another object of the present invention is a kit for detecting 2009 H1N1 influenza virus RNA without cross-reacting with the existing human influenza A (H1N1) virus, and all reagents required for polymerase chain reaction are mixed, dispensed, and It is to provide a kit for diagnosing 2009 H1N1 influenza virus RNA, which is dried and does not require the skill of an examiner for use.

Another object of the present invention is to provide a rapid and accurate method for diagnosing 2009 H1N1 influenza virus RNA.

In order to achieve the above object, the present invention provides primers and probes necessary to detect 2009 H1N1 influenza virus RNA through real-time polymerase chain reaction.

In the real-time polymerase chain reaction of the present invention, the reaction result is monitored in real time by using an oligonucleotide probe in which a primer and a fluorescent substance are chemically bound. In the process of polymerase chain reaction, this probe binds to the complementary sequence in the sample's nucleic acid, like two primers, and the binding site is a little away from the primers. The probe of the present invention has a structure in which a reporter and a fluorescent substance called a quencher are attached at both ends, and when the reporter and the quencher are in close proximity, the fluorescence of the reporter is canceled and the fluorescence of the reporter is not detected, but amplification proceeds. According to this, when the reporter is separated from the quencher, the reporter's fluorescence is detected. Therefore, the intensity of fluorescence gradually increases as the amplification cycle increases.

The present inventors independently designed primers and probes in a specific sequence of the HA gene of 2009 H1N1 influenza virus in order to detect various subtypes of 2009 H1N1 influenza virus compared to existing real-time polymerase chain reaction products. Self-designed primers and probes are designed so that there is no cross-reaction with the existing human influenza A (H1N1) virus.

The primer and probe sequences of the present invention are 2009 H1N1 influenza virus, preferably 2009 H1N1 influenza virus (Influenza A virus (A/California/04/2009(H1N1)) HA gene (GeneBank accession number; FJ966082) described in SEQ ID NO: 6. ), or a part of its complementary nucleotide sequence, and more preferably consists of 18 to 30 nucleotide sequences within the 200th to 540th bases of the nucleotide sequence described in SEQ ID NO: 6. Since a lot of mutations occur in bases 200 to 540 of the described nucleotide sequence compared to conventional influenza virus A, the efficiency of specifically detecting only the 2009 H1N1 influenza virus is highest, particularly preferably SEQ ID NO: 1 and sequence. It is a forward primer that is a nucleotide sequence represented by number 2 and a reverse primer that is a base sequence represented by SEQ ID NO: 3 and SEQ ID NO: 4. In addition, the probe is preferably represented by SEQ ID NO: 5, and is a forward probe.

The primers and probes can be any combination if they are composed of 2 primers (1 forward, 1 reverse) and 1 probe, but preferably the 2009 H1N1 influenza virus is a forward primer represented by SEQ ID NO: 1, SEQ ID NO: 3 It is possible to use a reverse primer described as and a forward probe described in SEQ ID NO: 5 (see FIG. 1). The primer of the present invention can be used not only for real-time polymerase chain reaction, but also for general polymerase chain reaction. It is preferable to use FAM (6-carboxyfluorescein) as a reporter of the 2009 H1N1 influenza virus probe and BHQ1 as a quencher, but the present invention is not limited thereto.

As a result of comparing the genes that 100% match at the same time with the primers (SEQ ID NO: 1 and SEQ ID NO: 3) and probe (SEQ ID NO: 5) of the present invention, all the sequences of the 2009 H1N1 influenza virus subtype reported so far were searched. (See Fig. 1), there was no cross-reaction with the existing influenza A (H1N1) virus (see Fig. 2).

In addition, the present invention provides a method for detecting 2009 H1N1 influenza virus, characterized in that polymerase chain reaction or real-time polymerase chain reaction is performed using the primers and probes of the present invention using a sample as a template.

According to the detection method of the present invention, even if a very small amount of 2009 H1N1 influenza virus is present in the sample due to its high sensitivity, in particular, in the case of real-time polymerase chain reaction, it is possible to immediately observe whether amplification is in progress. Since a separate amplification product identification step is not required, detection time can be reduced. In the polymerase chain reaction or real-time polymerase chain reaction, it is preferable to additionally use an internal positive control (hereinafter referred to as'IPC'), but is not limited thereto. During the polymerase chain reaction, it is possible to easily check whether or not PCR was performed well by preparing the IPC template and a primer suitable for it and putting them together. In addition, the specimen may be obtained from a clinical sample or an environmental sample, but is not limited thereto.

In addition, the present invention provides a kit for detecting 2009 H1N1 influenza virus comprising the primer or probe.

The kit includes an amplification buffer solution, dNTP, control, detection reagent, etc. in addition to the primers or probes of the present invention, and is provided in a dry state, and may contain additional components depending on the purpose only when there is no effect on the reaction. . The kit provided in a dry state can be used for a long period of time due to improved storage stability, and an accurate quantitative value can be obtained within a faster time.

Using the primers, probes, and detection methods of the present invention, the 2009 H1N1 influenza virus gene can be detected quickly and easily, and the sensitivity is high, and even the very low concentration of the 2009 H1N1 influenza virus present in the sample can be accurately detected. In addition, through the development of the 2009 H1N1 influenza virus RNA diagnosis kit of the present invention, it is expected that accurate diagnosis in the early stages of infection will be possible, and it will contribute greatly to early diagnosis of the 2009 H1N1 influenza virus and prevention of further spread through the distribution of a wide range of kits at home and abroad. It is expected.

1 shows a part of the nucleotide sequence of the 2009 H1N1 influenza virus (A/California/04/2009 (H1N1)) HA gene (GeneBank accession number; FJ966082) registered in NCBI, and part of the nucleotide sequence of the HA gene or its The primers and probes of the present invention, which are composed of a part of the complementary nucleotide sequence, are 100% matched with the 2009 H1N1 influenza virus nucleotide sequence registered in the NCBI.
Figure 2 shows the result of comparing the nucleotide sequence of the 2009 H1N1 influenza virus registered in NCBI with the existing influenza A (H1N1) virus nucleotide sequence, the primers of the present invention (SEQ ID NO: 1 and SEQ ID NO: 3) and probe (SEQ ID NO: The parts that match 5) 100% are marked in black.
3 is a graph showing the results of an optimized set by combining the forward and reverse primer sets of the present invention.
4 is a graph showing the results of testing optimal concentrations of forward and reverse primers for a predetermined set of primers No. 1.
5 is a graph showing the results of testing the optimal concentration of the probe represented by SEQ ID NO: 5 with respect to the first set.
6 is a graph showing the experimental results of a real-time reverse transcription polymerase reaction in a standard template using a dry-type polymerase chain reaction composition. In graph A, the blue line represents IPC, and the detected cycle value is the same within ±1 error range, and the black line represents the loading value of the H1N1 virus RNA template by concentration. Graph B shows graph A as a standard graph, ^{and the closer the R 2} value is to 1, the closer the efficiency is to 100%, the higher the PCR efficiency. Table C is a numerical representation of the value of the A graph, indicating that ^{when the amount of H1N1 flu RNA, which is a positive control, is 10 7} , the signal can be seen even by running only about 19.76 cycles of Realtime PCR.
7 is a graph showing experimental results of real-time reverse transcription polymerase chain reaction for positive samples. In graph A, the blue line represents the IPC signal, and the black line represents the swine flu positive control. The B graph is a combination of the C and D graphs. In the B and C graphs, the black line represents the signal from actual H1N1 influenza samples, and the blue line represents the IPC signal.
8 is a graph showing experimental results of real-time reverse transcription polymerase chain reaction for negative samples. The blue line represents the IPC signal, and the black line represents the H1N1 signal, and since it is a negative sample, it was confirmed that amplification of the black line, which is a H1N1 signal, did not appear.
9 is a graph showing the results of comparing the performance of the primer/probe for detecting swine flu and the primer/probe of the present invention presented by the US Centers for Disease Control and Prevention (CDC).
10 is a graph showing the experimental results of a real-time reverse transcription polymerase chain reaction according to a position change of a quencher of a probe. In graph A, the blue line represents the IPC, and the black line represents the loading value of the H1N1 virus RNA template by concentration. The B graph represents the A graph as a standard graph, and the C table represents the numerical value of the A graph.
11 is a graph showing the result of confirming that the cross-reaction of the existing influenza A does not occur as a result of experimenting with a standard template real-time reverse transcription polymerase reaction using the polymerase chain reaction composition of the present invention. H1N1 sample, B graph shows H3N2 sample, C graph shows influenza B sample, and D graph shows the results for 2009 H1N1 influenza virus (swine flu) sample.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

Example 1. Mold RNA Produce

First, a template DNA was prepared for carrying out real-time polymerase chain reaction. The 2009 H1N1 influenza virus was first registered on April 27, 2009 among the 2009 H1N1 influenza virus registered in the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov). California/04/2009 (H1N1)) HA gene (GeneBank accession number; FJ966082, SEQ ID NO: 6) was synthesized by gene synthesis method ( Biochem . Biophys . Res . Commun . 1998, 248, 200-203), respectively, and the Some of them were cloned into pGEM-T-Easy Vector (Cat: A1360, manufactured by Promega, USA). Specifically, 5 μl of 2X rapid ligation buffer (promega, USA), 1 μl of T-Easy Vector (promega, USA), 1 μl of T4 DNA ligase (promega, USA), 3 μl of gene synthesis material (manufactured by Promega, USA) 8 ng) was put in the same tube and mixed, and then placed at a constant temperature for 1 hour at 37°C. Then, 5 µl of the reaction solution placed at a constant temperature was added to 50 µl of E. coli competent cells, placed on ice for 30 minutes, incubated at 42° C. for 90 seconds, and placed on ice for 2 minutes. The reaction solution was inoculated on an LB plate containing ampicillin, IPTG, and X-Gal, followed by incubation at 37° C. for 16 hours.

Take white colonies, incubate in LB liquid medium for about 16 hours, centrifuge to discard the supernatant, and Accuprep Plasmid DNA was extracted from the pellet using a plasmid DNA prep kit (manufactured by Bieer, Korea). After measuring the concentration and purity of the plasmid DNA with a UV spectrometer (manufactured by Shimazu, Japan), it was confirmed that the purity was between 1.8 and 2.0, and MAXIsciptPlasmid DNA was transcribed into RNA using an in vitro transcription kit (manufactured by Ambion, USA). After transcription, the concentration and purity were measured with a UV spectrometer, and if the purity was between 1.8 and 2.0, it was used as a template RNA in the subsequent real-time polymerase chain reaction. The RNA copy number was calculated by the formula below.

6.02×10 ²³ ×concentration (concentration g/ml measured by UV spectrometer)/(3,015+340)×340

[3,015 bp: size of T-easy vector, 340 bp: size of 2009 H1N1 influenza virus template RNA]

After calculating the number of copies of the template RNA, it was diluted in decimal with 1X TE buffer (10mM Tris-HCl pH 8.0, 0.1mM EDTA) and stored at -70°C until use.

Example 2. primer And Probe design

2009 H1N1 influenza virus (A/California/04/2009(H1N1)) HA gene (GeneBank accession number; FJ966082, SEQ ID NO: 6) between base sequences 200 and 540, length 18-25 bp, Tm value 55 The base sequence was arbitrarily selected so that the temperature ranged from °C to 60 °C to obtain the forward and reverse primers. In addition, between nucleotide sequences 200 to 540, lengths between 20 and 25 bp, and Tm values between 67 and 72°C, a nucleotide sequence was arbitrarily selected as a probe, and the Tm value was checked using the Primer3Plus program. As a result, primers and probes shown in Table 1 below were designed.

Base sequence Sequence number Forward primer GGCTGGATCCTGGGAAATC One GATCCTGGGAAATCCAGAGTG 2 Reverse primer TCGATGAAATCTCCTGGGTAAC 3 TTGCTCTCTTAGCTCCTCATAATC 4 TaqMan probe
(Forward direction) ACTCTCCACAGCAAGCTCATGGTCC 5

Example 3. Standard mold real time Reverse transcription Polymerase chain reaction

First, after combining the 2009 H1N1 influenza virus primer and all probes as a set, real-time reverse transcription polymerase chain reaction was performed using ^{Exicycler TM Quantitative Thermal Block (Bionia, Korea).}

The RNA of the 2009 H1N1 influenza virus prepared in Example 1 was used as a template, and several sets of 2009 H1N1 influenza virus primers designed in Example 2 were each combined (Table 2). Using Exicycler ^TM Quantitative Thermal Block (manufactured by Bioneer, Korea), real-time reverse transcription polymerase chain reaction was performed by adding SYBR Green (staining reagent for nucleic acid detection), DW and 2009 H1N1 influenza virus template. CDNA was synthesized by reacting at 45° C. for 15 minutes, denatured at 95° C. for 5 minutes, and then 45 cycles were reacted at 95° C. for 5 seconds and 55° C. for 5 seconds each. As a result, it was found that set 1 was the most optimized set (Fig. 3). In Fig. 3A, three experimental graphs are shown, and in B, the results of numerical analysis are shown. Using the 2009 H1N1 influenza virus prepared in Example 1 as a template and diluting by concentration to show the detection limit, all three sets showed the detection limit of the same concentration (10 copies), and the number of cycles detected was 34-37, respectively. It was different between Ct. When looking at the efficiency of the polymerase chain reaction, the efficiency of set 1 was 95%. When the virus template was diluted by concentration and a standard graph was drawn using the detected cycle value, the closer the value representing the straight line of the graph was to 1, the better. All three sets had a value of 0.999 or more and showed equivalence.

Next, the selected primer concentration was combined differently, and a process was performed to verify the optimized primer concentration combination condition using SYBR Green (a dyeing reagent for nucleic acid detection). As a result, with 15 pmoles of primers of SEQ ID NO: 1 and 20 pmoles of primers of SEQ ID NO: 3, the sensitivity of the detectable virus copy number was 10 copies, and the efficiency of real-time reverse transcription polymerase chain reaction was 91%. Standard template When a standard graph of real-time reverse transcription polymerase chain reaction is made, the slope is -2.81, R² The value was 0.9988 (Fig. 4). Where R² Is a correlation coefficient representing the linearity of the graph when drawing a standard graph of real-time polymerase chain reaction. The closer to 1 (closer to the straight line), the polymerase chain reaction proceeded properly.

Sequence number Set 1 Set 2 Set 3 Forward direction One 2 One Reverse 3 3 4

Example 4. Standard mold real time Reverse transcription Polymerase chain reaction

Using the primers of SEQ ID NO: 1 and SEQ ID NO: 3 set in Example 3, using a probe that detects a nucleic acid of a specific sequence instead of a reagent for non-specific nucleic acid staining using concentration conditions (15 pmoles in the forward direction and 20 pmoles in the reverse direction). By varying the conditions for each probe concentration, an optimized probe concentration condition establishment process was performed. 10X RT Buffer 5 µl, MMLV 600U, wTfi 5unit, dNTP 20mM 3 µl, DTT 50mM, RNasin 15U, stabilizer, optimized concentration of primer, probe (different by concentration), etc. 2009 H1N1 influenza virus RNA prepared in Example 1 And internal control RNA as a template, and put it in one tube so that the total volume was 50 µl with DW to perform real-time reverse transcription polymerase chain reaction. This was subjected to a reverse transcription reaction at 45° C. for 15 minutes, then denatured at 95° C. for 5 minutes, and then reacted for 45 cycles at 95° C. for 5 seconds and 55° C. for 5 seconds.

When the concentration of the probe was 10 pmole and 20 pmole, the polymerase chain reaction efficiency was the best at 96% at 15 pmole, the number of detectable RNA copies was 100, and the standard template real-time reverse transcription polymerase chain reaction When the standard graph of is written, the slope is -2.91, R ² The value was 0.9974 (Fig. 5).

Example 5. Standard template real - time reverse transcription polymerase chain reaction using dry type polymerase chain reaction composition

In order to provide a kit for diagnosing 2009 H1N1 influenza virus RNA with improved convenience and reproducibility, and confirming that the performance of the polymerase chain reaction mixture in a solution state is not affected by drying conditions, After preparing a real-time polymerase chain reaction mixture, a dried product was prepared, and a real-time reverse transcription polymerase chain reaction was performed with ^{an Exicycler TM Quantitative Thermal Block (manufactured by Bioneer, Korea).} Specifically, 10X RT Buffer 5 µl, MMLV 600U, wTfi 5unit, dNTP 20 mM 3 µl, DTT 50mM, RNasin 15U, stabilizer, etc. were put in one tube, DW was added, and the total volume was mixed so that the total volume was 25 µl, and then 96-well It was dispensed on a plate, and dried for 50 to 60 minutes using SuperCentra2 (manufactured by Bioneer, Korea). Thereafter, the primers represented by SEQ ID NO: 1 and SEQ ID NO: 3 selected in Examples 3 and 4, IPC primers (Bionia Co., Ltd.) and the probe represented by SEQ ID NO: 5 were mixed to a total volume of 5 µl. It was further dispensed to the first dried product and dried for 25 to 30 minutes. To the dried polymerase chain reaction composition, 5 µl of 2009 H1N1 influenza virus RNA prepared in Example 1 was added as a template, 1 µl of internal positive control RNA was added, and the total volume was dispensed with DW so that the total volume was 50 µl. Mix thoroughly to loosen. Real-time reverse transcription polymerase chain reaction of 45 cycles was performed under the same conditions as in Example 4 using Exicycler ^{TM Quantitative Thermal Block (manufactured by Bioneer, Korea).} As a result, the 2009 H1N1 influenza virus template RNA was stably detectable up to a minimum of 100 copies, and when a standard graph of real-time reverse transcription polymerase chain reaction with a standard template was prepared, the slope was -3.0, R ² The value was 0.9996 (Fig. 6).

From the above results, it can be seen that equivalent performance is maintained in the two methods using a polymerase chain reaction mixture in a solution state and a real-time reverse transcription polymerase chain reaction using a dry mixture.

Example 6. Real-time for positive samples Reverse transcription Polymerase chain reaction

Using the primer/probe set for detecting 2009 H1N1 influenza virus of the present invention, a real-time reverse transcription polymerase chain reaction was performed with the method of Example 5 on 15 swine flu-positive specimens.

As a result, it was confirmed as positive for all 15 specimens, indicating 100% accuracy (FIG. 7).

Example 7. For negative samples About real time Reverse transcription Polymerase chain reaction

Using the primer/probe set for detecting 2009 H1N1 influenza virus of the present invention, a real-time reverse transcription polymerase chain reaction was performed by the method of Example 5 with respect to 15 H1N1 negative samples.

As a result, all 15 specimens were identified as negative, indicating 100% accuracy (FIG. 8).

Comparative Example 1. U.S. Centers for Disease Control and Prevention (Centers for Disease Control and Prevention , CDC), the performance comparison of the primer/probe for detecting swine flu and the primer/probe of the present invention

Real-time reverse transcription according to the conditions suggested by the US Centers for Disease Control and Prevention using a primer/probe set suggested by the US Centers for Disease Control and Prevention, and a set of primers for SEQ ID NOs: 1 and 3 of the present invention, and a probe set for SEQ ID NO: 5 Polymerase chain reaction was carried out. The real-time polymerase chain reaction kit used at this time was Invitrogen's SuperScript ^ⓡ Ⅲ Platinum ^ⓡ One-step qRT-PCR Kit, and an ABI 7500 instrument was used.

The sequence of the CDC primer/probe set is shown in Table 3 below, and the primer/probe concentration recommended in the CDC test method was used (40 pmoles of forward and reverse primers were used/10 pmoles of the probe were used). A quencher was added to the 12th nucleotide sequence T of the probe sequence and used. In the case of the primer/probe set of the present invention, the concentration suggested in Example 3 was used. The equipment was subjected to reverse transcription reaction at 50° C. for 30 minutes using ABI 7500, then denatured at 95° C. for 2 minutes, and then reacted for 45 cycles at 95° C. for 15 seconds and 55° C. for 30 seconds each.

As a result, when the primer/probe set of the US Centers for Disease Control and Prevention was used, a Ct value of 28.09 was shown, whereas when the primer and probe set of the present invention was used, a Ct value of 29.97 was shown (FIG. 9). Therefore, it can be seen that a difference of about 2 Ct appears, so that the performance of the primer/probe set of the present invention is more excellent.

CDC primer probe set Sequence number Forward primer GTG CTA TAA ACA CCA GCC TYC TA 7 Reverse primer CGG GAT ATT CCT TAA TCC TGT RGC 8 Probe CA GAA TAT ACA T CC RGT CAC AAT TGG ARA A 9

Example 8. Probe Real-time reverse transcription according to the location of quencher Polymerase chain reaction

The probe used in Example 5 has a structure in which FAM (6-carboxyfluorescein) is attached as a reporter at the 5'end and BHQ1 is attached as a quencher at the 3'end. On the other hand, an inner dT probe with a quencher attached to the fifth nucleotide sequence T of the probe sequence was prepared, and real-time reverse transcription polymerase chain reaction was performed in the same manner as in Example 5. At this time, the nucleotide sequence of the inner dT probe is the same as SEQ ID NO: 5 (Table 4).

As a result, when creating a standard graph of real-time reverse transcription polymerase chain reaction in a standard template, the slope is -3.2, R ² The value was 0.9998 (Fig. 10). From the above results, it was found that almost equivalent performance was maintained in the two methods using a probe with a quencher attached to the 3'end and a probe with a quencher attached to the 5th base sequence T, in real-time reverse transcription polymerase chain reaction. Confirmed.

Sequence number Probe 5 ACTCTCCACAGCAAGCTCATGGTCC inner dT1 probe ACTC T CCACAGCAAGCTCATGGTCC

Example 9. Verification test against existing influenza virus using 2009 H1N1 influenza virus primer

RNA extracted from a sample of a patient, identified through clinical symptoms and gene sequencing, was provided at Guro Hospital, affiliated with Korea University College of Medicine. For the representative samples of influenza A, H1N1 and H3N2 and influenza B samples were verified for cross-reaction with existing influenza by the method of Example 5 using the primers for detecting the 2009 H1N1 influenza virus of the present invention.

As a result, it was confirmed that the primer/probe set for detecting 2009 H1N1 influenza virus of the present invention did not react in the existing influenza sample (FIG. 11).

<110> Bioneer Corporation <120> PRIMER AND PROBE FOR DETECTION OF NEW INFLUENZA A VIRUS, KIT COMPRISING THE SAME, AND DETECTION METHOD USING THE SAME <130> 2014-dpa-0764d <150> KR 10-2009-0046211 <151> 2009-05-26 <160> 9 <170> KopatentIn 1.71 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 2009 H1N1 influenza virus forward primer 1 <400> 1 ggctggatcc tgggaaatc 19 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 2009 H1N1 influenza virus forward primer 2 <400> 2 gatcctggga aatccagagt g 21 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 2009 H1N1 influenza virus reverse primer 1 <400> 3 tcgatgaaat ctcctgggta ac 22 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 2009 H1N1 influenza virus reverse primer 2 <400> 4 ttgctctctt agctcctcat aatc 24 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 2009 H1N1 influenza virus forward probe 1 <400> 5 actctccaca gcaagctcat ggtcc 25 <210> 6 <211> 1701 <212> DNA <213> Influenza A virus (A/California/04/2009(H1N1)) segment 4 hemagglutinin (HA) gene <400> 6 atgaaggcaa tactagtagt tctgctatat acatttgcaa ccgcaaatgc agacacatta 60 tgtataggtt atcatgcgaa caattcaaca gacactgtag acacagtact agaaaagaat 120 gtaacagtaa cacactctgt taaccttcta gaagacaagc ataacgggaa actatgcaaa 180 ctaagagggg tagccccatt gcatttgggt aaatgtaaca ttgctggctg gatcctggga 240 aatccagagt gtgaatcact ctccacagca agctcatggt cctacattgt ggaaacacct 300 agttcagaca atggaacgtg ttacccagga gatttcatcg attatgagga gctaagagag 360 caattgagct cagtgtcatc atttgaaagg tttgagatat tccccaagac aagttcatgg 420 cccaatcatg actcgaacaa aggtgtaacg gcagcatgtc ctcatgctgg agcaaaaagc 480 ttctacaaaa atttaatatg gctagttaaa aaaggaaatt catacccaaa gctcagcaaa 540 tcctacatta atgataaagg gaaagaagtc ctcgtgctat ggggcattca ccatccatct 600 actagtgctg accaacaaag tctctatcag aatgcagata catatgtttt tgtggggtca 660 tcaagataca gcaagaagtt caagccggaa atagcaataa gacccaaagt gagggatcaa 720 gaagggagaa tgaactatta ctggacacta gtagagccgg gagacaaaat aacattcgaa 780 gcaactggaa atctagtggt accgagatat gcattcgcaa tggaaagaaa tgctggatct 840 ggtattatca tttcagatac accagtccac gattgcaata caacttgtca aacacccaag 900 ggtgctataa acaccagcct cccatttcag aatatacatc cgatcacaat tggaaaatgt 960 ccaaaatatg taaaaagcac aaaattgaga ctggccacag gattgaggaa tatcccgtct 1020 attcaatcta gaggcctatt tggggccatt gccggtttca ttgaaggggg gtggacaggg 1080 atggtagatg gatggtacgg ttatcaccat caaaatgagc aggggtcagg atatgcagcc 1140 gacctgaaga gcacacagaa tgccattgac gagattacta acaaagtaaa ttctgttatt 1200 gaaaagatga atacacagtt cacagcagta ggtaaagagt tcaaccacct ggaaaaaaga 1260 atagagaatt taaataaaaa agttgatgat ggtttcctgg acatttggac ttacaatgcc 1320 gaactgttgg ttctattgga aaatgaaaga actttggact accacgattc aaatgtgaag 1380 aacttatatg aaaaggtaag aagccagcta aaaaacaatg ccaaggaaat tggaaacggc 1440 tgctttgaat tttaccacaa atgcgataac acgtgcatgg aaagtgtcaa aaatgggact 1500 tatgactacc caaaatactc agaggaagca aaattaaaca gagaagaaat agatggggta 1560 aagctggaat caacaaggat ttaccagatt ttggcgatct attcaactgt cgccagttca 1620 ttggtactgg tagtctccct gggggcaatc agtttctgga tgtgctctaa tgggtctcta 1680 cagtgtagaa tatgtattta a 1701 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CDC forward primer <400> 7 gtgctataaa caccagccty cta 23 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CDC reverse primer <400> 8 cgggatattc cttaatcctg trgc 24 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> CDC probe <400> 9 cagaatatac atccrgtcac aattggaraa 30

Claims (12)

A primer set for detecting 2009H1N1 influenza virus comprising the nucleotide sequence shown in SEQ ID NO: 1 and SEQ ID NO: 3. The method according to claim 1,
A primer set for detecting 2009 H1N1 influenza virus, further comprising a primer consisting of the nucleotide sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 4. The method according to claim 1 or 2,
A primer set for 2009 H1N1 influenza virus detection, further comprising a probe comprising the nucleotide sequence of SEQ ID NO: 5. The method of claim 3,
A primer set for 2009 H1N1 influenza virus detection, characterized in that the probe has a structure in which a reporter and a quencher are attached. The method of claim 4,
Wherein the reporter is FAM. A primer set for detecting 2009 H1N1 influenza virus. The method of claim 4,
A primer set for 2009 H1N1 influenza virus detection, wherein the quencher is BHQ1. A primer set of the nucleotide sequence shown in SEQ ID NO: 1 and SEQ ID NO: 3 and a probe of the nucleotide sequence shown in SEQ ID NO: 5 are used as a template as the template, and a polymerase chain reaction or real time PCR is carried out 2009 H1N1 influenza virus detection method. The method of claim 7,
A method for detecting 2009 H1N1 influenza virus, characterized in that a polymerase chain reaction or a real-time PCR is performed using an internal positive control. The method of claim 7,
Wherein the specimen is obtained from a clinical sample or an environmental sample. The method of claim 7,
And further comprising a primer consisting of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4. A kit for detecting 2009 H1N1 influenza virus, comprising a primer set of the nucleotide sequence shown in SEQ ID NO: 1 and SEQ ID NO: 3, and a probe of the nucleotide sequence shown in SEQ ID NO: The method of claim 11,
A kit for detecting 2009 H1N1 influenza virus, further comprising a primer consisting of the nucleotide sequence shown in SEQ ID NO: 2 or SEQ ID NO: 4.

Images