CN106191310A - A kind of primer combination simultaneously differentiating 3 kinds of calf diarrhea pathogen and GeXP detection method - Google Patents
A kind of primer combination simultaneously differentiating 3 kinds of calf diarrhea pathogen and GeXP detection method Download PDFInfo
- Publication number
- CN106191310A CN106191310A CN201610569470.9A CN201610569470A CN106191310A CN 106191310 A CN106191310 A CN 106191310A CN 201610569470 A CN201610569470 A CN 201610569470A CN 106191310 A CN106191310 A CN 106191310A
- Authority
- CN
- China
- Prior art keywords
- primer
- sequence
- pathogen
- dna
- bovine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of primer combination simultaneously differentiating 3 kinds of calf diarrhea pathogen and GeXP detection method.III is made up of by the primer combination of the present invention by I, primer by II and primer primer.The present invention also protects and differentiates mouth bovine viral diarrhea virus, bovine rota and the GeXP detection method of enterotoxigenic escherichia coli simultaneously.The GeXP detection method that the present invention sets up can differentiate 3 kinds of calf diarrhea pathogen simultaneously.This method has the advantages that high flux, specificity and sensitivity are higher, can be used for the EPDML monitoring of cattle disease and the Differential Diagnosis of SARS Epidemic, ensures the sound development of cattle-raising.
Description
Technical field
The present invention relates to a kind of primer combination simultaneously differentiating 3 kinds of calf diarrhea pathogen and GeXP detection method.
Background technology
Bovine viral diarrhea virus (Bovine Viral Diarrheal Virus, BVDV), bovine rota (Bovine
Rotavirus, BRV) and enterotoxigenic escherichia coli (Enterotoxigenic E.coli, ETEC) cause calf diarrhea
3 kinds of main pathogens.BVDV in cattle body, often mixes with other pathogen presented in persistence symptomless infection jointly
Infected cattle body, in cows, some cattle is BVDV carrier, and calver can cause birth persistent infection after infecting BVDV
Calf, they lifelong band poison persistently dissipate poison, cause the popular of disease.Bovine rota causes the sickness rate of calf diarrhea to be
60%-80%, mortality rate is 0%-50%.ETEC can produce enterotoxin, causes host's secretory diarrhea, spirit depressed.Water sample
Suffering from diarrhoea, being dehydrated, generate heat is the total clinical symptoms of these 3 kinds of diarrhoeal diseasess, and symptom is quite similar, is difficult to only according to clinical pathological changes trouble
Sick cattle carries out Accurate Diagnosis.Therefore need to set up the method for quick of BVDV, BRV and ETEC, calf diarrhea is carried out quick standard
True ground checkout and diagnosis, the prevention and control for cattle disease provide technical support.
It is a kind of novel high-throughout technique of gene detection that GeXP multi-gene expression analyzes system, by multiple PCR technique
Being effectively combined with capillary electrophoresis technique, (i.e. gene is special to use fluorescent labeling universal primer and specific chimeric primer
Specific primer 5 ' holds connection universal primer sequence) combine thus cause the amplification of multiple system, can be simultaneously to up to 30 mesh
Gene effectively detect analysis, it is achieved high throughput testing truly differentiates the purpose of multiple pathogens.
Summary of the invention
It is an object of the invention to provide a kind of primer combination simultaneously differentiating 3 kinds of calf diarrhea pathogen and GeXP detection side
Method.
The invention provides a kind of primer combination, primer, III is made up of by I, primer by II and primer；
I is made up of by described primer primer BVDV-F and primer BVDV-R；
Described primer BVDV-F is following (a1) or (a2) or (a3):
(a1) single strand dna shown in sequence 1 of sequence table；
(a2) sequence 1 of sequence table is from the DNA molecular shown in the 19th to 36 nucleotide of 5 ' end；
(a3) (a2) or (a3) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and had phase
The DNA molecular of congenerous；
Described primer BVDV-R is following (a4) or (a5) or (a6):
(a4) single strand dna shown in sequence 2 of sequence table；
(a5) sequence 2 of sequence table is from the DNA molecular shown in the 20th to 44 nucleotide of 5 ' end；
(a6) (a4) or (a5) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and had phase
The DNA molecular of congenerous；
II is made up of by described primer primer BRV-F and primer BRV-R；
Described primer BRV-F is following (a7) or (a8) or (a9):
(a7) single strand dna shown in sequence 3 of sequence table；
(a8) sequence 3 of sequence table is from the DNA molecular shown in the 19th to 40 nucleotide of 5 ' end；
(a9) (a7) or (a8) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and had phase
The DNA molecular of congenerous；
Described primer BRV-R is following (a10) or (a11) or (a12):
(a10) single strand dna shown in sequence 4 of sequence table；
(a11) sequence 4 of sequence table is from the DNA molecular shown in the 20th to 37 nucleotide of 5 ' end；
(a12) (a10) or (a11) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had
The DNA molecular of identical function；
III is made up of by described primer primer ETEC-F and primer ETEC-R:
Described primer ETEC-F is following (a13) or (a14) or (a15):
(a13) single strand dna shown in sequence 5 of sequence table；
(a14) sequence 5 of sequence table is from the DNA molecular shown in the 19th to 36 nucleotide of 5 ' end；
(a15) (a13) or (a14) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had
The DNA molecular of identical function；
Described primer ETEC-R is following (a16) or (a17) or (a18):
(a16) single strand dna shown in sequence 6 of sequence table；
(a17) sequence 6 of sequence table is from the DNA molecular shown in the 20th to 40 nucleotide of 5 ' end；
(a18) (a16) or (a17) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had
The DNA molecular of identical function.
The purposes of described primer combination is any one in following (b1) to (b6):
(b1) 3 kinds of calf diarrhea substances are differentiated；
(b2) preparation is for differentiating the test kit of 3 kinds of calf diarrhea substances；
(b3) detect whether pathogen to be measured is bovine viral diarrhea virus, bovine rota or produces enterotoxin large intestine bar
Bacterium；
(b4) preparation is used for detecting whether pathogen to be measured is bovine viral diarrhea virus, bovine rota or produces enterotoxin
Colibacillary test kit；
(b5) whether detection sample to be tested contains bovine viral diarrhea virus and/or bovine rota and/or produces intestinal poison
Element escherichia coli；
(b6) preparation be used for detecting in sample to be tested whether contain bovine viral diarrhea virus and/or bovine rota with/
Or the test kit of enterotoxigenic escherichia coli.
The present invention also protects the application that described primer combines, for any one in following (b1) to (b6):
(b1) 3 kinds of calf diarrhea substances are differentiated；
(b2) preparation is for differentiating the test kit of 3 kinds of calf diarrhea substances；
(b3) detect whether pathogen to be measured is bovine viral diarrhea virus, bovine rota or produces enterotoxin large intestine bar
Bacterium；
(b4) preparation is used for detecting whether pathogen to be measured is bovine viral diarrhea virus, bovine rota or produces enterotoxin
Colibacillary test kit；
(b5) whether detection sample to be tested contains bovine viral diarrhea virus and/or bovine rota and/or produces intestinal poison
Element escherichia coli；
(b6) preparation be used for detecting in sample to be tested whether contain bovine viral diarrhea virus and/or bovine rota with/
Or the test kit of enterotoxigenic escherichia coli.
The present invention also protects the test kit combined containing described primer；The purposes of described test kit is following (c1) or (c2)
Or (c3):
(c1) 3 kinds of calf diarrhea substances are differentiated；
(c2) detect whether pathogen to be measured is bovine viral diarrhea virus, bovine rota or produces enterotoxin large intestine bar
Bacterium；
(c3) whether detection sample to be tested contains bovine viral diarrhea virus and/or bovine rota and/or produces intestinal poison
Element escherichia coli.
The present invention also protects the preparation method of described test kit, including the step individually packed by each bar primer.
The present invention also protects a kind of method differentiating 3 kinds of calf diarrhea substances, comprises the steps (d1) or (d2):
(d1) nucleic acid of pathogen to be measured is carried out reverse transcription, obtain DNA profiling, use the combination of described primer to carry out PCR
Amplification (specifically can carry out GeXP multiplexed PCR amplification；Amplified production can carry out capillary electrophoresis detection), if amplified production contains
The DNA fragmentation of 308-310bp, pathogen to be measured are or candidate is bovine viral diarrhea virus, if amplified production contains 211-
The DNA fragmentation of 214bp, pathogen to be measured are or candidate is bovine rota, if amplified production contains the DNA of 252-254bp
Fragment, pathogen to be measured are or candidate is enterotoxigenic escherichia coli；
(d2) detection whether contain in treating the genomic DNA of pathogen or cDNA described primer to the target sequence of I, described in draw
Thing to the target sequence of II or the described primer target sequence to III, if in described cDNA containing described primer to the target sequence of I,
Pathogen to be measured is or candidate is bovine viral diarrhea virus, if in described cDNA containing described primer to the target sequence of II,
Pathogen to be measured is or candidate is bovine rota, if in described genomic DNA containing described primer to the target sequence of III,
Pathogen to be measured is or candidate is enterotoxigenic escherichia coli.
The present invention also protects whether a kind of detection pathogen to be measured is bovine viral diarrhea virus, bovine rota or produces intestinal
The colibacillary method of toxin, comprises the steps (e1) or (e2):
(e1) nucleic acid of pathogen to be measured is carried out reverse transcription, obtain DNA profiling, use the combination of described primer to carry out PCR
Amplification (specifically can carry out GeXP multiplexed PCR amplification；Amplified production can carry out capillary electrophoresis detection), if amplified production contains
The DNA fragmentation of 308-310bp, pathogen to be measured are or candidate is bovine viral diarrhea virus, if amplified production contains 211-
The DNA fragmentation of 214bp, pathogen to be measured are or candidate is bovine rota, if amplified production contains the DNA of 252-254bp
Fragment, pathogen to be measured are or candidate is enterotoxigenic escherichia coli；
(e2) detection whether contain in treating the genomic DNA of pathogen or cDNA described primer to the target sequence of I, described in draw
Thing to the target sequence of II or the described primer target sequence to III, if in described cDNA containing described primer to the target sequence of I,
Pathogen to be measured is or candidate is bovine viral diarrhea virus, if in described cDNA containing described primer to the target sequence of II,
Pathogen to be measured is or candidate is bovine rota, if in described genomic DNA containing described primer to the target sequence of III,
Pathogen to be measured is or candidate is enterotoxigenic escherichia coli.
The present invention also protects in a kind of detection sample to be tested whether contain bovine viral diarrhea virus and/or bovine rota
And/or the method for enterotoxigenic escherichia coli, comprise the steps (f1) or (f2):
(f1) nucleic acid of sample to be tested is carried out reverse transcription, obtain DNA profiling, use the combination of described primer to carry out PCR expansion
Increase and (specifically can carry out GeXP multiplexed PCR amplification；Amplified production can carry out capillary electrophoresis detection), if amplified production contains
The DNA fragmentation of 308-310bp, sample to be tested contain or doubtful containing bovine viral diarrhea virus, if amplified production contains
The DNA fragmentation of 211-214bp, sample to be tested contain or doubtful containing bovine rota, if amplified production contains 252-254bp
DNA fragmentation, sample to be tested contains or doubtful containing enterotoxigenic escherichia coli；
(f2) whether the detection genomic DNA of sample to be tested or cDNA contain described primer to the target sequence of I, described in draw
Thing to the target sequence of II or the described primer target sequence to III, if in described cDNA containing described primer to the target sequence of I,
Sample to be tested contains or doubtful containing bovine viral diarrhea virus, if containing the described primer target to II in described cDNA
Sequence, sample to be tested contain or doubtful containing bovine rota, if containing described primer pair in described genomic DNA
The target sequence of III, sample to be tested contain or doubtful containing enterotoxigenic escherichia coli.
The present invention also protects primer to combine, for as follows (g1) or (g2):
(d1) described primer to I or described primer to II or described primer to III；
(d2) described primer is to the combination to any two primer pair in III to II and described primer of I, described primer.
The purposes of described primer combination is for differentiating bovine viral diarrhea virus and/or bovine rota and/or producing enterotoxin
Escherichia coli.
The present invention also protects the application that described primer combines, for differentiating bovine viral diarrhea virus and/or bovine rota
And/or enterotoxigenic escherichia coli.
The present invention also protects the test kit combined containing described primer；The purposes of described test kit is for differentiating bovine viral abdomen
Diarrhea virus and/or bovine rota and/or enterotoxigenic escherichia coli.
Any of the above the preparation method of nucleic acid of the preparation method of nucleic acid of pathogen to be measured or sample to be tested concrete the most such as
Under: pathogen to be measured is carried out extracting genome DNA operation and RNA extracts operation and (can carry out also can distinguishing in same system
Mix after carrying out), obtain nucleic acid solution.
Described in any of the above, 3 kinds of calf diarrhea substances are that bovine viral diarrhea virus, bovine rota and product enterotoxin are big
Enterobacteria.
The concretely BVDV Reference strains Oregon CV24 strain of pathogen to be measured described in any of the above (BVDV-1 type),
BVDV Reference strains NADL strain (BVDV-1 type), BVDV Reference strains yak strain (BVDV-1 type), BVDV strain GX-BVDV1,
BVDV strain GX-BVDV2, BVDV strain GX-BVDV3, BVDV strain GX-BVDV4, BVDV strain GX-BVDV5, BVDV strain
GX-BVDV6, BVDV strain GX-BVDV7, BVDV strain GX-BVDV8, BVDV strain GX-BVDV9, BVDV strain GX-
BVDV10, BVDV strain GX-BVDV11, BVDV strain GX-BVDV12, BVDV strain GX-BVDV13, BVDV strain GX-041,
BRV Reference strains NCDV, BRV Reference strains BRV014, BRV strain GX-BRV-1, BRV strain GX-BRV-2, BRV strain GX-
BRV-3, BRV strain GX-BRV-4, BRV strain GX-BRV-5, BRV strain GX-BRV-6, BRV strain GX-BRV-7, BRV strain
GX-BRV-8, ECTC bacterial strain GX-ETEC1, ECTC bacterial strain GX-ETEC2 or ECTC bacterial strain GX-ETEC3.
" the described primer target sequence to I " described in any of the above is concretely following (h1) or (h2) or (h3): (h1) sequence
The DNA molecular shown in sequence 12 of list；(h2) sequence 12 of sequence table is from shown in the 19th to 289 nucleotide of 5 ' end
DNA molecular；(h3) there is the DNA molecular of more than 98% homology with (h1) or (h2).
" the described primer target sequence to II " described in any of the above is concretely following (h4) or (h5) or (h6): (h4) sequence
The DNA molecular shown in sequence 13 of list；(h5) sequence 31 of sequence table is from shown in the 13rd to 192 nucleotide of 5 ' end
DNA molecular；(h6) there is the DNA molecular of more than 98% homology with (h4) or (h5).
" the described primer target sequence to III " described in any of the above is concretely following (h7) or (h8) or (h9): (h7)
The DNA molecular shown in sequence 14 of sequence table；(h8) sequence 14 of sequence table is from shown in the 19th to 234 nucleotide of 5 ' end
DNA molecular；(h9) there is the DNA molecular of more than 98% homology with (h7) or (h8).
The concretely Faecal swabs of sample to be tested described in any of the above, rectal mucosal tissue sample or lymph node tissue sample
This.
In the reaction system of GeXP multiplexed PCR amplification described in any of the above, the concentration of each bar primer in primer combination is such as
Under: the concentration of BVDV-F and BVDV-R be the concentration of 2 μm ol/ μ L, BRV-F and BRV-R be 0.2 μm ol/ μ L, ETEC-F and
The concentration of ETEC-R is 0.2 μm ol/ μ L.
The reaction system (20 μ L) of GeXP multiplexed PCR amplification described in any of the above is concretely: template 1 μ L (10-
100ng), (buffer is contained within universal primer to Genome Lab GeXP Starter Kit 5 × buffer 4 μ L, general draws
Thing is made up of the primer B shown in the sequence 11 of the primer A shown in the sequence 10 of sequence table and sequence table, wherein 5 ' the ends of primer A
End has the labelling of CY5 fluorophor, and the working concentration of primer A and primer B is 0.25 μM), MgCl2(25 μMs) 4 μ L, contains
Primer mixture 1 μ L, the DNA polymerase 10U of all primers in primer combination, complements to 20 μ L with ultra-pure water.
The response procedures of GeXP multiplexed PCR amplification described in any of the above is concretely: 95 DEG C of 5 minutes denaturations；94℃30
Second, 55 DEG C 30 seconds, 72 DEG C 30 seconds, 10 circulations；94 DEG C 30 seconds, 68 DEG C 30 seconds, 72 DEG C 30 seconds, 10 circulations；94℃
30 seconds, 50 DEG C 30 seconds, 72 DEG C 30 seconds, 10 circulations；72 DEG C extend 5min, terminate reaction.
The deposition condition of capillary electrophoresis described in any of the above is: 90 DEG C 120 seconds, degeneration；2.0KV 30 seconds, sucks sample
Product；6.0KV 35 minutes, separates sample.
The GeXP detection method that the present invention sets up can differentiate bovine viral diarrhea virus, bovine rota and product intestinal simultaneously
3 kinds of calf diarrhea pathogen of toxin escherichia coli.This method has the advantages that high flux, specificity and sensitivity are higher, available
In the EPDML monitoring of cattle disease and the Differential Diagnosis of SARS Epidemic, ensure the sound development of cattle-raising.
Accompanying drawing explanation
Fig. 1 is the multiplexed PCR amplification result figure of each sample to be tested in embodiment 2.
Fig. 2 is the multiplexed PCR amplification result figure of 3 kinds of calf diarrhea pathogen mixing samples in embodiment 2.
The amplification figure of multiplex PCR when Fig. 3 is to use reaction system 1-5 in embodiment 5.
Detailed description of the invention
Below example facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiment
Method, if no special instructions, is conventional method.Test material used in following embodiment, if no special instructions, is certainly
Routine biochemistry reagent shop is commercially available.Quantitative test in following example, is respectively provided with three times and repeats experiment, and result is made even
Average.
BVDV Reference strains Oregon CV24 strain (BVDV-1 type): China Veterinery Drug Inspection Office, article No.: AV69.
BVDV Reference strains NADL strain (BVDV-1 type): China Veterinery Drug Inspection Office, article No.: AV67.
BVDV Reference strains yak strain (BVDV-1 type): China Veterinery Drug Inspection Office, article No.: AV68.
BRV Reference strains NCDV: China Veterinery Drug Inspection Office, article No.: AV51.
BRV Reference strains BRV014: China Veterinery Drug Inspection Office, article No.: AV52.
ETEC Reference Strains 1676: China Veterinery Drug Inspection Office, article No.: 212.
ETEC Reference Strains 1751: China Veterinery Drug Inspection Office, article No.: 214.
ETEC Reference Strains B41: China Veterinery Drug Inspection Office, article No.: 215.
BVDV strain GX-BVDV1, BVDV strain GX-BVDV2, BVDV strain GX-BVDV3, BVDV strain GX-BVDV4,
BVDV strain GX-BVDV5, BVDV strain GX-BVDV6, BVDV strain GX-BVDV7, BVDV strain GX-BVDV8, BVDV strain
GX-BVDV9, BVDV strain GX-BVDV10, BVDV strain GX-BVDV11, BVDV strain GX-BVDV12, BVDV strain GX-
BVDV13, BVDV strain GX-041: list of references: Fan Q, Xie Z, Xie L, et al.Areverse transcription
loop-mediated isothermal amplification method for rapid detection of boyine
Viral diarrhea virus [J] .Journal of Virological Methods, 2012,186 (1-2): 43-48.；
The public can obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region.
BRV strain GX-BRV-1, BRV strain GX-BRV-2, BRV strain GX-BRV-3, BRV strain GX-BRV-4, BRV poison
Strain GX-BRV-5, BRV strain GX-BRV-6, BRV strain GX-BRV-7, BRV strain GX-BRV-8: list of references: Xie Z, Fan
Q, Liu J, et al.Reverse transcription loop-mediated isothermal amplification
Assay for rapid detection of Bovine Rotavirus [J] .Bmc Veterinary Research,
2012,8 (1): 451-452.；The public can obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region.
Genome Lab GeXP Starter Kit 5 × buffer: wherein drawing shown in the sequence 10 containing ordered list
The primer B shown in sequence 11 of thing A and sequence table, wherein 5 ' the ends of primer A have the labelling of CY5 fluorophor；U.S. shellfish
Ke Man Coulter Corporation.
Sample buffer: Beckman Coulter Inc. of the U.S., article No.: M409196.
DNA size standard kit-400Base Pairs: Beckman Coulter Inc. of U.S. product, article No.:
608098。
DNA polymerase: SIGMA company of the U.S., article No.: D4184-1.5KU.
MgCl2(25 μMs): SIGMA company of the U.S., article No.: M8787-1.5ML.
EasyPure Viral DNA/RNA Kit: Beijing Quanshijin Biotechnology Co., Ltd, article No.: ER201-01.
The design of embodiment 1, primer combination and preparation
Carry out a large amount of sequence analysis, comparison obtains for differentiating 3 kinds of calf diarrhea pathogen of BVDV, BRV and ETEC
Some primers.Each primer is carried out preliminary experiment, compares the performance such as sensitivity, specificity, finally give for differentiating 3 kinds of cattle abdomens
Rush down 3 pairs of specific primers of encephalapthy agent.Each specific primer pair, forward primer and reverse primer are by targeting section and lead to
Forming with primer section, universal primer section is positioned at 5 ' ends of targeting section.
For identifying that the primer of BVDV forms (5 ' → 3 ') by following two primers:
BVDV-F (sequence 1 of sequence table):AGGTGACACTATAGAATAGTGAGTTCGTTGGATGGC:
BVDV-R (sequence 2 of sequence table):GTACGACTCACTATAGGGATATGTTTTGTATAAGAGTTCATTTG。
Underscore part is universal primer section.
For identifying that the primer of BRV forms (5 ' → 3 ') by following two primers:
BRV-F (sequence 3 of sequence table):AGGTGACACTATAGAATACAGTGGCTTCCATTAGAAGCAT；
BRV-R (sequence 4 of sequence table):GTACGACTCACTATAGGGAGGTCACATCCTCTCACTA。
Underscore part is universal primer section.
For identifying that the primer of ETEC forms (5 ' → 3 ') by following two primers:
ETEC-F (sequence 5 of sequence table):AGGTGACACTATAGAATACTCAGGTGCGAAAGCGTG:
ETEC-R (sequence 6 of sequence table):GTACGACTCACTATAGGGACGTTGCATCGAATTAAACCAC。
Underscore part is universal primer section.
For identify the primer of BVDV to named primer to I.
For identify the primer of BRV to named primer to II.
For identify the primer of ETEC to named primer to III.
Above-mentioned each primer is to composition primer combination.
Embodiment 2, specificity
One, single template experiment
1, extract the total serum IgE of sample to be tested, and reverse transcription is cDNA.Sample to be tested is respectively as follows: BVDV Reference strains
Oregon CV24 strain (BVDV-1 type), BRV Reference strains NCDV.
2, the genomic DNA of sample to be tested is extracted.Sample to be tested is respectively ETEC Reference Strains 1676.
3, the genomic DNA that the cDNA obtained with step 1 respectively and step 2 obtain, as template, uses the primer of embodiment 1
Combination carries out GeXP multiplex PCR.
The reaction system (20 μ L) of multiplex PCR: template 1 μ L, Genome Lab GeXP Starter Kit 5 × buffer
(buffer is contained within universal primer to 4 μ L, and universal primer is by the primer A shown in the sequence 10 of sequence table and the sequence 11 of sequence table
Shown primer B composition, wherein 5 ' the ends of primer A have the labelling of CY5 fluorophor, primer A and the working concentration of primer B
It is 0.25 μM), MgCl2(25 μMs) 4 μ L, the primer mixture 1 μ L, DNA of all primers in combining containing primer
Polymerase 10U, complements to 20 μ L with ultra-pure water.In the reaction system of multiplex PCR, the concentration of BVDV-F and BVDV-R is equal
It is that the concentration of 2 μm ol/ μ L, BRV-F and BRV-R is the concentration of 0.2 μm ol/ μ L, ETEC-F and ETEC-R and is 0.2 μm ol/ μ
L.The negative control using equal-volume water as template is set.
DNA content about 100ng when template is each eDNA sample that step 1 obtains, in 1 μ L template；
DNA content about 100ng when template is the genomic DNA sample that step 2 obtains, in 1 μ L template；
The response procedures of multiplex PCR: 95 DEG C of 5 minutes denaturations；94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 30 seconds, 10
Circulation；94 DEG C 30 seconds, 68 DEG C 30 seconds, 72 DEG C 30 seconds, 10 circulations；94 DEG C 30 seconds, 50 DEG C 30 seconds, 72 DEG C 30 seconds, 10
Individual circulation；72 DEG C extend 5min, terminate reaction.
4, the multiplexed PCR amplification product of step 3 is carried out capillary electrophoresis, concretely comprise the following steps: by 3 μ L multiplexed PCR amplification
Product, 38.75 μ L sample buffer and the concussion of 0.25 μ L DNA size standard kit-400Base Pairs whirlpool are mixed
Even, in addition in model, every hole drips 1 dropstone and seals with wax and close liquid level, it is to avoid Methanamide oxidation and sample evaporate.On buffer plate
Every hole adds the sample buffer of 180 μ L, carries out capillary electrophoresis.Capillary electrophoresis condition: 90 DEG C 120 seconds, degeneration；2.0KV
30 seconds, suck sample；6.0KV 35 minutes, separates sample.The PCR primer of different size fragment separates in electrophoresis, and instrument leads to
Cross the detection fluorophor that carries of PCR primer and recognize its clip size and signal intensity.After electrophoresis completes, instrument is used to carry soft
Part Express Profiler software analysis result.
Judge according to electrophoresis result, it is judged that standard is: the am-plified fragments of 3 kinds of calf diarrhea pathogen genes of interest is big
Little respectively BVDV:308-310bp, BRV:211-214bp, ETEC:252-254bp.Due to the error of the system of GeXP own, expand
Increase segment size and belong to correct result with theoretical value existence ± 2bp deviation.
Electrophoresis result is as shown in Figure 1.In Fig. 1, abscissa represents clip size (unit is bp), and vertical coordinate represents that signal is strong
Degree, i.e. the content of pcr amplification product.Figure 1A is the multiplex PCR of BVDV Reference strains Oregon CV24 strain (BVDV-1 type) cDNA
Amplification, amplification obtains the DNA fragmentation of 309.58bp.Figure 1B is the multiplexed PCR amplification knot of BRV Reference strains NCDV cDNA
Really, amplification obtains the DNA fragmentation of 211.71bp.Fig. 1 C is the multiplexed PCR amplification result of ETEC Reference Strains 1676 genomic DNA,
Amplification obtains the DNA fragmentation of 252.24bp.Each reaction only occurs that specificity is unimodal, without other signal peak, and clip size with
Criterion is consistent.Negative control is all without amplification, without purpose signal peak.
Two, hybrid template experiment
1, extract the total serum IgE of sample to be tested, and reverse transcription is cDNA.Sample to be tested is respectively as follows: BVDV Reference strains
Oregon CV24 strain (BVDV-1 type), BRV Reference strains NCDV.
2, the genomic DNA of sample to be tested is extracted.Sample to be tested is respectively ETEC Reference Strains 1676.
3, a kind of genomic DNA mixing that 2 kinds of cDNA, the steps 2 step 1 obtained obtain.
4, the mixed liquor obtained with step 3 is as template, uses the primer combination of embodiment 1 to carry out GeXP multiplex PCR.
The reaction system (20 μ L) of multiplex PCR: template 1 μ L, Genome Lab GeXP Starter Kit 5 × buffer
(buffer is contained within universal primer to 4 μ L, and universal primer is by the primer A shown in the sequence 10 of sequence table and the sequence 11 of sequence table
Shown primer B composition, wherein 5 ' the ends of primer A have the labelling of CY5 fluorophor, primer A and the working concentration of primer B
It is 0.25 μM), MgCl2(25 μMs) 4 μ L, the primer mixture 1 μ L, DNA of all primers in combining containing primer
Polymerase 10U, complements to 20 μ L with ultra-pure water.In the reaction system of multiplex PCR, the concentration of BVDV-F and BVDV-R is equal
It is that the concentration of 2 μm ol/ μ L, BRV-F and BRV-R is the concentration of 0.2 μm ol/ μ L, ETEC-F and ETEC-R and is 0.2 μ
mol/μL.The negative control using equal-volume water as template is set.
In 1 μ L template, the cDNA of BVDV Reference strains Oregon CV24 strain (BVDV-1 type) is about 100ng, BRV with reference to poison
Strain NCDV cDNA is about the genomic DNA of 100ng, ETEC Reference Strains 1676 and is about 100ng,.
The response procedures of multiplex PCR: 95 DEG C of 5 minutes denaturations；94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 30 seconds, 10
Circulation；94 DEG C 30 seconds, 68 DEG C 30 seconds, 72 DEG C 30 seconds, 10 circulations；94 DEG C 30 seconds, 50 DEG C 30 seconds, 72 DEG C 30 seconds, 10
Individual circulation；72 DEG C extend 5min, terminate reaction.
5, the multiplexed PCR amplification product of step 4 is carried out capillary electrophoresis, concretely comprise the following steps: by 3 μ L multiplexed PCR amplification
Product, 38.75 μ L sample buffer and the concussion of 0.25 μ L DNA size standard kit-400Base Pairs whirlpool are mixed
Even, in addition in model, every hole drips 1 dropstone and seals with wax and close liquid level, it is to avoid Methanamide oxidation and sample evaporate.On buffer plate
Every hole adds the sample buffer of 180 μ L, carries out capillary electrophoresis.Capillary electrophoresis condition: 90 DEG C 120 seconds, degeneration；2.0KV
30 seconds, suck sample；6.0KV 35 minutes, separates sample.The PCR primer of different size fragment separates in electrophoresis, and instrument leads to
Cross the detection fluorophor that carries of PCR primer and recognize its clip size and signal intensity.After electrophoresis completes, instrument is used to carry soft
Part Express Profiler software analysis result.
Judge according to electrophoresis result, it is judged that standard is: the am-plified fragments of 3 kinds of calf diarrhea pathogen genes of interest is big
Little respectively BVDV:308-310bp, BRV:211-214bp, ETEC:252-254bp.Due to the error of the system of GeXP own, expand
Increase segment size and belong to correct result with theoretical value existence ± 2bp deviation.
Testing result is as shown in Figure 2.In Fig. 2, abscissa represents clip size (unit is bp), and vertical coordinate represents that signal is strong
Degree, i.e. the content of pcr amplification product.Result shows, uses GeXP multiplex PCR can detect 3 kinds of calf diarrhea cause of diseases simultaneously
3 kinds of signal peaks that body is corresponding, BVDV:309.75bp, BRV:211.93bp, ETEC:253.30bp, without other miscellaneous peak.Negative right
According to all without amplification, without purpose signal peak.
Embodiment 3, universality
1, extract the total serum IgE of sample to be tested, and reverse transcription is cDNA.Sample to be tested is respectively as follows: BVDV Reference strains
Oregon CV24 strain (BVDV-1 type), BVDV Reference strains NADL strain (BVDV-1 type), BVDV Reference strains yak strain (BVDV-
1 type), BVDV strain GX-BVDV1, BVDV strain GX-BVDV2, BVDV strain GX-BVDV3, BVDV strain GX-BVDV4, BVDV
Strain GX-BVDV5, BVDV strain GX-BVDV6, BVDV strain GX-BVDV7, BVDV strain GX-BVDV8, BVDV strain GX-
BVDV9, BVDV strain GX-BVDV10, BVDV strain GX-BVDV11, BVDV strain GX-BVDV12, BVDV strain GX-
BVDV13, BVDV strain GX-041, BRV Reference strains NCDV, BRV Reference strains BRV014, BRV strain GX-BRV-1, BRV poison
Strain GX-BRV-2, BRV strain GX-BRV-3, BRV strain GX-BRV-4, BRV strain GX-BRV-5, BRV strain GX-BRV-6,
BRV strain GX-BRV-7, BRV strain GX-BRV-8.
2, the genomic DNA of sample to be tested is extracted.Sample to be tested is respectively as follows: ECTC bacterial strain GX-ETEC1, ECTC bacterial strain GX-
ETEC2, ECTC bacterial strain GX-ETEC3.
3, the genomic DNA that the cDNA obtained with step 1 respectively and step 2 obtain, as template, uses the primer of embodiment 1
Combination carries out GeXP multiplex PCR.
The reaction system (20 μ L) of multiplex PCR: template 1 μ L, Genome Lab GeXP Starter Kit 5 × buffer
(buffer is contained within universal primer to 4 μ L, and universal primer is by the primer A shown in the sequence 10 of sequence table and the sequence 11 of sequence table
Shown primer B composition, wherein 5 ' the ends of primer A have the labelling of CY5 fluorophor, primer A and the working concentration of primer B
It is 0.25 μM), MgCl2(25 μMs) 4 μ L, the primer mixture 1 μ L, DNA of all primers in combining containing primer
Polymerase 10U, complements to 20 μ L with ultra-pure water.In the reaction system of multiplex PCR, the concentration of BVDV-F and BVDV-R is equal
It is that the concentration of 2 μm ol/ μ L, BRV-F and BRV-R is the concentration of 0.2 μm ol/ μ L, ETEC-F and ETEC-R and is 0.2 μ
mol/μL.The negative control using equal-volume water as template is set.
DNA content about 100ng when template is each cDNA sample that step 1 obtains, in 1 μ L template；
DNA content about 100ng when template is each genomic DNA sample that step 2 obtains, in 1 μ L template；
The response procedures of multiplex PCR: 95 DEG C of 5 minutes denaturations；94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 30 seconds, 10
Circulation；94 DEG C 30 seconds, 68 DEG C 30 seconds, 72 DEG C 30 seconds, 10 circulations；94 DEG C 30 seconds, 50 DEG C 30 seconds, 72 DEG C 30 seconds, 10
Individual circulation；72 DEG C extend 5min, terminate reaction.
4, the multiplexed PCR amplification product of step 3 is carried out capillary electrophoresis, concretely comprise the following steps: by 3 μ L multiplexed PCR amplification
Product, 38.75 μ L sample buffer and the concussion of 0.25 μ L DNA size standard kit-400Base Pairs whirlpool are mixed
Even, in addition in model, every hole drips 1 dropstone and seals with wax and close liquid level, it is to avoid Methanamide oxidation and sample evaporate.On buffer plate
Every hole adds the sample buffer of 180 μ L, carries out capillary electrophoresis.Capillary electrophoresis condition: 90 DEG C 120 seconds, degeneration；2.0KV
30 seconds, suck sample；6.0KV 35 minutes, separates sample.The PCR primer of different size fragment separates in electrophoresis, and instrument leads to
Cross the detection fluorophor that carries of PCR primer and recognize its clip size and signal intensity.After electrophoresis completes, instrument is used to carry soft
Part Express Profiler software analysis result.
Judge according to electrophoresis result, it is judged that standard is: the am-plified fragments of 3 kinds of calf diarrhea pathogen genes of interest is big
Little respectively BVDV:308-310bp, BRV:211-214bp, ETEC:252-254bp.Due to the error of the system of GeXP own, expand
Increase segment size and belong to correct result with theoretical value existence ± 2bp deviation.
The primer combination using embodiment 1 is treated test sample and is originally carried out multiplexed PCR amplification, and corresponding cause of disease only occurs in each sample
The specificity of body is unimodal, and without other signal peaks, and clip size is consistent with criterion, and result shows, drawing of embodiment 1 design
Thing combination is generally applicable to 3 kinds of calf diarrhea pathogen.
Prepared by embodiment 4, plasmid standard
BVDV standard substance: the double chain DNA molecule shown in the sequence 7 of sequence table is connected with pMD-18T carrier, is recombinated
Plasmid (named BVDV standard substance).
BRV standard substance: the double chain DNA molecule shown in the sequence 8 of sequence table is connected with pMD-18T carrier, is recombinated
Plasmid (named BRV standard substance).
ETEC standard substance: the double chain DNA molecule shown in the sequence 9 of sequence table is connected with pMD-18T carrier, is recombinated
Plasmid (named ETEC standard substance).
Embodiment 5, sensitivity
1, by implementing the copy number mixing such as BVDV standard substance, BRV standard substance and the ETEC standard substance of 3 preparations, mixed
Liquid.
2, ddH is used2The mixed liquor that 10 times of gradient dilution steps 2 of O obtain, obtains each diluent.
3, diluent step 2 obtained is as template, uses the primer combination of embodiment 1 preparation to carry out GeXP multiple
PCR。
The reaction system (20 μ L) of multiplex PCR: template 1 μ L, Genome Lab GeXP Starter Kit 5 × buffer
(buffer is contained within universal primer to 4 μ L, and universal primer is by the primer A shown in the sequence 10 of sequence table and the sequence 11 of sequence table
Shown primer B composition, wherein 5 ' the ends of primer A have the labelling of CY5 fluorophor, primer A and the working concentration of primer B
It is 0.25 μM), MgCl2(25 μMs) 4 μ L, the primer mixture 1 μ L, DNA of all primers in combining containing primer
Polymerase 10U, complements to 20 μ L with ultra-pure water.In the reaction system of multiplex PCR, the concentration of BVDV-F and BVDV-R is equal
It is that the concentration of 2 μm ol/ μ L, BRV-F and BRV-R is the concentration of 0.2 μm ol/ μ L, ETEC-F and ETEC-R and is 0.2 μ
mol/μL.The negative control using equal-volume water as template is set.
The dilution factor of the diluent owing to using is different, forms the most different reaction systems:
In reaction system 1, the initial concentration of BVDV standard substance, BRV standard substance and ETEC standard substance is 106Copy/μ L；
In reaction system 2, the initial concentration of BVDV standard substance, BRV standard substance and ETEC standard substance is 105Copy/μ
L；
In reaction system 3, the initial concentration of BVDV standard substance, BRV standard substance and ETEC standard substance is 104Copy/μ
L；
In reaction system 4, the initial concentration of BVDV standard substance, BRV standard substance and ETEC standard substance is 103Copy/μ
L；
In reaction system 5, the initial concentration of BVDV standard substance, BRV standard substance and ETEC standard substance is 102Copy/μ
L；
In reaction system 6, the initial concentration of BVDV standard substance, BRV standard substance and ETEC standard substance is 10 copies/μ L；
In reaction system 7, the initial concentration of BVDV standard substance, BRV standard substance and ETEC standard substance is 1 copy/μ L.
The response procedures of multiplex PCR: 95 DEG C of 5 minutes denaturations；94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 30 seconds, 10
Circulation；94 DEG C 30 seconds, 68 DEG C 30 seconds, 72 DEG C 30 seconds, 10 circulations；94 DEG C 30 seconds, 50 DEG C 30 seconds, 72 DEG C 30 seconds, 10
Individual circulation；72 DEG C extend 5min, terminate reaction.
4, the multiplexed PCR amplification product of step 3 is carried out capillary electrophoresis, concretely comprise the following steps: by 3 μ L multiplexed PCR amplification
Product, 38.75 μ L sample buffer and the concussion of 0.25 μ L DNA size standard kit-400Base Pairs whirlpool are mixed
Even, in addition in model, every hole drips 1 dropstone and seals with wax and close liquid level, it is to avoid Methanamide oxidation and sample evaporate.On buffer plate
Every hole adds the sample buffer of 180 μ L, carries out capillary electrophoresis.Capillary electrophoresis condition: 90 DEG C 120 seconds, degeneration；2.0KV
30 seconds, suck sample；6.0KV 35 minutes, separates sample.The PCR primer of different size fragment separates in electrophoresis, and instrument leads to
Cross the detection fluorophor that carries of PCR primer and recognize its clip size and signal intensity.After electrophoresis completes, instrument is used to carry soft
Part Express Profiler software analysis result.
Judge according to electrophoresis result, it is judged that standard is: the am-plified fragments of 3 kinds of calf diarrhea pathogen genes of interest is big
Little respectively BVDV:308-310bp, BRV:211-214bp, ETEC:252-254bp.Due to the error of the system of GeXP own, expand
Increase segment size and belong to correct result with theoretical value existence ± 2bp deviation.
Testing result is as shown in Figure 3.The amplification of multiplex PCR when Fig. 3 A-3E is corresponding in turn to use reaction system 1-5,
In Fig. 3, abscissa represents clip size (unit is bp), and vertical coordinate represents signal intensity, i.e. the content of pcr amplification product.Knot
Fruit shows, as the concentration as little as 100 copy/μ L of DNA to be measured in detection system, it is also possible to detect 3 kinds of calf diarrhea cause of diseases
Body.
Embodiment 5, clinical sample detect
Sample to be tested is: 169 parts of clinical samples, including 156 parts of Faecal swabs, 10 parts of intestinal mucosas, 3 parts of lymph nodes.
Clinical sample is collected in various places, 2012-2014 Guangxi, and 30 parts of sample sources, in having watery diarrhea, are become thin rapidly, and mouth and nose are white
The cattle of the clinical symptoms such as foam, other sample source in asymptomatic milch cow.
1, use EasyPure Viral DNA/RNA Kit to extract the DNA/RNA of sample to be tested, obtain DNA/RNA mixing
Solution.
2, DNA/RAN mixed solution reverse transcription step 1 obtained obtains DNA/cDNA mixed solution.
3, DNA/cDNA mixed solution step 2 obtained, as template, uses the primer combination of embodiment 1 preparation to carry out
Carry out GeXP multiplex PCR.
The reaction system (20 μ L) of multiplex PCR: template 1 μ L, Genome Lab GeXP Starter Kit 5 × buffer
(buffer is contained within universal primer to 4 μ L, and universal primer is by the primer A shown in the sequence 10 of sequence table and the sequence 11 of sequence table
Shown primer B composition, wherein 5 ' the ends of primer A have the labelling of CY5 fluorophor, primer A and the working concentration of primer B
It is 0.25 μM), MgCl2(25 μMs) 4 μ L, the primer mixture 1 μ L, DNA of all primers in combining containing primer
Polymerase 10U, complements to 20 μ L with ultra-pure water.In the reaction system of multiplex PCR, the concentration of BVDV-F and BVDV-R is equal
It is that the concentration of 2 μm ol/ μ L, BRV-F and BRV-R is the concentration of 0.2 μm ol/ μ L, ETEC-F and ETEC-R and is 0.2 μ
mol/μL.The negative control using equal-volume water as template is set.
The response procedures of multiplex PCR: 95 DEG C of 5 minutes denaturations；94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 30 seconds, 10
Circulation；94 DEG C 30 seconds, 68 DEG C 30 seconds, 72 DEG C 30 seconds, 10 circulations；94 DEG C 30 seconds, 50 DEG C 30 seconds, 72 DEG C 30 seconds, 10
Individual circulation；72 DEG C extend 5min, terminate reaction.
4, the multiplexed PCR amplification product of step 3 is carried out capillary electrophoresis, concretely comprise the following steps: by 3 μ L multiplexed PCR amplification
Product, 38.75 μ L sample buffer and the concussion of 0.25 μ L DNA size standard kit-400Base Pairs whirlpool are mixed
Even, in addition in model, every hole drips 1 dropstone and seals with wax and close liquid level, it is to avoid Methanamide oxidation and sample evaporate.On buffer plate
Every hole adds the sample buffer of 180 μ L, carries out capillary electrophoresis.Capillary electrophoresis condition: 90 DEG C 120 seconds, degeneration；2.0KV
30 seconds, suck sample；6.0KV 35 minutes, separates sample.The PCR primer of different size fragment separates in electrophoresis, and instrument leads to
Cross the detection fluorophor that carries of PCR primer and recognize its clip size and signal intensity.After electrophoresis completes, instrument is used to carry soft
Part Express Profiler software analysis result.
Judge according to electrophoresis result, it is judged that standard is: the am-plified fragments of 3 kinds of calf diarrhea pathogen genes of interest is big
Little respectively BVDV:308-310bp, BRV:211-214bp, ETEC:252-254bp.Due to the error of the system of GeXP own, expand
Increase segment size and belong to correct result with theoretical value existence ± 2bp deviation.
5, positive amplification product step 4 obtained carries out the correctness with the result that checks order.
Testing result is as shown in table 1.
Table 1 clinical sample testing result is added up
| Pathogen | GeXP multiplex PCR positive number | The positive number of order-checking | Positive findings sample accounts for the ratio of total sample |
| BVDV | 41 | 41 | 24.3% |
| BRV | 8 | 8 | 4.7% |
| ETEC | 55 | 55 | 32.5% |
| BVDV+ETEC | 23 | 23 | 13.6% |
| BRV+ETEC | 5 | 5 | 3.0% |
In 169 parts of samples, 104 parts of testing results are positive, and wherein substance infects and is 92 parts (one-shot infects sample and accounts for the positive
The 28.4% of result sample), mixed infection 28 parts (mixed infection sample accounts for the 16.6% of positive findings sample).Sequencing result shows
Show that positive findings is the virus of correspondence, without the false positive of non-specific amplification.
Claims (10)
1. primer combination, is made up of III II and primer I, primer primer；
I is made up of by described primer primer BVDV-F and primer BVDV-R；
Described primer BVDV-F is following (a1) or (a2) or (a3):
(a1) single strand dna shown in sequence 1 of sequence table；
(a2) sequence 1 of sequence table is from the DNA molecular shown in the 19th to 36 nucleotide of 5 ' end；
(a3) (a2) or (a3) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and had identical merit
The DNA molecular of energy；
Described primer BVDV-R is following (a4) or (a5) or (a6):
(a4) single strand dna shown in sequence 2 of sequence table；
(a5) sequence 2 of sequence table is from the DNA molecular shown in the 20th to 44 nucleotide of 5 ' end；
(a6) (a4) or (a5) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and had identical merit
The DNA molecular of energy；
II is made up of by described primer primer BRV-F and primer BRV-R；
Described primer BRV-F is following (a7) or (a8) or (a9):
(a7) single strand dna shown in sequence 3 of sequence table；
(a8) sequence 3 of sequence table is from the DNA molecular shown in the 19th to 40 nucleotide of 5 ' end；
(a9) (a7) or (a8) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and had identical merit
The DNA molecular of energy；
Described primer BRV-R is following (a10) or (a11) or (a12):
(a10) single strand dna shown in sequence 4 of sequence table；
(a11) sequence 4 of sequence table is from the DNA molecular shown in the 20th to 37 nucleotide of 5 ' end；
(a12) (a10) or (a11) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had identical
The DNA molecular of function；
III is made up of by described primer primer ETEC-F and primer ETEC-R:
Described primer ETEC-F is following (a13) or (a14) or (a15):
(a13) single strand dna shown in sequence 5 of sequence table；
(a14) sequence 5 of sequence table is from the DNA molecular shown in the 19th to 36 nucleotide of 5 ' end；
(a15) (a13) or (a14) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had identical
The DNA molecular of function；
Described primer ETEC-R is following (a16) or (a17) or (a18):
(a16) single strand dna shown in sequence 6 of sequence table；
(a17) sequence 6 of sequence table is from the DNA molecular shown in the 20th to 40 nucleotide of 5 ' end；
(a18) (a16) or (a17) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had identical
The DNA molecular of function.
2. the application of primer combination described in claim 1, for any one in following (b1) to (b6):
(b1) 3 kinds of calf diarrhea substances are differentiated；
(b2) preparation is for differentiating the test kit of 3 kinds of calf diarrhea substances；
(b3) detect whether pathogen to be measured is bovine viral diarrhea virus, bovine rota or enterotoxigenic escherichia coli；
(b4) preparation is used for detecting whether pathogen to be measured is bovine viral diarrhea virus, bovine rota or produces enterotoxin large intestine
The test kit of bacillus；
(b5) whether detection sample to be tested contains bovine viral diarrhea virus and/or bovine rota and/or product enterotoxin is big
Enterobacteria；
(b6) preparation is used for detecting in sample to be tested whether containing bovine viral diarrhea virus and/or bovine rota and/or product
The test kit of enterotoxic Escherichia coli；
Described 3 kinds of calf diarrhea substances are bovine viral diarrhea virus, bovine rota and enterotoxigenic escherichia coli.
3. contain the test kit of primer combination described in claim 1；The purposes of described test kit be following (c1) or (c2) or
(c3):
(c1) 3 kinds of calf diarrhea substances are differentiated；
(c2) detect whether pathogen to be measured is bovine viral diarrhea virus, bovine rota or enterotoxigenic escherichia coli；
(c3) whether detection sample to be tested contains bovine viral diarrhea virus and/or bovine rota and/or product enterotoxin is big
Enterobacteria；
Described 3 kinds of calf diarrhea substances are bovine viral diarrhea virus, bovine rota and enterotoxigenic escherichia coli.
4. the preparation method of test kit described in claim 3, including the step individually packed by each bar primer.
5. the method differentiating 3 kinds of calf diarrhea substances, comprises the steps (d1) or (d2):
(d1) nucleic acid of pathogen to be measured is carried out reverse transcription, obtains DNA profiling, use the combination of described primer to carry out PCR amplification,
If amplified production contains the DNA fragmentation of 308-310bp, pathogen to be measured is or candidate is bovine viral diarrhea virus, if
Amplified production contains the DNA fragmentation of 211-214bp, pathogen to be measured is or candidate is bovine rota, if amplified production contains
Have the DNA fragmentation of 252-254bp, pathogen to be measured for or candidate for enterotoxigenic escherichia coli；
(d2) detection whether contain in treating the genomic DNA of pathogen or cDNA primer described in claim 1 to the target sequence of I,
Described primer is to the target sequence of II or the described primer target sequence to III, if containing the described primer target to I in described cDNA
Sequence, pathogen to be measured are or candidate is bovine viral diarrhea virus, if containing the described primer target to II in described cDNA
Sequence, pathogen to be measured are or candidate is bovine rota, if containing the described primer target to III in described genomic DNA
Sequence, pathogen to be measured are or candidate is enterotoxigenic escherichia coli；
Described 3 kinds of calf diarrhea substances are bovine viral diarrhea virus, bovine rota and enterotoxigenic escherichia coli.
6. one kind is detected whether pathogen to be measured is bovine viral diarrhea virus, bovine rota or enterotoxigenic escherichia coli
Method, comprises the steps (e1) or (e2):
(e1) nucleic acid of pathogen to be measured is carried out reverse transcription, obtains DNA profiling, use the combination of described primer to carry out PCR amplification,
If amplified production contains the DNA fragmentation of 308-310bp, pathogen to be measured is or candidate is bovine viral diarrhea virus, if
Amplified production contains the DNA fragmentation of 211-214bp, pathogen to be measured is or candidate is bovine rota, if amplified production contains
Have the DNA fragmentation of 252-254bp, pathogen to be measured for or candidate for enterotoxigenic escherichia coli；
(e2) detection whether contain in treating the genomic DNA of pathogen or cDNA primer described in claim 1 to the target sequence of I,
Described primer is to the target sequence of II or the described primer target sequence to III, if containing the described primer target to I in described cDNA
Sequence, pathogen to be measured are or candidate is bovine viral diarrhea virus, if containing the described primer target to II in described cDNA
Sequence, pathogen to be measured are or candidate is bovine rota, if containing the described primer target to III in described genomic DNA
Sequence, pathogen to be measured are or candidate is enterotoxigenic escherichia coli.
7. whether a detection sample to be tested contains bovine viral diarrhea virus and/or bovine rota and/or produce enterotoxin
Colibacillary method, comprises the steps (f1) or (f2):
(f1) nucleic acid of sample to be tested is carried out reverse transcription, obtain DNA profiling, use the combination of described primer to carry out PCR amplification, as
Really amplified production contains the DNA fragmentation of 308-310bp, sample to be tested contains or doubtful containing bovine viral diarrhea virus, if
Amplified production contains the DNA fragmentation of 211-214bp, sample to be tested contains or doubtful containing bovine rota, if amplified production
DNA fragmentation containing 252-254bp, sample to be tested contain or doubtful containing enterotoxigenic escherichia coli；
(f2) whether the detection genomic DNA of sample to be tested or cDNA contain primer described in claim 1 to the target sequence of I,
Described primer is to the target sequence of II or the described primer target sequence to III, if containing the described primer target to I in described cDNA
Sequence, sample to be tested contain or doubtful containing bovine viral diarrhea virus, if containing described primer pair in described cDNA
The target sequence of II, sample to be tested contain or doubtful containing bovine rota, if drawn containing described in described genomic DNA
Target sequence, the sample to be tested of III are contained or doubtful containing enterotoxigenic escherichia coli by thing.
8. primer combination, for as follows (g1) or (g2):
(g1) the described primer in claim 1 to I or described primer to II or described primer to III；
(g2) the described primer in claim 1 to I, described primer to II and described primer to any two primer in III
To combination.
9. primer sets described in claim 8 is combined in the application preparing in test kit, and the purposes of described test kit is for differentiating bovine viral
Property diarrhea virus and/or bovine rota and/or enterotoxigenic escherichia coli.
10. containing the test kit of primer combination described in claim 8, the purposes of described test kit is for differentiating bovine viral diarrhea
Poison and/or bovine rota and/or enterotoxigenic escherichia coli.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610569470.9A CN106191310A (en) | 2016-07-19 | 2016-07-19 | A kind of primer combination simultaneously differentiating 3 kinds of calf diarrhea pathogen and GeXP detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610569470.9A CN106191310A (en) | 2016-07-19 | 2016-07-19 | A kind of primer combination simultaneously differentiating 3 kinds of calf diarrhea pathogen and GeXP detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106191310A true CN106191310A (en) | 2016-12-07 |
Family
ID=57493508
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610569470.9A Pending CN106191310A (en) | 2016-07-19 | 2016-07-19 | A kind of primer combination simultaneously differentiating 3 kinds of calf diarrhea pathogen and GeXP detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106191310A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754911A (en) * | 2017-03-22 | 2017-05-31 | 广西壮族自治区兽医研究所 | Primer sets and its application for identifying Mycoplasma bovis, bovine viral diarrhea virus and infectious bovine rhinotrachetis virus |
| CN106987657A (en) * | 2017-04-21 | 2017-07-28 | 广西壮族自治区兽医研究所 | For differentiating that the primer of bovine viral diarrhea virus and bovine rota is combined and its applied |
| CN117106985A (en) * | 2023-10-17 | 2023-11-24 | 苏州依科赛生物科技股份有限公司 | BVDV rapid detection kit and detection method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101063176A (en) * | 2007-05-23 | 2007-10-31 | 山东奥克斯生物技术有限公司 | Dual RT-PCR method and special reagent case for checking cattle rotavirus and cattle virus diarrhea virus simultaneously |
-
2016
- 2016-07-19 CN CN201610569470.9A patent/CN106191310A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101063176A (en) * | 2007-05-23 | 2007-10-31 | 山东奥克斯生物技术有限公司 | Dual RT-PCR method and special reagent case for checking cattle rotavirus and cattle virus diarrhea virus simultaneously |
Non-Patent Citations (3)
| Title |
|---|
| 智海东等: "感染性犊牛腹泻病原学的研究进展", 《黑龙江畜牧兽医》 * |
| 潘欣主编: "《医学生物侦检与防护技术概论》", 31 July 2011 * |
| 石莹等: "GeXP联合多重PCR系统在腹泻病毒检测中的应用", 《中华实验和临床病毒学杂志》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754911A (en) * | 2017-03-22 | 2017-05-31 | 广西壮族自治区兽医研究所 | Primer sets and its application for identifying Mycoplasma bovis, bovine viral diarrhea virus and infectious bovine rhinotrachetis virus |
| CN106754911B (en) * | 2017-03-22 | 2019-12-24 | 广西壮族自治区兽医研究所 | Primer group for identifying mycoplasma bovis, bovine viral diarrhea virus and infectious bovine rhinotracheitis virus and application thereof |
| CN106987657A (en) * | 2017-04-21 | 2017-07-28 | 广西壮族自治区兽医研究所 | For differentiating that the primer of bovine viral diarrhea virus and bovine rota is combined and its applied |
| CN106987657B (en) * | 2017-04-21 | 2020-06-09 | 广西壮族自治区兽医研究所 | Primer combination for identifying bovine virus diarrhea virus and bovine rotavirus and application thereof |
| CN117106985A (en) * | 2023-10-17 | 2023-11-24 | 苏州依科赛生物科技股份有限公司 | BVDV rapid detection kit and detection method thereof |
| CN117106985B (en) * | 2023-10-17 | 2024-01-26 | 苏州依科赛生物科技股份有限公司 | BVDV rapid detection kit and detection method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Belák | Molecular diagnosis of viral diseases, present trends and future aspects: A view from the OIE Collaborating Centre for the Application of Polymerase Chain Reaction Methods for Diagnosis of Viral Diseases in Veterinary Medicine | |
| CN106191309A (en) | A kind of primer combination simultaneously differentiating 8 kinds of cattle disease substances and GeXP detection method | |
| CN108192996B (en) | Multiple RT-RPA primer combination for detecting influenza A virus and parting H1 and H3 and application thereof | |
| CN110699489B (en) | Real-time fluorescence PCR detection primer probe set, kit and method for African swine fever virus CD2V gene | |
| WO2005121367A1 (en) | Diagnostic primers and method for detecting avian influenza virus subtype h5 and h5n1 | |
| CN105671201A (en) | Primer combination for identifying foot-and-mouth disease virus and vesicular stomatitis virus and application thereof | |
| CN107034316B (en) | System for simultaneously detecting 6 porcine viruses and LAMP primer special for system | |
| CN106636472B (en) | Complete set of reagent and method for detecting avian influenza virus and chicken parvovirus | |
| CN110724769A (en) | PCR primer group, kit and detection method for detecting African swine fever virus MGF360-505R gene | |
| Fulton et al. | Genomic and antigenic characterization of bovine parainfluenza-3 viruses in the United States including modified live virus vaccine (MLV) strains and field strains from cattle | |
| CN106191310A (en) | A kind of primer combination simultaneously differentiating 3 kinds of calf diarrhea pathogen and GeXP detection method | |
| Rashid et al. | Multiplex polymerase chain reaction for the detection and differentiation of avian influenza viruses and other poultry respiratory pathogens | |
| CN110656163A (en) | Double-label report fluorescent multiple pathogen nucleic acid detection method | |
| Agüero et al. | A fully automated procedure for the high-throughput detection of avian influenza virus by real-time reverse transcription–polymerase chain reaction | |
| CN110878381A (en) | Primer composition, kit and method for detecting mycoplasma bovis and infectious bovine rhinotracheitis virus | |
| CN101230404B (en) | Gene chip for synchronously detecting multiple hybrid infection viruses | |
| CN106987657B (en) | Primer combination for identifying bovine virus diarrhea virus and bovine rotavirus and application thereof | |
| CN110438260A (en) | A kind of African swine fever virus nucleic acid test strips detection kit | |
| CN101487064B (en) | Method and special reagent kit for detecting five zoonosis virus | |
| He et al. | Development of multiplex PCR for simultaneous detection and differentiation of six DNA and RNA viruses from clinical samples of sheep and goats | |
| Liao et al. | A highly adaptable platform powered by CRISPR-Cas12a to diagnose lumpy skin disease in cattle | |
| CN105969913A (en) | Primer combination and GeXP detection method for simultaneously identifying 5 bovine viral dermatitis viruses | |
| CN112831601A (en) | Primer probe set, kit and detection method for multiple detection of respiratory syncytial virus subtype based on fluorescent RMA method | |
| Kuriakose et al. | Detection of avian influenza viruses and differentiation of H5, H7, N1, and N2 subtypes using a multiplex microsphere assay | |
| KR20200056831A (en) | The primer set for detecting Influenza virus, a kit comprising the same, and detection method using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161207 |
|
| RJ01 | Rejection of invention patent application after publication |