CN105969913A - Primer combination and GeXP detection method for simultaneously identifying 5 bovine viral dermatitis viruses - Google Patents
Primer combination and GeXP detection method for simultaneously identifying 5 bovine viral dermatitis viruses Download PDFInfo
- Publication number
- CN105969913A CN105969913A CN201610567609.6A CN201610567609A CN105969913A CN 105969913 A CN105969913 A CN 105969913A CN 201610567609 A CN201610567609 A CN 201610567609A CN 105969913 A CN105969913 A CN 105969913A
- Authority
- CN
- China
- Prior art keywords
- virus
- primer
- sequence
- described primer
- measured
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer combination and GeXP detection method for simultaneously identifying 5 bovine viral dermatitis viruses. The primer combination is composed of a primer pair I, a primer pair II, a primer pair III, a primer pair IV and a primer pair V. The invention also discloses a GeXP detection method for simultaneously identifying foot-and-mouth disease virus, bluetongue virus, vesicular stomatitis virus, bovine viral diarrhoea virus and infectious bovine rhinotracheitis virus. The GeXP detection method can simultaneously identify the 5 bovine viral dermatitis viruses. The method has the characteristics of higher flux, higher specificity and higher sensitivity, can be used for monitoring of bovine disease epidemiology and differential diagnosis of unexpected epidemic situations, and ensures the healthy development of cattle raising industry.
Description
Technical field
The present invention relates to a kind of primer combination simultaneously differentiating 5 kinds of bovine viral dermatitis viruses and GeXP detection method.
Background technology
Foot and mouth disease virus (Foot and Mouth Disease Virus, FMDV), blue tongue virus (Bluetongue
Virus, BTV), vesicular stomatitis virus (Vesicular Stomatitis Virus, VSV), bovine viral abdomen
Diarrhea virus (Bovine Viral Diarrheal Virus, BVDV) and infectious bovine rhinotrachetis virus (Infectious
Bovine Rhinotracheitis Virus, IBRV) it is the 5 kinds of main viruses causing bovine viral dermatitis.Infect
The cattle of virus the most all shows as between oral cavity, mouth and nose, hoof, vaginal orifice and breast generation pathological changes, occur blister,
Erythema, cracking, necrosis and ulcer.The cattle foot and mouth disease caused by FMDV, the cattle vesicular stomatitis caused by VSV and by
The cattle bluetongue that BTV causes is the hyperacute infectious disease of cattle, general break out and spread, and mortality rate is high, by the world
Animal health tissue (OIE) is classified as A class infectious disease.BVDV and IBRV belongs to immunosuppressive disease virus, virus
Making immunity degradation, secondary bacterial infection, each province and city and infected zone spreads all over the country after infecting body, infection rate occupies
High.In cows, some cattle is BVDV carrier, and calver can cause birth persistent infection after infecting BVDV
Calf, they lifelong band poison persistently dissipate poison, cause the popular of disease.These diseases are the huge latent trouble of cattle-raising, one
Denier is broken out, it will cause huge economic loss.Owing to these 5 kinds of viruses are quite similar in clinical symptoms, it is difficult to distinguish,
Therefore need to set up a kind of high flux method for quick, bovine viral dermatitis virus is carried out Accurate Diagnosis.
It is a kind of novel high-throughout technique of gene detection that GeXP multi-gene expression analyzes system, by multiple PCR technique
It is effectively combined with capillary electrophoresis technique, uses fluorescent labeling universal primer and specific chimeric primer (i.e. base
Because specific primer 5 ' holds connection universal primer sequence) combine thus cause the amplification of multiple system, can be the most right
Up to 30 genes of interest effectively detect analysis, it is achieved high throughput testing truly differentiates multiple pathogens
Purpose.
Summary of the invention
It is an object of the invention to provide a kind of primer combination simultaneously differentiating 5 kinds of bovine viral dermatitis viruses and GeXP detection
Method.
The invention provides the combination of a kind of primer, by primer to I, primer to II, primer to III, primer is to IV and draws
V is formed by thing；
I is made up of by described primer primers F MDV-F and primers F MDV-R；
Described primers F MDV-F is following (a1) or (a2) or (a3):
(a1) single strand dna shown in sequence 1 of sequence table；
(a2) sequence 1 of sequence table is from the DNA molecular shown in the 19th to 36 nucleotide of 5 ' end；
(a3) by (a1) or (a2) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and tool
There is the DNA molecular of identical function；
Described primers F MDV-R is following (a4) or (a5) or (a6):
(a4) single strand dna shown in sequence 2 of sequence table；
(a5) sequence 2 of sequence table is from the DNA molecular shown in the 20th to 43 nucleotide of 5 ' end；
(a6) by (a4) or (a5) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and tool
There is the DNA molecular of identical function；
II is made up of by described primer primer BTV-F and primer BTV-R；
Described primer BTV-F is following (a7) or (a8) or (a9):
(a7) single strand dna shown in sequence 3 of sequence table；
(a8) sequence 3 of sequence table is from the DNA molecular shown in the 19th to 41 nucleotide of 5 ' end；
(a9) by (a7) or (a8) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and with
Sequence 3 has the DNA molecular of identical function；
Described primer BTV-R is following (a10) or (a11) or (a12):
(a10) single strand dna shown in sequence 4 of sequence table；
(a11) sequence 4 of sequence table is from the DNA molecular shown in the 20th to 37 nucleotide of 5 ' end；
(a12) by (a10) or (a11) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and
There is the DNA molecular of identical function；
III is made up of by described primer primer VSV-F and primer VSV-R；
Described primer VSV-F is following (a13) or (a14) or (a15):
(a13) single strand dna shown in sequence 5 of sequence table；
(a14) sequence 5 of sequence table is from the DNA molecular shown in the 19th to 38 nucleotide of 5 ' end；
(a15) by (a13) or (a14) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and
There is the DNA molecular of identical function；
Described primer VSV-R is following (a16) or (a17) or (a18):
(a16) single strand dna shown in sequence 6 of sequence table；
(a17) sequence 6 of sequence table is from the DNA molecular shown in the 20th to 38 nucleotide of 5 ' end；
(a18) by (a16) or (a17) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and
There is the DNA molecular of identical function；
IV is made up of by described primer primer BVDV-F and primer BVDV-R；
Described primer BVDV-F is following (a19) or (a20) or (a21):
(a19) single strand dna shown in sequence 7 of sequence table；
(a20) sequence 7 of sequence table is from the DNA molecular shown in the 19th to 36 nucleotide of 5 ' end；
(a21) by (a19) or (a20) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and
With the DNA molecular that sequence 7 has identical function；
Described primer BVDV-R is following (a22) or (a23) or (a24):
(a22) single strand dna shown in sequence 8 of sequence table；
(a23) sequence 8 of sequence table is from the DNA molecular shown in the 20th to 44 nucleotide of 5 ' end；
(a24) by (a22) or (a23) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and
There is the DNA molecular of identical function；
V is made up of by described primer primer I BRV-F and primer I BRV-R；
Described primer I BRV-F is following (a25) or (a26) or (a27):
(a25) single strand dna shown in sequence 9 of sequence table；
(a26) sequence 9 of sequence table is from the DNA molecular shown in the 19th to 41 nucleotide of 5 ' end；
(a27) by (a25) or (a26) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and
There is the DNA molecular of identical function；
Described primer I BRV-R is following (a28) or (a29) or (a30):
(a28) single strand dna shown in sequence 10 of sequence table；
(a29) sequence 10 of sequence table is from the DNA molecular shown in the 20th to 36 nucleotide of 5 ' end；
(a30) by (a28) or (a29) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and
There is the DNA molecular of identical function.
The purposes of described primer combination is any one in following (b1) to (b6):
(b1) 5 kinds of bovine viral dermatitis viruses are differentiated；
(b2) preparation is for differentiating the test kit of 5 kinds of bovine viral dermatitis viruses；
(b3) detect whether virus to be measured is foot and mouth disease virus, blue tongue virus, vesicular stomatitis virus, bovine viral
Property diarrhea virus or infectious bovine rhinotrachetis virus；
(b4) preparation be used for detecting virus to be measured be whether foot and mouth disease virus, blue tongue virus, vesicular stomatitis virus,
Bovine viral diarrhea virus or the test kit of infectious bovine rhinotrachetis virus；
(b5) whether detection sample to be tested contains foot and mouth disease virus and/or blue tongue virus and/or vesicular stomatitis is sick
Poison and/or bovine viral diarrhea virus and/or infectious bovine rhinotrachetis virus；
(b6) preparation is used for detecting in sample to be tested whether containing foot and mouth disease virus and/or blue tongue virus and/or blister
Property Stomatovirus and/or bovine viral diarrhea virus and/or the test kit of infectious bovine rhinotrachetis virus.
The present invention also protects the application that described primer combines, for any one in following (b1) to (b6):
(b1) 5 kinds of bovine viral dermatitis viruses are differentiated；
(b2) preparation is for differentiating the test kit of 5 kinds of bovine viral dermatitis viruses；
(b3) detect whether virus to be measured is foot and mouth disease virus, blue tongue virus, vesicular stomatitis virus, bovine viral
Property diarrhea virus or infectious bovine rhinotrachetis virus；
(b4) preparation be used for detecting virus to be measured be whether foot and mouth disease virus, blue tongue virus, vesicular stomatitis virus,
Bovine viral diarrhea virus or the test kit of infectious bovine rhinotrachetis virus；
(b5) whether detection sample to be tested contains foot and mouth disease virus and/or blue tongue virus and/or vesicular stomatitis is sick
Poison and/or bovine viral diarrhea virus and/or infectious bovine rhinotrachetis virus；
(b6) preparation is used for detecting in sample to be tested whether containing foot and mouth disease virus and/or blue tongue virus and/or blister
Property Stomatovirus and/or bovine viral diarrhea virus and/or the test kit of infectious bovine rhinotrachetis virus.
The present invention also protects the test kit combined containing described primer；The purposes of described test kit is following (c1) or (c2)
Or (c3):
(c1) 5 kinds of bovine viral dermatitis viruses are differentiated；
(c2) detect whether virus to be measured is foot and mouth disease virus, blue tongue virus, vesicular stomatitis virus, bovine viral
Property diarrhea virus or infectious bovine rhinotrachetis virus；
(c3) whether detection sample to be tested contains foot and mouth disease virus and/or blue tongue virus and/or vesicular stomatitis is sick
Poison and/or bovine viral diarrhea virus and/or infectious bovine rhinotrachetis virus；
Described 5 kinds of bovine viral dermatitis viruses are foot and mouth disease virus, blue tongue virus, vesicular stomatitis virus, cattle disease
Viral diarrhea virus and infectious bovine rhinotrachetis virus.
The present invention also protects the preparation method of described test kit, including the step individually packed by each bar primer.
The present invention also protects a kind of method differentiating 5 kinds of bovine viral dermatitis viruses, comprises the steps (d1) or (d2):
(d1) RNA of virus to be measured is carried out reverse transcription, obtain cDNA template, use the combination of described primer to carry out
PCR amplification (specifically can carry out GeXP multiplexed PCR amplification；Amplified production can carry out capillary electrophoresis detection), if
Amplified production contains the DNA fragmentation of 165-167bp, pathogen to be measured is or candidate is foot and mouth disease virus, if amplification
Product contains the DNA fragmentation of 135-137bp, pathogen to be measured is or candidate is blue tongue virus, if amplified production
DNA fragmentation containing 278-281bp, pathogen to be measured are or candidate is vesicular stomatitis virus, if amplified production
DNA fragmentation containing 308-310bp, pathogen to be measured are or candidate is bovine viral diarrhea virus, if amplification is produced
Thing contains the DNA fragmentation of 187-189bp, pathogen to be measured is or candidate is infectious bovine rhinotrachetis virus；
(d2) whether detection contains described primer to the target sequence of I, the described primer target to II in treating viral cDNA
Sequence, described primer to the target sequence of III, described primer to the target sequence of IV or the described primer target sequence to V, as
The target sequence of I, pathogen to be measured containing described primer are by the most described cDNA or candidate is foot and mouth disease virus, if
The target sequence of II, pathogen to be measured containing described primer are by described cDNA or candidate is blue tongue virus, if institute
State in cDNA containing described primer to the target sequence of III, pathogen to be measured for or candidate for vesicular stomatitis virus, if
The target sequence of IV, pathogen to be measured containing described primer are by described cDNA or candidate are bovine viral diarrhea virus,
If the target sequence of V, pathogen to be measured containing described primer being by described cDNA or candidate being cattle infectious rhinotracheitis
Scorching virus.
The present invention also protect a kind of detect virus to be measured be whether foot and mouth disease virus, blue tongue rims, vesicular stomatitis virus,
Bovine viral diarrhea virus or the method for infectious bovine rhinotrachetis virus, comprise the steps (e1) or (e2):
(e1) RNA of virus to be measured is carried out reverse transcription, obtain cDNA template, use the combination of described primer to carry out
PCR amplification (specifically can carry out GeXP multiplexed PCR amplification；Amplified production can carry out capillary electrophoresis detection), if
Amplified production contains the DNA fragmentation of 165-167bp, pathogen to be measured is or candidate is foot and mouth disease virus, if amplification
Product contains the DNA fragmentation of 135-137bp, pathogen to be measured is or candidate is blue tongue virus, if amplified production
DNA fragmentation containing 278-281bp, pathogen to be measured are or candidate is vesicular stomatitis virus, if amplified production
DNA fragmentation containing 308-310bp, pathogen to be measured are or candidate is bovine viral diarrhea virus, if amplification is produced
Thing contains the DNA fragmentation of 187-189bp, pathogen to be measured is or candidate is infectious bovine rhinotrachetis virus；
(e2) whether detection contains described primer to the target sequence of I, the described primer target to II in treating viral cDNA
Sequence, described primer to the target sequence of III, described primer to the target sequence of IV or the described primer target sequence to V, as
The target sequence of I, pathogen to be measured containing described primer are by the most described cDNA or candidate is foot and mouth disease virus, if
The target sequence of II, pathogen to be measured containing described primer are by described cDNA or candidate is blue tongue virus, if institute
State in cDNA containing described primer to the target sequence of III, pathogen to be measured for or candidate for vesicular stomatitis virus, if
The target sequence of IV, pathogen to be measured containing described primer are by described cDNA or candidate are bovine viral diarrhea virus,
If the target sequence of V, pathogen to be measured containing described primer being by described cDNA or candidate being cattle infectious rhinotracheitis
Scorching virus.
The present invention also protects in a kind of detection sample to be tested whether contain foot and mouth disease virus and/or blue tongue rims and/or blister
Property Stomatovirus and/or bovine viral diarrhea virus and/or the method for infectious bovine rhinotrachetis virus, including walking as follows
Suddenly (f1) or (f2):
(f1) RNA of sample to be tested is carried out reverse transcription, obtain cDNA template, use the combination of described primer to carry out
PCR amplification (specifically can carry out GeXP multiplexed PCR amplification；Amplified production can carry out capillary electrophoresis detection), if
Amplified production contains the DNA fragmentation of 165-167bp, sample to be tested contains or doubtful containing foot and mouth disease virus, if expanded
Thing contains the DNA fragmentation of 135-137bp, sample to be tested contains or doubtful containing blue tongue virus in volume increase, if amplification
Product contains the DNA fragmentation of 278-281bp, sample to be tested contains or doubtful containing vesicular stomatitis virus, if expanded
Volume increase thing contains the DNA fragmentation of 308-310bp, sample to be tested contains or doubtful containing bovine viral diarrhea virus, as
Really amplified production contains the DNA fragmentation of 187-189bp, sample to be tested contains or doubtful containing infectious bovine rhinotrachetis
Virus；
(f2) whether the cDNA of detection sample to be tested contains described primer to the target sequence of I, described primer to II's
Target sequence, described primer to the target sequence of III, described primer to the target sequence of IV or the described primer target sequence to V,
If target sequence, the sample to be tested of I contained or doubtful containing foot and mouth disease virus by described cDNA containing described primer,
If target sequence, the sample to be tested of II contained or doubtful sick containing bluetongue by described cDNA containing described primer
Poison, if contained or doubtful containing blister target sequence, the sample to be tested of III containing described primer in described cDNA
Property Stomatovirus, if target sequence, the sample to be tested of IV contained or doubtful containing described primer by described cDNA
Containing bovine viral diarrhea virus, if containing described primer to the target sequence of V, sample to be tested in described eDNA
Contain or doubtful containing infectious bovine rhinotrachetis virus.
The present invention also protects primer to combine, for as follows (g1) or (g2):
(g1) described primer to I or described primer to II or described primer to III or described primer to IV or described primer
To V；
(g2) described primer to I, described primer to II, described primer to III, described primer to IV and described primer
To the combination of any two primer pair in V, the combination of any three primers pair, the combination of any four primer pair.
The purposes of described primer combination for differentiate foot and mouth disease virus and/or blue tongue virus and/or vesicular stomatitis virus and
/ or bovine viral diarrhea virus and/or infectious bovine rhinotrachetis virus.
The present invention also protects the application that described primer combines, for differentiating foot and mouth disease virus and/or blue tongue virus and/or water
Bubble property Stomatovirus and/or bovine viral diarrhea virus and/or infectious bovine rhinotrachetis virus.
The present invention also protects the test kit combined containing described primer；The purposes of described test kit is for differentiating foot and mouth disease virus
And/or blue tongue virus and/or vesicular stomatitis virus and/or bovine viral diarrhea virus and/or cattle infectious rhinotracheitis
Scorching virus.
Described in any of the above, 5 kinds of bovine viral dermatitis viruses are foot and mouth disease virus, blue tongue virus, vesicular stomatitis disease
Poison, bovine viral diarrhea virus and infectious bovine rhinotrachetis virus.
The concretely FMDV O type inactivation of viruses of virus to be measured described in any of the above, FMDV A type inactivation of viruses, FMDV Asia
I type inactivation of viruses, VSV NJ type inactivation of viruses, VSV IND type inactivation of viruses, BTV 4 type inactivation of viruses, BTV 8
Type inactivation of viruses, BTV 9 type inactivation of viruses, BTV 15 type inactivation of viruses, BTV 17 type inactivation of viruses, BTV 18 type go out
Live virus, BVDV Reference strains Oregon CV24 strain (BVDV-1 type), BVDV Reference strains NADL strain (BVDV-1
Type), BVDV Reference strains yak strain (BVDV-1 type), BRV Reference strains NCDV, BRV Reference strains BRV014,
IBRV virus, BVDV strain GX-BVDV1, BVDV strain GX-BVDV2, BVDV strain GX-BVDV3, BVDV strain
GX-BVDV4, BVDV strain GX-BVDV5, BVDV strain GX-BVDV6, BVDV strain GX-BVDV7, BVDV strain
GX-BVDV8, BVDV strain GX-BVDV9, BVDV strain GX-BVDV10, BVDV strain GX-BVDV11, BVDV strain
GX-BVDV12, BVDV strain GX-BVDV13 or BVDV strain GX-041.
" the described primer target sequence to I " described in any of the above is concretely following (h1) or (h2) or (h3):
(h1) DNA molecular shown in sequence 18 of sequence table；(h1) sequence 18 of sequence table from 5 ' ends the 19th to
DNA molecular shown in 146 nucleotide；(h3) there is the DNA molecular of more than 98% homology with (h1) or (h2).
" the described primer target sequence to II " described in any of the above is concretely following (h4) or (h5) or (h6):
(h4) DNA molecular shown in sequence 19 of sequence table；(h5) sequence 19 of sequence table from 5 ' ends the 19th to
DNA molecular shown in 117 nucleotide；(h6) there is the DNA molecular of more than 98% homology with (h4) or (h5).
" the described primer target sequence to III " described in any of the above is concretely following (h7) or (h8) or (h9):
(h7) DNA molecular shown in sequence 20 of sequence table；(h8) sequence 20 of sequence table from 5 ' ends the 19th to
DNA molecular shown in 259 nucleotide；(h9) there is the DNA molecular of more than 98% homology with (h7) or (h8).
" the described primer target sequence to IV " described in any of the above is concretely following (h10) or (h11) or (h12):
(h10) DNA molecular shown in sequence 21 of sequence table；(h11) sequence 21 of sequence table is from 5 ' ends the 19th
To the DNA molecular shown in 289 nucleotide；(h12) there is the DNA of more than 98% homology with (h10) or (h11)
Molecule.
" the described primer target sequence to V " described in any of the above is concretely following (h13) or (h14) or (h15):
(h13) DNA molecular shown in sequence 22 of sequence table；(h14) sequence 22 of sequence table is from 5 ' ends the 19th
To the DNA molecular shown in 169 nucleotide；(h15) there is the DNA of more than 98% homology with (h13) or (h14)
Molecule.
The concretely Faecal swabs of sample to be tested described in any of the above, eye swab, snotter swab, anticoagulation, esophagus-
Pharyngeal secretions, blister fluid, rectal mucosal tissue sample, blister skin tissue samples or lymph node tissue sample.
In the reaction system of GeXP multiplexed PCR amplification described in any of the above, the concentration of each bar primer in primer combination is such as
Under: the concentration of FMDV-F and FMDV-R is the concentration of 0.2 μm ol/ μ L, BTV-F and BTV-R and is 0.2 μm ol/
The concentration of μ L, VSV-F and VSV-R is the concentration of 0.2 μm ol/ μ L, BVDV-F and BVDV-R and is 2 μm ol/
The concentration of μ L, IBRV-F and IBRV-R is 0.2 μm ol/ μ L.
The reaction system (20 μ L) of GeXP multiplexed PCR amplification described in any of the above is concretely: template 1 μ L
(10-100ng), (buffer is contained within leading to Genome Lab GeXP Starter Kit 5 × buffer 4 μ L
With primer, universal primer is by the primer B shown in the sequence 17 of the primer A shown in the sequence 16 of sequence table and sequence table
Composition, wherein 5 ' the ends of primer A have the labelling of CY5 fluorophor, primer A and the working concentration of primer B
It is 0.25 μM), MgCl2(25 μMs) 4 μ L, the primer mixture 1 μ L of all primers in combining containing primer,
DNA polymerase 10U, complements to 20 μ L with ultra-pure water.
The response procedures of GeXP multiplexed PCR amplification described in any of the above is concretely: 95 DEG C of 5 minutes denaturations；94℃
30 seconds, 55 DEG C 30 seconds, 72 DEG C 30 seconds, 10 circulations；94 DEG C 30 seconds, 68 DEG C 30 seconds, 72 DEG C 30 seconds,
10 circulations；94 DEG C 30 seconds, 50 DEG C 30 seconds, 72 DEG C 30 seconds, 10 circulations；72 DEG C extend 5min, terminate
Reaction.
The deposition condition of capillary electrophoresis described in any of the above is: 90 DEG C 120 seconds, degeneration；2.0KV 30 seconds, inhales
Enter sample；6.0KV 35 minutes, separates sample.
The GeXP detection method that the present invention sets up can differentiate foot and mouth disease virus, blue tongue virus, vesicular stomatitis simultaneously
Virus, bovine viral diarrhea virus and 5 kinds of bovine viral dermatitis viruses of infectious bovine rhinotrachetis virus.This method has
There is the feature that high flux, specificity and sensitivity are higher, can be used for the EPDML monitoring of cattle disease and the mirror of SARS Epidemic
Do not diagnose, ensure the sound development of cattle-raising.
Accompanying drawing explanation
Fig. 1 is the multiplexed PCR amplification result figure of each sample to be tested in embodiment 2.
Fig. 2 is the multiplexed PCR amplification result figure of 5 kinds of bovine viral dermatitis virus mixing samples in embodiment 2.
The amplification figure of multiplex PCR when Fig. 3 is to use reaction system 1-5 in embodiment 5.
Detailed description of the invention
Below example facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiment
Method, if no special instructions, is conventional method.Test material used in following embodiment, if no special instructions,
It is and is commercially available from routine biochemistry reagent shop.Quantitative test in following example, is respectively provided with three times and repeats in fact
Test, results averaged.
FMDV O type inactivation of viruses, FMDV A type inactivation of viruses, FMDV Asia I type inactivation of viruses, BTV 4 type inactivate
Virus, BTV 8 type inactivation of viruses, BTV 9 type inactivation of viruses, BTV 15 type inactivation of viruses, BTV 17 type inactivation of viruses,
BTV 18 type inactivation of viruses, VSV NJ type inactivation of viruses, VSV IND type inactivation of viruses: list of references: Qin Min, Zou Feng
, Yang Yunqing, etc. bluetongue, foot and mouth disease, PPR and the foundation of vesicular stomatitis multi-PCR detection method
[J]. animal medicine is in progress, and 2015,36 (9): 18-22.；By Yunnan, Entry-Exit Inspection and Quarantine Bureau give, and the public can be from
Veterinary Institute of Guangxi Zhuang Autonomous Region obtains.
BVDV Reference strains Oregon CV24 strain (BVDV-1 type): China Veterinery Drug Inspection Office, article No.: AV69.
BVDV Reference strains NADL strain (BVDV-1 type): China Veterinery Drug Inspection Office, article No.: AV67.
BVDV Reference strains yak strain (BVDV-1 type): China Veterinery Drug Inspection Office, article No.: AV68.
IBRV virus: veterinary microorganism culture presevation administrative center of China, article No.: AV21.
BVDV strain GX-BVDV1, BVDV strain GX-BVDV2, BVDV strain GX-BVDV3, BVDV strain GX-BVDV4,
BVDV strain GX-BVDV5, BVDV strain GX-BVDV6, BVDV strain GX-BVDV7, BVDV strain GX-BVDV8,
BVDV strain GX-BVDV9, BVDV strain GX-BVDV10, BVDV strain GX-BVDV11, BVDV strain GX-BVDV12,
BVDV strain GX-BVDV13, BVDV strain GX-041: list of references: Fan Q, Xie Z, Xie L, et al.A
reverse transcription loop-mediated isothermal amplification method for rapid
Detection of bovine viral diarrhea virus [J] .Journal of Virological Methods,
2012,186 (1-2): 43-48.；The public can obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region.
Genome Lab GeXP Starter Kit 5 × buffer: wherein drawing shown in the sequence 16 containing ordered list
The primer B shown in sequence 17 of thing A and sequence table, wherein 5 ' the ends of primer A have the labelling of CY5 fluorophor；Beautiful
Beckman Coulter Inc. of state.
Sample buffer: Beckman Coulter Inc. of the U.S., article No.: M409196.
DNA size standard kit-400 Base Pairs: Beckman Coulter Inc. of U.S. product, article No.:
608098。
DNA polymerase: SIGMA company of the U.S., article No.: D4184-1.5KU.
MgCl2(25 μMs): SIGMA company of the U.S., article No.: M8787-1.5ML.
EasyPure Viral DNA/RNA Kit: Beijing Quanshijin Biotechnology Co., Ltd, article No.: ER201-01.
The design of embodiment 1, primer combination and preparation
Carry out a large amount of sequence analysis, comparison obtains for differentiating 5 kinds of cattle of FMDV, BTV, VSV, BVDV and IBRV
Some primers of viral dermatitis virus.Each primer is carried out preliminary experiment, compares the performance such as sensitivity, specificity,
Finally give 5 pairs of specific primers for differentiating 5 kinds of bovine viral dermatitis viruses.Each specific primer pair, just
Forming by targeting section and universal primer section to primer and reverse primer, universal primer section is positioned at targeting section
5 ' ends.
For identifying that the primer of FMDV forms (5 ' → 3 ') by following two primers:
FMDV-F (sequence 1 of sequence table):AGGTGACACTATAGAATAGCCGTGGGACCATACAGG；
FMDV-R (sequence 2 of sequence table):GTACGACTCACTATAGGGAAAGTGATCTGTAGCTTGGAATCTC。
Underscore part is universal primer section.
For identifying that the primer of BTV forms (5 ' → 3 ') by following two primers:
BTV-F (sequence 3 of sequence table):AGGTGACACTATAGAATAAGGGTAACTCACAGCAAACTCAA；
BTV-R (sequence 4 of sequence table):GTACGACTCACTATAGGGAGAGCAGCCTGTCCATCCC。
Underscore part is universal primer section.
For identifying that the primer of VSV forms (5 ' → 3 ') by following two primers:
VSV-F (sequence 5 of sequence table):AGGTGACACTATAGAATAAAACTACTGGACGGGCTTGA；
VSV-R (sequence 6 of sequence table):GTACGACTCACTATAGGGATGAGATGCCCAAATGTTGC。
Underscore part is universal primer section.
For identifying that the primer of BVDV forms (5 ' → 3 ') by following two primers:
BVDV-F (sequence 7 of sequence table):AGGTGACACTATAGAATAGTGAGTTCGTTGGATGGC；
BVDV-R (sequence 8 of sequence table):GTACGACTCACTATAGGGATATGTTTTGTATAAGAGTTCATTTG。
Underscore part is universal primer section.
For identifying that the primer of ETEC forms (5 ' → 3 ') by following two primers:
IBRV-F (sequence 9 of sequence table):AGGTGACACTATAGAATAGCGTCATTTACAAGGAGAACATC；
IBRV-R (sequence 10 of sequence table):GTACGACTCACTATAGGGAATCTCGCCCATGCCCAC。
Underscore part is universal primer section.
For identify the primer of FMDV to named primer to I.
For identify the primer of BTV to named primer to II.
For identify the primer of VSV to named primer to III.
For identify the primer of BVDV to named primer to IV.
For identify the primer of IBRV to named primer to V.
Above-mentioned each primer is to composition primer combination.
Embodiment 2, specificity
One, single template experiment
1, extract the total serum IgE of sample to be tested, and reverse transcription is cDNA.Sample to be tested is respectively as follows: FMDV O type inactivation disease
Poison, BTV 4 type inactivation of viruses, VSV NJ type inactivation of viruses, BVDV Reference strains Oregon CV24 strain (BVDV-1 type),
IBRV virus.
2, the cDNA obtained with step 1 respectively is as template, uses the primer combination of embodiment 1 to carry out GeXP multiplex PCR.
The reaction system (20 μ L) of multiplex PCR: template 1 μ L (about 100ng), Genome Lab GeXP Starter
(buffer is contained within universal primer to Kit 5 × buffer 4 μ L, and universal primer is by shown in the sequence 16 of sequence table
Primer A and sequence table the primer B shown in sequence 17 composition, wherein 5 ' the ends of primer A have CY5 fluorescence
The labelling of group, the working concentration of primer A and primer B is 0.25 μM), MgCl2(25 μMs) 4 μ L, contains
Primer mixture 1 μ L, the DNA polymerase 10U of all primers in primer combination, complements to ultra-pure water
20μL.In the reaction system of multiplex PCR, the concentration of FMDV-F and FMDV-R is 0.2 μm ol/ μ L, BTV-F
The concentration being 0.2 μm ol/ μ L, VSV-F and VSV-R with the concentration of BTV-R is 0.2 μm ol/ μ L, BVDV-F
The concentration being 2 μm ol/ μ L, IBRV-F and IBRV-R with the concentration of BVDV-R is 0.2 μm ol/ μ L.If
Put the negative control using equal-volume water as template.
The response procedures of multiplex PCR: 95 DEG C of 5 minutes denaturations；94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 30 seconds,
10 circulations；94 DEG C 30 seconds, 68 DEG C 30 seconds, 72 DEG C 30 seconds, 10 circulations；94 DEG C 30 seconds, 50 DEG C 30
Second, 72 DEG C 30 seconds, 10 circulations；72 DEG C extend 5min, terminate reaction.
3, the multiplexed PCR amplification product of step 2 is carried out capillary electrophoresis, concretely comprise the following steps: by 3 μ L multiplex PCRs
Amplified production, 38.75 μ L sample buffer and 0.25 μ L DNA size standardkit-400 Base Pairs
Whirlpool concussion mixing, in additions in model, every hole drips 1 dropstone and seals with wax and close liquid level, it is to avoid Methanamide aoxidizes and sample
Evaporation.On buffer plate, every hole adds the sample buffer of 180 μ L, carries out capillary electrophoresis.Capillary electrophoresis bar
Part: 90 DEG C 120 seconds, degeneration；2.0KV 30 seconds, sucks sample；6.0KV 35 minutes, separates sample.No
Separating in electrophoresis with the PCR primer of size fragment, the fluorophor that instrument is carried by detection PCR primer recognizes it
Clip size and signal intensity.After electrophoresis completes, instrument is used to carry software Express Profiler software
Analysis result.
Judge according to electrophoresis result, it is judged that standard is: the amplification sheet of 5 kinds of bovine viral dermatitis virus genes of interest
Disconnected size is respectively as follows: FMDV:165-167bp, BTV:135-137bp, VSV:278-281bp, BVDV:308-310
Bp, IBRV:187-189bp.Due to the error of the system of GeXP own, am-plified fragments size and theoretical value existence ± 2bp
Deviation belongs to correct result.
Electrophoresis result is as shown in Figure 1.In Fig. 1, abscissa represents clip size (unit is bp), and vertical coordinate represents
The content of signal intensity, i.e. pcr amplification product.Figure 1A is the multiplexed PCR amplification of FMDV O type inactivation of viruses cDNA
As a result, amplification obtains the DNA fragmentation of 165.03bp.Figure 1B is the multiplex PCR of BTV 4 type inactivation of viruses cDNA
Amplification, amplification obtains the DNA fragmentation of 136.72bp.Fig. 1 C is the multiple of VSV NJ type inactivation of viruses cDNA
PCR amplification, amplification obtains the DNA fragmentation of 278.04bp.Fig. 1 D is BVDV Reference strains Oregon CV24
The multiplexed PCR amplification result of strain (BVDV-1 type) cDNA, amplification obtains the DNA fragmentation of 309.58bp.Fig. 1 F is
The multiplexed PCR amplification result of IBRV virus genom DNA, amplification obtains the DNA fragmentation of 188.21bp.Each instead
Should only occur that specificity is unimodal, without other signal peak, and clip size is consistent with criterion.Negative control is all without expanding
Increase, without purpose signal peak.
Two, hybrid template experiment
1, extract the total serum IgE of sample to be tested, and reverse transcription is cDNA.Sample to be tested is respectively as follows: FMDV O type inactivation disease
Poison, BTV 4 type inactivation of viruses, VSV NJ type inactivation of viruses, BVDV Reference strains Oregon CV24 strain (BVDV-1 type),
IBRV virus.
2,5 kinds of cDNA mixing step 1 obtained.
3, the mixed liquor obtained with step 2 is as template, uses the primer combination of embodiment 1 to carry out GeXP multiplex PCR.
The reaction system (20 μ L) of multiplex PCR: template 1 μ L, Genome Lab GeXP Starter Kit 5 × buffer
(buffer is contained within universal primer to 4 μ L, and universal primer is by the primer A shown in the sequence 16 of sequence table and sequence table
The primer B shown in sequence 17 composition, wherein 5 ' the ends of primer A have the labelling of CY5 fluorophor, primer
The working concentration of A and primer B is 0.25 μM), MgCl2(25 μMs) 4 μ L, all drawing in combining containing primer
Primer mixture 1 μ L, the DNA polymerase 10U of thing, complements to 20 μ L with ultra-pure water.Multiplex PCR
In reaction system, the concentration that the concentration of FMDV-F and FMDV-R is 0.2 μm ol/ μ L, BTV-F and BTV-R is equal
It is that the concentration of 0.2 μm ol/ μ L, VSV-F and VSV-R is the dense of 0.2 μm ol/ μ L, BVDV-F and BVDV-R
Degree is the concentration of 2 μm ol/ μ L, IBRV-F and IBRV-R and is 0.2 μm ol/ μ L.Arrange and make with equal-volume water
Negative control for template.
In 1 μ L template, the cDNA of cDNA about 100ng, the BTV 4 type inactivation of viruses of FMDV O type inactivation of viruses is about
The cDNA of 100ng, VSV NJ type inactivation of viruses is about 100ng, BVDV Reference strains Oregon CV24 strain (BVDV-1
Type) cDNA be about 100ng, IBRV virus cDNA be about 100ng.
The response procedures of multiplex PCR: 95 DEG C of 5 minutes denaturations；94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 30 seconds,
10 circulations；94 DEG C 30 seconds, 68 DEG C 30 seconds, 72 DEG C 30 seconds, 10 circulations；94 DEG C 30 seconds, 50 DEG C 30
Second, 72 DEG C 30 seconds, 10 circulations；72 DEG C extend 5min, terminate reaction.
4, the multiplexed PCR amplification product of step 3 is carried out capillary electrophoresis, concretely comprise the following steps: by 3 μ L multiplex PCRs
Amplified production, 38.75 μ L sample buffer and 0.25 μ L DNA size standard kit-400 Base Pairs
Whirlpool concussion mixing, in additions in model, every hole drips 1 dropstone and seals with wax and close liquid level, it is to avoid Methanamide aoxidizes and sample
Evaporation.On buffer plate, every hole adds the sample buffer of 180 μ L, carries out capillary electrophoresis.Capillary electrophoresis bar
Part: 90 DEG C 120 seconds, degeneration；2.0KV 30 seconds, sucks sample；6.0KV 35 minutes, separates sample.No
Separating in electrophoresis with the PCR primer of size fragment, the fluorophor that instrument is carried by detection PCR primer recognizes it
Clip size and signal intensity.After electrophoresis completes, instrument is used to carry software Express Profiler software
Analysis result.
Judge according to electrophoresis result, it is judged that standard is: the amplification sheet of 5 kinds of bovine viral dermatitis virus genes of interest
Disconnected size is respectively as follows: FMDV:165-167bp, BTV:135-137bp, VSV:278-281bp, BVDV:308-310
Bp, IBRV:187-189bp.Due to the error of the system of GeXP own, am-plified fragments size and theoretical value existence ± 2bp
Deviation belongs to correct result.
Testing result is as shown in Figure 2.In Fig. 2, abscissa represents clip size (unit is bp), and vertical coordinate represents
The content of signal intensity, i.e. pcr amplification product.Result shows, uses GeXP multiplex PCR can detect 5 simultaneously
Plant 5 kinds of signal peaks that bovine viral dermatitis virus is corresponding, FMDV:166.17bp, BTV:136.85bp, VSV:280.45
Bp, BVDV:309.67bp, IBRV:188.02bp, without other miscellaneous peak.Negative control all without amplification, is believed without purpose
Number peak value.
Embodiment 3, universality
1, extract the total serum IgE of sample to be tested, and reverse transcription is cDNA.Sample to be tested is respectively as follows:: FMDV O type inactivation disease
Poison, FMDV A type inactivation of viruses, FMDV Asia I type inactivation of viruses, BTV 4 type inactivation of viruses, BTV 8 type inactivation disease
Poison, BTV 9 type inactivation of viruses, BTV 15 type inactivation of viruses, BTV 17 type inactivation of viruses, BTV 18 type inactivation of viruses,
VSV NJ type inactivation of viruses, VSV IND type inactivation of viruses, BVDV Reference strains Oregon CV24 strain (BVDV-1 type),
BVDV Reference strains NADL strain (BVDV-1 type), BVDV Reference strains yak strain (BVDV-1 type), BVDV strain
GX-BVDV1, BVDV strain GX-BVDV2, BVDV strain GX-BVDV3, BVDV strain GX-BVDV4, BVDV strain
GX-BVDV5, BVDV strain GX-BVDV6, BVDV strain GX-BVDV7, BVDV strain GX-BVDV8, BVDV strain
GX-BVDV9, BVDV strain GX-BVDV10, BVDV strain GX-BVDV11, BVDV strain GX-BVDV12, BVDV strain
GX-BVDV13, BVDV strain GX-041, IBRV virus.
2, the cDNA obtained with step 1 respectively is as template, uses the primer combination of embodiment 1 to carry out GeXP multiplex PCR.
The reaction system (20 μ L) of multiplex PCR: template 1 μ L (about 100ng), Genome Lab GeXP Starter
(buffer is contained within universal primer to Kit 5 × buffer 4 μ L, and universal primer is by shown in the sequence 16 of sequence table
Primer A and sequence table the primer B shown in sequence 17 composition, wherein 5 ' the ends of primer A have CY5 fluorescence
The labelling of group, the working concentration of primer A and primer B is 0.25 μM), MgCl2(25 μMs) 4 μ L, contains
Primer mixture 1 μ L, the DNA polymerase 10U of all primers in primer combination, complements to ultra-pure water
20μL.In the reaction system of multiplex PCR, the concentration of FMDV-F and FMDV-R is 0.2 μm ol/ μ L, BTV-F
The concentration being 0.2 μm ol/ μ L, VSV-F and VSV-R with the concentration of BTV-R is 0.2 μm ol/ μ L, BVDV-F
The concentration being 2 μm ol/ μ L, IBRV-F and IBRV-R with the concentration of BVDV-R is 0.2 μm ol/ μ L.If
Put the negative control using equal-volume water as template.
The response procedures of multiplex PCR: 95 DEG C of 5 minutes denaturations；94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 30 seconds,
10 circulations；94 DEG C 30 seconds, 68 DEG C 30 seconds, 72 DEG C 30 seconds, 10 circulations；94 DEG C 30 seconds, 50 DEG C 30
Second, 72 DEG C 30 seconds, 10 circulations；72 DEG C extend 5min, terminate reaction.
3, the multiplexed PCR amplification product of step 2 is carried out capillary electrophoresis, concretely comprise the following steps: by 3 μ L multiplex PCRs
Amplified production, 38.75 μ L sample buffer and 0.25 μ L DNA size standard kit-400 Base Pairs
Whirlpool concussion mixing, in additions in model, every hole drips 1 dropstone and seals with wax and close liquid level, it is to avoid Methanamide aoxidizes and sample
Evaporation.On buffer plate, every hole adds the sample buffer of 180 μ L, carries out capillary electrophoresis.Capillary electrophoresis bar
Part: 90 DEG C 120 seconds, degeneration；2.0KV 30 seconds, sucks sample；6.0KV 35 minutes, separates sample.No
Separating in electrophoresis with the PCR primer of size fragment, the fluorophor that instrument is carried by detection PCR primer recognizes it
Clip size and signal intensity.After electrophoresis completes, instrument is used to carry software Express Profiler software
Analysis result.
Judge according to electrophoresis result, it is judged that standard is: the amplification sheet of 5 kinds of bovine viral dermatitis virus genes of interest
Disconnected size is respectively as follows: FMDV:165-167bp, BTV:135-137bp, VSV:278-281bp, BVDV:308-310
Bp, IBRV:187-189bp.Due to the error of the system of GeXP own, am-plified fragments size and theoretical value existence ± 2bp
Deviation belongs to correct result.
The primer combination using embodiment 1 is treated test sample and is originally carried out multiplexed PCR amplification, and each sample only occurs corresponding sick
The specificity of substance is unimodal, and without other signal peaks, and clip size is consistent with criterion, and result shows, embodiment
The primer combination of 1 design is generally applicable to 5 kinds of bovine viral dermatitis viruses.
Prepared by embodiment 4, plasmid standard
FMDV standard substance: be connected with pMD-18T carrier by the double chain DNA molecule shown in the sequence 11 of sequence table, obtain weight
Group plasmid (named FMDV standard substance).
BTV standard substance: the double chain DNA molecule shown in the sequence 12 of sequence table is connected with pMD-18T carrier, is recombinated
Plasmid (named BTV standard substance).
VSV standard substance: the double chain DNA molecule shown in the sequence 13 of sequence table is connected with pMD-18T carrier, is recombinated
Plasmid (named VSV standard substance).
BVDV standard substance: be connected with pMD-18T carrier by the double chain DNA molecule shown in the sequence 14 of sequence table, obtain weight
Group plasmid (named BVDV standard substance).
IBRV standard substance: be connected with pMD-18T carrier by the double chain DNA molecule shown in the sequence 15 of sequence table, obtain weight
Group plasmid (named IBRV standard substance).
Embodiment 5, sensitivity
1, FMDV standard substance, BTV standard substance, VSV standard substance, BVDV standard substance and the IBRV standard of 4 preparations will be implemented
The copy number mixing such as product, obtain mixed liquor.
2, ddH is used2The mixed liquor that 10 times of gradient dilution steps 2 of O obtain, obtains each diluent.
3, diluent step 2 obtained is as template, uses the primer combination of embodiment 1 preparation to carry out GeXP many
Weight PCR.
The reaction system (20 μ L) of multiplex PCR: template 1 μ L (about 100ng), Genome Lab GeXP Starter
(buffer is contained within universal primer to Kit 5 × buffer 4 μ L, and universal primer is by shown in the sequence 16 of sequence table
Primer A and sequence table the primer B shown in sequence 17 composition, wherein 5 ' the ends of primer A have CY5 fluorescence
The labelling of group, the working concentration of primer A and primer B is 0.25 μM), MgCl2(25 μMs) 4 μ L, contains
Primer mixture 1 μ L, the DNA polymerase 10U of all primers in primer combination, complements to ultra-pure water
20μL.In the reaction system of multiplex PCR, the concentration of FMDV-F and FMDV-R is 0.2 μm ol/ μ L, BTV-F
The concentration being 0.2 μm ol/ μ L, VSV-F and VSV-R with the concentration of BTV-R is 0.2 μm ol/ μ L, BVDV-F
The concentration being 2 μm ol/ μ L, IBRV-F and IBRV-R with the concentration of BVDV-R is 0.2 μm ol/ μ L.If
Put the negative control using equal-volume water as template.
The dilution factor of the diluent owing to using is different, forms the most different reaction systems:
In reaction system 1, FMDV standard substance, BTV standard substance, VSV standard substance, BVDV standard substance and IBRV standard
The initial concentration of product is 106Copy/μ L；
In reaction system 2, FMDV standard substance, BTV standard substance, VSV standard substance, BVDV standard substance and IBRV standard
The initial concentration of product is 105Copy/μ L；
In reaction system 3, FMDV standard substance, BTV standard substance, VSV standard substance, BVDV standard substance and IBRV standard
The initial concentration of product is 104Copy/μ L；
In reaction system 4, FMDV standard substance, BTV standard substance, VSV standard substance, BVDV standard substance and IBRV standard
The initial concentration of product is 103Copy/μ L；
In reaction system 5, FMDV standard substance, BTV standard substance, VSV standard substance, BVDV standard substance and IBRV standard
The initial concentration of product is 102Copy/μ L；
In reaction system 6, FMDV standard substance, BTV standard substance, VSV standard substance, BVDV standard substance and IBRV standard
The initial concentration of product is 10 copies/μ L；
In reaction system 7, FMDV standard substance, BTV standard substance, VSV standard substance, BVDV standard substance and IBRV standard
The initial concentration of product is 1 copy/μ L.
The response procedures of multiplex PCR: 95 DEG C of 5 minutes denaturations；94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 30 seconds,
10 circulations；94 DEG C 30 seconds, 68 DEG C 30 seconds, 72 DEG C 30 seconds, 10 circulations；94 DEG C 30 seconds, 50 DEG C 30
Second, 72 DEG C 30 seconds, 10 circulations；72 DEG C extend 5min, terminate reaction.
4, the multiplexed PCR amplification product of step 3 is carried out capillary electrophoresis, concretely comprise the following steps: by 3 μ L multiplex PCRs
Amplified production, 38.75 μ L sample buffer and 0.25 μ L DNA size standard kit-400 Base Pairs
Whirlpool concussion mixing, in additions in model, every hole drips 1 dropstone and seals with wax and close liquid level, it is to avoid Methanamide aoxidizes and sample
Evaporation.On buffer plate, every hole adds the sample buffer of 180 μ L, carries out capillary electrophoresis.Capillary electrophoresis bar
Part: 90 DEG C 120 seconds, degeneration；2.0KV 30 seconds, sucks sample；6.0KV 35 minutes, separates sample.No
Separating in electrophoresis with the PCR primer of size fragment, the fluorophor that instrument is carried by detection PCR primer recognizes it
Clip size and signal intensity.After electrophoresis completes, instrument is used to carry software Express Profiler software
Analysis result.
Judge according to electrophoresis result, it is judged that standard is: the amplification sheet of 5 kinds of bovine viral dermatitis virus genes of interest
Disconnected size is respectively as follows: FMDV:165-167bp, BTV:135-137bp, VSV:278-281bp, BVDV:308-310
Bp, IBRV:187-189bp.Due to the error of the system of GeXP own, am-plified fragments size and theoretical value existence ± 2bp
Deviation belongs to correct result.
Testing result is as shown in Figure 3.The amplification knot of multiplex PCR when Fig. 3 A-3E is corresponding in turn to use reaction system 1-5
Really, in Fig. 3, abscissa represents clip size (unit is bp), and vertical coordinate represents signal intensity, i.e. PCR expands
The content of product.Result shows, as the concentration as little as 100 copy/μ L of DNA to be measured in detection system, it is also possible to
Detect 5 kinds of bovine viral dermatitis viruses.
Embodiment 5, clinical sample detect
Sample to be tested is: 305 parts of clinical samples, and including 156 parts of Faecal swabs, 30 parts of eye swab, 30 parts of noses glue
Liquid swab, 70 parts of anticoagulations, 2 parts of OP liquid (esophagus-pharyngeal secretions), 2 parts of blister fluid, 15 parts of tissue samples (10
Part rectal mucosa, 2 parts of blister skins, 3 parts of lymph nodes).Clinical sample is collected in various places, 2012-2014 Guangxi, and about 1/2
Sample source, become thin in having diarrhoea in the asymptomatic milch cow in cattle farm, various places, the sample source of about 1/4, rhinorrhea etc.
The cattle of clinical symptoms, 1/4 sample source does not sticks up in having spirit, dysphagia, fever, and blister occurs in oral erosion,
The cattle of mouth and nose foam.
1, extract sample to be tested total serum IgE and reverse transcription obtains cDNA.
2, cDNA step 1 obtained is as template, uses the primer combination of embodiment 1 preparation to carry out GeXP
Multiplex PCR.
The reaction system (20 μ L) of multiplex PCR: template 1 μ L (about 100ng), Genome Lab GeXP Starter
(buffer is contained within universal primer to Kit 5 × buffer 4 μ L, and universal primer is by shown in the sequence 16 of sequence table
Primer A and sequence table the primer B shown in sequence 17 composition, wherein 5 ' the ends of primer A have CY5 fluorescence
The labelling of group, the working concentration of primer A and primer B is 0.25 μM), MgCl2(25 μMs) 4 μ L, contains
Primer mixture 1 μ L, the DNA polymerase 10U of all primers in primer combination, complements to ultra-pure water
20μL.In the reaction system of multiplex PCR, the concentration of FMDV-F and FMDV-R is 0.2 μm ol/ μ L, BTV-F
The concentration being 0.2 μm ol/ μ L, VSV-F and VSV-R with the concentration of BTV-R is 0.2 μm ol/ μ L, BVDV-F
The concentration being 2 μm ol/ μ L, IBRV-F and IBRV-R with the concentration of BVDV-R is 0.2 μm ol/ μ L.If
Put the negative control using equal-volume water as template.
The response procedures of multiplex PCR: 95 DEG C of 5 minutes denaturations；94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 30 seconds,
10 circulations；94 DEG C 30 seconds, 68 DEG C 30 seconds, 72 DEG C 30 seconds, 10 circulations；94 DEG C 30 seconds, 50 DEG C 30
Second, 72 DEG C 30 seconds, 10 circulations；72 DEG C extend 5min, terminate reaction.
3, the multiplexed PCR amplification product of step 2 is carried out capillary electrophoresis, concretely comprise the following steps: by 3 μ L multiplex PCRs
Amplified production, 38.75 μ L sample buffer and 0.25 μ L DNA size standard kit-400 Base Pairs
Whirlpool concussion mixing, in additions in model, every hole drips 1 dropstone and seals with wax and close liquid level, it is to avoid Methanamide aoxidizes and sample
Evaporation.On buffer plate, every hole adds the sample buffer of 180 μ L, carries out capillary electrophoresis.Capillary electrophoresis bar
Part: 90 DEG C 120 seconds, degeneration；2.0KV 30 seconds, sucks sample；6.0KV 35 minutes, separates sample.No
Separating in electrophoresis with the PCR primer of size fragment, the fluorophor that instrument is carried by detection PCR primer recognizes it
Clip size and signal intensity.After electrophoresis completes, instrument is used to carry software Express Profiler software
Analysis result.
Judge according to electrophoresis result, it is judged that standard is: the amplification sheet of 5 kinds of bovine viral dermatitis virus genes of interest
Disconnected size is respectively as follows: FMDV:165-167bp, BTV:135-137bp, VSV:278-281bp, BVDV:308-310
Bp, IBRV:187-189bp.Due to the error of the system of GeXP own, am-plified fragments size and theoretical value existence ± 2bp
Deviation belongs to correct result.
4, positive amplification product step 3 obtained carries out the correctness with the result that checks order.
Testing result is as shown in table 1.
Table 1 clinical sample testing result is added up
| Pathogen | GeXP multiplex PCR positive number | The positive number of order-checking | Positive findings sample accounts for the ratio of total sample |
| FMDV | 6 | 6 | 2.0% |
| BTV | 32 | 32 | 10.5% |
| VSV | 0 | 0 | 0% |
| BVDV | 41 | 41 | 13.4% |
| IBRV | 4 | 4 | 1.31% |
In 305 parts of samples, 83 parts of testing results are positive, are substance and infect, without mixed infection.Sequencing result shows
Show that positive findings is the virus of correspondence, without the false positive of non-specific amplification.
Claims (10)
1. primer combination, is made up of V IV and primer III, primer II, primer I, primer primer；
I is made up of by described primer primers F MDV-F and primers F MDV-R；
Described primers F MDV-F is following (a1) or (a2) or (a3):
(a1) single strand dna shown in sequence 1 of sequence table；
(a2) sequence 1 of sequence table is from the DNA molecular shown in the 19th to 36 nucleotide of 5 ' end；
(a3) by (a1) or (a2) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and tool
There is the DNA molecular of identical function；
Described primers F MDV-R is following (a4) or (a5) or (a6):
(a4) single strand dna shown in sequence 2 of sequence table；
(a5) sequence 2 of sequence table is from the DNA molecular shown in the 20th to 43 nucleotide of 5 ' end；
(a6) by (a4) or (a5) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and tool
There is the DNA molecular of identical function；
II is made up of by described primer primer BTV-F and primer BTV-R；
Described primer BTV-F is following (a7) or (a8) or (a9):
(a7) single strand dna shown in sequence 3 of sequence table；
(a8) sequence 3 of sequence table is from the DNA molecular shown in the 19th to 41 nucleotide of 5 ' end；
(a9) by (a7) or (a8) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and with
Sequence 3 has the DNA molecular of identical function；
Described primer BTV-R is following (a10) or (a11) or (a12):
(a10) single strand dna shown in sequence 4 of sequence table；
(a11) sequence 4 of sequence table is from the DNA molecular shown in the 20th to 37 nucleotide of 5 ' end；
(a12) by (a10) or (a11) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and
There is the DNA molecular of identical function；
III is made up of by described primer primer VSV-F and primer VSV-R；
Described primer VSV-F is following (a13) or (a14) or (a15):
(a13) single strand dna shown in sequence 5 of sequence table；
(a14) sequence 5 of sequence table is from the DNA molecular shown in the 19th to 38 nucleotide of 5 ' end；
(a15) by (a13) or (a14) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and
There is the DNA molecular of identical function；
Described primer VSV-R is following (a16) or (a17) or (a18):
(a16) single strand dna shown in sequence 6 of sequence table；
(a17) sequence 6 of sequence table is from the DNA molecular shown in the 20th to 38 nucleotide of 5 ' end；
(a18) by (a16) or (a17) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and
There is the DNA molecular of identical function；
IV is made up of by described primer primer BVDV-F and primer BVDV-R；
Described primer BVDV-F is following (a19) or (a20) or (a21):
(a19) single strand dna shown in sequence 7 of sequence table；
(a20) sequence 7 of sequence table is from the DNA molecular shown in the 19th to 36 nucleotide of 5 ' end；
(a21) by (a19) or (a20) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and
With the DNA molecular that sequence 7 has identical function；
Described primer BVDV-R is following (a22) or (a23) or (a24):
(a22) single strand dna shown in sequence 8 of sequence table；
(a23) sequence 8 of sequence table is from the DNA molecular shown in the 20th to 44 nucleotide of 5 ' end；
(a24) by (a22) or (a23) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and
There is the DNA molecular of identical function；
V is made up of by described primer primer I BRV-F and primer I BRV-R；
Described primer I BRV-F is following (a25) or (a26) or (a27):
(a25) single strand dna shown in sequence 9 of sequence table；
(a26) sequence 9 of sequence table is from the DNA molecular shown in the 19th to 41 nucleotide of 5 ' end；
(a27) by (a25) or (a26) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and
There is the DNA molecular of identical function；
Described primer I BRV-R is following (a28) or (a29) or (a30):
(a28) single strand dna shown in sequence 10 of sequence table；
(a29) sequence 10 of sequence table is from the DNA molecular shown in the 20th to 36 nucleotide of 5 ' end；
(a30) by (a28) or (a29) through the replacement of one or several nucleotide and/or disappearance and/or interpolation and
There is the DNA molecular of identical function.
2. the application of primer combination described in claim 1, for any one in following (b1) to (b6):
(b1) 5 kinds of bovine viral dermatitis viruses are differentiated；
(b2) preparation is for differentiating the test kit of 5 kinds of bovine viral dermatitis viruses；
(b3) detect whether virus to be measured is foot and mouth disease virus, blue tongue virus, vesicular stomatitis virus, bovine viral
Property diarrhea virus or infectious bovine rhinotrachetis virus；
(b4) preparation be used for detecting virus to be measured be whether foot and mouth disease virus, blue tongue virus, vesicular stomatitis virus,
Bovine viral diarrhea virus or the test kit of infectious bovine rhinotrachetis virus；
(b5) whether detection sample to be tested contains foot and mouth disease virus and/or blue tongue virus and/or vesicular stomatitis is sick
Poison and/or bovine viral diarrhea virus and/or infectious bovine rhinotrachetis virus；
(b6) preparation is used for detecting in sample to be tested whether containing foot and mouth disease virus and/or blue tongue virus and/or blister
Property Stomatovirus and/or bovine viral diarrhea virus and/or the test kit of infectious bovine rhinotrachetis virus；
Described 5 kinds of bovine viral dermatitis viruses are foot and mouth disease virus, blue tongue virus, vesicular stomatitis virus, cattle disease
Viral diarrhea virus and infectious bovine rhinotrachetis virus.
3. contain the test kit of primer combination described in claim 1；The purposes of described test kit is following (c1) or (c2)
Or (c3):
(c1) 5 kinds of bovine viral dermatitis viruses are differentiated；
(c2) detect whether virus to be measured is foot and mouth disease virus, blue tongue virus, vesicular stomatitis virus, bovine viral
Property diarrhea virus or infectious bovine rhinotrachetis virus；
(c3) whether detection sample to be tested contains foot and mouth disease virus and/or blue tongue virus and/or vesicular stomatitis is sick
Poison and/or bovine viral diarrhea virus and/or infectious bovine rhinotrachetis virus；
Described 5 kinds of bovine viral dermatitis viruses are foot and mouth disease virus, blue tongue virus, vesicular stomatitis virus, cattle disease
Viral diarrhea virus and infectious bovine rhinotrachetis virus.
4. the preparation method of test kit described in claim 3, including the step individually packed by each bar primer.
5. the method differentiating 5 kinds of bovine viral dermatitis viruses, comprises the steps (d1) or (d2):
(d1) RNA of virus to be measured is carried out reverse transcription, obtain cDNA template, use the combination of described primer to carry out
PCR expands, if amplified production contains the DNA fragmentation of 165-167bp, pathogen to be measured is or candidate is foot and mouth disease
Virus, if amplified production contains the DNA fragmentation of 135-137bp, pathogen to be measured is or candidate is blue tongue virus,
If amplified production contains the DNA fragmentation of 278-281bp, pathogen to be measured is or candidate is vesicular stomatitis virus,
If amplified production contains the DNA fragmentation of 308-310bp, pathogen to be measured is or candidate is bovine viral diarrhea virus,
If amplified production contains the DNA fragmentation of 187-189bp, pathogen to be measured is or candidate is infectious bovine rhinotrachetis
Virus；
(d2) detection whether contain in treating the cDNA of virus primer described in claim 1 to the target sequence of I, described in draw
Thing to the target sequence of II, described primer to the target sequence of III, described primer to the target sequence of IV or described primer to V's
Target sequence, if in described cDNA containing described primer to the target sequence of I, pathogen to be measured being or candidate is foot and mouth disease
Virus, if in described cDNA containing described primer to the target sequence of II, pathogen to be measured be or candidate is bluetongue disease
Poison, if in described cDNA containing described primer to the target sequence of III, pathogen to be measured being or candidate is vesicular stomatitis
Virus, if in described cDNA containing described primer to the target sequence of IV, pathogen to be measured being or candidate is bovine viral
Diarrhea virus, if in described cDNA containing described primer to the target sequence of V, pathogen to be measured be or candidate is cattle biography
Metachromia rhinotracheitis virus；
Described 5 kinds of bovine viral dermatitis viruses are foot and mouth disease virus, blue tongue virus, vesicular stomatitis virus, cattle disease
Viral diarrhea virus and infectious bovine rhinotrachetis virus.
6. one kind is detected whether virus to be measured is foot and mouth disease virus, blue tongue rims, vesicular stomatitis virus, bovine viral
Diarrhea virus or the method for infectious bovine rhinotrachetis virus, comprise the steps (e1) or (e2):
(e1) RNA of virus to be measured is carried out reverse transcription, obtain cDNA template, use the combination of described primer to carry out
PCR expands, if amplified production contains the DNA fragmentation of 165-167bp, pathogen to be measured is or candidate is foot and mouth disease
Virus, if amplified production contains the DNA fragmentation of 135-137bp, pathogen to be measured is or candidate is blue tongue virus,
If amplified production contains the DNA fragmentation of 278-281bp, pathogen to be measured is or candidate is vesicular stomatitis virus,
If amplified production contains the DNA fragmentation of 308-310bp, pathogen to be measured is or candidate is bovine viral diarrhea virus,
If amplified production contains the DNA fragmentation of 187-189bp, pathogen to be measured is or candidate is infectious bovine rhinotrachetis
Virus；
(e2) detection whether contain in treating the cDNA of virus primer described in claim 1 to the target sequence of I, described in draw
Thing to the target sequence of II, described primer to the target sequence of III, described primer to the target sequence of IV or described primer to V's
Target sequence, if in described cDNA containing described primer to the target sequence of I, pathogen to be measured being or candidate is foot and mouth disease
Virus, if in described cDNA containing described primer to the target sequence of II, pathogen to be measured be or candidate is bluetongue disease
Poison, if in described cDNA containing described primer to the target sequence of III, pathogen to be measured being or candidate is vesicular stomatitis
Virus, if in described cDNA containing described primer to the target sequence of IV, pathogen to be measured being or candidate is bovine viral
Diarrhea virus, if in described cDNA containing described primer to the target sequence of V, pathogen to be measured be or candidate is cattle biography
Metachromia rhinotracheitis virus.
7. whether a detection sample to be tested contains foot and mouth disease virus and/or blue tongue rims and/or vesicular stomatitis virus
And/or bovine viral diarrhea virus and/or the method for infectious bovine rhinotrachetis virus, comprise the steps (f1) or
(f2):
(f1) RNA of sample to be tested is carried out reverse transcription, obtain cDNA template, use the combination of described primer to carry out
PCR expands, if amplified production contains the DNA fragmentation of 165-167bp, sample to be tested contains or doubtful containing mouth hoof
Epidemic disease poison, if amplified production contains the DNA fragmentation of 135-137bp, sample to be tested contains or doubtful containing bluetongue
Virus, if amplified production contains the DNA fragmentation of 278-281bp, sample to be tested contains or doubtful containing vesiculovirus mouth
Scorching virus, if amplified production contains the DNA fragmentation of 308-310bp, sample to be tested contains or doubtful containing bovine viral
Property diarrhea virus, if amplified production contains the DNA fragmentation of 187-189bp, sample to be tested contains or doubtful containing cattle
Infectious bovine rhinotracheitis virus；
(f2) whether the cDNA of detection sample to be tested contains primer described in claim 1 to the target sequence of I, described
Primer to the target sequence of II, described primer to the target sequence of III, described primer to the target sequence of IV or described primer to V
Target sequence, if target sequence, the sample to be tested of I contained or doubtful containing mouth containing described primer by described cDNA
Aphtovirus, if containing the target sequence of II, sample to be tested containing described primer in described cDNA or doubtful containing
There is blue tongue virus, if target sequence, the sample to be tested of III are contained or doubt containing described primer by described cDNA
Like containing vesicular stomatitis virus, if containing described primer to the target sequence of IV, sample to be tested in described cDNA
Containing or doubtful containing bovine viral diarrhea virus, if in described cDNA containing described primer to the target sequence of V,
Sample to be tested contains or doubtful containing infectious bovine rhinotrachetis virus.
8. primer combination, for as follows (g1) or (g2):
(g1) the described primer in claim 1 to I or described primer to II or described primer to III or described primer
To IV or described primer to V；
(g2) the described primer in claim 1 to I, described primer to II, described primer to III, described primer
To IV and described primer to the combination of any two primer pair in V, the combination of any three primers pair, any four
The combination of primer pair.
9. primer sets described in claim 8 is combined in the application preparing in test kit, and the purposes of described test kit is for differentiating mouth
Aphtovirus and/or blue tongue rims and/or vesicular stomatitis virus and/or bovine viral diarrhea virus and/or cattle infectiousness
Rhinotracheitis virus.
10. containing the test kit of primer combination described in claim 8, the purposes of described test kit is for differentiating hoof-and-mouth disease
Poison and/or blue tongue rims and/or vesicular stomatitis virus and/or bovine viral diarrhea virus and/or cattle infectious rhinotracheitis
Scorching virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610567609.6A CN105969913A (en) | 2016-07-19 | 2016-07-19 | Primer combination and GeXP detection method for simultaneously identifying 5 bovine viral dermatitis viruses |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610567609.6A CN105969913A (en) | 2016-07-19 | 2016-07-19 | Primer combination and GeXP detection method for simultaneously identifying 5 bovine viral dermatitis viruses |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105969913A true CN105969913A (en) | 2016-09-28 |
Family
ID=56952123
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610567609.6A Pending CN105969913A (en) | 2016-07-19 | 2016-07-19 | Primer combination and GeXP detection method for simultaneously identifying 5 bovine viral dermatitis viruses |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105969913A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754934A (en) * | 2016-11-28 | 2017-05-31 | 北京市农林科学院 | A kind of aptamer of infectious bovine rhinotrachetis virus and application thereof |
| CN108342510A (en) * | 2018-03-23 | 2018-07-31 | 重庆出入境检验检疫局检验检疫技术中心 | The multiple RT-PCR kit and its detection method that BTV-11 types, 17 types, 20 types, 23 types, 24 type genotypings differentiate |
| CN108588275A (en) * | 2018-03-23 | 2018-09-28 | 重庆出入境检验检疫局检验检疫技术中心 | The multiple RT-PCR kit and its detection method of BTV-10 types, 20 types, 23 type genotypings |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105603120A (en) * | 2015-11-17 | 2016-05-25 | 天津出入境检验检疫局动植物与食品检测中心 | GeXP multiple rapid detection primers for detection of bluetongue virus, bovine viral diarrhea virus and foot and mouth disease virus and detection method |
-
2016
- 2016-07-19 CN CN201610567609.6A patent/CN105969913A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105603120A (en) * | 2015-11-17 | 2016-05-25 | 天津出入境检验检疫局动植物与食品检测中心 | GeXP multiple rapid detection primers for detection of bluetongue virus, bovine viral diarrhea virus and foot and mouth disease virus and detection method |
Non-Patent Citations (2)
| Title |
|---|
| 季新成: ""牛传染性鼻气管炎病毒和牛病毒性腹泻病毒分子生物学检测技术研究"", 《中国博士论文全文数据库》 * |
| 陈圣军: ""牛传染性鼻气管炎和赤羽病分子检测方法的建立和应用"", 《中国优秀硕士论文全文数据库》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754934A (en) * | 2016-11-28 | 2017-05-31 | 北京市农林科学院 | A kind of aptamer of infectious bovine rhinotrachetis virus and application thereof |
| CN108342510A (en) * | 2018-03-23 | 2018-07-31 | 重庆出入境检验检疫局检验检疫技术中心 | The multiple RT-PCR kit and its detection method that BTV-11 types, 17 types, 20 types, 23 types, 24 type genotypings differentiate |
| CN108588275A (en) * | 2018-03-23 | 2018-09-28 | 重庆出入境检验检疫局检验检疫技术中心 | The multiple RT-PCR kit and its detection method of BTV-10 types, 20 types, 23 type genotypings |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106191309A (en) | A kind of primer combination simultaneously differentiating 8 kinds of cattle disease substances and GeXP detection method | |
| Mochizuki et al. | Genotypes of canine distemper virus determined by analysis of the hemagglutinin genes of recent isolates from dogs in Japan | |
| US7247457B2 (en) | Detection and identification of enteroviruses by semi-nested amplification of the enterovirus VP1 protein | |
| CN105671201B (en) | For identifying that the primer of foot and mouth disease virus and vesicular stomatitis virus is combined and its applied | |
| Kuan | Detection and rapid differentiation of human enteroviruses following genomic amplification | |
| CN106893787A (en) | Differentiate bifluorescence RT LAMP detection primers group, kit and its application of foot and mouth disease virus and vesicular stomatitis virus | |
| CN104328222A (en) | Kit capable of detecting and parting dengue viruses by reverse transcription PCR and detection method of kit | |
| CN105969913A (en) | Primer combination and GeXP detection method for simultaneously identifying 5 bovine viral dermatitis viruses | |
| Ashmi et al. | Molecular characterization of canine distemper virus from Tamil Nadu, India | |
| US20230374614A1 (en) | Primers, kit and method for detecting of african swine fever virus | |
| CN113249517A (en) | Primer, probe and kit for real-time fluorescent quantitative PCR (polymerase chain reaction) detection of bovine plague | |
| CN106754911B (en) | Primer group for identifying mycoplasma bovis, bovine viral diarrhea virus and infectious bovine rhinotracheitis virus and application thereof | |
| CN106987657B (en) | Primer combination for identifying bovine virus diarrhea virus and bovine rotavirus and application thereof | |
| CN106191310A (en) | A kind of primer combination simultaneously differentiating 3 kinds of calf diarrhea pathogen and GeXP detection method | |
| CN110747293B (en) | Triple fluorescence RT-PCR detection kit for identifying swine vesicular disease virus, foot and mouth disease virus and seneca valley virus | |
| CN102719566A (en) | Nucleotide sequences and kit for testing bovine ephemeral fever virus | |
| CN112391501A (en) | Quadruple PCR (polymerase chain reaction) primer set for identifying canine distemper virus, mink parvovirus, Aleutian mink virus and pseudorabies virus of minks | |
| Dar et al. | PCR-based detection of an emerging avian pneumovirus in US turkey flocks | |
| CN106636473A (en) | Complete reagent and method for detecting H5 subtype avian influenza virus and chicken parvovirus | |
| CN115612753A (en) | Method for detecting aleuti, enteritis and canine distemper | |
| CN112626278B (en) | Primer and probe for identifying canine distemper virus wild strain and vaccine strain and application | |
| Harding et al. | Development of PCR-based tests for the identification of North American isolates of epizootic haemorrhagic disease virus. | |
| CN105925727A (en) | Primer and kit for detecting foot and mouth disease virus type A and type O mixed infection and use method and application of kit | |
| BR112021016179B1 (en) | SARS-COV-2 DETECTING PRIMER SET, SARS-COV-2 TESTING METHOD, E, SARS-COV-2 TESTING KIT AND REAGENT | |
| Chen et al. | Advances in the differential molecular diagnosis of vesicular disease pathogens in swine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160928 |
|
| RJ01 | Rejection of invention patent application after publication |