CN106929569A - A kind of instant detection kit of candida albicans Genotyping - Google Patents
A kind of instant detection kit of candida albicans Genotyping Download PDFInfo
- Publication number
- CN106929569A CN106929569A CN201611214240.7A CN201611214240A CN106929569A CN 106929569 A CN106929569 A CN 106929569A CN 201611214240 A CN201611214240 A CN 201611214240A CN 106929569 A CN106929569 A CN 106929569A
- Authority
- CN
- China
- Prior art keywords
- candida albicans
- sense primer
- candida
- detection kit
- amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Abstract
The invention discloses a kind of instant detection kit of candida albicans Genotyping, the kit is the kit that a kind of gene is expanded and detected at a constant temperature.The present invention can carry out rapid fluorescence detection based on a kind of probe of Two Colour Fluorescence mark of isothermal amplification reactions agents coordinate.Constant-temperature amplification system of the invention, real to realize carrying out gene amplification reaction at same temperature, reaction system does not rely on the high energy kinetomeres such as ATP, phosphocreatine, relatively existing constant-temperature amplification system, its composition is more simple, and cost is more cheap, using more convenient.Constant-temperature amplification system of the invention is applied to the amplification of template complex, and amplification rate is fast and stable, and amplified reaction can be completed within 15 min, and the sensitivity of amplification and accuracy are high, are less prone to mispairing, and expanding effect is good.
Description
Technical field
The present invention relates to a kind of instant detection kit of candida albicans Genotyping, more particularly to one kind does not rely on high-energy
The isothermal amplification technology of molecule.
Background technology
Candida albicans is a kind of fungi, and generally cause vaginitis is the Candida albicans in candida albicans.This bacterium is in oval,
There is the pseudohypha of gemma and cell budding elongation and formation.Candida albicans is not strong to the resistance of heat, is heated to 60 DEG C after 1 hour i.e.
Can be dead.But it is stronger to resistances such as drying, daylight, ultraviolet and chemicals.Candida albicans is most common condition in fungi
Pathogenic bacteria.It often parasitizes skin, oral cavity, vagina and intestinal mucosa of people etc., when human body immune function is low or normally lives away from home
The micro-ecological environment imbalance at position, easily causes candidiasis.Candida albicans can cause mucocutaneous shallow-layer or whole body system sexy
Dye, infection different parts can cause different illness, in addition to cutaneous candidiasis, also monilial stomatitis, vaginitis, wing
Guang inflammation, pyelonephritis, meningitis, bacteremia and infection of biliary tract etc..
Cause mankind's candidiasis disease to be mainly candida albicans bacterium, account for 80%~90%, differentiated there are 200 various whites
Candidiasis, all bacterial strains seem to be respectively provided with the equal ability lived away from home or cause vaginitis.With the transition in epoch, false silk ferment
The increase of female bacterium resistance, its strain changes, and ratio of the candida albicans bacterium in vulvovaginitis has declined, and other
Vulvovaginitis caused by candidiasis increases.Beads slightly belongs to yeast-like fungi, and the candida albicans for finding so far has 270 kinds
More than, but clinical normal conditioned pathogen mainly has following several：Candida albicans, Candida tropicalis, Candida albicans mushroom star
Type mutation, candida krusei, Candida parapsilosis, Candida glabrata, monilia guilliermondii, Candida kefyr and Dublin are read
Pearl bacterium etc..Wherein Candida albicans and Candida tropicalis pathogenicity is most strong, causes the mainly Candida albicans of mankind's candidiasis
Bacterium, Candida tropicalis, Candida glabrata, account for 60 ~ 80 %.Report in recent years, monilial infection strain has Variance trend,
Non-white candida albicans is increased in causing monilial infection, and there may be the mixed infection of various pathogenic candida albicans in focus；So
And various candida albicans are larger to the natural sensitivity difference of antifungal, so detection is read monilial infection patient immediately
Pearl bacterium parting has positive effect.Directly detected based on pathogen DNA, greatly improved compared to smear sensitiveness, Ke Yiji
Big lifting positive rate.
Traditional PCR technique is commonly used in the detection of the DNA of candida albicans, and detection program needs to set multiple circulations, each circulation
Denaturation, annealing including nucleic acid, extend, this cause PCR have in technology application some limitation：First, PCR technology need high
Expensive Laboratory Instruments, while instrument will possess fine temperature control program and heated die plate, so as to realize temperature very high
Under DNA template strands denaturation, primed probe annealing extends template at relatively low temperature, and such repeated temperature changes tens
The amplification of template amount is realized after circulation.Because each circulation time is shorter, instrument must be able to quick and precisely lift temperature,
This is accomplished by the heating module of silvery or gold system, increased the cost of instrument development.Polymerase in second, PCR amplification system
There must be the ability of tolerance high temperature, otherwise new enzyme must be rejoined in each circulation, to realize the expansion of subsequent cycle
Increase, be so easy to pollute also increase cost.3rd, in PCR circulations, the time of each circulation primer annealing
It is all very short（Several seconds to more than ten seconds）This requires that primer must be quickly found out the section of homologous matching in template, to realize extending.
This requires that PCR systems must have excessive PCR primers.Excessive primer can trigger amplification, draw with template mispairing, mistake
Thing dimer etc., and then suppression PCR amplification, particularly in the situation that template amount is low, can aggravate such case.
Isothermal amplification technology of the present invention mainly utilizes the activity of recombinase, in constant temperature by nucleic and melting not being carried out and being annealed
Under the conditions of（Such as 37 DEG C）The amplification of nucleic acid is carried out, compared with traditional round pcr, it is not necessary to expensive instrument, it also avoid height
Loss of the temperature to enzyme.Isothermal amplification technology need not add excessive primer in system simultaneously, reduce primer wrong with template
With or generation primer dimer possibility.In addition, constant-temperature amplification system has multiple tools enzyme to match effectively being expanded, expand
Efficiency far is higher than traditional PCR technique, and the time used is shorter, most short to be realized in 5min.Finally, relative at present other
Isothermal amplification technology platform is compared, and the recombinase used by the present invention relies on the profit that amplification technique platform is detection of nucleic acids of new generation
Device, in the ageing of detection, many aspects such as convenience and technical parameter are better than other isothermal amplification technology platforms, by examination
Agent is effectively matched, it might even be possible in human body oxter carry out amplified reaction.On the technology platform, except that can develop based on small
Type portable set is used for medical testing agency such as hospital emergency department, gynemetrics, operating room；Community Service Center and primary care
Mechanism；The molecule diagnostic products of inspection and quarantine control and prevention of disease mechanism, may be developed that the molecule diagnosis that suitable family uses is produced
Product, even if make China's different zones exist economic condition it is uneven in the case of, it is also possible to launch national viral disease,
The regular and quick census of tumour and genetic disease.This is a very huge potential market, its economic worth and society
Benefit is inestimable.Currently we have developed the HIV used suitable for medical institutions and family and have detected product and cervical carcinoma HPV
Detection product.With the continuous maturation of platform, food security, inspection and quarantine, the anti-multiple fields such as probably can be further extended to.
Isothermal amplification technology is applied to the instant detection kit of candida albicans Genotyping of the present invention the inspection of monilial infection
In survey, the reaction time is shortened, reduce requirement of the system to reaction condition, greatly increase the efficiency of detection, be also not required to
Very important person is subjective sentence read result, while testing result is not disturbed by mixed infection, therefore can more accurately point out mixed infection
Type, be very beneficial for clinic quick diagnosis and symptomatic treatment.
The content of the invention
It is an object of the invention to provide a kind of instant detection kit of candida albicans Genotyping, including reaction solution, start
Liquid, reacts enzyme system, candida albicans specific primer and probe.
The concrete component of the instant detection kit reaction solution of candida albicans Genotyping is as follows：
| Name of an article concentration（Molar concentration/mass fraction/mass concentration） |
| Tris-HCl 50mM |
| KCl 40mM |
| Dithiothreitol (DTT) 2mM |
| Glycine betaine 1M |
| Trehalose 3.5% |
| PEG 5.5% |
| BSA 0.1mg/mL |
Used as the further improvement of above-mentioned reaction solution, the pH of Tris-HCl is 7.0~9.0, and preferably pH is 8.3.
The concrete component that the instant detection kit of candida albicans Genotyping starts liquid is as follows：
| Name of an article molar concentration |
| Magnesium chloride 5mM ~ 20mM |
Used as the further improvement of above-mentioned startup liquid, the preferred concentration of magnesium chloride is 10mM.
The concrete component of the instant detection kit reaction enzyme system of candida albicans Genotyping is as follows：
| Name of an article concentration（Molar concentration/enzyme concentration/mass concentration） |
| dNTPs 200uM |
| Polymerase Bsu 100ng/ul |
| Single strand binding protein 262ng/ul |
| Recombinase（E.coli RecT） 360ng/ul |
| Sense primer 200nM |
| Anti-sense primer 200nM |
Used as the further improvement of above-mentioned reaction enzyme system, recombinase is selected from E.coli RecT albumen.
The instant detection kit specific primer of candida albicans Genotyping and probe sequence are as follows：
| Sense primer 1 | TCAACAACGGATCTCTTGGTTCTC（SEQ ID NO：1） |
| Anti-sense primer 1 | AATTGTGGTGGCCACTAGCAAAATAAGCGTTTTG（SEQ ID NO：2） |
| Fluorescence probe 1 | CATCGATGAAGAACGCAGCGAAATGCGA(FAM-dt)TA(dSpacer)GT(BHQ-dT)AATRTGAATTGCAGA（SEQ ID NO：3） |
| Sense primer 2 | AACTTTCAACAACGGATCTCTTGG（SEQ ID NO：4） |
| Anti-sense primer 2 | TCAACACCGAGTTGGTAAAACCTAATACAGTATTAAC（SEQ ID NO：5） |
| Fluorescence probe 2 | CGTGAATCATCGAATCT(FAM-dt)T(dSpacer)T(BHQ-dT)GAACGCACATTGCGCCC（SEQ ID NO：6） |
| Sense primer 3 | ATCGAATCTTTGAACGCACATTGCG（SEQ ID NO：7） |
| Anti-sense primer 3 | ATATACGTGGTGGACGTTACCGCCGCAAGCAATG（SEQ ID NO：8） |
| Fluorescence probe 3 | CATCGATGAAGAACGCAGCGAAA(FAM-dt)GC(dSpacer)AT(BHQ-dT)ACGTAATRTGAATTGCAGA（SEQ ID NO：9） |
Used as the further improvement of the inventive method, the temperature of constant-temperature amplification is 35~42 DEG C, and it is 37 DEG C preferably to expand temperature.
Beneficial effects of the present invention：
Constant-temperature amplification system of the invention, does not rely on the high energy kinetomeres such as ATP, phosphocreatine, and relatively existing constant temperature expands
Increasing system, its composition is more simple, and cost is more cheap, using more convenient.
Constant-temperature amplification system of the invention is applied to the amplification of template complex, and amplification rate is fast and stable, can be 15
Amplified reaction is completed within min, the sensitivity of amplification and accuracy are high, be less prone to mispairing, expanding effect is good.
Constant-temperature amplification system of the invention uses fluorescence real-time quantitative technology, and range of application is wider, it is adaptable to big on the market
Most fluorescent quantitation amplification instruments.
The present invention detects 3 kinds of pathogenic candida albicans simultaneously, is respectively Candida albicans, Candida glabrata, Candida tropicalis.It is right
Than the cultural method of conventional detection, the time is shorter, and sensitivity is high to be limited few by condition of culture, and artificial maloperation probability is low.
Brief description of the drawings：
Fig. 1 to Figure 10 respectively is the fluorescence results figure of embodiment 1 to embodiment 10, and the label correspondence of fluorescence curve is real in figure
Apply the label of reaction tube in example.
Specific embodiment
A kind of instant detection kit of candida albicans Genotyping, employs a kind of constant temperature for not relying on high energy kinetomeres
Amplification technique.Kit components include reaction solution, start liquid, react enzyme system, candida albicans specific primer and probe, each composition
Concrete component is as follows：
The concrete component of the instant detection kit reaction solution of candida albicans genotyping kit candida albicans Genotyping is as follows：
| Name of an article concentration（Molar concentration/mass fraction/mass concentration） |
| Tris-HCl（pH8.3） 50mM |
| KCl 40mM |
| Dithiothreitol (DTT) 2mM |
| Glycine betaine 1M |
| Trehalose 3.5% |
| PEG 5.5% |
| BSA 0.1mg/mL |
The concrete component that the instant detection kit of candida albicans Genotyping starts liquid is as follows：
| Name of an article molar concentration |
| Magnesium chloride 10mM |
The concrete component of the instant detection kit reaction enzyme system of candida albicans Genotyping is as follows：
| Name of an article concentration（Molar concentration/enzyme concentration/mass concentration） |
| dNTPs 200uM |
| Polymerase Bsu 100ng/ul |
| Single strand binding protein 262ng/ul |
| Recombinase（E.coli RecT） 360ng/ul |
| Sense primer 200nM |
| Anti-sense primer 200nM |
The instant detection kit specific primer of candida albicans Genotyping and probe sequence are as follows：
| Sense primer 1 | TCAACAACGGATCTCTTGGTTCTC（SEQ ID NO：1） |
| Anti-sense primer 1 | AATTGTGGTGGCCACTAGCAAAATAAGCGTTTTG（SEQ ID NO：2） |
| Fluorescence probe 1 | CATCGATGAAGAACGCAGCGAAATGCGATA(FAM-dt)TC (dSpacer) AT (BHQ-dT)AATRTGAATTGCAGA（SEQ ID NO：3） |
| Sense primer 2 | AACTTTCAACAACGGATCTCTTGG（SEQ ID NO：4） |
| Anti-sense primer 2 | TCAACACCGAGTTGGTAAAACCTAATACAGTATTAAC（SEQ ID NO：5） |
| Fluorescence probe 2 | CGTGAATCATCGAATCT（FAM-dt)TT(dSpacer)TT(BHQ-dT) GAACGCACATTGCGCCC（SEQ ID NO：6） |
| Sense primer 3 | ATCGAATCTTTGAACGCACATTGCG（SEQ ID NO：7） |
| Anti-sense primer 3 | ATATACGTGGTGGACGTTACCGCCGCAAGCAATG（SEQ ID NO：8） |
| Fluorescence probe 3 | CATCGATGAAGAACGCAGCGAAA(FAM-dt)TG(dSpacer)GAT(BHQ-dT)ACGTAATRTGAATTGCAGA（SEQ ID NO：9） |
With reference to specific experiment, the advantage of the instant detection kit of candida albicans Genotyping is further illustrated, but not limit
The system present invention.
Experiment sample is originated：
With the Candida tropicalis, Candida glabrata, Candida albicans, the extracted nucleic acid for obtaining that in monilial infection patient separate
Solution is used as sample；
With mixed tropical candida albicans-Candida glabrata, Candida tropicalis-Candida albicans, Candida glabrata-Candida albicans
Nucleic acid solution is used as mixed infection sample；
With outsourcing staphylococcus aureus, Lactobacillus crispatus, Zhan's formula lactobacillus, inertia lactobacillus, mycoplasma strains, Gardner
The extracted nucleic acid for obtaining of bacterium, trichomonas vaginalis, Candida parapsilosis, Candida tropicalis, candida krusei, Candida kefyr is molten
Liquid as specificity experiments sample；
With normal human vaginal's secretion extract as negative control sample.
Embodiment 1（3 kinds of detections of candida albicans）：
6 200ul reaction tubes are taken, reaction tube 1 ~ 6 is respectively labeled as.20ul reaction solutions, 5ul are separately added into reaction tube 1 ~ 6
Reaction enzyme system；Sense primer 1 is added in reaction tube 1,2（200nM）, anti-sense primer 1（200nM）, fluorescence probe 1（150nM）；
Sense primer 2 is added in reaction tube 3,4（200nM）, anti-sense primer 2（200nM）, fluorescence probe 2（150nM）；In reaction tube
5th, sense primer 3 is added in 6（200nM）, anti-sense primer 3（200nM）, fluorescence probe 3（150nM）.Heat is added in reaction tube 1
Band candida albicans sample 2ul, adds Candida glabrata sample 2ul, reaction tube 5 to add Candida albicans sample 2ul in reaction tube 3,
Reaction tube 2,4,6 be all separately added into negative control sample 2ul.Each reaction tube supplies system to 45ul with aqua sterilisa, and vibration is mixed
Each pipe is separately added into 5ul startup liquid again after even（The final volume of each pipe is 50ul）.
Selection quantitative real time PCR Instrument is expanded and is collected fluorescence, and particularly machine condition is：37 DEG C, 30s, 30 circulations,
Fluorescence is collected in each circulation.
Embodiment 2（The detection of non-optimal amplification temperature conditionss）：
With embodiment 1, difference is that upper machine condition is changed to：35 DEG C, fluorescence is collected in 30s, 30 circulations, each circulation.
Result such as Fig. 2.
Embodiment 3（The detection of non-optimal amplification temperature conditionss）：
With embodiment 1, different places are that upper machine condition is changed to：42 DEG C, fluorescence is collected in 30s, 30 circulations, each circulation.Knot
Fruit such as Fig. 3.
Embodiment 4（Specificity experiments）：
Managed according to the preparation system 42 of embodiment 1, respectively the reaction tube of mark 1 ~ 42.Upstream is added to draw in the system of 1 ~ 14 reaction tube
Thing 1（200nM）, anti-sense primer 1（200nM）, fluorescence probe 1（150nM）；Upstream is added to draw in the system of 15 ~ 28 reaction tubes
Thing 2（200nM）, anti-sense primer 2（200nM）, fluorescence probe 2（150nM；Sense primer is added in the system of 28 ~ 42 reaction tubes
3（200nM）, anti-sense primer 3（200nM）, fluorescence probe 3（150nM）.The torrid zone is separately added into order in 1 ~ No. 13 reaction tube
Candida albicans, staphylococcus aureus, Lactobacillus crispatus, Zhan's formula lactobacillus, inertia lactobacillus, mycoplasma strains, Gardnerella, vagina
Trichmonad, Candida albicans, Candida glabrata, Candida parapsilosis, Candida tropicalis, candida krusei, Candida kefyr sample
This 2ul；It is separately added into Candida glabrata, staphylococcus aureus, Lactobacillus crispatus, Zhan's formula in order in 14 ~ No. 26 reaction tubes
It is lactobacillus, inertia lactobacillus, mycoplasma strains, Gardnerella, trichomonas vaginalis, Candida tropicalis, Candida albicans, near smooth
Candida albicans, Candida tropicalis, candida krusei, the sample 2ul of Candida kefyr；Distinguish in order in 27 ~ No. 34 reaction tubes
Add Candida albicans, staphylococcus aureus, Lactobacillus crispatus, Zhan's formula lactobacillus, inertia lactobacillus, mycoplasma strains, plus moral
Receive bacterium, trichomonas vaginalis, Candida tropicalis, Candida glabrata, Candida parapsilosis, Candida tropicalis, candida krusei, koumiss
Candida albicans sample 2ul.Each reaction tube supplies system to 45ul with aqua sterilisa, and each pipe is separately added into 5ul and opens again after vibration mixing
Hydrodynamic（The final volume of each pipe is 50ul）.
Selection quantitative real time PCR Instrument is expanded and is collected fluorescence, and particularly machine condition is：37 DEG C, 30s, 30 circulations,
Fluorescence is collected in each circulation, as a result such as Fig. 4.
Embodiment 5（Candida tropicalis repeated experiment）：
Managed by the preparation system 6 of embodiment 1, reaction tube 1 ~ 6 is marked respectively.Sense primer 1 is added in reaction tube 1 ~ 6（200nM）、
Anti-sense primer 1（200nM）, fluorescence probe 1（150nM）.Candida tropicalis sample 2ul is added in reaction tube 1 ~ 3, in reaction
Negative control sample 2ul is added in pipe 4 ~ 6.Each reaction tube supplies system to 45ul with aqua sterilisa, and vibration is each after mixing to manage again
It is separately added into 5ul and starts liquid（The final volume of each pipe is 50ul）.
Selection quantitative real time PCR Instrument is expanded and is collected fluorescence, and particularly machine condition is：37 DEG C, 30s, 30 circulations,
Fluorescence is collected in each circulation, as a result such as Fig. 5.
Embodiment 6（Candida glabrata repeated experiment）：
Managed by the preparation system 6 of embodiment 1, reaction tube 1 ~ 6 is marked respectively.Sense primer 2 is added in reaction tube 1 ~ 6（200nM）、
Anti-sense primer 2（200nM）, fluorescence probe 2（150nM）.Candida glabrata sample 2ul is added in reaction tube 1 ~ 3, in reaction
Negative control sample 2ul is added in pipe 4 ~ 6.Each reaction tube supplies system to 45ul with aqua sterilisa, and vibration is each after mixing to manage again
It is separately added into 5ul and starts liquid（The final volume of each pipe is 50ul）.
Selection quantitative real time PCR Instrument is expanded and is collected fluorescence, and particularly machine condition is：37 DEG C, 30s, 30 circulations,
Fluorescence is collected in each circulation, as a result such as Fig. 6.
Embodiment 7（Candida albicans repeated experiment）：
Managed by the preparation system 6 of embodiment 1, reaction tube 1 ~ 6 is marked respectively.Sense primer 3 is added in reaction tube 1 ~ 6（200nM）、
Anti-sense primer 3（200nM）, fluorescence probe 3（150nM）.Candida albicans sample 2ul is added in reaction tube 1 ~ 3, in reaction
Negative control sample 2ul is added in pipe 4 ~ 6.Each reaction tube supplies system to 45ul with aqua sterilisa, and vibration is each after mixing to manage again
It is separately added into 5ul and starts liquid（The final volume of each pipe is 50ul）.
Selection quantitative real time PCR Instrument is expanded and is collected fluorescence, and particularly machine condition is：37 DEG C, 30s, 30 circulations,
Fluorescence is collected in each circulation, as a result such as Fig. 7.
Embodiment 8（Candida tropicalis and Candida glabrata mixed infection are detected）：
Managed by the preparation system 6 of embodiment 1, reaction tube 1 ~ 6 is marked respectively.Sense primer 1 is added in reaction tube 1,2（200nM）、
Anti-sense primer 1（200nM）, fluorescence probe 1（150nM）；Sense primer 2 is added in reaction tube 3,4（200nM）, anti-sense primer 2
（200nM）, fluorescence probe 2（150nM）；Sense primer 3 is added in reaction tube 5,6（200nM）, anti-sense primer 3（200nM）、
Fluorescence probe 3（150nM）.Candida tropicalis and Candida glabrata bacterium mixed infection sample are added in reaction tube 1,3,5
2ul；Negative control sample 2ul is added in reaction tube 2,4,6.Each reaction tube supplies system to 45ul with aqua sterilisa, shakes
Each pipe is separately added into 5ul startup liquid again after swinging mixing（The final volume of each pipe is 50ul）.
Selection quantitative real time PCR Instrument is expanded and is collected fluorescence, and particularly machine condition is：37 DEG C, 30s, 30 circulations,
Fluorescence is collected in each circulation, as a result such as Fig. 8.
Embodiment 9（Candida tropicalis and Candida albicans mixed infection are detected）：
With embodiment 8, it is that Candida tropicalis and Candida albicans mixed infection sample are added toward reaction tube 1,3,5 not exist together
2ul。
Selection quantitative real time PCR Instrument is expanded and is collected fluorescence, and particularly machine condition is：37 DEG C, 30s, 30 circulations,
Fluorescence is collected in each circulation, as a result such as Fig. 8.
Embodiment 10（Candida glabrata and Candida albicans mixed infection are detected）：
With embodiment 8, it is that Candida glabrata and Candida albicans mixed infection sample are added toward reaction tube 1,3,5 not exist together
2ul。
Selection quantitative real time PCR Instrument is expanded and is collected fluorescence, and particularly machine condition is：37 DEG C, 30s, 30 circulations,
Fluorescence is collected in each circulation, as a result such as Figure 10.
Conclusion：
1. can be seen that corresponding pathogen sample amplification from the result of Fig. 1 has " S " type amplification curve, illustrates this hair
The constant-temperature amplification effect of bright kit is good.
Even if 2. be can be seen that from Fig. 2,3 result be not that amplified reaction is carried out under optimum temperature, stabilization is still obtained
Positive findings, illustrate that the serious forgiveness of kit of the present invention is high, stability is strong.
3. other intravaginal microorganisms in non-kit detection range can be seen that from the result of Fig. 4（Golden yellow Portugal
It is grape coccus, Lactobacillus crispatus, Zhan's formula lactobacillus, inertia lactobacillus, mycoplasma strains, Gardnerella, trichomonas vaginalis, near smooth
Candida albicans, Candida tropicalis, candida krusei, Candida kefyr）False positive results will not be produced, and this kit is detectable
Candida tropicalis, Candida glabrata, the detection of Candida albicans do not produce interference each other, illustrate the specificity of this kit
By force.
4. the result from Fig. 5,6,7 can be seen that and Candida tropicalis and Candida glabrata, Candida albicans are weighed
Multiple experiment, obtains corresponding " S " type amplification curve, illustrates that the sensitivity of this kit is high.
5. different disease-producing pathogens are not each other in the sample that can be seen that mixed infection type from the result of Fig. 8,9,10
Interfere, testing result is errorless, illustrate that the specific good, stability of this kit is strong.
To sum up, the expanding effect of kit of the present invention is good, and high specificity, serious forgiveness is high, and stability is strong, and sensitivity is high.
SEQUENCE LISTING
<110>Guangzhou two kinds of substance synthesis into another Technology Co., Ltd.
<120>A kind of instant detection kit of candida albicans Genotyping
<130> 2016
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 24
<212> DNA
<213>Artificial sequence
<400> 1
tcaacaacgg atctcttggt tctc 24
<210> 2
<211> 34
<212> DNA
<213>Artificial sequence
<400> 2
aattgtggtg gccactagca aaataagcgt tttg 34
<210> 3
<211> 47
<212> DNA
<213>Artificial sequence
<400> 3
catcgatgaa gaacgcagcg aaatgcgata gtaatrtgaa ttgcaga 47
<210> 4
<211> 24
<212> DNA
<213>Artificial sequence
<400> 4
aactttcaac aacggatctc ttgg 24
<210> 5
<211> 37
<212> DNA
<213>Artificial sequence
<400> 5
tcaacaccga gttggtaaaa cctaatacag tattaac 37
<210> 6
<211> 36
<212> DNA
<213>Artificial sequence
<400> 6
cgtgaatcat cgaatctttg aacgcacatt gcgccc 36
<210> 7
<211> 25
<212> DNA
<213>Artificial sequence
<400> 7
atcgaatctt tgaacgcaca ttgcg 25
<210> 8
<211> 34
<212> DNA
<213>Artificial sequence
<400> 8
atatacgtgg tggacgttac cgccgcaagc aatg 34
<210> 9
<211> 46
<212> DNA
<213>Artificial sequence
<400> 9
catcgatgaa gaacgcagcg aaagcatacg taatrtgaat tgcaga 46
Claims (8)
1. a kind of instant detection kit of candida albicans Genotyping, its reaction solution composition is as follows：
Tris-HCl 50mM
KCl 40mM
Dithiothreitol (DTT) 2mM
Glycine betaine 1M
Trehalose 3.5%
PEG 5.5%
BSA 0.1mg/mL。
2. a kind of instant detection kit of candida albicans Genotyping according to claim 1, it is as follows that it starts liquid composition：
Magnesium chloride 5mM ~ 20mM.
3. a kind of instant detection kit of candida albicans Genotyping according to claim 1, its reaction enzyme system composition is as follows：
dNTPs 200uM
Polymerase Bsu 50U
Single strand binding protein 262ng/ul
Recombinase（E.coli RecT） 360ng/ul
Sense primer 200nM
Anti-sense primer 200nM
Fluorescence probe 60nM
Recombinase is the recombinase for not relying on kinetomeres.
4. a kind of instant detection kit of candida albicans Genotyping according to claim 3, the sense primer for being used, under
Trip primer and fluorescence probe, it is characterised in that：
The sequence of sense primer for detecting Candida tropicalis is：TCAACAACGGATCTCTTGGTTCTC；The sequence of anti-sense primer
For：AATTGTGGTGGCCACTAGCAAAATAAGCGTTTTG；Fluorescence probe sequence is：CATCGATGAAGAACGCAGCGAAAT
GCGATA(FAM-dt)TC(dSpacer)AT(BHQ-dT)AATRTGAATTGCAGA；
Detect Candida glabrata upstream primer sequence be：AACTTTCAACAACGGATCTCTTGG；The sequence of anti-sense primer is：
TCAACACCGAGTTGGTAAAACCTAATACAGTATTAAC；Fluorescence probe sequence is：CGTGAATCATCGAATCT（FAM-
dt)TT(dSpacer)TT(BHQ-dT)GAACGCACATTGCGCCC；
The sequence of sense primer for detecting Candida albicans is：ATCGAATCTTTGAACGCACATTGCG；The sequence of anti-sense primer
For：ATATACGTGGTGGACGTTACCGCCGCAAGCAATG；Fluorescence probe sequence is：CATCGATGAAGAACGCAGCGAAA
（FAM-dt)TG(dSpacer)GAT(BHQ-dT)ACGTAATRTGAATTGCAGA.
5. a kind of instant detection kit of candida albicans Genotyping according to claim 1, it is characterised in that：Tris- delays
The pH of fliud flushing is 7.0~9.0, and preferably pH is 8.3.
6. a kind of instant detection kit of candida albicans Genotyping according to claim 3, it is characterised in that：Recombinase is selected
From E.coli RecT albumen；Bacteriophage lambda β albumen；Brewer's yeast Sep Ι/STP β；Brewer's yeast DPA albumen；Brewer's yeast STP α
Albumen；Schizosaccharomyces pombe p140/ Exo ∥ albumen and Rrp Ι, HPP- Ι, v-SEP, ICP8 albumen.
7. a kind of instant detection kit of candida albicans Genotyping according to claim 1-6, it is characterised in that：Constant temperature expands
The temperature of increasing is 35~42 DEG C, and it is 37 DEG C preferably to expand temperature.
8. a kind of instant detection kit of candida albicans Genotyping according to claim 1-3, it is characterised in that use chlorination
Magnesium is 5mM ~ 20mM as the startup liquid for reacting, concentration, and preferred concentration is 10mM.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611214240.7A CN106929569A (en) | 2016-12-26 | 2016-12-26 | A kind of instant detection kit of candida albicans Genotyping |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611214240.7A CN106929569A (en) | 2016-12-26 | 2016-12-26 | A kind of instant detection kit of candida albicans Genotyping |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106929569A true CN106929569A (en) | 2017-07-07 |
Family
ID=59443977
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611214240.7A Withdrawn CN106929569A (en) | 2016-12-26 | 2016-12-26 | A kind of instant detection kit of candida albicans Genotyping |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106929569A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109971883A (en) * | 2019-05-07 | 2019-07-05 | 丹娜（天津）生物科技有限公司 | A kind of primer combination of probe, kit, detection method and its application of candida albicans point kind detection |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105420360A (en) * | 2015-12-09 | 2016-03-23 | 广州和实生物技术有限公司 | Kit for instantly detecting vaginitis pathogen gene |
-
2016
- 2016-12-26 CN CN201611214240.7A patent/CN106929569A/en not_active Withdrawn
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105420360A (en) * | 2015-12-09 | 2016-03-23 | 广州和实生物技术有限公司 | Kit for instantly detecting vaginitis pathogen gene |
Non-Patent Citations (1)
| Title |
|---|
| 张云操等: "实时荧光定量PCR在念珠菌研究中的应用", 《中国热带医学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109971883A (en) * | 2019-05-07 | 2019-07-05 | 丹娜（天津）生物科技有限公司 | A kind of primer combination of probe, kit, detection method and its application of candida albicans point kind detection |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105524985A (en) | Detection of nucleic acids in crude matrices | |
| CN107119140A (en) | Respiratory tract micro-fluidic chip Fast Detection Technique and kit | |
| CN105420360A (en) | Kit for instantly detecting vaginitis pathogen gene | |
| CN110066885A (en) | A kind of primer and probe combination and its application based on RPA- Sidestream chromatography technology detection chestnut Heisui River phytophthora | |
| CN101575640B (en) | Primer group for bovine tuberculosis mycobacterium detection, rapid detection method and detection kit | |
| CN108060268A (en) | The application method of the primer and probes of HPV parting detections, kit and kit | |
| CN104328171B (en) | Loop-mediated isothermal amplification primer, kit and method for detecting rat staphylococcus aureus | |
| CN101712973A (en) | Reactive reagent of nucleic acid amplification by chain replacement at room temperature and nucleic acid amplification method at room temperature thereof | |
| Kobylak et al. | Real-time PCR approach in dermatophyte detection and Trichophyton rubrum identification | |
| CN107058483A (en) | A kind of fluorescence Constant Temperature Detection kit of instant detection gardnerella vaginalis | |
| CN106929569A (en) | A kind of instant detection kit of candida albicans Genotyping | |
| CN105986042A (en) | Method for quickly detecting nucleic acid of H9 subtype avian influenza virus | |
| CN109825628B (en) | A kind of primer and probe combination and its application based on RPA- Sidestream chromatography technology detection Fusarium solani | |
| CN108384834A (en) | A kind of highland barley base rot disease oat Fusariumsp loop-mediated isothermal amplification detection method and its application | |
| CN108315469A (en) | Primer composition and kit of the pathogenic sickle-like bacteria of ring mediated isothermal amplification method detection and application thereof | |
| CN109943624A (en) | A kind of method and its primer special and probe combinations based on RPA- Sidestream chromatography technology detection soybean phytophthora | |
| CN109825627B (en) | A kind of primer and probe combination and its application based on RPA- Sidestream chromatography technology detection cloves phytophthora | |
| CN109897910A (en) | A method of pinch outs are detected based on RPA- Sidestream chromatography Lateral Flow Strip fast accurate | |
| CN106399471A (en) | Detection kit and detection method of pneumocystis jiroveci | |
| CN108411017A (en) | Detect the LAMP primer and method of pseudomonas syringae tomato pvs oryzae and oryzicola | |
| CN106906309A (en) | A kind of HCV（HCV）Constant Temperature Detection kit | |
| EP3757231A1 (en) | Primer set for detecting trichophyton gene by lamp method, kit including same, and method for detecting trichophyton using same | |
| CN109988860A (en) | A kind of primer and probe compositions and its kit and detection method for detecting phytophthora hibernalis | |
| CN102634594B (en) | PCR (Polymerase Chain Reaction) detection method for candiada albicans | |
| RU2639498C1 (en) | Set of oligonucleotide primers and fluorescence marked probes for identifying of blastomycesis dermatitis irritant |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20170707 |