CN109988860A - A kind of primer and probe compositions and its kit and detection method for detecting phytophthora hibernalis - Google Patents
A kind of primer and probe compositions and its kit and detection method for detecting phytophthora hibernalis Download PDFInfo
- Publication number
- CN109988860A CN109988860A CN201910194831.XA CN201910194831A CN109988860A CN 109988860 A CN109988860 A CN 109988860A CN 201910194831 A CN201910194831 A CN 201910194831A CN 109988860 A CN109988860 A CN 109988860A
- Authority
- CN
- China
- Prior art keywords
- rpa
- primer
- probe
- detection
- phytophthora
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The primer and probe compositions and its kit and detection method that the invention discloses a kind of for detecting phytophthora hibernalis, the primer and probe sequence are as follows: RPA-PSYPT-F:5'-TTCCACCCTTCCACCAGACTGCTGAGGAGG-3', RPA-PSYPT-R:5 '-[Biotin] TGTTAGCTGCGTGTTCGTTGGTCACCCCAGA-3 ', SYPT-P:5 '-[FAM] CTTCTGTGATTTATCCAGAAAATCCGTACGAT-THE-GAGCTGGACGGCAAGA [C3-spacer] -3 '.Primed probe group RPA expanding effect used in the present invention is good, band high specificity, with other germ no cross reactions, has positive reaction in detection zone, increases the sensitivity of detection.
Description
Technical field
The invention belongs to field of biotechnology, phytophthora hibernalis is detected based on RPA- Sidestream chromatography technology, be exclusively used in customs into
Highly sensitive quick with phytophthora hibernalis (Phytophthora hibernalis) of fruit institute of leaving the country detects, while can be used for woods
Between the early diagnosis of winter raw epidemic disease and the monitoring of germ.More particularly to a kind of for detecting the primer and probe combinations of phytophthora hibernalis
Object and its kit and detection method.
Background technique
Phytophthora hibernalis (Phytophthora hibernalis) is the important plant quarantine venereal disease opportunistic pathogen in China, most early in
It is found on the citrusfruit of western australia, is mainly distributed on Israel, Turkey, South Africa, France, Britain, western class at present
Tooth, Greece, Italy, Portugal, the U.S., Argentina, Venezuela, Trinidad and Tobago, Australia, New Zealand,
The countries such as Fiji.Its allied species cloves phytophthora is once at 2011 and 2012 2 times by China Tianjin intercept and capture, while each port
Also the inspection to phytophthora hibernalis is increased.
The method of traditional detection phytophthora hibernalis is time-consuming and laborious and operator is required to have the phytophthora separation of profession, form
Learn identification knowledge and experience abundant.With the development of the relevant identification method of nucleic acid, the method based on PC R is successfully used
In detection phytophthora hibernalis, although PCR method is greatly improved in specificity and sensibility, detection time still compares
It is long, general 4~5h, while PCR method relies on accurate temperature cycling device.Its detection sensitivity is relatively high, but detects
Journey is complicated, is not able to satisfy the demand quickly detected.
Recombinase-mediated isothermal duplication (Recombinase Polymerase Amlification, RPA) technology is recognized
It is the nucleic acid detection technique that can substitute PCR.Its principle is to form Protein-DNA mixtures, energy in conjunction with primer using recombinase
Homologous sequence is found in double-stranded DNA.Once primer located homologous sequence, Exchange reaction of chain will occur and formed and started
DNA synthesis carries out exponential amplification to the target area in template.In addition, RPA technology has the matching of multiple tools enzyme effectively to be expanded
Increase, amplification efficiency is much higher than traditional round pcr, and the time used is shorter, most short to realize in 5min.Since RPA technology has
The amplification used time is short, is not required to expensive instrument, the features such as specificity is good, makes it using more and more extensive.The maximum feature of RPA technology is only
It needs 1 pair of primer that can realize the amplification of template nucleic acid under 37 DEG C or so of constant temperature, does not need to recycle by high and low temperature
It realizes nucleic and melting and annealing, therefore does not need expensive instrument and equipment.And 37 DEG C of popular response temperature is easily met, and is fitted
Close quick detection of the base to pathogen.Currently, RPA technology has been widely used for human body, the viral diagnosis on animal or plant,
But it in the context of detection of pathogenic oomycetes, is detected especially for the RPA of quarantine phytophthora hibernalis, has no that related application is reported.
Summary of the invention
Goal of the invention: being directed to the deficiencies in the prior art, and the object of the present invention is to provide one kind to be used for phytophthora hibernalis
RPA- Sidestream chromatography detection primer and probe combination, meet RPA- Sidestream chromatography detection use demand.Of the invention is another
One purpose is to provide a kind of kit based on the combination of above-mentioned primer and probe.Further object of the present invention is to provide one kind and is based on
The soyabean phytophthora detection method of RPA- Sidestream chromatography technology, to establish the New Method for Rapid of phytophthora hibernalis.
Technical solution: to achieve the above object, the present invention adopts the following technical solutions:
A kind of primer and probe combination that the RPA- Sidestream chromatography for phytophthora hibernalis detects, it is specific as follows: forward primer
For RPA-PSYPT-F:5'-TTCCACCCTTCCACCAGACTGCTGAGGAGG-3'；Reverse primer is RPA-PSYPT-R:5 '-
[Biotin]TGTTAGCTGCGTGTTCGTTGGTCACC CCAGA-3'；Probe is PSYPT-P:5 '-[FAM]
CTTCTGTGATTTATCCAGAAAATCC GTACGAT-THE-GAGCTGGACGGCAAGA[C3-spacer]-3’。
Application of the primer and probe combination in detection phytophthora hibernalis.
A kind of kit detecting phytophthora hibernalis, includes the primed probe mixed liquor being made of the primer and probe.
The kit, the composition of the primed probe liquid are as follows: forward primer and reverse primer final concentration are 0.42 μ
Mol/L, final concentration of 0.06 μm of ol/L of probe.
The kit, further includes: standard positive DNA, buffer, eight union of enzymatic amplification, aseptic double-distilled water, reaction are driven
Hydrodynamic, product dilution and Sidestream chromatography test strips.
The kit is visited containing the corresponding primer of 29.5 μ L of buffer, phytophthora hibernalis RPA in every 50 μ L amplification system
4.8 μ L of needle liquid, 11.2 μ L of aseptic double-distilled water, sample to be tested DNA are that positive control is respectively 2 μ L or using aseptic double-distilled water as blank
Compare 2 μ L, reaction driving 2.5 μ L of liquid.
A method of phytophthora hibernalis being detected based on RPA- Sidestream chromatography technology, steps are as follows:
1) sample to be tested DNA is extracted；
2) using DNA as template, RPA amplification is carried out, wherein the forward primer of RPA amplification is RPA-PSYPT-F:5'-
TTCCACCCTTCCACCAGACTGCTGAGGAGG-3'；Reverse primer is RPA-PSYPT-R:5 '-[Biotin]
TGTTAGCTGCGTGTTCGTTGGTCACCCCAGA-3'；Probe is PSYPT-P:5 '-[FAM] CTTCTGTGATTTATCCAGA
AAATCCGTACGAT-THE-GAGCTGGACGGCAAGA[C3-spacer]-3'；
3) amplified production detection is carried out using Sidestream chromatography test strips；When two brown bands, a position occur in test strips
In in quality control region, one is located at detection zone, then result is the positive, shows to contain phytophthora hibernalis in sample；When test strips only have matter
It controls area and a brown band occurs, detection zone does not have band, then the result is that it is negative, show in sample without containing phytophthora hibernalis.
In step 2), amplification condition are as follows: after 38 DEG C of metal bath 4min, mix, then 38 DEG C of metal bath 16mi n.
In step 2), RPA amplified reaction process includes: in the reaction member equipped with RPA nucleic acid amplification agents detection dry powder
Buffer solution B uffer 29.5 μ L, 10 μM of upstream primer 2.1 μ L, 10 μM of downstream primer 2.1 μ L, 0.6 μ of probe are added in pipe
2.0 μ L of L, DNA；It reacts while carrying out to guarantee, 2.5 μ L of MgAc should be added on the lid of eight connecting legs, be carefully turned over lid
On, RPA amplification system is mixed well, 5,000 × g is centrifuged 10s, is placed on 38 DEG C of metal baths and reacts, and takes out after incubating 4min
Reaction tube mixes again, is centrifuged 3-5s, is put into metal bath the reaction was continued 16min.
Different from routine PCR reaction, the length of primer needed for RPA reacts is usually 30-35bp, and the length of probe sequence is
46-52bp, formed inside primer when design of primers and between secondary structure, the increase of length also sets primer
The increase of meter and selection difficulty, therefore, the design and selection of primer are most important to the result of RPA.RPA technology is in starting
Conceptual phase there is no special primer, probe design software, also without a large amount of data for its design of primers principle provide according to
According to.Therefore, primer and probe of the invention combination is to need to design multipair primer from target sequence both ends to optimize, screen
It can obtain.Ypt1 gene is the relevant gene of a Ras, and a gtp binding protein relevant to Ras is encoded in yeast.
Ypt1 gene includes multiple intrones, and conserved sequence and evolution region are spaced apart from each other, and is suitable as phytophthora Molecular Detection
Target.For achieving the above object, the present invention is used first against the Ypt1 gene of phytophthora hibernalis as target sequence
The a series of RPA primer of 5.0 software design of Primer Premier, and designed primer optimized by experiment
Screening obtains a pair of primer special and probe for RPA detection phytophthora hibernalis.
The primer sets and probe can be used in production practices the fast and reliable of phytophthora hibernalis in incidence tissue and soil
Testing and appraisal.When for there are when phytophthora hibernalis, the DNA of phytophthora hibernalis to be extracted using NaOH rapid cleavage method in incidence tissue,
Detailed process is as follows: taking the tissue sample of one section of morbidity, every milligram of tissue is added 10 μ L 0.5M NaOH, sufficiently grinds in mortar
It is transferred to after mill in the EP pipe of 1.5mL, 12000rpm is centrifuged 5min, takes 5 μ L supernatants that 495 μ L 0.1mM Tris are added
(pH8.0), 1 μ L is taken to be directly used in RPA reaction after mixing.Each reaction is at least in triplicate.
The utility model has the advantages that compared with prior art, present invention has the advantage that
1) method that present invention system establishes quickly detection phytophthora hibernalis using RPA- Sidestream chromatography technology for the first time, and pass through spy
Anisotropic and sensitivity evaluation, can be used for the detection of actual sample, and for the on-site test of phytophthora hibernalis, to provide one kind sensitive, reliable
New method.The YPT1 gene primer that the present invention selects be through many experiments screen obtain, specificity it is good, with other pathogens without
Cross reaction.Primed probe expanding effect used in the present invention is good, band high specificity, can be formed in detection zone higher
The primer-probe heterodimer of concentration, thus make test strips that strong positive reaction be presented, increase the sensitivity of detection, institute of the present invention
Establishing detection method can detect the phytophthora hibernalis genome of 100pg.
2) RPA technology of the invention and the method for combining Sidestream chromatography technology detection phytophthora hibernalis, both have molecular biosciences
The highly sensitive, high-throughput of detection is learned, and has the advantages that the specificity of immunology detection is good, easy to operate, is further without complicated instrument
Device, particularly suitable for the phytophthora hibernalis rapid screening detection of laboratories and quarantine scene.
3) detection speed is fast: compared with Standard PCR, it is not necessary to by denaturation, annealing, extend three steps, RPA reacts most
Thermophilic degree is between 37 DEG C -40 DEG C, and without denaturation, reaction is can be completed in 20min or so at normal temperature.
4) complicated instrument and equipment is not needed, on-site test is suitable for.Constant-temperature amplification is realized, unlike PCR method has to
Thermal cycle thus gets rid of the dependence to thermal cycler instrument, as long as having stable heat source RPA reaction, greatly
The range for extending RPA and using, can really realize portable live Rapid nucleic acid detection.
5) present invention can be used for carrying disease germs the quick detection of phytophthora hibernalis in plant tissue, only need an about 2h that detection can be completed
Process is a kind of effective means for detecting phytophthora hibernalis.
6) prediction of the detection method for morbidity the early period detection and disease of phytophthora hibernalis, it is anti-for determining
Optimum period is controlled, disease is effectively prevented and has a very important significance.
Detailed description of the invention
Fig. 1 is specific detection result figure of the Sidestream chromatography test strips in different phytophthora inter-species of RPA sensitivity；In figure,
1: phytophthora hibernalis (P.hibernalis)；2: cloves phytophthora (Phytophthora syringae)；3: phytophthora parasitica
(P.parasitica)；4: phytophthora infestans (P.infestans)；5: radix aucklandiae phytophthora (P.tent aculata)；6:；Lichee phytophthora
(P.litchii)；7: ramie mould (P.boehmeriae)；8: negative control；
Fig. 2 is specific detection result figure testing result figure of the Sidestream chromatography test strips of RPA sensitivity between category；Figure
In, 1: phytophthora hibernalis (P.hibernalis)；2: Pythium ultimum (Pythium ultimum)；3: scouring rush's Fusariumsp (Fusarium
equiseti)；4: tack anthrax-bacilus (Colletotrichum truncatum)；5: verticillium dahliae (Verticilium dahliae)；
6: Rhizoctonia solani Kuhn (Rhizoctonia solani)；7: Pyricularia oryzae (Magnaporthe grisea)；8: negative control；
Fig. 3 is the sensitivity test result figure and regular-PCR sensitivity test result figure of RPA Sidestream chromatography test strips detection method.
Specific embodiment
The present invention is described further combined with specific embodiments below, but the present invention is not limited by the following examples.
Embodiment 1
1, according to the Ypt1 sequence of phytophthora hibernalis (P.hibernalis KJ755160.1), Primer Premier is used
5.0 design forward primers and reverse primer and probe composition RPA primer and probe combination.It is specific as follows:
Forward primer is RPA-PSYPT-F:5'-TTCCACCCTTCCACCAGACTGCTGAGGAGG-3'；Reverse primer is
RPA-PSYPT-R:5 '-[Biotin] TGTTAGCTGCGTGTTCGTTGGTCACCCCAGA-3 '；Probe is PSYPT-P:5 '-
[FAM]CTTCTGTGATTTATCCAGAAAATCCGTACGAT-THE-GAGCTGGACGGCAAGA[C3-spacer]-3’。
2, the genomic DNA for trying cause of disease bacteria strain is extracted.Specific extraction process is as follows:
A small amount of hypha powder is taken, adds 900 μ L2%CTAB extracting solutions and 90 μ L10%SDS, whirlpool mixes, in 60 DEG C of water-bath 1h,
Intermediate every 10min turns upside down several times.12000rpm is centrifuged 10min, takes supernatant that isometric phenol/chloroform/isoamyl alcohol is added
(25:24:1), is mixed by inversion, and 12000rpm is centrifuged 10min；Supernatant is transferred in new pipe, isometric chloroform is added, gently
It is gently mixed by inversion, 12000rpm is centrifuged 5min.It takes supernatant to be transferred in new pipe, adds the dehydrated alcohol and 1/10 body of 2 times of volumes
Long-pending 3M NaAc (pH5.2), -20 DEG C of precipitatings (> 1h).12000rpm is centrifuged 10min, and incline supernatant, precipitates 70% ethyl alcohol
It washes twice, room temperature is dried.Add appropriate sterilizing ultrapure water or TE (pH 8.0) dissolution precipitating (containing 20 μ g mL-1RNase), 37 DEG C
After handling 1h, -20 DEG C are saved backup.Each soil sample is dried pulverize first, then claimed respectively by the extraction for DNA in soil
It takes 0.5g soil sample as sample is extracted, usesSPIN kit (Q-Biogene Ltd, USA) carries out mentioning for DNA
It takes.The specific steps that soil DNA extracts are referring to kit specification.
3, using the DNA of extraction as template, using the RPA primer of design, RPA reaction is carried out in following reaction systems:
Sample detection: 29.5 μ L of Buffer, 10 μM of upstream primer are added into the reaction member pipe equipped with detection dry powder
2.1 μ L, 10 μM of 2.1 μ L of downstream primer, 0.6 2.0 μ L of μ L, DNA of probe；2.5 μ L of MgAc is added on reaction member pipe lid,
It is carefully turned over and covers, RPA amplification system is mixed well, 5,000 × g is centrifuged 10s, is placed on 38 DEG C of metal baths and reacts, and incubates
Reaction tube is taken out after 4min to mix again, is centrifuged 3-5s, is put into metal bath the reaction was continued 16min.
Negative control: 2.0 μ L template DNAs are changed to that 2.0 μ L sterilizing ddH is added by the same sample detection of operating procedure2O。
RPA carries out amplified production detection after reaction, using Sidestream chromatography test strips.When two brown items occur in test strips
Band, one is located in quality control region, and one is located at detection zone, then result is the positive, shows to contain phytophthora hibernalis in sample；Work as test strips
Only there is a brown band in quality control region, and detection zone does not have band, then the result is that negative, shows in sample without containing phytophthora hibernalis.
Embodiment 2
It is other with 2 plants of phytophthora hibernalis bacterial strains and 14 kinds in order to verify the specificity of RPA Sidestream chromatography test strips detection method
Oomycetes and 17 kinds of disease fungus are material to be tested (table 1), 2 plants of winters as the result is shown of RPA Sidestream chromatography test strips detection method
There are two brown bands in the test strips of raw phytophthora, and one is located in quality control region, and one is located at detection zone, then result is the positive,
The test strips of remaining 14 kinds of oomycetes and 17 kinds of disease fungus only have quality control region a brown band occur, and detection zone does not have item
Band, then the result is that it is negative, show in sample without containing phytophthora hibernalis.Selection and phytophthora hibernalis (cloves phytophthora not of the same race；Parasitic epidemic disease
It is mould；Phytophthora infestans；Radix aucklandiae phytophthora；Lichee phytophthora；Ramie mould etc.) and bacterium (the tack anthrax-bacilus that does not belong to；Eggplant sickle-like bacteria；Rice
Seasonal febrile diseases bacterium；Rhizoctonia solani Kuhn；Verticillium dahliae；Pythium ultimum) DNA as template, carry out the detection of RPA Sidestream chromatography test strips.
Table 1 is used to detect fungi and the oomycetes bacterial strain of phytophthora hibernalis specificity
Testing result is as depicted in figs. 1 and 2.Fig. 1 is the Sidestream chromatography test strips of RPA sensitivity in different phytophthora inter-species
Specific detection is as a result, in figure, and 1: phytophthora hibernalis (P.hibernalis)；2: cloves phytophthora (Phytophthora
syringae)；3: phytophthora parasitica (P.parasitica)；4: phytophthora infestans (P.infestans)；5: radix aucklandiae phytophthora
(P.tentaculata)；6:；Lichee phytophthora (P.litchii)；7: ramie mould (P.boehmeriae)；8: negative control；Examination
There are two brown bands in paper slip, and one is located in quality control region, and one is located at detection zone, then result is the positive, shows in sample
Contain phytophthora hibernalis；When test strips only have quality control region a brown band occur, detection zone does not have band, then the result is that negative,
Show in sample without containing phytophthora hibernalis.The 1st article of aobvious 2 bands are shown in figure, are positive；Remaining 1 band, is negative.
Fig. 2 is specific detection result figure testing result of the Sidestream chromatography test strips of RPA sensitivity between category, in figure,
1: phytophthora hibernalis (P.hibernalis)；2: Pythium ultimum (Pythium ultimum)；3: scouring rush's Fusariumsp (Fusarium
equiseti)；4: tack anthrax-bacilus (Colletotrichum truncatum)；5: verticillium dahliae (Verticilium
dahliae)；6: Rhizoctonia solani Kuhn (Rhizoctonia solani)；7: Pyricularia oryzae (Magnaporthe grisea)；8: yin
Property control；There are two brown bands in test strips, and one is located in quality control region, and one is located at detection zone, then result is the positive, table
Contain phytophthora hibernalis in bright sample；When test strips only have quality control region a brown band occur, detection zone does not have band, then result
It is feminine gender, shows in sample without containing phytophthora hibernalis.The 9th article of aobvious 2 bands are shown in figure, are positive；Remaining 1 band, is negative.
As it can be seen that after carrying out RPA amplified reaction with the primer that embodiment 1 designs, Sidestream chromatography test strips 2 palm fibres as the result is shown
Vitta band (Fig. 1, Fig. 2), target stripe is analysed clearly, can effectively detect phytophthora hibernalis.And other fungies and oomycetes are only in Quality Control
There is a brown band in area, and negative control also only a brown band occurs in quality control region.
Embodiment 3
Determining embodiment 3 to extract the concentration of DNA using 2000 micro-spectrophotometer of Nanodro is 100ng μ L-1。
It is successively diluted to 100pg μ L-1、10pgμL-1、1pgμL-1With 100fg μ L-1, used according to above-described embodiment
Primer, reaction system and reaction condition carry out RPA and PCR to the DNA of various concentration and detect.
Experimental result as shown in figure 3, contain 100ng μ L respectively in the reaction system of 25 μ L-1、10ngμL-1、1ngμL-1、
100pgμL-1There are two brown bands in the test strips of phytophthora hibernalis DNA, are positive, contain respectively in the reaction system of 25 μ L
There is 10pg μ L-1、1pgμL-1、100fgμL-1There is a brown band in the paper slip of phytophthora hibernalis DNA, negative.Colour developing knot
Fruit shows that the sensitivity of RPA isothermal amplification reaches 100pg μ L-1.With the reference culture of the phytophthora hibernalis bacterium of same concentration
Genomic DNA carries out pcr amplification reaction, compares the sensitivity of two methods as amplification template.Experiment 3 times is repeated, with determination
The sensitivity of PCR method detection phytophthora hibernalis bacterium genomic DNA.The result of 3 repetition experiments is consistent.It is in genomic DNA concentration
1ngμL-1When, PCR detection is capable of detecting when specific band, it was demonstrated that specific amplification occurs, testing result is judged to the positive.And
Genomic DNA concentration is 100pg μ L-1When, PCR product is detected without discovery specific band, it was demonstrated that there is no specificity
Amplification, testing result are judged to feminine gender, i.e. the sensitivity of PCR method detection phytophthora hibernalis bacterium genomic DNA is 1ng μ L-1.Thus may be used
See, the sensitivity of RPA Sidestream chromatography test strips detection method is higher by 10 times than PCR method.
The result shows that RPA detectable concentration is 10pg μ L-1, and PCR detectable concentration is 1ng μ L-1When remain to see target item
Band illustrates the high sensitivity of RPA detection in PCR.But PCR detection process needs 2.5h, and RPA detection time only needs 30min, and
The instrument and equipment of the valuableness such as PCR instrument is not needed, operation sequence is easy, more favorably promotes and applies in production.
Claims (9)
1. a kind of primer and probe combination that the RPA- Sidestream chromatography for phytophthora hibernalis detects, which is characterized in that specific as follows:
Forward primer is RPA-PSYPT-F:5'-TTCCACCCTTCCACCAGACTGCTGAGGAGG-3'；Reverse primer is RPA-
PSYPT-R:5 '-[Biotin] TGTTAGCTGCGTGTTCGTTGGTCACCCCAGA-3 '；Probe is PSYPT-P:5 '-[FAM]
CTTCTGTGATTTATCCAGAAAATCCGTACGAT-THE-GAGCTGGACGGCAAGA[C3-spacer]-3’。
2. application of the primer and probe combination described in claim 1 in detection phytophthora hibernalis.
3. a kind of kit for detecting phytophthora hibernalis, which is characterized in that the kit include by primer described in claim 1 and
The primed probe mixed liquor of probe composition.
4. kit according to claim 3, which is characterized in that the composition of the primed probe liquid are as follows: forward primer and
Reverse primer final concentration is 0.42 μm of ol/L, final concentration of 0.06 μm of ol/L of probe.
5. kit according to claim 3, which is characterized in that further include: standard positive DNA, buffer, enzymatic amplification eight
Union, aseptic double-distilled water, reaction driving liquid, product dilution and Sidestream chromatography test strips.
6. kit according to claim 3, which is characterized in that in every 50 μ L amplification system containing 29.5 μ L of buffer,
Corresponding 4.8 μ L of primed probe liquid of phytophthora hibernalis RPA, 11.2 μ L of aseptic double-distilled water, sample to be tested DNA are respectively for positive control
2 μ L drive 2.5 μ L of liquid by 2 μ L of blank control, reaction of aseptic double-distilled water.
7. a kind of method based on RPA- Sidestream chromatography technology detection phytophthora hibernalis, which is characterized in that steps are as follows:
1) sample to be tested DNA is extracted；
2) using DNA as template, RPA amplification is carried out, wherein the forward primer of RPA amplification is RPA-PSYPT-F:5'-
TTCCACCCTTCCACCAGACTGCTGAGGAGG-3'；Reverse primer is RPA-PSYPT-R:5 '-[Biotin]
TGTTAGCTGCGTGTTCGTTGGTCACCCCAGA-3'；Probe is PSYPT-P:5 '-[FAM] CTTCTGTGATTTATCCAGA
AAATCCGTACGAT-THE-GAGCTGGACGGCAAGA[C3-spacer]-3'；
3) amplified production detection is carried out using Sidestream chromatography test strips；When two brown bands occur in test strips, one is located at matter
It controls in area, one is located at detection zone, then result is the positive, shows to contain phytophthora hibernalis in sample；When test strips only have quality control region
There is a brown band, detection zone does not have band, then the result is that it is negative, show in sample without containing phytophthora hibernalis.
8. the method according to claim 7 based on RPA- Sidestream chromatography technology detection phytophthora hibernalis, which is characterized in that step
It is rapid 2) in, amplification condition are as follows: after 38 DEG C of metal bath 4min, mix, then 38 DEG C of metal bath 16min.
9. the method according to claim 7 based on RPA- Sidestream chromatography technology detection phytophthora hibernalis, which is characterized in that step
It is rapid 2) in, RPA amplified reaction process include: be added in the reaction member pipe equipped with RPA nucleic acid amplification agents detection dry powder it is slow
Fliud flushing Buffer 29.5 μ L, 10 μM of upstream primer 2.1 μ L, 10 μM of 2.1 μ L of downstream primer, 0.6 2.0 μ of μ L, DNA of probe
L；It reacts while carrying out to guarantee, 2.5 μ L of Mg Ac should be added on the lid of eight connecting legs, be carefully turned over and covered, RPA is expanded
Increasing system mixes well, and 5,000 × g is centrifuged 10s, is placed on 38 DEG C of metal baths and reacts, and takes out reaction tube again after incubating 4min
It mixes, is centrifuged 3-5s, be put into metal bath the reaction was continued 16min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910194831.XA CN109988860B (en) | 2019-03-14 | 2019-03-14 | Primer and probe composition for detecting phytophthora hibernalis, kit and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910194831.XA CN109988860B (en) | 2019-03-14 | 2019-03-14 | Primer and probe composition for detecting phytophthora hibernalis, kit and detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109988860A true CN109988860A (en) | 2019-07-09 |
| CN109988860B CN109988860B (en) | 2022-08-30 |
Family
ID=67129709
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910194831.XA Active CN109988860B (en) | 2019-03-14 | 2019-03-14 | Primer and probe composition for detecting phytophthora hibernalis, kit and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109988860B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111118038A (en) * | 2020-01-15 | 2020-05-08 | 南京林业大学 | Phytophthora hibernalis specific detection new target Phibe _ s00003g00002.1 and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103725762A (en) * | 2012-10-11 | 2014-04-16 | 中国检验检疫科学研究院 | Primer pair and probe used for detecting phytophthora hibernalis and detection method for phytophthora hibernalis |
| WO2016097726A1 (en) * | 2014-12-16 | 2016-06-23 | Fungialert Limited | Device and method for detecting plant pathogens |
| CN108546779A (en) * | 2018-04-20 | 2018-09-18 | 山东师范大学 | RPA- Sidestream chromatographies detection primer, probe and the kit of bovine rota |
| CN108588266A (en) * | 2018-06-11 | 2018-09-28 | 南京林业大学 | The LAMP detection primer composition and its LAMP detection kit and LAMP detection method of a kind of phytophthora hibernalis |
-
2019
- 2019-03-14 CN CN201910194831.XA patent/CN109988860B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103725762A (en) * | 2012-10-11 | 2014-04-16 | 中国检验检疫科学研究院 | Primer pair and probe used for detecting phytophthora hibernalis and detection method for phytophthora hibernalis |
| WO2016097726A1 (en) * | 2014-12-16 | 2016-06-23 | Fungialert Limited | Device and method for detecting plant pathogens |
| CN108546779A (en) * | 2018-04-20 | 2018-09-18 | 山东师范大学 | RPA- Sidestream chromatographies detection primer, probe and the kit of bovine rota |
| CN108588266A (en) * | 2018-06-11 | 2018-09-28 | 南京林业大学 | The LAMP detection primer composition and its LAMP detection kit and LAMP detection method of a kind of phytophthora hibernalis |
Non-Patent Citations (3)
| Title |
|---|
| J. YU等: "Rapid and equipment-free detection of Phytophthora capsici using lateral flow strip-based recombinase polymerase amplification assay", 《LETTERS IN APPLIED MICROBIOLOGY》 * |
| TIMOTHY D MILES等: "Development of Rapid Isothermal Amplification Assays for Detection of Phytophthora spp. in Plant Tissue", 《PHYTOPATHOLOGY》 * |
| 张海峰等: "冬生疫霉（Phytophthora hibernalis）的快速分子检测", 《植物病理学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111118038A (en) * | 2020-01-15 | 2020-05-08 | 南京林业大学 | Phytophthora hibernalis specific detection new target Phibe _ s00003g00002.1 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109988860B (en) | 2022-08-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108103240A (en) | Prawn infectivity muscle necrosis virus（IMNV）RAA constant temperature fluorescence detection method and reagent | |
| CN107988325A (en) | Shrimp liver sausage born of the same parents worm（EHP）RAA constant temperature fluorescence detection method and reagent | |
| CN101575640B (en) | Primer group for bovine tuberculosis mycobacterium detection, rapid detection method and detection kit | |
| CN107988326A (en) | Prawn Acute Hepatic pancreatic necrosis（AHPND）RAA constant temperature fluorescence detection method and reagent | |
| CN110066885A (en) | A kind of primer and probe combination and its application based on RPA- Sidestream chromatography technology detection chestnut Heisui River phytophthora | |
| CN106520977A (en) | Primers and method for detecting alfalfa root rot fungi by virtue of loop-mediated isothermal amplification | |
| CN107828913A (en) | Prawn white spot syndrome（WSSV）RAA constant temperature fluorescence detection method and kit | |
| CN107988426A (en) | Prawn Taura syndrome（TSV）RAA constant temperature fluorescence detection method and reagent | |
| CN107988427A (en) | Prawn hepatopancreatic parvovirus（HPV）RAA constant temperature fluorescence detection method and reagent | |
| CN108504780A (en) | 8 kinds of sheep common virus and bacterium Taqman PCR kit for fluorescence quantitative and method are detected simultaneously | |
| CN104946758A (en) | LAMP detection primer set, detection kit and detection method for candida albicans | |
| CN106399486A (en) | Primer group and kit for detecting diarrhea-causing parasites through multi-PCR technology | |
| CN104328171B (en) | Loop-mediated isothermal amplification primer, kit and method for detecting rat staphylococcus aureus | |
| CN112322768B (en) | Rapid RPA detection method for diagnosing sea-buckthorn branch blight and pathogenic bacteria | |
| CN109825628B (en) | A kind of primer and probe combination and its application based on RPA- Sidestream chromatography technology detection Fusarium solani | |
| CN109943624A (en) | A kind of method and its primer special and probe combinations based on RPA- Sidestream chromatography technology detection soybean phytophthora | |
| CN109988860A (en) | A kind of primer and probe compositions and its kit and detection method for detecting phytophthora hibernalis | |
| CN109897910A (en) | A method of pinch outs are detected based on RPA- Sidestream chromatography Lateral Flow Strip fast accurate | |
| CN107287352A (en) | The probe primer group and its method of duck enteritis virus and duck hepatitis virus quick detection | |
| CN110093446A (en) | Recombinase-mediated isothermal duplication-Sidestream chromatography technology detection camphor tree phytophthora primer and probe combination and its application | |
| CN109825627B (en) | A kind of primer and probe combination and its application based on RPA- Sidestream chromatography technology detection cloves phytophthora | |
| CN109811073A (en) | Double PCR early stage quickly detects primer and its application of Streptococcusagalactiae and Streptococcus iniae | |
| CN106521038B (en) | A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit | |
| CN108913815A (en) | A kind of primer sets and dual RT-PCR method detecting ox norovirus and bovine coronavirus | |
| CN109735635A (en) | Method that is a kind of while detecting staphylococcus aureus, salmonella and shigella |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20190709 Assignee: MAANSHAN Panshi Biotechnology Co.,Ltd. Assignor: NANJING FORESTRY University Contract record no.: X2022320000333 Denomination of invention: Primer and probe composition for detection of Phytophthora Winter, kit and detection method thereof Granted publication date: 20220830 License type: Common License Record date: 20221210 Application publication date: 20190709 Assignee: Yulinwei (Nanjing) Biotechnology Co.,Ltd. Assignor: NANJING FORESTRY University Contract record no.: X2022320000315 Denomination of invention: Primer and probe composition for detection of Phytophthora Winter, kit and detection method thereof Granted publication date: 20220830 License type: Common License Record date: 20221210 |