CN106854654B

CN106854654B - rBCG for expressing sheep brookfield strain L7/L12 gene and construction method and application thereof

Info

Publication number: CN106854654B
Application number: CN201710084346.8A
Authority: CN
Inventors: 石艳春; 郑源强; 韩新荣
Original assignee: Inner Mongolia Medical University
Current assignee: Inner Mongolia Medical University
Priority date: 2017-02-16
Filing date: 2017-02-16
Publication date: 2020-06-23
Anticipated expiration: 2037-02-16
Also published as: CN106854654A

Abstract

The invention provides rBCG for expressing a Brucella melitensis L7/L12 gene, which is constructed by transferring an expression vector carrying a codon-optimized Brucella melitensis L7/L12 gene into BCG. Brucella ribonucleoprotein L7/L12 is a T cell antigen. BCG is the only commercial vaccine against tuberculosis to date. The research proves that BCG not only has obvious immunologic adjuvant effect, but also is an exogenous gene expression host with good performance and high safety. The brucella L7/L12 gene which is expressed by BCG and optimized by codons can improve the expression quantity of the L7/L12 gene, the constructed rBCG vaccine can simulate the intracellular infection and parasitism characteristics of the brucella, more effectively induces an organism to generate immune response, and can play the advantages of high safety, simple preparation, low cost and the like of the BCG as an expression host and the immune adjuvant effect of the BCG, so that the vaccine is expected to become a novel brucella vaccine.

Description

rBCG for expressing sheep brookfield strain L7/L12 gene and construction method and application thereof

Technical Field

The invention relates to the technical field of genetic engineering and vaccine preparation, in particular to rBCG for expressing a Brucella melitensis L7/L12 gene, and a construction method and application thereof.

Background

Brucellosis (Brucellosis), abbreviated as Brucellosis, is a zoonosis infection caused by brucella infection. The Bulbilus is a facultative intracellular parasite, highly infectious and pathogenic to humans and mammals. The genus mainly comprises 6 biological species such as sheep species, cattle species, pig species and dog species, the first 3 species are popular in China, and the Brucella melitensis infection in sheep species is the most common. The transmission mode of the cloth disease is animal-animal and animal-crowd. The livestock such as sheep, cattle, pigs and the like are most susceptible to infection, and the infection of the animals can cause inflammation of reproductive organs and fetal membranes, abortion, sterility and various tissue diseases, thereby greatly increasing the probability of spreading to people. The population is generally susceptible to the brucella, and the brucella of the common sheep species has the greatest harm to people. After a person contacts diseased animals and contaminated animal products, brucella bacteria can infect the animal through the pathways of digestive tract, respiratory tract, urogenital tract, skin, conjunctiva of eyes, and the like.

In recent 20 years, the epidemic situation of disease distribution in China has become more serious and has a tendency of spreading rapidly. The existing epidemic disease distribution vaccines at home and abroad are attenuated live vaccines, and the vaccines generally have the defects of high toxicity, short protection period, incapability of distinguishing natural infection, vaccination and the like, and cannot meet the practical requirement of disease distribution prevention and control. Therefore, the research and development of the novel disease distribution vaccine have important significance for controlling the spread of the disease distribution epidemic situation, and are hot spots of disease distribution research at home and abroad. The T cell antigens of the brucella comprise PBP39, L7/L12, Cu-Zn SOD and the like, and the proteins and the coding genes thereof are used for experimental research of brucella subunit vaccines and DNA vaccines.

Bacillus Calmette-guerin (BCG) is the only vaccine currently used to prevent tuberculosis and is widely used in the world health organization global expanded immunization program. BCG has the characteristics of large amount of safe use records for decades, good thermal stability, low production cost, obvious adjuvant effect, capability of inducing effective mucosal immunity by oral administration and the like, is an attractive live vaccine vector, and has attractive prospect as an expression host of a novel vaccine. In recent years, the research and development of recombinant BCG vaccines taking BCG as a carrier are increasingly concerned and valued by researchers at home and abroad, and the targeted pathogens relate to bacteria, viruses, parasites, tumors and the like, so that the recombinant BCG vaccine has a wide development prospect.

At present, reports about construction of recombinant BCG carrying ribosomal protein L7/L12 (L7/L12 gene) of Brucella melitensis M5 strain are not found at home and abroad.

Disclosure of Invention

The invention aims to provide rBCG for expressing a Brucella melitensis L7/L12 gene and a construction method thereof.

Another object of the present invention is to provide the use of the rBCG for the preparation of a brucellosis vaccine.

In order to realize the purpose of the invention, the invention firstly provides an expression vector, the expression vector carries a codon-optimized expression cassette of the Brucella melitensis L7/L12 gene, and the starting vector is an Escherichia coli-mycobacterium shuttle expression vector pMV 361.

In the invention, the Brucella melitensis L7/L12 gene is derived from Brucella melitensis M5 strain (CMCC55009) and is subjected to codon optimization, and the nucleotide sequence of the Brucella melitensis L7/L12 gene is shown as SEQ ID NO 1.

Preferably, the nucleotide sequence of the expression vector is shown as SEQ ID NO. 2.

The invention also provides a rBCG for expressing the Brucella melitensis L7/L12 gene, which is obtained by transferring an expression vector carrying the Brucella melitensis L7/L12 gene expression cassette into BCG and screening the BCG to secretly express the Brucella melitensis L7/L12 gene.

The rBCG for expressing the sheep brookfield bacteria L7/L12 gene is constructed by the following method:

1) according to the disclosed L7/L12 gene sequence of Brucella melitensis M5 strain, after codon optimization is carried out by adopting Jcat software, artificially synthesizing a full-sequence optimized L7/L12 gene as a target gene;

2) constructing a recombinant expression vector carrying the optimized Brucella melitensis L7/L12 gene: inserting the target gene into a shuttle expression vector pMV361 through two enzyme cutting sites of MunI and PvuII;

3) and (3) host bacterium transformation: transforming the recombinant expression vector constructed in the step 2) into BCG, and screening positive clones to obtain rBCG capable of carrying out secretory expression on the Brucella melitensis L7/L12 gene.

The invention also provides application of the rBCG in preparation of the brucellosis vaccine.

The invention also provides a brucellosis vaccine prepared from the rBCG.

The rBCG can be directly used as a brucellosis vaccine or prepared into the brucellosis vaccine by being assisted with an immunologic adjuvant.

The invention has the following advantages:

the brucella abortus ribosome protein L7/L12 (the relative molecular weight is about 15kDa, and the coding gene is L7/L12 gene) is a T cell antigen and can stimulate the organism to generate effective immune response.

BCG (BCG vaccine) is the only commercial vaccine for preventing tuberculosis so far, and the vaccine prepared by being used as an expression host of exogenous genes has the advantages of high safety, good thermal stability, simple preparation, low price and the like.

And (III) BCG has obvious immunologic adjuvant effect, so that the rBCG vaccine does not need to be added with a vaccine adjuvant, and the cost is further saved.

And (IV) the BCG is also a facultative intracellular parasitic bacterium, and the rBCG can simulate the characteristics of brucella infection and intracellular parasitism and more effectively induce the organism to generate immune response.

After codon optimization of the L7/L12 gene, the expression level of the exogenous gene in BCG can be improved (the expression level can be improved by more than one time), and the problem of poor immune effect of the recombinant BCG caused by low expression level of the exogenous gene is solved.

The results of animal experiments show that the constructed rBCG can induce mice to generate obvious immune response.

And (seventhly), the recombinant BCG vaccine prepared by using the Brucella melitensis L7/L12 gene has important research significance and potential application value.

Drawings

FIG. 1 is the SDS-PAGE electrophoresis result of the target protein in the recombinant BCG constructed by the optimized and non-optimized L7/L12 gene in example 2 of the present invention; wherein, 1: carrying the optimized L7/L12 gene recombinant BCG; 2: carrying the unoptimized L7/L12 gene recombinant BCG; 3: carrying the optimized L7/L12 gene recombinant BCG (temperature induction); 4: untransfected BCG; m: and (3) protein Marker.

FIG. 2 is a comparison of the immune effect of different recombinant BCG constructed in example 3 of the present invention on Balb/c mice.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular Cloning handbook, Sambrook et al (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual,2001), or the conditions as recommended by the manufacturer's instructions.

Example 1 construction of recombinant expression vector carrying Brucella melitensis L7/L12 Gene

The method comprises the following steps:

1. according to the published sequence of the Brucella melitensis L7/L12 gene (GenBank: EF173477.1), after codon optimization is carried out by adopting Jcat software, the L7/L12 gene with the optimized complete sequence is artificially synthesized to be used as a target gene (the nucleotide sequence is shown as SEQ ID NO: 1).

2. Construction of recombinant expression vector carrying M5 strain L7/L12 Gene:

the target gene is inserted into a shuttle expression vector pMV361 through two enzyme cutting sites of MunI and PvuII.

3. Validation of insertion of the correct recombinant expression vector:

the nucleic acid sequence determination proves that the recombinant expression vector carrying the optimized Brucella melitensis L7/L12 gene is successfully constructed.

Example 2 construction of rBCG expressing the Brucella melitensis L7/L12 Gene

1. The recombinant expression vector constructed in example 1 (the entire sequence is shown in SEQ ID NO: 2) was transformed into BCG using BCG as a host bacterium.

The transformation is carried out by adopting an electrotransformation method under the experimental conditions of 2500V, 25 mu F and 1000 omega, the electrotransformation time is 5ms, and the electrotransformation reaction system comprises 4 mu l of plasmid (the concentration is 0.51 mu g/mu l) and 100 mu l of competent BCG bacterial liquid (the concentration is about 1 × 10)¹⁰CFU/ml)。

2. Screening for Positive clones

After the electroporation, the cells were inoculated into a medium (slant) containing 50. mu.g/ml kanamycin to perform positive clone screening.

3. Detection of expression level of target Gene

Inoculating the screened positive clone (namely recombinant BCG) into a liquid culture medium for amplification culture, collecting culture supernatant, and detecting the expression quantity of the target gene by SDS-PAGE electrophoresis. The expression of the optimized L7/L12 gene is increased, and particularly, the expression level is obviously improved after temperature induction (60 ℃ for 4 hours). The results are shown in FIG. 1.

Example 3 Effect test of Brucella vaccine

Immunizing female Balb/c mice of 6-8 weeks old with recombinant BCG, and injecting subcutaneously at a dose of 4 × 10⁸CFU/mouse, 4 weeks after immunization, serum expression of Th1/Th2 type cytokines was examined in each group of mice. The experimental results show that the carrier is not optimizedCompared with the non-transformed BCG, the recombinant BCG (rBCG-L7/L12(wild)) of the L7/L12 gene can effectively induce the generation of Th1 cytokines such as IL-2, IFN-gamma and the like by the recombinant BCG (rBCG-L7/L12) carrying the L7/L12 gene subjected to codon optimization. (FIG. 2)

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> university of medical inner Mongolia

<120> rBCG for expressing Brucella melitensis L7/L12 gene and construction method and application thereof

<130>KHP161118995.5

<160>2

<170>PatentIn version 3.3

<210>1

<211>375

<212>DNA

<213> Artificial sequence

<400>1

atggccgacc tggccaagat cgtggaggac ctgtcggccc tgaccgtgct ggaggccgcc 60

gagctgtcga agctgctgga ggagaagtgg ggcgtgtcgg ccgccgcccc ggtggccgtg 120

gccgccgccg gcggcgccgc cccggccgcc gccgccgagg agaagaccga gttcgacgtg 180

gtgctggccg acggcggcgc caacaagatc aacgtgatca aggaggtgcg cgccctgacc 240

ggcctgggcc tgaaggaggc caaggacctg gtggagggcg ccccgaaggc cgtgaaggag 300

ggcgcctcga aggacgaggc cgagaagatc aaggcccagc tggaggccgc cggcgccaag 360

gtggagctga agtaa 375

<210>2

<211>4819

<212>DNA

<213> recombinant expression vector

<400>2

gctagcaaca aagcgacgtt gtgtctcaaa atctctgatg ttacattgca caagataaaa 60

atatatcatc atgaacaata aaactgtctg cttacataaa cagtaataca aggggtgtta 120

tgagccatat tcaacgggaa acgtcttgct cgaggccgcg attaaattcc aacatggatg 180

ctgatttata tgggtataaa tgggctcgcg ataatgtcgg gcaatcaggt gcgacaatct 240

atcgcttgta tgggaagccc catgcgccag agttgtttct gaaacatggc aaaggtagcg 300

ttgccaatga tgttacagat gagatggtca gactaaactg gctgacggaa tttatgcctc 360

ttccgaccat caagcatttt atccgtactc ctgatgatgc atggttactc accactgcga 420

tccccgggaa aacagcattc caggtattag aagaatatcc tgattcaggt gaaaatattg 480

ttgatgcgct ggcagtgttc ctgcgccggt tgcattcgat tcctgtttgt aattgtcctt 540

ttaacagcga tcgcgtattt cgtctcgctc aggcgcaatc acgaatgaat aacggtttgg 600

ttgatgcgag tgattttgat gacgagcgta atggctggcc tgttgaacaa gtctggaaag 660

aaatgcataa tcttttgcca ttctcaccgg attcagtcgt cactcatggt gatttctcac 720

ttgataacct tatttttgac gaggggaaat taataggttg tattgatgtt ggacgagtcg 780

gaatcgcaga ccgataccag gatcttgcca tcctatggaa ctgcctcggt gagttttctc 840

cttcattaca gaaacggctt tttcaaaaat atggtattga taatcctgat atgaataaat 900

tgcagtttca tttgatgctc gatgagtttt tctaatcaga attggttaat tggttgtaac 960

actggcagag cattacgctg acttgacggg acggcggctt tgttgaataa atcgaacttt 1020

tgctgagttg aaggatcaga tcacgcatct tcccgacaac gcagaccgtt ccgtggcaaa 1080

gcaaaagttc aaaatcacca actggtccac ctacaacaaa gctctcatca accgtggctc 1140

cctcactttc tggctggatg atggggcgat tcaggcctgg tatgagtcag caacaccttc 1200

ttcacgaggc agacctcact agttccactg agcgtcagac cccgtagaaa agatcaaagg 1260

atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc 1320

gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac 1380

tggcttcagc agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca 1440

ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt 1500

ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc 1560

ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg 1620

aacgacctac accgaactga gatacctaca gcgtgagcat tgagaaagcg ccacgcttcc 1680

cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac 1740

gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct 1800

ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc 1860

cagcaacgcg gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt 1920

tcctgcgtta tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac 1980

cgctcgccgc agccgaacga ccgagcgcaa cgcgtgcggc cgcggtaccc ggggatcctc 2040

tagagtcgac caccaagggc accatctctg cttgggccac cccgttggcc gcagccagct 2100

cgctgagagc cgtgaacgac agggcgaacg ccagcccgcc gacggcgagg gttccgaccg 2160

ctgcaactcc cggtgcaacc ttgtcccggt ctattctctt cactgcacca gctccaatct 2220

ggtgtgaatg cccctcgtct gttcgcgcag gcggggggct ctattcgttt gtcagcatcg 2280

aaagtagcca gatcagggat gcgttgcaac cgcgtatgcc caggtcagaa gagtcgcaca 2340

agagttgcag acccctggaa agaaaaatgg ccagagggcg aaaacaccct ctgaccagcg 2400

gagcgggcga cgggaatcga acccgcgtag ctagtttgga agaatgggtg tctgccgacc 2460

acatatgggc cggtcaagat aggtttttac cccctctcgg ctgcatcctc taagtggaaa 2520

gaaattgcag gtcgtagaag cgcgttgaag cctgagagtt gcacaggagttgcaacccgg 2580

tagccttgtt cacgacgaga ggagacctag ttggcacgtc gcggatgggg atcgctgaag 2640

actcagcgca gcgggaggat ccaagcctca tacgtcaacc cgcaggacgg tgtgaggtac 2700

tacgcgctgc agacctacga caacaagatg gacgccgaag cctggctcgc gggcgagaag 2760

cggctcatcg agatggagac ctggacccct ccacaggacc gggcgaagaa ggcagccgcc 2820

agcgccatca cgctggagga gtacacccgg aagtggctcg tggagcgcga cctcgcagac 2880

ggcaccaggg atctgtacag cgggcacgcg gagcgccgca tctacccggt gctaggtgaa 2940

gtggcggtca cagagatgac gccagctctg gtgcgtgcgt ggtgggccgg gatgggtagg 3000

aagcacccga ctgcccgccg gcatgcctac aacgtcctcc gggcggtgat gaacacagcg 3060

gtcgaggaca agctgatcgc agagaacccg tgccggatcg agcagaaggc agccgatgag 3120

cgcgacgtag aggcgctgac gcctgaggag ctggacatcg tcgccgctga gatcttcgag 3180

cactaccgga tcgcggcata catcctggcg tggacgagcc tccggttcgg agagctgatc 3240

gagcttcgcc gcaaggacat cgtggacgac ggcatgacga tgaagctccg ggtgcgccgt 3300

ggcgcttccc gcgtggggaa caagatcgtc gttggcaacg ccaagaccgt ccggtcgaag 3360

cgtcctgtga cggttccgcc tcacgtcgcg gagatgatcc gagcgcacat gaaggaccgt 3420

acgaagatga acaagggccc cgaggcattc ctggtgacca cgacgcaggg caaccggctg 3480

tcgaagtccg cgttcaccaa gtcgctgaag cgtggctacg ccaagatcgg tcggccggaa 3540

ctccgcatcc acgacctccg cgctgtcggc gctacgttcg ccgctcaggc aggtgcgacg 3600

accaaggagc tgatggcccg tctcggtcacacgactccta ggatggcgat gaagtaccag 3660

atggcgtctg aggcccgcga cgaggctatc gctgaggcga tgtccaagct ggccaagacc 3720

tcctgaaacg caaaaagccc ccctcccaag gacactgagt cctaaagagg ggggtttctt 3780

gtcagtacgc gaagaaccac gcctggccgc gagcgccagc accgccgctc tgtgcggaga 3840

cctgggcacc agccccgccg ccgccaggag cattgccgtt cccgccagaa atctagacgg 3900

tgaccacaac gacgcgcccg ctttgatcgg ggacgtctgc ggccgaccat ttacgggtct 3960

tgttgtcgtt ggcggtcatg ggccgaacat actcacccgg atcggagggc cgaggacaag 4020

gtcgaacgag gggcatgacc cggtgcgggg cttcttgcac tcggcatagg cgagtgctaa 4080

gaataacgtt ggcactcgcg accggtgagt cgtaggtcgg gacggtgagg ccaggcccgt 4140

cgtcgcagcg agtggcagcg aggacaactt gagccgtccg tcgcgggcac tgcgcccggc 4200

cagcgtaagt agcggggttg ccgtcacccg gtgacccccg gtttcatccc cgatccggag 4260

gaatcacttc gcaatggcca agacaattgg ccacatggcc gacctggcca agatcgtgga 4320

ggacctgtcg gccctgaccg tgctggaggc cgccgagctg tcgaagctgc tggaggagaa 4380

gtggggcgtg tcggccgccg ccccggtggc cgtggccgcc gccggcggcg ccgccccggc 4440

cgccgccgcc gaggagaaga ccgagttcga cgtggtgctg gccgacggcg gcgccaacaa 4500

gatcaacgtg atcaaggagg tgcgcgccct gaccggcctg ggcctgaagg aggccaagga 4560

cctggtggag ggcgccccga aggccgtgaa ggagggcgcc tcgaaggacg aggccgagaa 4620

gatcaaggcc cagctggagg ccgccggcgc caaggtggag ctgaagtaac agctgcagaa 4680

ttcgaagcttatcgatgtcg acgtagttaa ctagcgtacg atcgactgcc aggcatcaaa 4740

taaaacgaaa ggctcagtcg aaagactggg cctttcgttt tatctgttgt ttgtccggcc 4800

atcatggccg cggtgatca 4819

Claims

1. The rBCG for expressing the sheep brucella L7/L12 gene is characterized in that an expression vector carrying the gene shown as SEQ ID NO:1 is transferred into BCG, and the rBCG capable of carrying out secretory expression on the sheep brucella L7/L12 gene is obtained by screening.

2. The rBCG according to claim 1, wherein the starting vector is the E.coli-Mycobacterium shuttle expression vector pMV 361.

3. The rBCG according to claim 2, wherein the nucleotide sequence of the expression vector is represented by SEQ ID NO 2.

4. Use of the rBCG according to any one of claims 1-3 for the preparation of a vaccine against Brucella.

5. A brucellosis vaccine prepared from the rBCG of any of claims 1-3.