CN104152480A - Construction method and expression method of coexpression vector of L7/L12, Omp31, Rs alpha and sodC Brucella immune proteins - Google Patents
Construction method and expression method of coexpression vector of L7/L12, Omp31, Rs alpha and sodC Brucella immune proteins Download PDFInfo
- Publication number
- CN104152480A CN104152480A CN201410378291.8A CN201410378291A CN104152480A CN 104152480 A CN104152480 A CN 104152480A CN 201410378291 A CN201410378291 A CN 201410378291A CN 104152480 A CN104152480 A CN 104152480A
- Authority
- CN
- China
- Prior art keywords
- expression
- omp31
- sodc
- brucella
- carrier
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses a construction method and an expression method of a coexpression vector of L7/L12, Omp31, Rs alpha and sodC Brucella immune proteins. The disclosed coexpression vector includes a double expression vector pETDuet-1 and a double expression vector pRSFDuet-1, which are both expressed in the same host bacteria, wherein the two double expression vectors are respectively connected with encoding genes of two Brucella immune proteins. On this basis, the invention also discloses the construction method and the expression method of the coexpression vector. L7/L12, Omp31, Rs alpha and sodC Brucella immune proteins all with good immunity functions can be expressed simultaneously by the coexpression vector disclosed by the invention and are effectively used for preparing subunit vaccine of the Brucella gene engineering and preventing and controlling various brucellosis.
Description
Technical field
The co-expression carrier construction process and the expression method that the present invention relates to brucella L7/L12, Omp31, Rs α, sodC immune protein, belong to technical field of biological genetic engineering.
Background technology
Brucella (Brucella) is the facultative intracellular parasitic bacteria of a kind of Gram-negative, extensively infect domestic animal, wildlife and people, livestock animals brucella main infection sheep, ox and pig, what wherein people is caused a disease mainly contains alcaligenes melitensis and Bacillus abortus; Brucellosis infects domestic animal and causes the epididymitis of male animal and the miscarriage of conceived domestic animal, placenta inflammation and sterile; For the mankind, brucellosis can cause the symptom of acute inflammation and many similar influenza infections, comprises brucellosis, hidrosis, has a back ache and has a delicate constitution.At some patients, acute clinical symptom is sustainable more than 1 year, finally causes chronic persistent infection.Chronic clinical symptom comprises irregular heating, arthritis, weak, concurrent sacroiliitis, local peripheral nerve inflammation, spondylitis, osteomyelitis and the bursitis of causing.The popular development that not only endangers livestock industry of brucellosis, causes huge financial loss, and the mankind's health and public health security in serious threat.
The common brucella virulence factor having been found that is at present L7/L12, Omp31, Rs α, tetra-kinds of albumen of sodC, for adaptive immune resistance, conventional solution is the multiple vaccines such as attenuated vaccine, live vector vaccine, nucleic acid vaccine, gene-deleted vaccine, it is high that but these vaccines are produced complicated cost on the one hand, be difficult for large-scale production and application, these vaccines are owing to tending to occur the problem of phase mutual interference between different genes based on gene fusion technology on the other hand, and these vaccine strains are also easily killed loss of activity by various microbiotic simultaneously.The use of various vaccines not only disturb vaccine immunity and with the differential diagnosis of natural infection; and vaccine strain has pathogenic virulence to people in various degree; therefore a kind of conservative albumen that exists and have fine immunologic function between various brucella kinds that is present in is urgently invented in this area, thereby develop, prevents the high subunit vaccine of protection.In traditional biology of gene, representation aids can only be expressed a kind of albumen, and brucella exists multiple and Ia albumen, and the expression of single albumen can not form effective protection vaccine antigen.
Summary of the invention
Defect for prior art, the present invention utilizes molecule clone technology that the encoding gene of L7/L12, Omp31, Rs α, tetra-kinds of brucella immune proteins of sodC is connected with dual-expression vector pETDuet-1, pRSFDuet-1 respectively, thereby has built the co-expression carrier of four kinds of immune protein encoding genes.Disclosed co-expression carrier can be expressed four albumen that immunologic function is good in single Host Strains simultaneously, thereby for the preparation of the many brucellosis of brucella genetic engineering subunit vaccine prevention and control, effectively improve the Prevention Technique level of China's animal brucellosis, to guaranteeing that aquaculture develops in a healthy way, improves peasants and herdsmen's income, guarantees that public health and livestock product have safely great Social benefit and economic benefit.
For achieving the above object, the present invention is achieved through the following technical solutions:
Brucella L7/L12, Omp31, Rs α, sodC immune protein co-expression carrier, disclosed co-expression carrier carrier is respectively dual-expression vector pETDuet-1, the pRSFDuet-1 expressing in same Host Strains, is connected with respectively the encoding gene of two kinds of brucella immune proteins on two dual-expression vectors.
The present invention carrier pETDuet-1, pRSFDuet-1 used is dual-expression vector, on each carrier, there are two promotors, belong to single carrier double-promoter system, the encoding gene of each albumen has an independently promotor, the expression of each each albumen of promotor independent drive.
Compare with traditional gene fusion construct, dual-expression vector of the present invention has been avoided influencing each other between gene, has guaranteed protein stabilized expression, has overcome the shortcoming of tandem expression expression amount deficiency.And by the double-plasmid expression system of expressing in same Host Strains, pETDuet-1 with pRSFDuet-1 as identical inconsistent two plasmids of replicon, under the pressure of Amp and two kinds of microbiotic existence of Kana, filial generation bacterium can effectively survive, can be by antibiotic kills, thereby can transform simultaneously, enter effectively expressing foreign gene after same Host Strains.
For the ease of large-scale production, reduce and cultivate difficulty, the present invention's Host Strains used is intestinal bacteria, it cultivates simple, can adopt fermentor tank to accomplish scale production, thereby effectively control quality, guarantees security and the validity of the vaccine of producing.
In conventional biotechnology, intestinal bacteria used all can be used for the present invention, include but not limited to colibacillary BL21, BL21 (DE3), and BL21 (DE3) PLySs etc.
Present inventor has fully studied complexity and the accuracy of annexation between the encoding gene of different albumen and expression vector in R&D process, preferred annexation is pETDuet-1-L7/L12-Omp31 and pRSFDuet-1-Rs α-sodC, the encoding gene that is L7/L12, Omp31 immune protein inserts dual-expression vector pETDuet-1, and the encoding gene of Rs α, sodC immune protein inserts dual-expression vector pRSFDuet-1.
Accordingly, the invention discloses the construction process of above-mentioned co-expression carrier, comprise the step that brucella L7/L12, Omp31 immune protein, brucella Rs α, sodC immune protein are connected with dual-expression vector pETDuet-1, pRSFDuet-1 respectively, specifically comprise the following steps: 1) utilize Bacillus abortus genomic dna as PCR masterplate, to amplify the encoding gene of L7/L12, Omp31, Rs α, sodC immune protein; 2) use EcoR I, Not I double digestion carrier pETDuet-1, pRSFDuet-1 respectively; 3) utilize the respectively encoding gene of double digestion L7/L12, Rs alpha immunization albumen of EcoR I, Not I, it is connected and obtains expression vector with pETDuet-1, pRSFDuet-1 carrier after double digestion; 4) utilize Bgl II, Xho I double digestion step 3) expression vector that obtains, use the encoding gene of Bgl II, Xho I double digestion Omp31, sodC immune protein, be connected and obtain co-expression carrier with expression vector after double digestion respectively.
Wherein, each encoding gene the primer is corresponding as follows:
The primer of L7/L12 immune protein encoding gene is:
L7/L12-F:ctggaattcaaccccaaaggccgtttct (containing EcoRI restriction enzyme site)
L7/L12-R:ctagcggccgcccgacaacaaggatgaaaa (containing NotI restriction enzyme site)
The primer of Omp31 immune protein encoding gene is:
Omp31-F:ctg
agatctaaggttcgtaattttggcgtccatc (containing BglII restriction enzyme site)
Omp31-R:cta
ctcgagagaacttgtagttcagaccaacgc (containing XhoI restriction enzyme site)
The primer of the encoding gene of Rs alpha immunization albumen is:
Rs α-F:ctg
gaattcggtgatgtttacaggcataatcac (containing EcoRI restriction enzyme site)
Rs α-R:cta
gcggccgccctatttctgatattgcgcaag (containing NotI restriction enzyme site)
The primer of the encoding gene of sodC immune protein is:
SodC-F:ctg
agatctggcagaacagaaatcgagctac (containing BglII restriction enzyme site)
SodC-R:cta
ctcgagattattgcgcgctgccttccttg (containing XhoI restriction enzyme site).
Above-mentioned pcr amplification reaction adopts conventional PCR reaction conditions, without particular requirement.
The coding gene sequence of above-mentioned four kinds of immune proteins all can openly be found from database, and genome that also can Bacillus abortus is that template amplification obtains,
Preferably, step 3) build respectively pETDuet-1-L7/L12 and pRSFDuet-1-Rs α carrier, step 4) build respectively pETDuet-1-L7/L12-Omp31 and pRSFDuet-1-Rs α-sodC carrier.
Construction process of the present invention; the process of being cut, connect, being transformed by enzyme is inserted dual-expression vector pETDuet-1, pRSFDuet-1 by the encoding gene of immune protein; thereby can be used in four kinds of immune proteins of high efficient expression in same Host Strains; these four kinds of albumen can with same animal body in positive serum react; having good immunogenicity and can induce the good immune protective efficiency of generation, is a kind of desirable vaccine.
Finally, the invention also discloses the expression method of described co-expression carrier, is that above-mentioned co-expression carrier is transformed into Host Strains, and picking mono-clonal colony inoculation, in LB substratum, shakes bacterium and spends the night, and is transferred in new LB substratum, adopts IPTG abduction delivering.
As aforementioned, Host Strains used is preferably intestinal bacteria, includes but not limited to e. coli bl21, (DE3) of BL21, and BL21 (DE3) PLySs etc.
Above-mentioned expression method; by the co-expression carrier that carries four immune protein encoding genes is transformed and enters same Host Strains; can access the bacterial strain of four kinds of immune proteins of stable, high efficient expression; its four kinds of expressed albumen exist with inclusion body form; do not there is native protein itself active, there is good immunogenicity and can produce good immune protective efficiency by induced animal body.Owing to thering is above-mentioned characteristic, the invention also discloses a kind of brucella genetic engineering subunit vaccine, comprise the Host Strains with above-mentioned co-expression carrier, because this vaccine antigen used is protein, compare and can not occur to occur gene recombination problem with other vaccines (as live vector vaccine, nucleic acid vaccine, gene-deleted vaccine), therefore there is not biological safety problem, be applicable to biological use in enormous quantities.
Accompanying drawing explanation
Fig. 1 is L7/L12, Omp31, Rs α, sodC protein gene amplification electrophorogram, and wherein: M is 2000bp Marker, 1 is L7/L12 immune protein encoding gene; 2 is omp31 immune protein encoding gene; 3 is blank; 4 is sodC immune protein encoding gene; 5 is Rs alpha immunization protein coding gene;
Fig. 2 is the western-blotting analysis chart of four kinds of immune protein expression products, and wherein four bands are respectively Omp31, sodC, Rs α, L7/L12 from top to bottom.
Embodiment
The main raw that used in the present invention all can be bought from associated biomolecule goods company, has provided the purchase source of material therefor in embodiment below, is only signal.
Bacillus abortus bacterial strain is purchased from China Veterinery Drug Inspection Office; PETDuet-1 and pRSFDuet-1 dual-expression vector are purchased from Novagen company; BL21 (DE3) is purchased from Beijing Quanshijin Biotechnology Co., Ltd.
The primer is synthetic by Shanghai Sheng Gong biotechnology company limited.
Enzyme used and reagent: restriction enzyme Bgl II, EcoRI, Not I, Xho I, T4 DNA ligase and 2 * Power Taq PCR MasterMix are all purchased from the precious biological company limited in Dalian; IPTG, SDS (sodium laurylsulfonate), nucleic acid Marker, Agarose DNA extraction kit, DNA fast purifying reclaim test kit, plasmid rapid extraction test kit all purchased from Dalian Bao Bio-Engineering Company; It is synthetic purchased from Shanghai Sheng Gong biotechnology company limited that bacterial genomes is extracted test kit; Agarose is purchased from Invitrogen company; Dye in advance albumen Marker purchased from Fermentas company.
Embodiment 1: the structure of co-expression carrier and expression
1.L7/L12, Omp31, Rs α, sodC encoding gene pcr amplification
Utilizing bacterial genomes to extract test kit Bacillus abortus reference culture extracts genomic dna as PCR masterplate, amplifies required gene, reaction system: 50 μ L MasterMix, each 2 μ L of upstream and downstream primer, masterplate 16 μ L, deionized water 30 μ L; DNA glue reclaims test kit and reclaims four protein coding genes;
The structure of 2.pETDuet-1-L7/L12 and pRSFDuet-1-Rs α carrier
By pETDuet-1, two carrier EcoR I of pRSFDuet-1, Not I double digestion.
40 μ L enzymes are cut system: 10 * H damping fluid, 4 μ L, and each 1 μ L of EcoR I, Not I, carrier 24 μ L, deionized water 10 μ L, after enzyme is cut product 1% agarose electrophoresis, glue reclaims test kit recovery.
The L7/L12 of EcoRI, NotI double digestion, Rs α protein gene 40 μ L enzymes are cut system: 10 * H damping fluid, 4 μ L, each 1 μ L of EcoR I, Not I, goal gene 24 μ L, deionized water 10 μ L, after enzyme is cut product 1% agarose electrophoresis, glue reclaims test kit recovery, then be connected with the pETDuet-1 of double digestion, the carrier of pRSFDuet-1 respectively, build two linked systems: 10 * T4DNA Ligase Buffer, 2.5 μ L, L7/L12 protein coding gene glue reclaims product 14 μ L, pETDuet-12 μ L, T4DNALigasel μ L, deionized water 5.5 μ L; 10 * T4DNA Ligase Buffer, 2.5 μ L, Rs α protein coding gene glue reclaims product 14 μ L, pRSFDuet-12 μ L, T4DNA Ligasel μ L, deionized water 5.5 μ L.16 ℃ of connections are spent the night, and transform respectively Trans109 competent cell, and picking mono-clonal bacterium colony carries out respectively bacterium liquid PCR evaluation, enzyme is cut evaluation.The order-checking of bacterium liquid determines that L7/L12, Rs α are connected respectively on pETDuet-1-L7/L12 and pRSFDuet-1-Rs α carrier;
3.pETDuet-1-L
7/ L
12the structure of-Omp31 and pRSFDuet-1-Rs α-sodC carrier
PETDuet-1-L7/L12 and pRSFDuet-1-Rs α BglII, XhoI double digestion.
40 μ L enzymes are cut system: 10 * H damping fluid, 4 μ L, and each 1 μ L of Bgl II, Xho I, carrier 24 μ L, deionized water 10 μ L, after enzyme is cut product 1% agarose electrophoresis, glue reclaims test kit recovery.The Omp31 of Bgl II, Xho I double digestion, sodC protein coding gene, 40 μ L enzymes are cut system: 10 * H damping fluid, 4 μ L, each 1 μ L of Bgl II, Xho I, goal gene 24 μ L, deionized water 10 μ L, after enzyme is cut product 1% agarose electrophoresis, glue reclaims test kit recovery, then build two link systems: 10 * T4DNA Ligase Buffer, 2.5 μ L, Omp31 protein coding gene glue reclaims product 14 μ L, pETDuet-1-L7/L122 μ L, T4DNALigase1 μ L, deionized water 5.5 μ L; 10 * T4DNALigase Buffer, 2.5 μ L, sodC protein coding gene glue reclaims product 14 μ L, pRSFDuet-1-Rs α 2 μ L, T4DNALigase1 μ L, deionized water 5.5 μ L.16 ℃ of connections are spent the night, and transform respectively Trans109 state cell, and picking mono-clonal bacterium colony carries out respectively bacterium liquid PCR evaluation, enzyme is cut evaluation.The order-checking of bacterium liquid determines that Omp31, sodC are connected respectively on pETDuet-1-L7/L12 and pRSFDuet-1-Rs α carrier;
The coexpression of 4.L7/L12, Omp31, Rs α, tetra-albumen of sodC
Each 0.5 μ L plasmid of pETDuet-1-L7/L12-Omp31 and pRSFDuet-1-Rs α-sodC transforms BL21 (DE3) Host Strains simultaneously, picking mono-clonal colony inoculation is in fresh 10ml LB substratum, shaking bacterium spends the night, in 1: 100 ratio, transfer in fresh 10ml LB substratum, when OD value reaches 0.6-0.8, get 1ml bacterium liquid as not inducing sample, then add the 10 μ L IPTG abduction deliverings of final concentration 0.8mM within four hours, to collect 1ml bacterium liquid sample;
First the detection of expression of embodiment 2:L7/L12, Omp31, Rs α, tetra-immune protein co-expression carriers of SodC configures SDS-PAGE solution:
Tris-glycine buffer: 25mmol/L Tris, 250mmol/L glycine (pH 8.0), 0.1%SDS.
2 * SDS loading buffer:100mmol/L Tris.Cl (pH8.0), 200m mol/L mercaptoethanol, 4%SDS, 0.2% tetrabromophenol sulfonphthalein, 20% glycerine.
Coomassie brilliant blue staining liquid: dissolve 0.25g coomassie brilliant blue R250 in 45ml methyl alcohol, 45ml water, 10ml Glacial acetic acid.
Destainer: 30% methyl alcohol, 10% glacial acetic acid, distilled water complement amasss to 100ml.
Then use above-mentioned solution, carry out SDS-PAGE detection, comprise the following steps:
(1) clean sheet glass, be fixed on electrophoresis chamber, with 2.0% agarose edge sealing.Press the separation gel 5ml of the formulated 15% of molecular cloning, inject rapidly between two sheet glass, Jiao Ding covers 1ml distilled water.The solid hypsokinesis of gelling to be separated goes out tectum liquid, with deionized water rinsing gel top for several times, is inverted empty dry liquids, adds the concentrated sol solution of 2ml5%, plugs comb, vertically places electrophoresis chamber it is solidified.
(2) remove comb, between the upper and lower groove of electrophoresis apparatus, add Tris-glycine buffer, with irrigation with syringe well for several times, power cathode is connected with upper groove.
(3) the centrifugal 2min of bacterium liquid 12000rpm collecting, with the PBS of 50 μ l pH7.4, suspend, add isopyknic 2 * SDS loading buffer, mix, 10min is boiled in water-bath, with microsyringe loading 10 μ l, opening power, by 80V voltage electrophoresis to tetrabromophenol sulfonphthalein, enter separation gel, voltage is brought up to 120V, continue electrophoresis to tetrabromophenol sulfonphthalein and arrive gel bottom.
(4) dyeing: take off gel distilled water flushing, with the coomassie brilliant blue staining immersion foaming gel of 5 times of gel volumes, be placed on room temperature dyeing 3h on decolorization swinging table.
(5) decolouring: the mixed solution with 30% methyl alcohol, 10% glacial acetic acid, on decolorization swinging table, decolour and spend the night, change staining fluid therebetween 3～4 times.After blue background purifies completely, gel is immersed in distilled water and stops decolouring.
(6) by the recombinant protein through SDS-PAGE electrophoretic separation, with preceding method, be transferred on nitrocellulose (NC) film under 180mA electric current, 2.5h condition, 3%BSA4 ℃ of sealing spent the night, with PBST washing 4～5 times.Two NC films add respectively the Brucella abortus standard positive serum of dilution in 1: 100, and 37 ℃ of shaking tables are hatched 2.0h.After fully washing 3～4 with PBST, adding the anti-ox IgG-HP of rabbit of dilution in 1: 1000 is second antibody, and 37 ℃ in conjunction with after 1.5h, with the colour developing of 30ml DAB (biphenyl diamino) substrate solution.After there is reaction band, water rinses termination reaction.
Observing accompanying drawing 1,2 can see, construction process of the present invention and expression method can successfully realize the coexpression of four kinds of immune proteins.
Claims (10)
1. brucella L7/L12, Omp31, Rs α, sodC immune protein co-expression carrier, it is characterized in that disclosed co-expression carrier is respectively dual-expression vector pETDuet-1, the pRSFDuet-1 expressing in same Host Strains, is connected with respectively the encoding gene of two kinds of brucella immune proteins on two dual-expression vectors.
2. according to the co-expression carrier of claim 1, it is characterized in that described Host Strains is intestinal bacteria.
3. according to the co-expression carrier of claim 1, the annexation that it is characterized in that the encoding gene of dual-expression vector and brucella immune protein is pETDuet-1-L7/L12-Omp31 and pRSFDuet-1-Rs α-sodC.
4. the construction process of the co-expression carrier of claim 1, is characterized in that comprising the step that brucella L7/L12, Omp31 immune protein, brucella Rs α, sodC immune protein are connected with dual-expression vector pETDuet-1, pRSFDuet-1 respectively.
5. according to the construction process of claim 4, it is characterized in that specifically comprising the following steps: 1) utilize Bacillus abortus genomic dna as PCR masterplate, to amplify the encoding gene of L7/L12, Omp31, Rs α, sodC immune protein; 2) use EcoR I, Not I double digestion carrier pETDuet-1, pRSFDuet-1 respectively; 3) utilize the respectively encoding gene of double digestion L7/L12, Rs alpha immunization albumen of EcoR I, Not I, it is connected and obtains expression vector with pETDuet-1, pRSFDuet-1 carrier after double digestion; 4) utilize Bgl II, Xho I double digestion step 3) expression vector that obtains, use the encoding gene of Bgl II, Xho I double digestion Omp31, sodC immune protein, be connected and obtain co-expression carrier with expression vector after double digestion respectively.
6. according to the construction process of claim 5, it is characterized in that step 1) amplification the primer be respectively:
The primer of L7/L12 immune protein encoding gene is:
L7/L12-F：ctggaattcaaccccaaaggccgtttct
L7/L12-R：ctagcggccgcccgacaacaaggatgaaaa
The primer of omp31 immune protein encoding gene is:
omp31-F：ctgagatctaaggttcgtaattttggcgtccatc，
omp31-R：ctactcgagagaacttgtagttcagaccaacgc；
The primer of the encoding gene of Rs alpha immunization albumen is:
Rsα-F：ctggaattcggtgatgtttacaggcataatcac，
Rsα-R：ctagcggccgccctatttctgatattgcgcaag；
The primer of the encoding gene of sodC immune protein is:
sodC-F：ctgagatctggcagaacagaaatcgagctac，
sodC-R：ctactcgagattattgcgcgctgccttccttg。
7. according to the construction process of claim 5, it is characterized in that step 3) build respectively pETDuet-1-L7/L12 and pRSFDuet-1-Rs α carrier, step 4) build respectively pETDuet-1-L7/L12-Omp31 and pRSFDuet-1-Rs α-sodC carrier.
8. the expression method of the co-expression carrier of claim 1, is characterized in that co-expression carrier to be transformed into Host Strains, and picking mono-clonal colony inoculation, in LB substratum, shakes bacterium and spends the night, and is transferred in new LB substratum, adopts IPTG abduction delivering.
9. expression method according to Claim 8, is characterized in that described Host Strains is intestinal bacteria.
10. a brucella genetic engineering subunit vaccine, is characterized in that comprising the Host Strains that contains above-mentioned co-expression carrier.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410378291.8A CN104152480A (en) | 2014-08-01 | 2014-08-01 | Construction method and expression method of coexpression vector of L7/L12, Omp31, Rs alpha and sodC Brucella immune proteins |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410378291.8A CN104152480A (en) | 2014-08-01 | 2014-08-01 | Construction method and expression method of coexpression vector of L7/L12, Omp31, Rs alpha and sodC Brucella immune proteins |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104152480A true CN104152480A (en) | 2014-11-19 |
Family
ID=51878107
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410378291.8A Pending CN104152480A (en) | 2014-08-01 | 2014-08-01 | Construction method and expression method of coexpression vector of L7/L12, Omp31, Rs alpha and sodC Brucella immune proteins |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104152480A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105906714A (en) * | 2016-04-22 | 2016-08-31 | 吉林大学 | Preparation method and application of brucellosis specific fusion protein antigen |
| CN106854654A (en) * | 2017-02-16 | 2017-06-16 | 内蒙古医科大学 | Express rBCG and its construction method and the application of sheep kind Brucella sp L7/L12 genes |
| CN109486846A (en) * | 2018-12-29 | 2019-03-19 | 山东农业大学 | A kind of three kinds of gene recombination plasmids of brucella, construction method and its expression and application in Escherichia coli |
| KR102092041B1 (en) * | 2018-10-30 | 2020-03-23 | 경상대학교산학협력단 | Vaccine composition for prevention or treatment of brucellosis comprising SodC, RibH, Ndk, L7/L12 and MDH protein derived from Brucella abortus as effective component |
| CN113637703A (en) * | 2021-08-06 | 2021-11-12 | 河北科技师范学院 | Construction method and application of Brucella L7/L12 and GroES eukaryotic expression vector |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101016541A (en) * | 2006-12-26 | 2007-08-15 | 中国农业科学院兰州兽医研究所 | Method of producing brucella vaccine antigen protein |
-
2014
- 2014-08-01 CN CN201410378291.8A patent/CN104152480A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101016541A (en) * | 2006-12-26 | 2007-08-15 | 中国农业科学院兰州兽医研究所 | Method of producing brucella vaccine antigen protein |
Non-Patent Citations (2)
| Title |
|---|
| YANLING YANG, ET AL: "Immunoproteomic analysis of Brucella melitensis and identification of a new immunogenic candidate protein for the development of brucellosis subunit vaccine", 《MOLECULAR IMMUNOLOGY 》 * |
| 覃晓琳: "布鲁氏菌SOD、L7/L12、OMP25、OMP31蛋白DNA疫苗的构建及对小鼠免疫原性的分析", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105906714A (en) * | 2016-04-22 | 2016-08-31 | 吉林大学 | Preparation method and application of brucellosis specific fusion protein antigen |
| CN105906714B (en) * | 2016-04-22 | 2019-03-15 | 吉林大学 | A kind of preparation and application of brucellosis specific fusion protein antigen |
| CN106854654A (en) * | 2017-02-16 | 2017-06-16 | 内蒙古医科大学 | Express rBCG and its construction method and the application of sheep kind Brucella sp L7/L12 genes |
| KR102092041B1 (en) * | 2018-10-30 | 2020-03-23 | 경상대학교산학협력단 | Vaccine composition for prevention or treatment of brucellosis comprising SodC, RibH, Ndk, L7/L12 and MDH protein derived from Brucella abortus as effective component |
| CN109486846A (en) * | 2018-12-29 | 2019-03-19 | 山东农业大学 | A kind of three kinds of gene recombination plasmids of brucella, construction method and its expression and application in Escherichia coli |
| CN109486846B (en) * | 2018-12-29 | 2021-08-20 | 山东农业大学 | Three-gene recombinant plasmid of Brucella, construction method and expression and application thereof in escherichia coli |
| CN113637703A (en) * | 2021-08-06 | 2021-11-12 | 河北科技师范学院 | Construction method and application of Brucella L7/L12 and GroES eukaryotic expression vector |
| CN113637703B (en) * | 2021-08-06 | 2023-08-25 | 河北科技师范学院 | Construction method and application of Brucella L7/L12 and GroES eukaryotic expression vector |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106946995B (en) | I-group serum 4 type avian adenovirus genetic engineering subunit vaccine, preparation method and application thereof | |
| CN104152480A (en) | Construction method and expression method of coexpression vector of L7/L12, Omp31, Rs alpha and sodC Brucella immune proteins | |
| CN106519041A (en) | Establishing method of pig immunoglobulin Fc fragment-swine classical fever E2 fusion protein in CHO cell strain, as well as preparation method and application of fusion protein | |
| CN104131022A (en) | Clostridium perfringens alpha, beta 1, beta 2 and epsilon coexpression vector and construction method and expression method thereof | |
| CN104774270A (en) | Adenocarcinoma specificity EpCAM-GM-CSF genetic recombinant fusion protein and preparation method thereof | |
| CN103305542B (en) | Recombinant phage double expression vector and application | |
| CN110981968B (en) | Fusion protein containing rabies virus G protein, preparation method, application and vaccine thereof | |
| CN106344919A (en) | I-group 4-type aviadenovirus genetic engineering subunit vaccine and preparation method thereof | |
| CN102816246A (en) | Human cytomegalo virus immunogen fusion protein as well as preparation method and usage thereof | |
| CN104131021A (en) | Antibacterial peptide coexpression vector, construction and expression method thereof | |
| CN103193887A (en) | Recombinant porcine IL2-Fc (interteukin-2-Fc) fusion protein as well as encoding gene and expressing method of fusion protein | |
| CN101607081B (en) | brucella vaccine and method for preparing antigen protein used for same | |
| CN101691582A (en) | Prokaryotic expression and purification method for listeria monocytogenes hemolysin O | |
| CN103880953B (en) | One boar P21 protein antibodies and preparation method thereof and application | |
| CN106754981A (en) | A kind of method that utilization E. coli system prepares Goose Parvovirus sample particle | |
| CN105420174A (en) | Establishment of genetically engineered bacterium expressing recombined VEGF fusion protein | |
| JPH02502784A (en) | Polypeptide for diagnosis of coccidial infection and its production method using recombinant DNA method | |
| CN104448005A (en) | Fusion protein antigen of duck hepatitis A virus-3 VP1 protein and LTB and application of fusion protein antigen | |
| CN109021115A (en) | A kind of pig circular ring virus trivalent subunit vaccine | |
| CN107827986B (en) | Pig O/Mya98 and O/PanAsia type foot-and-mouth disease gene engineering inactivated vaccine | |
| CN104152479A (en) | Coexpression vector for main envelope protein and nonstructural protein of hog cholera virus and bovine viral diarrhea virus and building and expression method of coexpression vector | |
| CN103319590B (en) | Application of Chlamys farreri peptidoglycan recognition protein (CfPGRP-S1) | |
| CN101947325B (en) | Vibrio paraheamolyticus bivalent DNA vaccine as well as preparation method and application thereof | |
| CN1641034B (en) | Method for preparing tetanus toxin recombinant antigen and its use | |
| CN105566461B (en) | Bacterial outer membrane proteins ompAs-19 after DNA reorganization and its application as immunomodulator |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20141119 |
|
| WD01 | Invention patent application deemed withdrawn after publication |