KR102092041B1 - Vaccine composition for prevention or treatment of brucellosis comprising SodC, RibH, Ndk, L7/L12 and MDH protein derived from Brucella abortus as effective component - Google Patents

Abstract

The present invention relates to a subunit vaccine composition for preventing or treating brucellosis infection which contains Cu, Zn superoxide dismutase (SodC), 6,7-dimethyl-8-ribityllumazine synthase (RibH), nucleoside diphosphate kinase (Ndk), large subunit ribosomal proteins L7/L12, and malate dehydrogenase (MDH) protein derived from Brucella abortus strains as active components.

Description

Vaccine composition for prevention or treatment of brucellosis comprising SodC, RibH, Ndk, Ldk / L7 / L12 and MDH protein derived from Brucella abortus as effective component}

The present invention, SodC (Cu, Zn superoxide dismutase), RibH (6,7-dimethyl-8-ribityllumazine synthase), Ndk (nucleoside diphosphate kinase), large subunit ribosomal proteins L7 / L12 and MDH (malate) derived from the Brucella abotus strain dehydrogenase) It relates to a vaccine composition for preventing or treating brucellosis infection comprising a protein as an active ingredient.

Brucella infectious disease is one of the representative common infectious diseases (human body; 4th legislative disease, livestock; 2nd legislative disease) and is known to cause serious public health and economic problems both domestically and globally. Recently, brucellella infections seen in Korea are showing an explosive increase in humans and livestock, and it is urgent to take measures for this as well as national concerns.

Brucella abortus (cow), B. melitensis (sheep, goat), B. canis (dog), B. ovis (sheep), B. suis (pig) are known to cause brucellosis. Infection in the human body can lead to serious illness, and it is known in Korea that Brucella abortus accounts for a high proportion. When brucella infection develops, the human body has a fatality rate of less than 10%, and persistent fever, headache, loss of appetite, weakness, progress to severe diseases such as endocarditis, encephalomyelitis, and arthritis. Symptoms seen in infected animals Is known to cause infertility due to abortion due to placenitis, endometritis, etc. in females, and orchitis, malformation, and sperm in males, without special external symptoms. Since brucela bacteria multiply in the cell and cause onset, in the case of human infection, antibiotic treatment for several weeks to several years is required, and improvement of treatment methods is urgently needed due to sequelae caused by taking large amounts of antibiotics. Even if it is judged to be cured, it often recurs within a few years, and continuous observation is required.

Since Brucella is an intracellular pathogen that relies primarily on cell-mediated immunity (CMI), the resistance of the host has been obtained, a live attenuated vaccine capable of stimulating potent cell-mediated immunity against Brucella infection It is mainly used. Although vaccination is the most economical means of infection control, currently available live attenuated vaccines such as Brucella Avotus S19 (smooth) or RB51 (rough) strains are not sufficient to eliminate Brucellosis infection in certain host species. This was confirmed. Moreover, live attenuated vaccines have several drawbacks, such as abortion and excretion of vaccine strains into milk. Therefore, other approaches are needed for the development of efficient, safe and effective vaccines, and immunoassays using recombinant proteins are attracting attention as promising candidates.

So far, many studies have been reported on the protective effect of various types of recombinant Brucella proteins, including 22.9-kDa protein, lumazine synthase, and outer membrane proteins Omp31, Omp16 or Omp19, against pathogenic Brucella infections. However, administration of a single antigen does not effectively induce an immune response in mice from infection of Brucella bacteria, so it is expected that combinations of different types of antigen proteins will show a higher protective effect than a single antigen.

On the other hand, Korean Registered Patent No. 1840360 is a vector developed to increase the secretion of BLS, Omp19, PrpA, and SOD antigens derived from Brucella Avotus, and contains attenuated Salmonella, which has an attenuated L-O-antigen of LPS as an active ingredient. A vaccine composition for preventing or treating brucellosis, comprising an O-antigen deletion non-pathogenic Salmonella strain of LPS expressing a major common antigen of Brucella, is disclosed, and Korean Patent No. 1775369 discloses an 'Ohr recombinant protein derived from a Brucellella avotus strain A vaccine composition for preventing or treating brucellosis infection comprising as an active ingredient is disclosed, but prevention of brucellosis infection comprising SodC, RibH, Ndk, L7 / L12 and MDH proteins derived from the brucellella avotus strain of the present invention as an active ingredient Or there is no description of the therapeutic vaccine composition.

The present invention has been derived by the above-mentioned needs, the present inventors in order to compensate for the drawbacks of subunit vaccines known to be less than live vaccines in terms of immunogenicity and infection defense effect, derived from the Brucella abortus strain As a result of preparing a recombinant protein of high immunogenic proteins SodC, RibH, Ndk, L7 / L12 and MDH, and using the subunit vaccine containing all of the five recombinant proteins, the infection defense effect was confirmed. When the pathogenic Brucella bacteria were challenged in the group immunized with the all-inclusive subunit vaccine, the present invention was completed by confirming that the weight of the spleen and the number of pathogenic Brucella bacteria in the spleen were significantly reduced than in the non-immunized group.

In order to solve the above problems, the present invention is SodC (Cu, Zn superoxide dismutase), RibH (6,7-dimethyl-8-ribityllumazine synthase), Ndk (nucleoside diphosphate kinase) derived from a strain of Brucella abortus , large subunit ribosomal protein L7 / L12 and MDH (malate dehydrogenase) protein to provide a subunit vaccine (subunit vaccine) composition for the prevention or treatment of brucellosis infection containing as an active ingredient.

In addition, the present invention provides a method for preventing or treating brucellella infection, comprising administering the subunit vaccine composition to a livestock that is expected to develop brucellella infection or has developed brucellosis infection.

In addition, the present invention provides a feed composition for the prevention or improvement of brucellella infections comprising SodC, RibH, Ndk, L7 / L12 and MDH proteins derived from Brucella abotus strain as an active ingredient.

The vaccine of the present invention is a subunit vaccine having better stability than a live vaccine, and the subunit vaccine of the present invention contains five high antigenic proteins derived from Brucella abotus, and thus has excellent immunogenicity and protection against infection, thereby preventing brucellosis. Or it could be useful for treatment.

1 is a result of confirming the expression of recombinant proteins of SodC, RibH, Ndk, L7 / L12 and MDH (rSodC, rRibH, rNdk, rL7 / L12, rMDH, respectively) (A) and confirming the immunogenicity of Brucella-infected mouse serum As a result (B and C), B is a brucela infection positive mouse serum and C is a western blot result using brucella infection negative mouse serum. MBP: maltose binding protein, a protein in a recombinant vector.
Figure 2 is a combination vaccine of five recombinant proteins, RB51 vaccine (commercialized vaccine) and MBP (vector protein) after immunizing mice with proteins, the levels of INF-γ in the blood were analyzed at week 3 and week 4, It is the result of confirming the sexual immune response. *: P <0.05, **: P <0.01, ***: P <0.001, ****: P <0.0001.
Figure 3 is a combination vaccine of five recombinant proteins, RB51 vaccine (commercialized vaccine) and MBP (vector protein) after immunizing mice with proteins, the levels of IL-10 in the blood were analyzed at 3 and 4 weeks, and cells It is the result of confirming the sexual immune response. **: P <0.01, ***: P <0.001, ****: P <0.0001.
Figure 4 is a combination vaccine of five recombinant proteins, RB51 vaccine (commercial vaccine) and MBP (vector protein) after immunizing mice with protein, the levels of IgG1 and IgG2a in the blood were analyzed at week 3 and week 4, It is the result of confirming the sexual immune response. *: P <0.05, **: P <0.01, ***: P <0.001, ****: P <0.0001.
Figure 5 is a combination vaccine of five recombinant proteins, RB51 vaccine (commercialized vaccine) and MBP (vector protein) after immunizing the mouse with a mouse, challenged with Brucellia abotus bacteria to evaluate the defense, challenge infection 2 It is the result of measuring the number (A) and the spleen weight (B) of the challenge-infected strain in the spleen after a week. *: P <0.05, **: P <0.01, ***: P <0.001, ****: P <0.0001.

In order to achieve the object of the present invention, the present invention is SodC (Cu, Zn superoxide dismutase), RibH (6,7-dimethyl-8-ribityllumazine synthase), Ndk (nucleoside diphosphate) derived from Brucella abortus strain kinase), a large subunit ribosomal protein L7 / L12 and a malate dehydrogenase (MDH) protein as active ingredients, to provide a subunit vaccine composition for preventing or treating brucellella infection.

In the present invention, the term "subunit vaccine" refers to a vaccine comprising an infectious defense antigen isolated from a microorganism, and usually refers to a protein subunit vaccine that uses only some proteins of a microorganism by protein purification or genetic recombination technology. do.

The range of SodC protein, RibH protein, Ndk protein, L7 / L12 protein and MDH protein according to the present invention has an amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, respectively. Proteins and functional equivalents of the proteins. The term "functional equivalent" means at least 70% or more of the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5, as a result of addition, substitution, or deletion of the amino acid. A protein represented by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5 having 80% or more, more preferably 90% or more, and even more preferably 95% or more And a protein that exhibits substantially the same physiological activity.

The term "prevention" in the present invention means any action that suppresses or delays the onset of brucellosis infection by administration of the vaccine composition of the present invention.

The term "treatment" in the present invention means any action that improves or benefits the symptoms of brucellosis infection already caused by administration of the vaccine composition of the present invention.

The vaccine composition of the present invention further comprises a pharmaceutically acceptable carrier or diluent. Suitable carriers for vaccines are known to those skilled in the art and include, but are not limited to, proteins, sugars, and the like. Such carriers can be aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous carriers include propylene glycol, polyethylene glycol, edible oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous solutions carriers include water, alcohols / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral carriers include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. Intravenous carriers include electrolyte supplements such as those based on Ringer's dextrose, liquid and nutrient supplements, and the like. Preservatives and other additives such as antimicrobial agents, antioxidants, chelating agents, inert gases and the like may further be present. Preferred preservatives include formalin, thimerosal, neomycin, polymyxin B and amphotericin B.

In addition, the vaccine composition of the present invention may further include an adjuvant (adjuvant, adjuvant, adjuvant). The adjuvant refers to a compound or mixture that enhances the immune response and / or promotes the rate of absorption after inoculation, and includes any absorption-promoting agent. Acceptable adjuvants include Freund's complete adjuvant, Freund's incomplete adjuvant, saponin, mineral gels such as aluminum hydroxide, surfactants such as lysolecithin, fluron polyols, polyanions, peptides, oil or hydrocarbon emulsions. , Keyhole limpet hemocyanin, dinitrophenol, and the like.

The vaccine composition of the present invention may be administered through any one administration route selected from oral, transdermal, intramuscular, intraperitoneal, intravenous, subcutaneous, or nasal passages, and may be administered by bolus or slowly injected. It is preferably administered by injection.

The vaccine composition of the present invention is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" of the present invention is an amount sufficient to exhibit a vaccine effect, and means an amount that does not cause side effects or serious or excessive immune responses, and the effective dose level is a disorder to be treated. , The severity of the disorder, the activity of the specific compound, the route of administration, the rate of removal of the recombinant proteins (SodC, RibH, Ndk, L7 / L12 and MDH), the duration of treatment, the drug in combination with or used concurrently with the recombinant protein, the age of the subject, It can vary depending on a variety of factors, including body weight, gender, eating habits, general health conditions and factors known in the medical arts. In determining the "therapeutically effective amount", various general considerations that are considered are known to those skilled in the art.

In a method according to an embodiment of the present invention, as a method for preparing SodC, RibH, Ndk, L7 / L12 and MDH proteins, SEQ ID NO: 6 (SodC), SEQ ID NO: 7 (RibH), SEQ ID NO: 8 (Ndk ), The expression vector containing the gene of SEQ ID NO: 9 (L7 / L12) or SEQ ID NO: 10 (MDH) is transformed into a host cell and purified by expressing SodC , RibH , Ndk , L7 / L12 or MDH gene in a large amount Preferably, but not limited to.

The gene of the present invention includes both genomic DNA and cDNA encoding SodC, RibH, Ndk, L7 / L12 or MDH proteins. Preferably, the gene of the present invention may include a nucleotide sequence represented by SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10. In addition, homologs of the base sequences are included within the scope of the present invention. Specifically, the gene and the base sequence of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10, respectively, 70% or more, more preferably 80% or more, even more preferably 90% or more , Most preferably, it may include a base sequence having a sequence homology of 95% or more. “% Of sequence homology” to a polynucleotide is identified by comparing two optimally aligned sequences with a comparison region, and a portion of the polynucleotide sequence in the comparison region is a reference sequence (addition or deletion) for the optimal alignment of the two sequences. It does not include) may be added or deleted (ie, gap).

The term “vector” is used to refer to DNA fragment (s), nucleic acid molecules that are delivered into a cell. Vectors replicate DNA and can be independently reproduced in host cells. The term "expression vector" is often used interchangeably with "recombinant vector." The term "recombinant vector" refers to a recombinant DNA molecule comprising the desired coding sequence and the appropriate nucleic acid sequence necessary to express the linking coding sequence operably in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

The term "recombinant" in the present invention refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a peptide, a heterologous peptide or a protein encoded by a heterologous nucleic acid. Recombinant cells can express genes or gene segments not found in the natural form of the cells, either in sense or antisense form. Recombinant cells can also express genes found in natural cells, but these genes have been modified and reintroduced into cells by artificial means.

The present invention also provides a method for preventing or treating brucellella infection, comprising administering the subunit vaccine composition to a livestock that is expected to develop brucellella infection or has developed brucellella infection.

The term "livestock" of the present invention is an animal that can develop brucellosis infection, and preferably may be livestock such as cows, pigs, sheep, goats, dogs, but is not limited thereto.

When the subunit vaccine composition of the present invention is administered to the livestock, the immunity of an individual against a strain causing brucellosis infection may be enhanced, thereby preventing or treating brucellosis infection.

The present invention also, SodC (Cu, Zn superoxide dismutase), RibH (6,7-dimethyl-8-ribityllumazine synthase), Ndk (nucleoside diphosphate kinase), large subunit ribosomal protein derived from Brucella abortus strain Provided is a feed composition for the prevention or improvement of brucellella infection, which contains L7 / L12 and malate dehydrogenase (MDH) proteins as active ingredients.

The range of the SodC protein, RibH protein, Ndk protein, L7 / L12 protein and MDH protein according to the present invention consists of amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, respectively. And the range is as described above.

The present invention may include general feed ingredients known in the art. For example, the feed composition of the present invention may include grain flour, sugar, vitamins, amino acids, proteins, lipids, minerals, and the like.

Grain and grain by-products may be used in the feed composition of the present invention, such as rapeseed, cottonseed, soybean, wheat bran, rice bran, defatted river, malt, corn bran, malt, soybean skin, potato starch, sweet potato starch, corn starch, Coffee foil, jamsa, jam, seaweed, tapioca, soybean meal, cottonseed meal, gourd, chaejong, flax, zucchini, corn gluten, wheat gluten, peanut melon, palm melon, sunflower seed melon, drunk melon, corn germ , One or two or more selected from pepper seed meal, jangyu-bak, and beer-bak can be mixed.

The feed composition of the present invention may include sugar and complex carbohydrates such as water-soluble and insoluble monosaccharides, disaccharides and polysaccharides. More specifically, as sugars that can be used, glucose, mannose, fructose, white sugar, maltose, cellobiose, lactose, trehalose, melibiose, raffinose, escreen, salicin, amidaline, mannitol, sorbitol, Sorbose, mentiose, and the like, and can be used in combination with oligosaccharides as well as molasses and sucrose.

Arginine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, valine, tyrosine, alanine, aspartic acid, sodium glutamate, glycine, proline, serine , Cysteine, and their homologues, and salts thereof.

In addition, thiamin (vitamin B1), HCl, riboflavin (vitamin B2), pyridoxine (vitamin B6), HCl, niacin (vitamin B3), niacinamide (water soluble vitamin and vitamin B) that can be optionally added to the feed composition of the present invention Complex), vitamin B groups such as inositol (vitamin B8), choline chloride (vitamin B4), calcium pantothenate (vitamin B5), biotin (vitamin B7), folic acid (vitamin B9) and vitamins A, C, K, D and E And so on. Among them, vitamin A, vitamin B group, and vitamin E can also be used as antioxidants.

Fatty acids that may be included in the feed composition of the present invention include, for example, vegetable oils such as soybean oil, rapeseed oil, corn oil, safflower oil, sunflower oil, rice oil, beefsteak vegetable oil, evening primrose oil, glass fat oil, linseed oil, And fish oil such as bonito, mackerel, sardine, and triglycerides derived from various microorganisms, by hydrolysis treatment, and calcium salts and magnesium salts of fatty acids may also be included as metal salts of fatty acids obtained above. In the feed composition of the present invention, a small amount of known bioceramic materials such as plagioclase, bentonite, and mackban stone can be added to double the antibacterial function and the like.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only to illustrate the present invention, the content of the present invention is not limited to the following examples.

Materials and methods

1. Bacterial strains and growth conditions

The smooth, pathogenic Brucella abortus 544 biovar 1 strain was pre-sale from the Animal, Plant and Fisheries Quarantine and Inspection Agency and the E. coli DH5α strain was Invitrogen (USA). Was purchased from and used. The cultivation of Brucella abotus bacteria was cultured to a stationary phase at 37 ° C using Brucella culture medium (BD Biosciences, USA), and the E. coli strain used LB liquid or solid medium containing 100 μg / ml of ampicillin (Sigma, USA) And cultured at 37 ° C.

2. Preparation of plasmid and purification of recombinant protein

Cloning and protein purification of the SodC, RibH, Ndk, L7 / L12 and MDH genes of Brucella Abbotus was performed according to the methods of previous studies (Hop HT. Et al., FEMS Microbiol Lett. 2015, 362 (4)). Briefly, a gene-specific primer set was used to clone the full length of each Brucella Abbotus gene into a pMAL vector (Table 1). E. coli cells transformed with a vector containing each gene were cultured to produce recombinant protein, and IPTG (Isopropyl β-D-1-thiogalactopyranoside) was added to induce protein expression during culture.

Primer set gene Sequence information (5 '→ 3') Restriction enzyme (underlined) Sequence number SodC F: ACC GGATCC ATGAAGTCCTTATTTATTGCA BamH I 11 R: AGC CTGCAG TTATTCGATCACGCCGCAGGC Pst I 12 RibH F: ACC GGATCC ATGAACCAAAGCTGTCCGAAC BamH I 13 R: AGC CTGCAG CGGCTGCGCTCGCTCACGATC Pst I 14 Ndk F: CGC GGATCC ATGGCAATTGAACGTACGC BamH I 15 R: GGC CTGCAG TCAGCCAACGATTTCGGT Pst I 16 L7 / L12 F: AGC TCTAGA ATGGCTGATCTCGCAAAGATC XBa I 17 R: ATC CTGCAG CTTACTTGAGTTCAACCTTGGC Pst I 18 MDH F: ATT TCGGA TCCATGGCACGCAACAAGATT BamH I 19 R: AGGC GTCGAC TTATTTCAGCGACGGACG Sal I 20

Purification of the recombinant protein was performed by centrifuging the cultured cells at a rate of 3,000x g for 10 minutes to collect cell pellets, resuspending with 20 ml of column buffer, and freeze-thaw at -70 ° C / 4 ° C. After repeating the procedure three times, the cells were placed in an ice bucket and ultrasonically crushed under conditions of 10,000 Hz. Thereafter, the supernatant was recovered by centrifugation for 20 minutes at a rate of 5,000x g , and the recombinant protein was purified by a maltose resin column (Bio-Rad) using a column buffer containing 10 mM maltose as eluent.

3. SDS-PAGE and Western blot

Cell eluates from which protein expression was induced and purified recombinant proteins were analyzed by SDS-PAGE and Western blot. Mouse serum with a negative or positive infection with Brucella Abboth infection was used as the primary antibody.

4. Mouse immunization and humoral / cellular immune response analysis

To test the protective effect of the vaccine in combination with the recombinant protein, 36 female BALB / c mice (Japan SLC, Japan), 6 weeks of age, were divided into 4 groups. Each mouse is a combination vaccine containing 20 μg of recombinant proteins (rSodC, rRibH, rNdk, rL7 / L12 and rMDH) in 100 μl of incomplete Freund's adjuvant (Sigma), respectively, combined vaccine, RB51 commercialized vaccine, MBP Protein or PBS was mixed and administered intraperitoneally to immunize.

Thereafter, titers of IgG1 and IgG2a in serum specific to the recombinant protein were performed by ELISA analysis with reference to the method of Luo et al. (Infect Immun. 20016, 74: 2734-41). The cutoff value was calculated by adding the mean and standard deviation of the OD values based on non-immunized mouse serum diluted 1: 100. The levels of IL-10 and INF-γ in serum were analyzed using a cytometric bead array (BD CBA Mouse Inflammation Kit). All assays used serum samples collected from the tail vein of each mouse at 3 and 4 weeks after immunization.

5. Mouse immunization and bacterial challenge

To confirm the protective effect of the mixed subunit vaccine (rSodC, rRibH, rNdk, rL7 / L12 and rMDH), 20 mice were randomly divided into 4 groups, and then 100 μl of Freund's incomplete host Immunization was induced by intraperitoneal administration at week 0, 2, and 3 by mixing 100 μg of the mixed protein in the bunt (rSodC, rRibH, rNdk, rL7 / L12, and rMDH mixed 20 μg each) and MBP protein or PBS. . As a positive control, 5 × 10 ⁶ CFU RB51 (/ 100 μl PBS) was used by intraperitoneal administration on day 0. All groups were challenged 2 weeks after immunization by intraperitoneal administration of 5 × 10 ⁵ CFU Brucella Abbotus (/ 100 μl PBS).

6. Infection protection experiment

The infection protection study was performed by partially modifying the method of Luo et al. Two weeks after infection with Brucella abotus, the spleen was removed at the expense of the mice, weighed and homogenized in PBS conditions. The homogenized solution was serially diluted 10-fold using PBS, and then incubated for 3 days at 37 ° C. on a Brucella solid medium. The log ₁₀ CFU was calculated for each sample, and the protective effect was calculated by subtracting the log ₁₀ CFU value of each experimental group from the log ₁₀ CFU of the PBS group. All animal experiments were conducted in accordance with the guidelines of the Animal Ethics Committee at Gyeongsang National University (approval number GNU-170331-M0017).

All the results of the experiment were expressed as the mean ± standard deviation, and were tested by one-way ANOVA.

Example 1. Purification and immunogenicity analysis of recombinant protein

As a result of confirming the size and immunogenicity of each protein by deploying each purified recombinant protein on a 10% SDS-PAGE gel, the recombinant proteins rSodC, rRibH, rNdk, rL7 / L12 and rMDH were 68.1, 67.3, 65.2, 62.5 and It showed a molecular weight of 76 kDa (FIG. 1A), and at the same time, showed a strong reactivity to Brucella avotus-infected positive serum, but it was confirmed that the immune response did not occur in Brucella-Avotus-infected negative serum (FIGS. 1B and 1C).

Example 2. Analysis of humoral and cellular immune responses in mixed subunit vaccine immunized mice

The immune response of mice immunized with the mixed subunit vaccine (mixed subunit vaccine of rSodC, rRibH, rNdk, rL7 / L12 and rMDH) was analyzed. The immune response of the mixed subunit vaccine was analyzed using serum at 3 and 4 weeks after the administration of the vaccine once.

As a result of analyzing the levels of cytokines in each group, as shown in FIG. 2, the group injected with PBS or MBP alone did not induce the generation of INF-γ cytokines, but the group immunized with RB51 produced INF-γ significantly. It was found that it was induced. It can be seen that the mixed subunit vaccine of the present invention showed higher production of INF-γ than the control (MBP), but showed a significantly lower level of INF-γ production capacity compared to the commercial vaccine RB51 (live vaccine) treatment group. there was. In the case of IL-10, as shown in FIG. 3, the group in which only PBS or MBP was injected had higher serum level of IL-10 than the RB51 or mixed subunit vaccine, and the mixed subunit vaccine of the present invention was combined with the RB51 group. Similar levels of IL-10 were shown.

In addition, the group immunized with the mixed subunit vaccine showed an active IgG response after one immunization compared to the group immunized with MBP (FIG. 4), and showed a significantly higher IgG titer compared to RB51, in particular, the mixed subunit of the present invention It could be inferred that the vaccine induces an excellent humoral response.

Example 3. Analysis of protective effect against brucellella challenge in mixed subunit vaccinated mice

As a result of analyzing the vaccinating effect of the mixed subunit vaccine, it was found that the number of bacteria in the challenge spleen in the spleen was significantly reduced compared to the non-vaccinated group, and the weight of the spleen was also significantly reduced. Through the above results, it was found that the mixed subunit vaccine of the present invention exhibits an excellent protective effect against brucellella (FIG. 5).

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY <120> Vaccine composition for prevention or treatment of brucellosis          comprising SodC, RibH, Ndk, L7 / L12 and MDH protein derived from          Brucella abortus as effective component <130> PN18369 <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 173 <212> PRT <213> Brucella abortus <400> 1 Met Lys Ser Leu Phe Ile Ala Ser Thr Met Val Leu Met Ala Phe Pro   1 5 10 15 Ala Phe Ala Glu Ser Thr Thr Val Lys Met Tyr Glu Ala Leu Pro Thr              20 25 30 Gly Pro Gly Lys Glu Val Gly Thr Val Val Ile Ser Glu Ala Pro Gly          35 40 45 Gly Leu His Phe Lys Val Asn Met Glu Lys Leu Thr Pro Gly Tyr His      50 55 60 Gly Phe His Val His Glu Asn Pro Ser Cys Ala Pro Gly Glu Lys Asp  65 70 75 80 Gly Lys Ile Val Pro Ala Leu Ala Ala Gly Gly His Tyr Asp Pro Gly                  85 90 95 Asn Thr His His His Leu Gly Pro Glu Gly Asp Gly His Met Gly Asp             100 105 110 Leu Pro Arg Leu Ser Ala Asn Ala Asp Gly Lys Val Ser Glu Thr Val         115 120 125 Val Ala Pro His Leu Lys Lys Leu Ala Glu Ile Lys Gln Arg Ser Leu     130 135 140 Met Val His Val Gly Gly Asp Asn Tyr Ser Asp Lys Pro Glu Pro Leu 145 150 155 160 Gly Gly Gly Gly Ala Arg Phe Ala Cys Gly Val Ile Glu                 165 170 <210> 2 <211> 158 <212> PRT <213> Brucella abortus <400> 2 Met Asn Gln Ser Cys Pro Asn Lys Thr Ser Phe Lys Ile Ala Phe Ile   1 5 10 15 Gln Ala Arg Trp His Ala Asp Ile Val Asp Glu Ala Arg Lys Ser Phe              20 25 30 Val Ala Glu Leu Ala Ala Lys Thr Gly Gly Ser Val Glu Val Glu Ile          35 40 45 Phe Asp Val Pro Gly Ala Tyr Glu Ile Pro Leu His Ala Lys Thr Leu      50 55 60 Ala Arg Thr Gly Arg Tyr Ala Ala Ile Val Gly Ala Ala Phe Val Ile  65 70 75 80 Asp Gly Gly Ile Tyr Arg His Asp Phe Val Ala Thr Ala Val Ile Asn                  85 90 95 Gly Met Met Gln Val Gln Leu Glu Thr Glu Val Pro Val Leu Ser Val             100 105 110 Val Leu Thr Pro His His Phe His Glu Ser Lys Glu His His Asp Phe         115 120 125 Phe His Ala His Phe Lys Val Lys Gly Val Glu Ala Ala His Ala Ala     130 135 140 Leu Gln Ile Val Ser Glu Arg Ser Arg Ile Ala Ala Leu Val 145 150 155 <210> 3 <211> 140 <212> PRT <213> Brucella abortus <400> 3 Met Ala Ile Glu Arg Thr Phe Ser Met Ile Lys Pro Asp Ala Thr Arg   1 5 10 15 Arg Asn Leu Thr Gly Ala Ile Ile Ala Lys Leu Glu Glu Ala Gly Leu              20 25 30 Arg Val Val Ala Ser Lys Arg Val Trp Met Ser Arg Arg Glu Ala Glu          35 40 45 Gly Phe Tyr Ala Val His Lys Asp Arg Pro Phe Phe Gly Glu Leu Val      50 55 60 Glu Phe Met Ser Ser Gly Pro Thr Val Val Gln Val Leu Glu Gly Glu  65 70 75 80 Asn Ala Ile Ala Lys Asn Arg Glu Val Met Gly Ala Thr Asn Pro Ala                  85 90 95 Asn Ala Asp Glu Gly Thr Ile Arg Lys Thr Phe Ala Leu Ser Ile Gly             100 105 110 Glu Asn Ser Val His Gly Ser Asp Ala Pro Glu Thr Ala Ala Glu Glu         115 120 125 Ile Ala Tyr Trp Phe Ser Gly Thr Glu Ile Val Gly     130 135 140 <210> 4 <211> 124 <212> PRT <213> Brucella abortus <400> 4 Met Ala Asp Leu Ala Lys Ile Val Glu Asp Leu Ser Ala Leu Thr Val   1 5 10 15 Leu Glu Ala Ala Glu Leu Ser Lys Leu Leu Glu Glu Lys Trp Gly Val              20 25 30 Ser Ala Ala Ala Pro Val Ala Val Ala Ala Ala Gly Gly Ala Ala Pro          35 40 45 Ala Ala Ala Ala Glu Glu Lys Thr Glu Phe Asp Val Val Leu Ala Asp      50 55 60 Gly Gly Ala Asn Lys Ile Asn Val Ile Lys Glu Val Arg Ala Leu Thr  65 70 75 80 Gly Leu Gly Leu Lys Glu Ala Lys Asp Leu Val Glu Gly Ala Pro Lys                  85 90 95 Ala Val Lys Glu Gly Ala Ser Lys Asp Glu Ala Glu Lys Ile Lys Ala             100 105 110 Gln Leu Glu Ala Ala Gly Ala Lys Val Glu Leu Lys         115 120 <210> 5 <211> 320 <212> PRT <213> Brucella abortus <400> 5 Met Ala Arg Asn Lys Ile Ala Leu Ile Gly Ser Gly Met Ile Gly Gly   1 5 10 15 Thr Leu Ala His Leu Ala Gly Leu Lys Glu Leu Gly Asp Val Val Leu              20 25 30 Phe Asp Ile Ala Glu Gly Thr Pro Gln Gly Lys Gly Leu Asp Ile Ala          35 40 45 Glu Ser Ser Pro Val Asp Gly Phe Asp Ala Lys Phe Thr Gly Ala Asn      50 55 60 Asp Tyr Ala Ala Ile Glu Gly Ala Asp Val Val Ile Val Thr Ala Gly  65 70 75 80 Val Pro Arg Lys Pro Gly Met Ser Arg Asp Asp Leu Leu Gly Ile Asn                  85 90 95 Leu Lys Val Met Glu Gln Val Gly Ala Gly Ile Lys Lys Tyr Ala Pro             100 105 110 Glu Ala Phe Val Ile Cys Ile Thr Asn Pro Leu Asp Ala Met Val Trp         115 120 125 Ala Leu Gln Lys Phe Ser Gly Leu Pro Ala His Lys Val Val Gly Met     130 135 140 Ala Gly Val Leu Asp Ser Ala Arg Phe Arg Tyr Phe Leu Ser Glu Glu 145 150 155 160 Phe Asn Val Ser Val Glu Asp Val Thr Val Phe Val Leu Gly Gly His                 165 170 175 Gly Asp Ser Met Val Pro Leu Ala Arg Tyr Ser Thr Val Ala Gly Ile             180 185 190 Pro Leu Pro Asp Leu Val Lys Met Gly Trp Thr Ser Gln Asp Lys Leu         195 200 205 Asp Lys Ile Ile Gln Arg Thr Arg Asp Gly Gly Ala Glu Ile Val Gly     210 215 220 Leu Leu Lys Thr Gly Ser Ala Phe Tyr Ala Pro Ala Ala Ser Ala Ile 225 230 235 240 Gln Met Ala Glu Ser Tyr Leu Lys Asp Lys Lys Arg Val Leu Pro Val                 245 250 255 Ala Ala Gln Leu Ser Gly Gln Tyr Gly Val Lys Asp Met Tyr Val Gly             260 265 270 Val Pro Thr Val Ile Gly Ala Asn Gly Val Glu Arg Ile Ile Glu Ile         275 280 285 Asp Leu Asp Lys Asp Glu Lys Ala Gln Phe Asp Lys Ser Val Ala Ser     290 295 300 Val Ala Gly Leu Cys Glu Ala Cys Ile Gly Ile Ala Pro Ser Leu Lys 305 310 315 320 <210> 6 <211> 522 <212> DNA <213> Brucella abortus <400> 6 atgaagtcct tatttattgc atcgacaatg gtgcttatgg cttttccggc tttcgcagaa 60 agcacgacgg taaaaatgta tgaggcgctg ccgaccggac cgggtaaaga agttggcacc 120 gtggtcattt ccgaagcccc gggcgggctg cacttcaagg tgaatatgga aaagctgacg 180 ccgggctatc atggctttca tgttcacgaa aatccaagct gcgctccggg agaaaaagac 240 ggcaagatcg taccggctct tgctgccggc gggcattatg atccgggtaa tacccatcac 300 catttaggac ctgaaggtga tggacatatg ggcgatttgc cacgcctgag cgccaatgct 360 gacggcaagg tgagtgaaac cgttgtcgct ccacatctca agaaattggc ggaaatcaag 420 cagcgttctt tgatggtcca tgtcggaggg gataattatt ccgataagcc tgagccgctt 480 ggtggcggtg gtgcccgttt tgcctgcggc gtgatcgaat aa 522 <210> 7 <211> 477 <212> DNA <213> Brucella abortus <400> 7 atgaaccaaa gctgtccgaa caagacatcc tttaaaatcg cattcattca ggcccgctgg 60 cacgccgaca tcgttgacga agcgcgcaaa agctttgtcg ccgaactggc cgcaaagacg 120 ggtggcagcg tcgaggtaga gatattcgac gtgccgggtg catatgaaat tccccttcac 180 gccaagacat tggccagaac cgggcgctat gcagccatcg tcggtgcggc cttcgtgatc 240 gacggcggca tctatcgtca tgatttcgtg gcgacggccg ttatcaacgg catgatgcag 300 gtgcagcttg aaacggaagt gccggtgctg agcgtcgtgc tgacgccgca ccatttccat 360 gaaagcaagg agcatcacga cttcttccat gctcatttca aggtgaaggg cgtggaagcg 420 gcccatgccg ccttgcagat cgtgagcgag cgcagccgca tcgccgcgct tgtctga 477 <210> 8 <211> 423 <212> DNA <213> Brucella abortus <400> 8 atggcaattg aacgtacttt ctccatgatc aagcccgatg cgacccgccg caacctgact 60 ggcgcgatca tcgccaagct tgaagaagcg ggcctgcgcg ttgtcgcatc gaagcgcgtc 120 tggatgagcc gccgtgaagc tgaaggcttc tacgccgttc acaaggaccg tccgttcttt 180 ggcgaactgg ttgaattcat gtcctccggc ccgacggtcg ttcaggttct cgaaggcgaa 240 aacgcaattg ccaagaaccg tgaagtcatg ggcgccacca acccggccaa tgccgacgaa 300 ggcaccatcc gcaagacctt cgccctgtcc atcggtgaaa attcggttca cggttcggat 360 gctcccgaaa ccgctgccga agaaatcgcc tactggtttt cgggcaccga aatcgttggc 420 tga 423 <210> 9 <211> 375 <212> DNA <213> Brucella abortus <400> 9 atggctgatc tcgcaaagat cgttgaagac ctttcggccc tgaccgttct ggaagccgct 60 gagctgtcca agcttctcga agagaagtgg ggcgtttcgg ctgctgctcc ggtcgctgtt 120 gctgctgccg gtggcgctgc ccctgctgct gccgcagaag aaaagaccga attcgacgtc 180 gttctcgctg acggcggcgc taacaagatc aacgtgatca aggaagtgcg cgcactcacc 240 ggtctcggcc tcaaggaagc caaggacctg gtcgaaggcg ctccgaaggc tgtcaaggaa 300 ggcgcctcga aggacgaagc tgagaagatc aaggcacagc tcgaagctgc tggcgccaag 360 gttgaactca agtaa 375 <210> 10 <211> 963 <212> DNA <213> Brucella abortus <400> 10 atggcacgca acaagattgc cctcatcggc tccggcatga tcggcggtac gctcgctcac 60 ctggccggtc tgaaggaact cggtgacgtc gtccttttcg acattgcgga aggcaccccg 120 cagggcaagg ggctggatat cgccgaatct tctccggtcg atggtttcga tgcgaagttc 180 actggcgcga acgattacgc cgccattgaa ggcgcagacg tcgtcatcgt caccgcaggc 240 gtgccgcgca agccgggcat gagccgcgac gatctcctgg gcatcaacct gaaggtgatg 300 gaacaggtgg gcgcgggcat caagaaatat gcgccggaag ctttcgtcat ctgcatcacc 360 aacccgctcg acgccatggt ctgggcgctg cagaagttct ccggccttcc ggcccacaag 420 gttgtcggca tggctggcgt tctcgacagc gcccgcttcc gttatttcct ctcggaagaa 480 ttcaacgttt cggtcgagga cgtcacggta ttcgtgctgg gtggccacgg cgattcgatg 540 gttccgctgg cgcgctactc gaccgttgcc ggcattccgc tgcctgatct cgtcaagatg 600 ggctggacca gccaggacaa gctcgacaag atcatccagc gcacccgtga cggcggcgcg 660 gaaatcgtgg gccttctcaa gaccggctcg gctttctacg ctccggcggc atcggccatc 720 cagatggctg aatcctacct caaggacaag aagcgcgtcc tgccggtcgc agcccagctt 780 tcgggccagt atggcgtgaa ggacatgtat gtgggcgttc cgaccgtgat cggcgccaat 840 ggcgtggagc gcatcatcga gatcgatctc gacaaggacg agaaggcgca gttcgacaag 900 tcggtggcct ccgtcgccgg tctgtgcgaa gcctgcatcg gtattgctcc gtcgctgaaa 960 taa 963 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 accggatcca tgaagtcctt atttattgca 30 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 agcctgcagt tattcgatca cgccgcaggc 30 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 accggatcca tgaaccaaag ctgtccgaac 30 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 agcctgcagc ggctgcgctc gctcacgatc 30 <210> 15 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 cgcggatcca tggcaattga acgtacgc 28 <210> 16 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 ggcctgcagt cagccaacga tttcggt 27 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 agctctagaa tggctgatct cgcaaagatc 30 <210> 18 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 atcctgcagc ttacttgagt tcaaccttgg c 31 <210> 19 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 atttcggatc catggcacgc aacaagatt 29 <210> 20 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 aggcgtcgac ttatttcagc gacggacg 28

Claims (6)

Brucella Abbottus abortus ) SodC (Cu, Zn superoxide dismutase), RibH (6,7-dimethyl-8-ribityllumazine synthase), Ndk (nucleoside diphosphate kinase), large subunit ribosomal proteins L7 / L12 and malate dehydrogenase (MDH) proteins Subunit vaccine composition for the prevention or treatment of brucellosis infection containing as an active ingredient. According to claim 1, wherein the SodC, RibH, Ndk, L7 / L12 and MDH proteins are each characterized by consisting of the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, respectively. Unit vaccine composition. The composition of claim 1, wherein the composition further comprises at least one selected from the group consisting of pharmaceutically acceptable carriers, diluents and adjuvants. A method for the prevention or treatment of brucellosis infection comprising the step of administering the subunit vaccine (subunit vaccine) composition of claim 1 to a livestock that is expected to develop or develop brucellella infection. [5] The method of claim 4, wherein the administration is administered through any one administration route selected from oral, transdermal, intramuscular, intraperitoneal, intravenous, subcutaneous and nasal passages. SodC (Cu, Zn superoxide dismutase), RibH (6,7-dimethyl-8-ribityllumazine synthase), Ndk (nucleoside diphosphate kinase), large subunit ribosomal proteins L7 / L12 and MDH derived from Brucella abortus strain (malate dehydrogenase) A feed composition for the prevention or improvement of brucellosis infection comprising protein as an active ingredient.

Images