KR20200048054A - Vaccine composition for prevention or treatment of brucellosis comprising SodC and RibH protein derived from Brucella abortus as effective component - Google Patents

Abstract

The present invention relates to a subunit vaccine composition for preventing or treating brucellosis infection containing Cu, Zn superoxide dismutase (SodC) and 6,7-dimethyl-8-ribityllumazine synthase (RibH) proteins derived from a Brucella abortus strain as active components.

Description

Vaccine composition for prevention or treatment of brucellosis comprising SodC and RibH protein derived from Brucella abortus as effective component}

The present invention relates to a vaccine composition for preventing or treating brucellosis infection comprising SodC (Cu, Zn superoxide dismutase) and RibH (6,7-dimethyl-8-ribityllumazine synthase) proteins derived from Brucella abotus strain as active ingredients.

Brucella Infectious Disease is one of the representative common infectious diseases (human body; 4th legislative disease, livestock; 2nd legislative disease) and is known to cause serious public health and economic problems both domestically and globally. Recently, brucellella infections seen in Korea are showing an explosive increase in humans and livestock, and it is urgent to take measures against people's concerns as well as national concerns.

Brucella abortus (cow), B. melitensis (sheep, goat), B. canis (dog), B. ovis (sheep), B. suis (pig) are known to cause brucellosis. Infection in the human body can lead to serious illness, and in Korea, Brucella abortus is known to account for a high proportion. When Brucellella infection develops, the human body has a fatality rate of less than 10%, and persistent fever, headache, loss of appetite, and weakness leads to severe diseases such as endocarditis, encephalomyelitis, and arthritis. Symptoms seen in infected animals Is known to cause infertility due to abortion due to placenitis, endometritis, etc. in females, and orchitis, malformation sperm, etc. in males, without special external symptoms. Since brucela bacteria multiply in the cell and cause onset, in case of human infection, antibiotic treatment for several weeks to several years is required, and improvement of treatment methods is urgently needed due to sequelae caused by taking large amounts of antibiotics. Even if it is judged to be cured, it often recurs within a few years, and continuous observation is required.

Since Brucella bacteria are intracellular pathogens that rely primarily on cell-mediated immunity (CMI) for which the host's resistance has been obtained, live attenuated vaccines capable of stimulating strong cell-mediated immunity against Brucellosis It is mainly used. Although vaccination is the most economical means of infection control, currently available live attenuated vaccines such as Brucella Avotus S19 (smooth) or RB51 (rough) strains are not sufficient to eliminate brucellosis infections in certain host species. This was confirmed. Moreover, live attenuated vaccines have several disadvantages, such as abortion and the release of vaccine strains into milk. Therefore, other approaches are needed for the development of efficient, safe and effective vaccines, and immunoassays using recombinant proteins are becoming promising candidates.

So far, many studies have been reported on the protective effect of various types of recombinant Brucella proteins, including 22.9-kDa protein, lumazine synthase, and outer membrane proteins Omp31, Omp16 or Omp19, against pathogenic Brucella infections. However, administration of a single antigen does not effectively induce an immune response in mice from infection of brucellosis, and it is expected that combinations of different types of antigen proteins will show a higher protective effect than a single antigen.

On the other hand, Korean Registered Patent No. 1840360 is a vector developed to increase the secretion of BLS, Omp19, PrpA, and SOD antigens derived from Brucella Avotus, and contains attenuated Salmonella, which has an attenuated L-O-antigen as an active ingredient. A vaccine composition for preventing or treating brucellosis comprising an O-antigen deletion non-pathogenic Salmonella strain of LPS expressing a major common antigen of Brucella, has been disclosed, and Korean Patent No. 1775369 discloses' Ohr recombinant protein derived from Brucellella avotus strain A vaccine composition for preventing or treating brucellosis infection comprising as an active ingredient is disclosed, but a vaccine composition for preventing or treating brucellosis infection comprising SodC and RibH proteins derived from the brucellella avotus strain of the present invention as an active ingredient is described. There is no bar.

The present invention has been derived by the above-mentioned needs, the present inventors in order to compensate for the disadvantages of the sub-unit vaccine known to be less than the live vaccine in terms of immunogenicity and infection defense effect, derived from the Brucella abortus strain A recombinant protein of SodC and RibH, which is a highly immunogenic protein, was prepared, and the infection defense effect was confirmed using a subunit vaccine in which the recombinant protein was mixed. As a result, the pathogenic Brucella bacteria were challenged in a group immunized with the mixed subunit vaccine. At this time, the present invention was completed by confirming that the weight of the spleen and the number of pathogenic Brucella bacteria in the spleen were significantly reduced than the non-immunized group.

In order to solve the above problems, the present invention contains SodC (Cu, Zn superoxide dismutase) and RibH (6,7-dimethyl-8-ribityllumazine synthase) proteins derived from Brucella abortus strain as an active ingredient. Provided is a subunit vaccine composition for the prevention or treatment of brucellosis infection.

In addition, the present invention provides a method for preventing or treating brucellella infection, comprising administering the subunit vaccine composition to a livestock that is expected to develop brucellella infection or has developed brucellosis infection.

In addition, the present invention provides a feed composition for the prevention or improvement of brucellella infections comprising SodC and RibH proteins derived from a strain of brucellosis.

The vaccine of the present invention is a subunit vaccine having better stability than a live vaccine, and the subunit vaccine of the present invention contains two antigenic proteins derived from Brucellar abotus, and thus has excellent immunogenicity and protection against infection, thereby preventing brucellosis. Or it could be useful for treatment.

1 is a result of confirming the expression of the recombinant protein of SodC and RibH (rSodC, rRibH, respectively) (A) and the result of confirming the immunogenicity of Brucella-infected mouse serum (B and C), and B is Brucella-positive mouse serum. , C is a Western blot result using Brucella-infected negative mouse serum. MBP: maltose binding protein, a protein in a recombinant vector.
FIG. 2 analyzes the levels of TNF (tumor necrosis factor) in the blood at 3 and 4 weeks after immunization of mice with mixed subunit vaccine (rRibH + rSodC), RB51 vaccine (commercialized vaccine) and MBP (vector protein) protein. It is a result of confirming the cellular immune response. *: P <0.05, **: P <0.01, ***: P <0.001.
Figure 3 shows the immunization of mice with mixed subunit vaccine (rRibH + rSodC), RB51 vaccine (commercialized vaccine) and MBP (vector protein) protein, followed by blood plasma MCP-1 (monocyte chemoattractant protein-1) at 3 and 4 weeks As a result of analyzing the level of, it is the result of confirming the cellular immune response. *: P <0.05, **: P <0.01, ***: P <0.001.
Figure 4 is a mixed subunit vaccine (rRibH + rSodC), RB51 vaccine (commercialized vaccine) and MBP (vector protein) protein after immunization of the mouse, and analyzed the level of IL-10 in blood at 3 and 4 weeks, This is the result of confirming the cellular immune response. *: P <0.05, **: P <0.01, ***: P <0.001, ****: P <0.0001.
Figure 5 is a mixed subunit vaccine (rRibH + rSodC), RB51 vaccine (commercialized vaccine) and MBP (vector protein) after immunizing mice with protein, the level of IgG1 and IgG2a in the blood was analyzed at week 4, humoral immunity This is the result of confirming the reaction. ***: P <0.001.
FIG. 6 shows immunization of mice with mixed subunit vaccine (rRibH + rSodC), RB51 vaccine (commercialized vaccine) and MBP (vector protein) protein, and then challenged with Brucellia abotus bacteria to evaluate the protective ability. It is the result of measuring the number (A) and spleen weight (B) of the challenge-infected strain in the spleen after 2 weeks. *: P <0.05, **: P <0.01.

In order to achieve the object of the present invention, the present invention uses SodC (Cu, Zn superoxide dismutase) and RibH (6,7-dimethyl-8-ribityllumazine synthase) proteins derived from the Brucella abortus strain as an active ingredient. It provides a subunit vaccine composition for the prevention or treatment of containing brucellosis infection.

In the present invention, the term "subunit vaccine" refers to a vaccine comprising an infectious defense antigen isolated from a microorganism, and usually refers to a protein subunit vaccine that uses only some proteins of a microorganism by protein purification or genetic recombination technology. do.

The range of SodC protein and RibH protein according to the present invention includes proteins having amino acid sequences represented by SEQ ID NO: 1 and SEQ ID NO: 2, respectively, and functional equivalents of the proteins. The term “functional equivalent” means at least 70%, preferably 80% or more, more preferably 90% or more of the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2, as a result of addition, substitution, or deletion of the amino acid. More preferably, it has a sequence homology of 95% or more, and refers to a protein having substantially the same physiological activity as the protein represented by SEQ ID NO: 1 or SEQ ID NO: 2.

The term "prevention" in the present invention means any action that suppresses or delays the onset of brucellosis infection by administration of the vaccine composition of the present invention.

In the present invention, the term "treatment" means any action that improves or benefits the symptoms of brucellosis infection already caused by administration of the vaccine composition of the present invention.

The vaccine composition of the present invention further comprises a pharmaceutically acceptable carrier or diluent. Suitable carriers for vaccines are known to those skilled in the art and include, but are not limited to, proteins, sugars, and the like. The carrier can be an aqueous solution or a non-aqueous solution, a suspension, and an emulsion. Examples of non-aqueous carriers include propylene glycol, polyethylene glycol, edible oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous solutions carriers include water, alcohols / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral carriers include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. Intravenous carriers include electrolyte supplements such as those based on Ringer's dextrose, liquid and nutrient supplements, and the like. Preservatives and other additives such as antimicrobial agents, antioxidants, chelating agents, inert gases and the like may further be present. Preferred preservatives include formalin, thimerosal, neomycin, polymyxin B and amphotericin B.

In addition, the vaccine composition of the present invention may further include an adjuvant (adjuvant, adjuvant, adjuvant). The adjuvant refers to a compound or mixture that enhances the immune response and / or promotes the rate of absorption after inoculation, and includes any absorption-promoting agent. Acceptable adjuvants include Freund's complete adjuvant, Freund's incomplete adjuvant, saponin, mineral gels such as aluminum hydroxide, surfactants such as lysolecithin, fluron polyols, polyanions, peptides, oil or hydrocarbon emulsions. , Keyhole limpet hemocyanin, dinitrophenol, and the like.

The vaccine composition of the present invention may be administered through any one administration route selected from oral, transdermal, intramuscular, intraperitoneal, intravenous, subcutaneous, or nasal passages, and may be administered by bolus or slowly injected. It is preferably administered by injection.

The vaccine composition of the present invention is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" of the present invention is an amount sufficient to exhibit a vaccine effect, and means an amount that does not cause side effects or serious or excessive immune responses, and the effective dose level is a disorder to be treated. , The severity of the disorder, the activity of the specific compound, the route of administration, the rate of removal of the recombinant proteins (SodC and RibH), the duration of treatment, the drug used in combination with or concurrently with the recombinant protein, the subject's age, weight, sex, eating habits, general health It can depend on a variety of factors, including factors known in the state and medicine. In determining the "therapeutically effective amount", various general considerations that are considered are known to those skilled in the art.

In the method according to the embodiment of the present invention, a method for producing a SodC and RibH protein, SodC by transforming an expression vector containing the gene (SEQ ID NO: 3) or RibH (SEQ ID NO: 4) in host cell It is preferable that the SodC or RibH gene is expressed by mass expression and purified, but is not limited thereto.

The gene of the present invention includes both genomic DNA and cDNA encoding SodC or RibH protein. Preferably, the gene of the present invention may include a nucleotide sequence represented by SEQ ID NO: 3 or SEQ ID NO: 4. In addition, homologs of the base sequences are included within the scope of the present invention. Specifically, the gene has a sequence homology of 70% or more, more preferably 80% or more, even more preferably 90% or more, and most preferably 95% or more with the base sequence of SEQ ID NO: 3 or SEQ ID NO: 4, respectively. Branches can include nucleotide sequences. “% Of sequence homology” to a polynucleotide is identified by comparing two optimally aligned sequences with a comparison region, and a portion of the polynucleotide sequence in the comparison region is a reference sequence (addition or deletion) for the optimal alignment of the two sequences. It does not include) may be added or deleted (ie, gap).

The term "vector" is used to refer to DNA fragment (s), nucleic acid molecules that are delivered into a cell. Vectors replicate DNA and can be reproduced independently in host cells. The term "expression vector" is often used interchangeably with "recombinant vector." The term "recombinant vector" refers to a recombinant DNA molecule comprising the desired coding sequence and the appropriate nucleic acid sequence necessary to operably express the linking coding sequence in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

The term "recombinant" in the present invention refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a peptide, a heterologous peptide or a protein encoded by a heterologous nucleic acid. Recombinant cells can express genes or gene segments not found in the natural form of the cells, either in sense or antisense form. Recombinant cells can also express genes found in natural cells, but the genes have been modified and reintroduced into the cell by artificial means.

The present invention also provides a method for preventing or treating brucellella infection comprising administering the subunit vaccine composition to a livestock that is expected to develop brucellella infection or has developed brucellosis infection.

The term "livestock" of the present invention is an animal that can develop brucellosis infection, and preferably may be livestock such as cows, pigs, sheep, goats, dogs, but is not limited thereto.

When the subunit vaccine composition of the present invention is administered to the livestock, the immunity of an individual against a strain causing brucellosis infection may be enhanced, thereby preventing or treating brucellosis infection.

The present invention also prevents brucellella infections containing SodC (Cu, Zn superoxide dismutase) and RibH (6,7-dimethyl-8-ribityllumazine synthase) proteins derived from Brucella abortus strain as active ingredients or An improved feed composition is provided.

The range of the SodC protein and the RibH protein according to the present invention may be composed of the amino acid sequence of SEQ ID NO: 1 and SEQ ID NO: 2, respectively, and the range is as described above.

The present invention may include general feed ingredients known in the art. For example, the feed composition of the present invention may include grain flour, sugar, vitamins, amino acids, proteins, lipids, minerals, and the like.

Grain and grain by-products may be used in the feed composition of the present invention, such as rapeseed, cottonseed, soybean, wheat bran, rice bran, defatted river, malt, corn bran, malt sprout, soybean skin, potato starch, sweet potato starch, corn starch, Coffee foil, jamsa, jam, seaweed, tapioca, soybean meal, cottonseed meal, gourd, jong jong, flax, zucchini, corn gluten, wheat gluten, peanut melon, palm melon, sunflower seed melon, drunk melon, corn germ , One or two or more selected from pepper seed meal, jangyu-bak, and beer-bak can be mixed.

The feed composition of the present invention may include sugars and complex carbohydrates such as water-soluble and insoluble monosaccharides, disaccharides and polysaccharides. More specifically, as sugars that can be used, glucose, mannose, fructose, white sugar, maltose, cellobiose, lactose, trehalose, melibiose, raffinose, escreen, salicin, amidaline, mannitol, sorbitol, Sorbose, mentiose, etc. are mentioned, and it can be used in combination with oligosaccharides as well as molasses and sucrose.

Any amino acid component that may be included in the feed composition of the present invention includes arginine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, valine, tyrosine, alanine, aspartic acid, sodium glutamate, glycine, proline, serine , Cysteine, and their homologues, and salts thereof.

In addition, thiamin (vitamin B1), HCl, riboflavin (vitamin B2), pyridoxine (vitamin B6), HCl, niacin (vitamin B3), niacinamide (water-soluble vitamins and vitamin B) that can be optionally added to the feed composition of the present invention Complex), inositol (vitamin B8), choline chloride (vitamin B4), pantothenate (vitamin B5), biotin (vitamin B7), folic acid (vitamin B9) and other vitamin B groups and vitamins A, C, K, D and E And so on. Among them, vitamin A, vitamin B group, and vitamin E can also be used as antioxidants.

Fatty acids that may be included in the feed composition of the present invention include, for example, vegetable oils such as soybean oil, rapeseed oil, corn oil, safflower oil, sunflower oil, rice oil, beefsteak vegetable oil, evening primrose oil, glass fat oil, linseed oil, And fish oil such as bonito, mackerel, sardine, and triglycerides derived from various microorganisms, by hydrolysis treatment, and calcium salts and magnesium salts of fatty acids may also be included as metal salts of fatty acids obtained above. In the feed composition of the present invention, a small amount of known bioceramic materials such as plagioclase, bentonite, and mackban stone can be added to double the antibacterial function and the like.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

Materials and methods

1. Bacterial strains and growth conditions

The smooth, pathogenic Brucella abortus 544 biovar 1 strain was used by pre-sale from the Animal, Plant and Fisheries Quarantine and Inspection Agency, and the E. coli DH5α strain was Invitrogen (USA). It was purchased from and used. The cultivation of Brucella abotus bacteria was cultured to a stationary phase at 37 ° C using Brucella culture medium (BD Biosciences, USA), and the E. coli strain used LB liquid or solid medium containing 100 μg / ml of ampicillin (Sigma, USA) And cultured at 37 ° C.

2. Preparation of plasmid and purification of recombinant protein

Cloning and protein purification of the SodC and RibH genes of Brucella Abbotus was performed according to the methods of previous studies (Hop HT. Et al., FEMS Microbiol Lett. 2015, 362 (4)). Briefly, a gene-specific primer set was used to clone the full length of each Brucella Abbotus gene into a pMAL vector (Table 1). E. coli cells transformed with the vector containing each gene were cultured to produce recombinant protein, and IPTG (Isopropyl β-D-1-thiogalactopyranoside) was added to induce protein expression during culture.

Primer set gene Forward (5 '→ 3') (SEQ ID NO) Reverse (5 '→ 3') (SEQ ID NO) SodC ACC GGATCC ATGAAGTCCTTATTTATTGCA (5) AGC CTGCAG TTATTCGATCACGCCGCAGGC (6) RibH ACC GGATCC ATGAACCAAAGCTGTCCGAAC (7) AGC CTGCAG CGGCTGCGCTCGCTCACGATC (8)

(Underlined: BamH I and Pst I restriction enzyme sites)

Purification of the recombinant protein was performed by centrifuging the cultured cells at a rate of 3,000x g for 10 minutes to collect cell pellets, resuspending in 20 ml of column buffer, and freeze-thaw at -70 ° C / 4 ° C. After repeating the procedure three times, the cells were placed in an ice bucket and ultrasonically crushed under conditions of 10,000 Hz. Thereafter, the supernatant was recovered by centrifugation for 20 minutes at a rate of 5,000x g , and the recombinant protein was purified by a maltose resin column (Bio-Rad) using a column buffer containing 10 mM maltose as eluent.

3. SDS-PAGE and Western blot

Cell eluate from which protein expression was induced and purified recombinant protein were analyzed using SDS-PAGE and Western blot. Mouse serum with a negative or positive infection with Brucella Abboth infection was used as the primary antibody.

4. Mouse immunization and humoral / cellular immune response analysis

To test the protective effect of the vaccine in combination with recombinant protein, 35 female BALB / c mice (Japan SLC, Japan), 6 weeks of age, were divided into 5 groups. Each mouse was subunit vaccine group 1 in which 50 µg of recombinant proteins (rSodC and rRibH) were mixed in 100 µl of incomplete Freund's adjuvant (Sigma), respectively, and subunit vaccine group in which 100 µg each was mixed. 2, RB51 commercialized vaccine, MBP protein or PBS was mixed and administered intraperitoneally to immunize.

Thereafter, titers of IgG1 and IgG2a in serum specific to the recombinant protein were performed by ELISA analysis with reference to the method of Luo et al. (Infect Immun. 20016, 74: 2734-41). The cutoff value was calculated by adding the mean and standard deviation of the OD values based on non-immunized mouse serum diluted 1: 100. The levels of TNF and MCP-1 in serum were analyzed using a cytometric bead array (BD CBA Mouse Inflammation Kit). All assays used serum samples from the tail vein of each mouse at 3 and 4 weeks.

5. Mouse immunization and bacterial challenge

To confirm the protective effect of the mixed subunit vaccine (rSodC and rRibH combined subunit vaccine), 25 mice were randomly divided into 5 groups and then 100 μg or 200 μg in 100 μl Freund's incomplete adjuvant. Immunization was induced by mixing the mixed protein (rSodC and rRibH equal amounts), MBP protein or PBS, and intraperitoneally administered at week 0, 2 and 3 weeks. As a positive control, 5 × 10 ⁶ CFU RB51 (/ 100 μl PBS) was used by intraperitoneal administration on day 0. All groups were challenged 2 weeks after immunization by intraperitoneal administration of 5 × 10 ⁵ CFU Brucella Abbotus (/ 100 μl PBS).

6. Infection protection experiment

The infection protection study was performed by partially modifying the method of Luo et al. Two weeks after infection with Brucella abotus, the spleen was removed at the expense of the mice, weighed and homogenized in PBS conditions. The homogenized solution was serially diluted 10-fold using PBS, and then placed on a Brucella solid medium and incubated at 37 ° C for 3 days. The log ₁₀ CFU was calculated for each sample, and the protective effect was calculated by subtracting the log ₁₀ CFU value of each experimental group from the log ₁₀ CFU of the PBS group. All animal experiments were conducted in accordance with the guidelines of the Animal Ethics Committee of Gyeongsang National University (approval number GNU-170331-M0017).

All results of the experiment were expressed as mean ± standard deviation, and were tested by one-way ANOVA.

Example 1. Purification and immunogenicity analysis of recombinant protein

As a result of confirming the size and immunogenicity of each protein by deploying each purified recombinant protein on a 10% SDS-PAGE gel, the recombinant proteins rSodC and rRibH showed molecular weights of 68.1 and 67.3 kDa, respectively (FIG. 1A), and brucella at the same time. Although it showed strong reactivity to Avotus-infected positive sera, it was confirmed that the immune response did not occur in Brucella-Avotus-infected sera (Figs. 1B and 1C).

Example 2. Analysis of humoral and cellular immune response in mixed subunit vaccine immunized mice

The immune response of mice immunized with the mixed subunit vaccine (mixed subunit vaccine of rSodC and rRibH) was analyzed. The immune response of the mixed subunit vaccine was analyzed using serum at 3 and 4 weeks after administration of the vaccine once.

As a result of analyzing the cytokine level of each group after immunization, TNF and MCP in the group injected with 200 μg of mixed subunit vaccine compared to the group injected with PBS or MBP only and the group immunized with RB51 as shown in FIGS. 2 and 3 It was found that the serum level of -1 was significantly increased. In addition, as shown in FIG. 4, the group injected with PBS or MBP only had higher serum levels of IL-10 than the RB51 or mixed subunit vaccine, and the mixed subunit vaccine of the present invention had a level of IL similar to that of the RB51 group. -10 levels were shown. Except for IL-10, it was confirmed that the amount of TNF and MCP-1 cytokine changes increased depending on the concentration of the mixed subunit vaccine.

In addition, the group immunized with the mixed subunit vaccine showed an active IgG response even after one immunization compared to the group immunized with MBP (FIG. 5), and it was observed that the production of IgG1 was remarkably high, and the mixed subunit of the present invention was observed. It could be inferred that the vaccine induces an excellent humoral response.

Example 3. Analysis of protective effect against brucellella challenge in mixed subunit vaccinated mice

As a result of analyzing the vaccination effect of the mixed subunit vaccine, it was found that the number of bacteria in the spleen challenged strain was significantly reduced compared to the non-vaccinated group, and the spleen weight was also significantly reduced. Through the above results, it was found that the mixed subunit vaccine of the present invention exhibits an excellent protective effect against brucellella (FIG. 6).

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY <120> Vaccine composition for prevention or treatment of brucellosis          comprising SodC and RibH protein derived from Brucella abortus as          effective component <130> PN18370 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 173 <212> PRT <213> Brucella abortus <400> 1 Met Lys Ser Leu Phe Ile Ala Ser Thr Met Val Leu Met Ala Phe Pro   1 5 10 15 Ala Phe Ala Glu Ser Thr Thr Val Lys Met Tyr Glu Ala Leu Pro Thr              20 25 30 Gly Pro Gly Lys Glu Val Gly Thr Val Val Ile Ser Glu Ala Pro Gly          35 40 45 Gly Leu His Phe Lys Val Asn Met Glu Lys Leu Thr Pro Gly Tyr His      50 55 60 Gly Phe His Val His Glu Asn Pro Ser Cys Ala Pro Gly Glu Lys Asp  65 70 75 80 Gly Lys Ile Val Pro Ala Leu Ala Ala Gly Gly His Tyr Asp Pro Gly                  85 90 95 Asn Thr His His His Leu Gly Pro Glu Gly Asp Gly His Met Gly Asp             100 105 110 Leu Pro Arg Leu Ser Ala Asn Ala Asp Gly Lys Val Ser Glu Thr Val         115 120 125 Val Ala Pro His Leu Lys Lys Leu Ala Glu Ile Lys Gln Arg Ser Leu     130 135 140 Met Val His Val Gly Gly Asp Asn Tyr Ser Asp Lys Pro Glu Pro Leu 145 150 155 160 Gly Gly Gly Gly Ala Arg Phe Ala Cys Gly Val Ile Glu                 165 170 <210> 2 <211> 158 <212> PRT <213> Brucella abortus <400> 2 Met Asn Gln Ser Cys Pro Asn Lys Thr Ser Phe Lys Ile Ala Phe Ile   1 5 10 15 Gln Ala Arg Trp His Ala Asp Ile Val Asp Glu Ala Arg Lys Ser Phe              20 25 30 Val Ala Glu Leu Ala Ala Lys Thr Gly Gly Ser Val Glu Val Glu Ile          35 40 45 Phe Asp Val Pro Gly Ala Tyr Glu Ile Pro Leu His Ala Lys Thr Leu      50 55 60 Ala Arg Thr Gly Arg Tyr Ala Ala Ile Val Gly Ala Ala Phe Val Ile  65 70 75 80 Asp Gly Gly Ile Tyr Arg His Asp Phe Val Ala Thr Ala Val Ile Asn                  85 90 95 Gly Met Met Gln Val Gln Leu Glu Thr Glu Val Pro Val Leu Ser Val             100 105 110 Val Leu Thr Pro His His Phe His Glu Ser Lys Glu His His Asp Phe         115 120 125 Phe His Ala His Phe Lys Val Lys Gly Val Glu Ala Ala His Ala Ala     130 135 140 Leu Gln Ile Val Ser Glu Arg Ser Arg Ile Ala Ala Leu Val 145 150 155 <210> 3 <211> 522 <212> DNA <213> Brucella abortus <400> 3 atgaagtcct tatttattgc atcgacaatg gtgcttatgg cttttccggc tttcgcagaa 60 agcacgacgg taaaaatgta tgaggcgctg ccgaccggac cgggtaaaga agttggcacc 120 gtggtcattt ccgaagcccc gggcgggctg cacttcaagg tgaatatgga aaagctgacg 180 ccgggctatc atggctttca tgttcacgaa aatccaagct gcgctccggg agaaaaagac 240 ggcaagatcg taccggctct tgctgccggc gggcattatg atccgggtaa tacccatcac 300 catttaggac ctgaaggtga tggacatatg ggcgatttgc cacgcctgag cgccaatgct 360 gacggcaagg tgagtgaaac cgttgtcgct ccacatctca agaaattggc ggaaatcaag 420 cagcgttctt tgatggtcca tgtcggaggg gataattatt ccgataagcc tgagccgctt 480 ggtggcggtg gtgcccgttt tgcctgcggc gtgatcgaat aa 522 <210> 4 <211> 477 <212> DNA <213> Brucella abortus <400> 4 atgaaccaaa gctgtccgaa caagacatcc tttaaaatcg cattcattca ggcccgctgg 60 cacgccgaca tcgttgacga agcgcgcaaa agctttgtcg ccgaactggc cgcaaagacg 120 ggtggcagcg tcgaggtaga gatattcgac gtgccgggtg catatgaaat tccccttcac 180 gccaagacat tggccagaac cgggcgctat gcagccatcg tcggtgcggc cttcgtgatc 240 gacggcggca tctatcgtca tgatttcgtg gcgacggccg ttatcaacgg catgatgcag 300 gtgcagcttg aaacggaagt gccggtgctg agcgtcgtgc tgacgccgca ccatttccat 360 gaaagcaagg agcatcacga cttcttccat gctcatttca aggtgaaggg cgtggaagcg 420 gcccatgccg ccttgcagat cgtgagcgag cgcagccgca tcgccgcgct tgtctga 477 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 accggatcca tgaagtcctt atttattgca 30 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 agcctgcagt tattcgatca cgccgcaggc 30 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 accggatcca tgaaccaaag ctgtccgaac 30 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 agcctgcagc ggctgcgctc gctcacgatc 30

Claims (6)

Subunit vaccine for the prevention or treatment of brucellosis infection containing SodC (Cu, Zn superoxide dismutase) and RibH (6,7-dimethyl-8-ribityllumazine synthase) proteins derived from Brucella abortus strain as active ingredients (subunit vaccine) composition. According to claim 1, wherein the SodC and RibH protein is a subunit vaccine composition, characterized in that consisting of the amino acid sequence of SEQ ID NO: 1 and SEQ ID NO: 2, respectively. The composition of claim 1, wherein the composition further comprises at least one selected from the group consisting of a pharmaceutically acceptable carrier, diluent and adjuvant. A method for the prevention or treatment of brucellosis infection comprising the step of administering the subunit vaccine (subunit vaccine) composition of claim 1 to a livestock that is expected to develop or develop brucellella infection. 5. The method of claim 4, wherein the administration is administered through any one administration route selected from oral, transdermal, intramuscular, intraperitoneal, intravenous, subcutaneous and nasal routes. A feed composition for preventing or improving brucellosis infection comprising SodC (Cu, Zn superoxide dismutase) and RibH (6,7-dimethyl-8-ribityllumazine synthase) proteins derived from Brucella abortus strain as active ingredients.

Images