CN106834331B - rBCG for expressing fusion gene of Brucella melitensis P39 and L7/L12 and construction method thereof - Google Patents

rBCG for expressing fusion gene of Brucella melitensis P39 and L7/L12 and construction method thereof Download PDF

Info

Publication number
CN106834331B
CN106834331B CN201710084435.2A CN201710084435A CN106834331B CN 106834331 B CN106834331 B CN 106834331B CN 201710084435 A CN201710084435 A CN 201710084435A CN 106834331 B CN106834331 B CN 106834331B
Authority
CN
China
Prior art keywords
brucella
rbcg
bcg
gene
vaccine
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201710084435.2A
Other languages
Chinese (zh)
Other versions
CN106834331A (en
Inventor
石艳春
郑源强
韩新荣
周玉美
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Inner Mongolia Medical University
Original Assignee
Inner Mongolia Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Inner Mongolia Medical University filed Critical Inner Mongolia Medical University
Priority to CN201710084435.2A priority Critical patent/CN106834331B/en
Publication of CN106834331A publication Critical patent/CN106834331A/en
Application granted granted Critical
Publication of CN106834331B publication Critical patent/CN106834331B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/098—Brucella
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/23—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Brucella (G)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/523—Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/101—Plasmid DNA for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Veterinary Medicine (AREA)
  • Plant Pathology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The invention provides rBCG for expressing fusion genes of Brucella melitensis P39 and L7/L12, which is constructed by transferring expression vectors carrying fusion genes of Brucella melitensis P39 and L7/L12 which are subjected to codon optimization into BCG. The cytoplasmic binding protein PBP39 (coding gene P39) and brucella ribosomal protein L7/L12 produced by brucella are both T cell antigens. BCG is the only commercial vaccine for preventing tuberculosis so far, not only has obvious immune adjuvant effect, but also is an exogenous gene expression host with good performance and high safety. The fusion gene of the brucella P39 and the L7/L12 which are expressed by the BCG and are subjected to codon optimization can improve the expression quantity of a target gene, the obtained rBCG vaccine can simulate the intracellular infection and parasitism characteristics of the brucella, more effectively induces an organism to generate immune response, and can play the advantages of high safety, simple preparation, low cost and the like of the BCG as an expression host and the immune adjuvant effect of the BCG, so that the rBCG vaccine is expected to become a novel brucellosis vaccine.

Description

rBCG for expressing fusion gene of Brucella melitensis P39 and L7/L12 and construction method thereof
Technical Field
The invention relates to the technical field of genetic engineering and vaccine preparation, in particular to rBCG for expressing a fusion gene of Brucella melitensis P39 and L7/L12 and a construction method thereof.
Background
Brucellosis (Brucellosis), abbreviated as Brucellosis, is a zoonosis infection caused by brucella infection. The Bulbilus is a facultative intracellular parasite, highly infectious and pathogenic to humans and mammals. The genus mainly comprises 6 biological species such as sheep species, cattle species, pig species and dog species, the first 3 species are popular in China, and the Brucella melitensis infection in sheep species is the most common. The transmission mode of the cloth disease is animal-animal and animal-crowd. The livestock such as sheep, cattle, pigs and the like are most susceptible to infection, and the infection of the animals can cause inflammation of reproductive organs and fetal membranes, abortion, sterility and various tissue diseases, thereby greatly increasing the probability of spreading to people. The population is generally susceptible to the brucella, and the brucella of the common sheep species has the greatest harm to people. After a person contacts diseased animals and contaminated animal products, brucella bacteria can infect the animal through the pathways of digestive tract, respiratory tract, urogenital tract, skin, conjunctiva of eyes, and the like.
In recent 20 years, the epidemic situation of disease distribution in China has become more serious and has a tendency of spreading rapidly. The existing epidemic disease distribution vaccines at home and abroad are attenuated live vaccines, and the vaccines generally have the defects of high toxicity, short protection period, incapability of distinguishing natural infection, vaccination and the like, and cannot meet the practical requirement of disease distribution prevention and control. Therefore, the research and development of the novel disease distribution vaccine have important significance for controlling the spread of the disease distribution epidemic situation, and are hot spots of disease distribution research at home and abroad. The T cell antigens of the brucella comprise PBP39, L7/L12, Cu-Zn SOD and the like, and the proteins and the coding genes thereof are used for experimental research of brucella subunit vaccines and DNA vaccines.
Bacillus Calmette-guerin (BCG) is the only vaccine currently used to prevent tuberculosis and is widely used in the world health organization global expanded immunization program. BCG has the characteristics of large amount of safe use records for decades, good thermal stability, low production cost, obvious adjuvant effect, capability of inducing effective mucosal immunity by oral administration and the like, is an attractive live vaccine vector, and has attractive prospect as an expression host of a novel vaccine. In recent years, the research and development of recombinant BCG vaccines taking BCG as a carrier are increasingly concerned and valued by researchers at home and abroad, and the targeted pathogens relate to bacteria, viruses, parasites, tumors and the like, so that the recombinant BCG vaccine has a wide development prospect.
At present, reports about construction of recombinant BCG of fusion gene (P39-L7/L12 gene) carrying sheep brucella M5 strain 39kDa cytoplasmic-binding protein PBP39 coding gene (P39 gene) and ribosomal protein L7/L12 coding gene (L7/L12 gene) are not found at home and abroad.
Disclosure of Invention
The invention aims to provide rBCG for expressing fusion genes of Brucella melitensis P39 and L7/L12 and a construction method thereof.
Another object of the present invention is to provide the use of the rBCG for the preparation of a brucellosis vaccine.
In order to achieve the purpose of the invention, the invention firstly provides a gene expression cassette which comprises a fusion gene consisting of a P39 gene of the Brucella melitensis subjected to codon optimization and an L7/L12 gene subjected to codon optimization.
In the invention, the P39 and L7/L12 genes used for forming the Brucella melitensis P39 and L7/L12 fusion genes are both from Brucella melitensis M5 strain (CMCC55009), and the nucleotide sequence of the fusion genes is shown as SEQ ID NO:1 through codon optimization.
The invention also provides an expression vector, which carries the expression cassette of the Brucella melitensis P39 and L7/L12 fusion gene.
Preferably, the starting vector of the expression vector is an escherichia coli-mycobacterium shuttle expression vector pMV 361.
More preferably, the nucleotide sequence of the expression vector is shown as SEQ ID NO. 2.
The invention also provides rBCG for expressing the fusion gene of the Brucella melitensis P39 and L7/L12, which is obtained by transferring an expression vector carrying the fusion gene expression cassettes of the Brucella melitensis P39 and L7/L12 into BCG and screening the rBCG capable of secretly expressing the fusion gene of the Brucella melitensis P39 and L7/L12.
The rBCG for expressing the fusion gene of the Brucella melitensis P39 and L7/L12 is constructed by the following method:
1) according to the disclosed sequences of genes P39 and L7/L12 of Brucella melitensis M5 strain, after codon optimization is carried out by adopting Jcat software, genes P39 and L7/L12 after full-sequence optimization are artificially synthesized, and the constructed fusion gene P39-L7/L12 is used as a target gene;
2) constructing a recombinant expression vector carrying the optimized Brucella melitensis P39-L7/L12 fusion gene: inserting the target gene into a shuttle expression vector pMV361 through two enzyme cutting sites of PvuII and BstB I;
3) and (3) host bacterium transformation: transforming the recombinant expression vector constructed in the step 2) into BCG, and screening positive clones to obtain rBCG capable of secretly expressing the Brucella melitensis P39-L7/L12 fusion gene.
The invention also provides application of the rBCG in preparation of the brucellosis vaccine.
The invention also provides a brucellosis vaccine prepared from the rBCG.
The rBCG can be directly used as a brucellosis vaccine or prepared into the brucellosis vaccine by being assisted with an immunologic adjuvant.
The invention has the following advantages:
the cytoplasmic binding protein PBP39 (coding gene is P39) with the size of about 39kDa produced by brucella and the brucella ribosomal protein L7/L12 (relative molecular weight is about 15kDa, and coding gene is L7/L12 gene) are both T cell antigens and can stimulate the organism to generate effective immune response.
BCG (BCG vaccine) is the only commercial vaccine for preventing tuberculosis so far, and the vaccine prepared by being used as an expression host of exogenous genes has the advantages of high safety, good thermal stability, simple preparation, low price and the like.
And (III) BCG has obvious immunologic adjuvant effect, so that the rBCG vaccine does not need to be added with a vaccine adjuvant, and the cost is further saved.
And (IV) the BCG is also a facultative intracellular parasitic bacterium, and the rBCG can simulate the characteristics of brucella infection and intracellular parasitism and more effectively induce the organism to generate immune response.
After codon optimization of the P39-L7/L12 fusion gene, the expression level of the exogenous gene in BCG can be improved (after induction for 4 hours at 60 ℃, the expression level can be improved by more than 50 percent), and the problem of poor immune effect of the recombinant BCG caused by low expression level of the exogenous gene is solved.
The results of animal experiments show that the constructed rBCG can induce mice to generate obvious immune response.
And (VII) the recombinant BCG vaccine prepared by using the sheep brucella P39-L7/L12 fusion gene has important research significance and potential application value.
Drawings
FIG. 1 is the SDS-PAGE electrophoresis result of the target protein in the recombinant BCG constructed by the optimized and non-optimized P39-L7/L12 fusion gene in example 2 of the present invention; wherein, 1: carrying non-optimized P39-L7/L12 fusion gene recombinant BCG; 2: carrying the optimized P39-L7/L12 fusion gene recombinant BCG; 3: carrying the optimized P39-L7/L12 fusion gene recombination BCG (temperature induction); 4: untransfected BCG; m: and (3) protein Marker.
FIG. 2 is a comparison of the immune effect of different recombinant BCG constructed in example 3 of the present invention on Balb/c mice.
Detailed Description
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular Cloning handbook, Sambrook et al (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual,2001), or the conditions as recommended by the manufacturer's instructions.
Example 1 construction of recombinant expression vector carrying Brucella melitensis P39 and L7/L12 fusion genes
The method comprises the following steps:
1. according to the disclosed sequences of genes P39 and L7/L12 of Brucella melitensis M5 strain (GenBank: EF 189139.1; GenBank: EF173477.1), after codon optimization is carried out by Jcat software, a P39-L7/L12 fusion gene with an optimized complete sequence is artificially synthesized to be used as a target gene. (the nucleotide sequence of the fusion gene is shown in SEQ ID NO: 1).
2. Construction of recombinant expression vector carrying optimized M5 strain P39-L7/L12 fusion gene: the target gene is inserted into a shuttle expression vector pMV361 through two enzyme cutting sites of PvuII and BstB I.
3. Verification of insertion of the correct recombinant expression vector.
Through nucleic acid sequence determination, the successful construction of the recombinant expression vector carrying the optimized Brucella melitensis P39-L7/L12 fusion gene is verified.
Example 2 construction of rBCG expressing fusion genes of Brucella melitensis P39 and L7/L12
1. The recombinant expression vector constructed in example 1 (the entire sequence is shown in SEQ ID NO: 2) was transformed into BCG using BCG as a host bacterium.
The transformation is carried out by adopting an electrotransformation method, and the experimental conditions are as follows: 2500V, 25 muF, 1000 omega, 5ms of electric transfer time, 0.1cm electric shock cup. The electric conversion reaction system is as follows: plasmid 3. mu.l (concentration 0.68. mu.g/. mu.l), competent BCG strain 100. mu.l (concentration about 1X 10)10CFU/ml)。
2. Screening for Positive clones
After the electroporation, the cells were inoculated into a medium (slant) containing 50. mu.g/ml kanamycin to perform positive clone screening.
3. Detection of expression level of target Gene
Inoculating the screened positive clone (namely recombinant BCG) into a liquid culture medium for amplification culture, collecting culture supernatant, and detecting the expression quantity of the target gene by SDS-PAGE electrophoresis. The expression level of the optimized P39-L7/L12 fusion gene is obviously increased under temperature induction (60 ℃ for 4 hours). The results are shown in FIG. 1.
Example 3 Effect test of Brucella vaccine
Immunizing female Balb/c mice of 6-8 weeks old with the recombinant BCG, and injecting subcutaneously with the injection dose of 4 multiplied by 108CFU/mouse, 4 weeks after immunization, serum expression of Th1/Th2 type cytokines was examined in each group of mice. The experimental result shows that compared with the recombinant BCG (rBCG-P39-L7/L12 (world)) carrying the non-optimized P39-L7/L12 fusion gene and the non-transformed BCG, the recombinant BCG (rBCG-P39-L7/L12) carrying the codon-optimized P39-L7/L12 fusion gene can effectively induce the generation of Th1 cytokines such as IL-2, IL-12 and IFN-gamma. (FIG. 2)
Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Sequence listing
<110> university of medical inner Mongolia
<120> rBCG expressing fusion gene of Brucella melitensis P39 and L7/L12 and construction method thereof
<130>KHP161118993.5
<160>2
<170>PatentIn version 3.3
<210>1
<211>1578
<212>DNA
<213> Artificial sequence
<400>1
atggccccgg tggccaacgc ccaggagaag cagaacgtgg aggtgctgca ctggtggacc 60
tcgggcggcg aggcctcggc cctggaggtg ctgaagaagg acctggagtc gaagggcatc 120
tcgtggaccg acatgccggt ggccggcggc ggcggcaccg aggccatgac cgtgctgcgc 180
gcccgcgtga ccgccggcaa cgccccgacc gccgtgcaga tgctgggctt cgacatccgc 240
gactgggccg agcagggcgc cctgggcaac ctggacaccg tggcctcgaa ggagggctgg 300
gagaaggtga tcccggcccc gctgcaggag ttcgccaagt acgacggcca ctggatcgcc 360
gccccggtga acatccactc gaccaactgg atgtggatca acaaggccgc cctggacaag 420
gccggcggca aggagccgac caactgggac gagctgatcg ccctgctgga caacttcaag 480
gcccagggca tcaccccgat cgcccacggc ggccagccgt ggcaggacgc caccatcttc 540
gacgccgtgg tgctgtcgtt cggcccggac ttctacaaga aggccttcat cgacctggac 600
ccggaggccc tgggctcgga caccatgaag caggccttcg accgcatgtc gaagctgcgc 660
acctacgtgg acgacaactt ctcgggccgc gactggaacc tggcctcggc catggtgatc 720
gagggcaagg ccggcgtgca gttcatgggc gactgggcca agggcgagtt cctgaaggcc 780
ggcaagaagc cgggcgagga cttcgtgtgc atgcgctacc cgggcaccca gggcgccgtg 840
accttcaact cgggcatgtt cgccatgttc aaggtgtcgg aggacaaggt gccggcccag 900
ctggagatgg cctcggccat cgagtcgccg gccttccagt cggccttcaa cgtggagaag 960
ggctcggccc cggcccgcac cgacgtgccg gacaccgcct tcgacgcctg cggcaagaag 1020
accatcgccg acgtgaagga ggccaactcg aagggcaccc tgctgggctcgatggcccac 1080
ggctacgcca acccggccgc cgtgaagaac gccatctacg acgtggtgac ccgccagttc 1140
aacggccagc tgtcgtcgga ggacgccgtg aaggagctgg tggtggccgt ggaggccgcc 1200
aagatggccg acctggccaa gatcgtggag gacctgtcgg ccctgaccgt gctggaggcc 1260
gccgagctgt cgaagctgct ggaggagaag tggggcgtgt cggccgccgc cccggtggcc 1320
gtggccgccg ccggcggcgc cgccccggcc gccgccgccg aggagaagac cgagttcgac 1380
gtggtgctgg ccgacggcgg cgccaacaag atcaacgtga tcaaggaggt gcgcgccctg 1440
accggcctgg gcctgaagga ggccaaggac ctggtggagg gcgccccgaa ggccgtgaag 1500
gagggcgcct cgaaggacga ggccgagaag atcaaggccc agctggaggc cgccggcgcc 1560
aaggtggagc tgaagtaa 1578
<210>2
<211>6023
<212>DNA
<213> recombinant expression vector
<400>2
gctagcaaca aagcgacgtt gtgtctcaaa atctctgatg ttacattgca caagataaaa 60
atatatcatc atgaacaata aaactgtctg cttacataaa cagtaataca aggggtgtta 120
tgagccatat tcaacgggaa acgtcttgct cgaggccgcg attaaattcc aacatggatg 180
ctgatttata tgggtataaa tgggctcgcg ataatgtcgg gcaatcaggt gcgacaatct 240
atcgcttgta tgggaagccc catgcgccag agttgtttct gaaacatggc aaaggtagcg 300
ttgccaatga tgttacagat gagatggtca gactaaactg gctgacggaa tttatgcctc 360
ttccgaccat caagcatttt atccgtactc ctgatgatgc atggttactc accactgcga 420
tccccgggaa aacagcattc caggtattag aagaatatcc tgattcaggt gaaaatattg 480
ttgatgcgct ggcagtgttc ctgcgccggt tgcattcgat tcctgtttgt aattgtcctt 540
ttaacagcga tcgcgtattt cgtctcgctc aggcgcaatc acgaatgaat aacggtttgg 600
ttgatgcgag tgattttgat gacgagcgta atggctggcc tgttgaacaa gtctggaaag 660
aaatgcataa tcttttgcca ttctcaccgg attcagtcgt cactcatggt gatttctcac 720
ttgataacct tatttttgac gaggggaaat taataggttg tattgatgtt ggacgagtcg 780
gaatcgcaga ccgataccag gatcttgcca tcctatggaa ctgcctcggt gagttttctc 840
cttcattaca gaaacggctt tttcaaaaat atggtattga taatcctgat atgaataaat 900
tgcagtttca tttgatgctc gatgagtttt tctaatcaga attggttaat tggttgtaac 960
actggcagag cattacgctg acttgacggg acggcggctt tgttgaataa atcgaacttt 1020
tgctgagttg aaggatcaga tcacgcatct tcccgacaac gcagaccgtt ccgtggcaaa 1080
gcaaaagttc aaaatcacca actggtccac ctacaacaaa gctctcatca accgtggctc 1140
cctcactttc tggctggatg atggggcgat tcaggcctgg tatgagtcag caacaccttc 1200
ttcacgaggc agacctcact agttccactg agcgtcagac cccgtagaaa agatcaaagg 1260
atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc 1320
gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac 1380
tggcttcagc agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca 1440
ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt 1500
ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc 1560
ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg 1620
aacgacctac accgaactga gatacctaca gcgtgagcat tgagaaagcg ccacgcttcc 1680
cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac 1740
gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct 1800
ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc 1860
cagcaacgcg gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt 1920
tcctgcgtta tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac 1980
cgctcgccgc agccgaacga ccgagcgcaa cgcgtgcggc cgcggtaccc ggggatcctc 2040
tagagtcgac caccaagggc accatctctg cttgggccac cccgttggcc gcagccagct 2100
cgctgagagc cgtgaacgac agggcgaacg ccagcccgcc gacggcgagg gttccgaccg 2160
ctgcaactcc cggtgcaacc ttgtcccggt ctattctctt cactgcacca gctccaatct 2220
ggtgtgaatg cccctcgtct gttcgcgcag gcggggggct ctattcgttt gtcagcatcg 2280
aaagtagcca gatcagggat gcgttgcaac cgcgtatgcc caggtcagaa gagtcgcaca 2340
agagttgcag acccctggaa agaaaaatgg ccagagggcg aaaacaccct ctgaccagcg 2400
gagcgggcga cgggaatcga acccgcgtag ctagtttgga agaatgggtg tctgccgacc 2460
acatatgggc cggtcaagat aggtttttac cccctctcgg ctgcatcctc taagtggaaa 2520
gaaattgcag gtcgtagaag cgcgttgaag cctgagagtt gcacaggagt tgcaacccgg 2580
tagccttgtt cacgacgaga ggagacctag ttggcacgtc gcggatgggg atcgctgaag 2640
actcagcgca gcgggaggat ccaagcctca tacgtcaacc cgcaggacgg tgtgaggtac 2700
tacgcgctgc agacctacga caacaagatg gacgccgaag cctggctcgc gggcgagaag 2760
cggctcatcg agatggagac ctggacccct ccacaggacc gggcgaagaa ggcagccgcc 2820
agcgccatca cgctggagga gtacacccgg aagtggctcg tggagcgcga cctcgcagac 2880
ggcaccaggg atctgtacag cgggcacgcg gagcgccgca tctacccggt gctaggtgaa 2940
gtggcggtca cagagatgac gccagctctg gtgcgtgcgt ggtgggccgg gatgggtagg 3000
aagcacccga ctgcccgccg gcatgcctac aacgtcctcc gggcggtgat gaacacagcg 3060
gtcgaggaca agctgatcgc agagaacccg tgccggatcg agcagaaggc agccgatgag 3120
cgcgacgtag aggcgctgac gcctgaggag ctggacatcg tcgccgctga gatcttcgag 3180
cactaccgga tcgcggcata catcctggcg tggacgagcc tccggttcgg agagctgatc 3240
gagcttcgcc gcaaggacat cgtggacgac ggcatgacga tgaagctccg ggtgcgccgt 3300
ggcgcttccc gcgtggggaa caagatcgtc gttggcaacg ccaagaccgt ccggtcgaag 3360
cgtcctgtga cggttccgcc tcacgtcgcg gagatgatcc gagcgcacat gaaggaccgt 3420
acgaagatga acaagggccc cgaggcattc ctggtgacca cgacgcaggg caaccggctg 3480
tcgaagtccg cgttcaccaa gtcgctgaag cgtggctacg ccaagatcgg tcggccggaa 3540
ctccgcatcc acgacctccg cgctgtcggc gctacgttcg ccgctcaggc aggtgcgacg 3600
accaaggagc tgatggcccg tctcggtcac acgactccta ggatggcgat gaagtaccag 3660
atggcgtctg aggcccgcga cgaggctatc gctgaggcga tgtccaagct ggccaagacc 3720
tcctgaaacg caaaaagccc ccctcccaag gacactgagt cctaaagagg ggggtttctt 3780
gtcagtacgc gaagaaccac gcctggccgc gagcgccagc accgccgctc tgtgcggaga 3840
cctgggcacc agccccgccg ccgccaggag cattgccgtt cccgccagaa atctagacgg 3900
tgaccacaac gacgcgcccg ctttgatcgg ggacgtctgc ggccgaccat ttacgggtct 3960
tgttgtcgtt ggcggtcatg ggccgaacat actcacccgg atcggagggc cgaggacaag 4020
gtcgaacgag gggcatgacc cggtgcgggg cttcttgcac tcggcatagg cgagtgctaa 4080
gaataacgtt ggcactcgcg accggtgagt cgtaggtcgg gacggtgagg ccaggcccgt 4140
cgtcgcagcg agtggcagcg aggacaactt gagccgtccg tcgcgggcac tgcgcccggc 4200
cagcgtaagt agcggggttg ccgtcacccg gtgacccccg gtttcatccc cgatccggag 4260
gaatcacttc gcaatggcca agacaattgc ggatccagct ggccacatgg ccccggtggc 4320
caacgcccag gagaagcaga acgtggaggt gctgcactgg tggacctcgg gcggcgaggc 4380
ctcggccctg gaggtgctga agaaggacct ggagtcgaag ggcatctcgt ggaccgacat 4440
gccggtggcc ggcggcggcg gcaccgaggc catgaccgtg ctgcgcgccc gcgtgaccgc 4500
cggcaacgcc ccgaccgccg tgcagatgct gggcttcgac atccgcgact gggccgagca 4560
gggcgccctg ggcaacctgg acaccgtggc ctcgaaggag ggctgggaga aggtgatccc 4620
ggccccgctg caggagttcg ccaagtacga cggccactgg atcgccgccc cggtgaacat 4680
ccactcgacc aactggatgt ggatcaacaa ggccgccctg gacaaggccg gcggcaagga 4740
gccgaccaac tgggacgagc tgatcgccct gctggacaac ttcaaggccc agggcatcac 4800
cccgatcgcc cacggcggcc agccgtggca ggacgccacc atcttcgacg ccgtggtgct 4860
gtcgttcggc ccggacttct acaagaaggc cttcatcgac ctggacccgg aggccctggg 4920
ctcggacacc atgaagcagg ccttcgaccg catgtcgaag ctgcgcacct acgtggacga 4980
caacttctcg ggccgcgact ggaacctggc ctcggccatg gtgatcgagg gcaaggccgg 5040
cgtgcagttc atgggcgact gggccaaggg cgagttcctg aaggccggca agaagccggg 5100
cgaggacttc gtgtgcatgc gctacccggg cacccagggc gccgtgacct tcaactcggg 5160
catgttcgcc atgttcaagg tgtcggagga caaggtgccg gcccagctgg agatggcctc 5220
ggccatcgag tcgccggcct tccagtcggc cttcaacgtg gagaagggct cggccccggc 5280
ccgcaccgac gtgccggaca ccgccttcga cgcctgcggc aagaagacca tcgccgacgt 5340
gaaggaggcc aactcgaagg gcaccctgct gggctcgatg gcccacggct acgccaaccc 5400
ggccgccgtg aagaacgcca tctacgacgt ggtgacccgc cagttcaacg gccagctgtc 5460
gtcggaggac gccgtgaagg agctggtggt ggccgtggag gccgccaaga tggccgacct 5520
ggccaagatc gtggaggacc tgtcggccct gaccgtgctg gaggccgccg agctgtcgaa 5580
gctgctggag gagaagtggg gcgtgtcggc cgccgccccg gtggccgtgg ccgccgccgg 5640
cggcgccgcc ccggccgccg ccgccgagga gaagaccgag ttcgacgtgg tgctggccga 5700
cggcggcgcc aacaagatca acgtgatcaa ggaggtgcgc gccctgaccg gcctgggcct 5760
gaaggaggcc aaggacctgg tggagggcgc cccgaaggcc gtgaaggagg gcgcctcgaa 5820
ggacgaggcc gagaagatca aggcccagct ggaggccgcc ggcgccaagg tggagctgaa 5880
gtaattcgaa gcttatcgat gtcgacgtag ttaactagcg tacgatcgac tgccaggcat 5940
caaataaaac gaaaggctca gtcgaaagac tgggcctttc gttttatctg ttgtttgtcc 6000
ggccatcatg gccgcggtga tca 6023

Claims (5)

1. The rBCG for expressing the fusion gene of the Brucella melitensis P39 and L7/L12 is characterized in that an expression vector carrying a gene expression cassette shown as SEQ ID NO:1 is transferred into BCG, and the rBCG capable of carrying out secretory expression on the fusion gene of the Brucella melitensis P39 and L7/L12 is obtained by screening.
2. The rBCG according to claim 1, wherein the starting vector is the E.coli-Mycobacterium shuttle expression vector pMV 361.
3. The rBCG according to claim 1, wherein the nucleotide sequence of the expression vector is represented by SEQ ID NO 2.
4. Use of the rBCG according to any one of claims 1-3 for the preparation of a vaccine against Brucella.
5. A brucellosis vaccine prepared from the rBCG of any of claims 1-3.
CN201710084435.2A 2017-02-16 2017-02-16 rBCG for expressing fusion gene of Brucella melitensis P39 and L7/L12 and construction method thereof Active CN106834331B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710084435.2A CN106834331B (en) 2017-02-16 2017-02-16 rBCG for expressing fusion gene of Brucella melitensis P39 and L7/L12 and construction method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710084435.2A CN106834331B (en) 2017-02-16 2017-02-16 rBCG for expressing fusion gene of Brucella melitensis P39 and L7/L12 and construction method thereof

Publications (2)

Publication Number Publication Date
CN106834331A CN106834331A (en) 2017-06-13
CN106834331B true CN106834331B (en) 2020-04-07

Family

ID=59128574

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710084435.2A Active CN106834331B (en) 2017-02-16 2017-02-16 rBCG for expressing fusion gene of Brucella melitensis P39 and L7/L12 and construction method thereof

Country Status (1)

Country Link
CN (1) CN106834331B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108314709A (en) * 2018-03-22 2018-07-24 吉林农业大学 Recombinant glycosylated albumen P39 and its preparation method and application
CN109486846B (en) * 2018-12-29 2021-08-20 山东农业大学 Three-gene recombinant plasmid of Brucella, construction method and expression and application thereof in escherichia coli
CN113637703B (en) * 2021-08-06 2023-08-25 河北科技师范学院 Construction method and application of Brucella L7/L12 and GroES eukaryotic expression vector

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DNA vaccine encoding L7/L12-P39 of Brucella abortus induces protective immunity in BALB/c mice;LUO De-yan等;《Chinese Medical Journal》;20061231;第119卷(第4期);第331-334页 *
GenBank登录号：EF173477.1;NCBI;《NCBI GenBank》;20070110;第40-414位 *
GenBank登录号：EF189139.1;NCBI;《NCBI GenBank》;20070122;第34-1239位 *
Protection of BALB/c mice against Brucella melitensis 16 M infection induced by vaccination with live Escherchia coli expression Brucella P39 protein;Ayman Al-Mariri等;《Vaccine》;20091228;第28卷;第1766-1770页 *
布鲁氏菌omp25重组BCG的构建及其疫苗作用检测;张亚丽等;《中国病原生物学杂志》;20131231;第8卷(第12期);第1057-1123页 *

Also Published As

Publication number Publication date
CN106834331A (en) 2017-06-13

Similar Documents

Publication Publication Date Title
CN106834331B (en) rBCG for expressing fusion gene of Brucella melitensis P39 and L7/L12 and construction method thereof
CN104498493B (en) The method of CRISPR/Cas9 specific knockdown hepatitis type B viruses and the gRNA for selectively targeted HBV DNA
CN111235080B (en) Gene recombination escherichia coli and production method of 5-hydroxytryptamine
CN111154707B (en) Method for producing genetically engineered escherichia coli and melatonin
CN103740744B (en) A kind of zeaxanthin synthetic gene recombinant plasmid and its production and use
CN106676124B (en) rBCG for expressing ovine brucella P39 gene and construction method and application thereof
CN106854654B (en) rBCG for expressing sheep brookfield strain L7/L12 gene and construction method and application thereof
KR101915949B1 (en) Gene expression cassette and expression vector comprising the same
CN109295123A (en) A kind of biological production of betaxanthin
CN112899211B (en) Method for increasing yield of 2-KLG in gluconobacter oxydans
CN102586161B (en) Mycobacterium smegmatis IL-17A and preparation method thereof
CN111088267B (en) Method for improving cell density of liquid fermentation of clostridium solvolyticum
CN113072645A (en) Cancer vaccine targeting EphA2 antigen
CN114774472B (en) Construction and application of recombinant escherichia coli resistant to pentanediamine
KR101732026B1 (en) An effective method for specific gene silencing using artificial small RNA
CN110819652A (en) Dual-function system for simultaneous gene knockout and gene expression inhibition of corynebacterium glutamicum and application
CN115141856B (en) Recombinant clostridium and construction method and application thereof
JP2010525812A (en) DNA plasmid with improved expression and stability
CN113444708B (en) Hyaluronidase mutant for subcutaneous injection preparation of medicine
CN113755412B (en) Genetically engineered bacterium for producing MK-7, method and application
CN114736310B (en) Protein and biological material for producing circovirus type 2 virus-like particles and application
CN113549642A (en) Mycobacterium tuberculosis integrated expression plasmid and application thereof
CN111254104B (en) Preparation method of genetically engineered escherichia coli and indole-3-acetic acid
CN104789587B (en) Eukaryotic expression recombinant plasmid compound is preparing the application of strangles hammer bacteria vaccine
US20080274137A1 (en) DNA plasmids having improved expression and stability

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant