KR101732026B1 - An effective method for specific gene silencing using artificial small RNA - Google Patents

Abstract

The present invention relates to a nucleic acid molecule having a stem-loop structure, a nucleic acid complex comprising the nucleic acid molecule, and a composition for target recognition sequence transfer comprising the nucleic acid complex.

Description

An effective method for silencing a bacterial gene using a stem-loop structure nucleic acid molecule [

The present invention relates to a nucleic acid molecule having a stem-loop structure, a nucleic acid complex comprising the nucleic acid molecule, and a composition for target recognition sequence transfer comprising the nucleic acid complex.

A variety of bacterial small RNAs (sRNAs) play an important role as gene expression regulators in a wide variety of intracellular metabolic processes. In general, bacterial sRNAs regulate the translational activity and / or intracellular stability of target mRNA through RNA-RNA base pairing. About 100 kinds of sRNAs were detected experimentally in Escherichia coli , and nearly half of them were functionally analyzed.

Most of the identified sRNAs are present in the in trans state, where the distance between the target gene and the chromosome is far apart. Usually, the expression of the target gene is inhibited by suppressing the translation process or promoting the degradation of mRNA. , And Hfq in many cases. In addition, in the sRNA is located in the target gene complementary to opposite strands on the chromosome sRNAs in the cis state are generally capable of functioning independently of the Hfq protein and allow for the formation of complete bases for much longer regions. However, it is thought that actual base pair formation is confined to specific base sequence regions.

Some researchers have attempted to mimic the general function of sRNA and use it to silence or knockdown specific genes. In eukaryotic cells, a method of silencing the expression of a specific gene through siRNA (short interfering RNA) is widely used to reveal the function of a gene or to use it as a therapeutic agent. Thus, using artificial sRNA (afsRNA) with a well-designed target recognition sequence, gene silencing may be possible in bacteria as well. At this time, factors that may affect the interaction between the target mRNA and the afsRNA should be considered, including the accessibility of the target region, the base pairing energy, the secondary structure of the target mRNA and afsRNA, the off-target of the afsRNA effect, and reaction kinetics.

That is, knockdown or silencing of the expression of a specific gene can be very effectively utilized for revealing the function of a gene. Up to now, methods for silencing gene expression in eukaryotic cells have been well established, but in the case of bacteria Is not. Therefore, a new method of knocking down or silencing expression of a specific gene of bacteria using sRNA is required.

An example of the present invention provides a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1.

Another example of the invention is a nucleic acid molecule comprising a first nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1, a second nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 4, and a nucleotide linked between the first nucleic acid molecule and the second nucleic acid molecule And a target recognition sequence comprising a nucleotide sequence complementary thereto.

Another embodiment of the present invention provides a composition for target recognition sequence transfer comprising the nucleic acid complex.

Another example of the present invention provides a DNA encoding the nucleic acid molecule or the nucleic acid complex, or a vector comprising the same.

Another example of the present invention provides a cell transformed with said vector.

Therefore, the present inventors have devised a nucleic acid molecule that enables the target recognition sequence to maintain a single-stranded property. Although the insertion of the target recognition sequence is very simple, the nucleic acid molecule has a variety of target recognition sequences, And thus can be used as an RNA template capable of effectively silencing specific genes of bacteria.

The definitions of the main terms used in the description of the present invention and the like are as follows.

In the present invention, the term "sRNA (small RNA) " refers to RNA having a short length of 200 nucleotides or less in length, which effectively prevents translation of a specific mRNA through complementary binding.

In the present invention, the term "gene" should be regarded as the broadest meaning, and it is possible to encode a structural or regulatory protein, or a functional RNA. At this time, regulatory proteins include proteins involved in transcription factors, heat shock proteins or DNA / RNA replication, transcription and / or translation. In the present invention, the target gene to be inhibited in expression may exist as an extrachromosomal component.

The term "ARdSL RNA (double-stranded loop scaffold)" of the present invention refers to an artificial small ribonucleic acid (RNA) in which a target recognition sequence is inserted between two 5'- and 3'- (artificial small RNA; afsRNA).

The term "stem-loop structure" of the present invention refers to a structure in which a double stranded portion (stem) and a loop portion (loop, loop) therebetween are formed by base pair formation through hydrogen bonding within a single stranded RNA molecule. It is also called a hairpin structure. Such a stem-loop structure is relatively stable in a cell compared to a single stranded structure.

The term "P1 stem" of the present invention is a sequence derived from M1 RNA, which is a catalytic component of RNase P, and plays a crucial role in the intracellular stability of M1 RNA. It is characterized by mutation of M1 RNA, Decomposition.

M1 RNA is a highly stable sRNA expressed in the E. coli gene rnpB, having a length of 377 nt and a half-life of more than 60 minutes in the cell. The loop region of the P1 trunk of the wild-type M1 RNA corresponds to the region of +12 to +362 of the M1 RNA, and intracellular stability is maintained even if it is replaced with various sequences.

The term "terminator stem" of the present invention is a sequence derived from Escherichia coli sRNA, SibC RNA, characterized in that transcription is terminated immediately after transcription of the RNA having this stem, and RNA having the terminator stem is stable in the cell Loses.

The term "coding" of the present invention can be used to include encoding an RNA molecule having a base sequence complementary to its nucleotide sequence from a DNA molecule.

Hereinafter, the present invention will be described in more detail.

An example of the present invention provides nucleic acid molecules. The nucleic acid molecule may be a stem-loop structure, and specifically, the nucleic acid molecule may be represented by SEQ ID NO: 1 below.

SEQ ID NO: 1

GAAGCUGACC n GGUCAGUUUCCC

The n is an RNA base sequence having a loop structure including four or more RNA bases, for example, 4 to 438, 4 to 400, 4 to 100, 4 to 50, 4 to 10, 10 to 438 , 10 to 400, 10 to 100, 10 to 50, 42 to 438, 42 to 400, 42 to 100, or 42 to 50 RNA bases, Each independently selected from the group consisting of A, G, C, U, and modified bases thereof.

In one example, the nucleic acid molecule of SEQ ID NO: 1 may comprise the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3.

The term "stem-loop structure" in the present invention means a double-stranded RNA structure part (stem) generated by hydrogen bonding between backward repeating sequences present on a single-stranded RNA and a single It is a structure composed of RNA loop parts of a strand, also called a hairpin loop. Specifically, based on n, the 5'-terminal region and the 3'-terminal region are complementary to each other to form a stem structure, and the n-region has a loop structure. Because of this structure, a loop structure may be formed between the stem structure formed by the 5'-terminal region and the 3'-terminal region of n, and the specific base type is not limited.

Another example of the present invention provides a nucleic acid complex comprising a first nucleic acid molecule, a second nucleic acid molecule, and a target recognition sequence comprising 10 to 40 nucleotides connected between the first and second nucleic acid molecules.

In one example, the first nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of 26 to 460, 26 to 422, 26 to 222, 26 to 200, 26 to 122, 26 to 100, A nucleotide consisting of 26 to 72, 26 to 50, 64 to 460, 64 to 422, 64 to 222, 64 to 200, 64 to 122, 64 to 100, or 64 to 72 RNA bases And may be, for example, of the nucleotide sequence of SEQ ID NO: 2 or 3.

Also, the second nucleic acid molecule may comprise the nucleotide sequence of SEQ ID NO: 4.

Further, the first nucleic acid molecule and / or the second nucleic acid molecule may be a stem-loop structure.

In addition, the first nucleic acid molecule may be located at the 5 'end of the nucleic acid complex, i.e., at the 5' end of the target recognition sequence. The second nucleic acid molecule may be located at the 3 'end of the nucleic acid complex, i.e., at the 3' end of the target recognition sequence.

Specifically, the nucleic acid complex comprises a first nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1, a target recognition sequence comprising a total of 10 to 40 nucleotides linked to the 3'end of the first nucleic acid molecule, The second nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 4 linked to the terminus of the second nucleic acid.

The sequence listing of SEQ ID NO: 1 to SEQ ID NO: 4 is shown in Table 1 below.

SEQ ID NO: name Sequence listing (5 '-> 3') SEQ ID NO: 1 P1 stem-1 GAAGCUGACC n GGUCAGUUUCCC SEQ ID NO: 2 P1 stem-2 GAAGCUGACCAGAUCGGUCAGUUUCCC SEQ ID NO: 3 P1 stem-3 GAAGCUGACCAGGAGGUCAGUUUCCC SEQ ID NO: 4 Termination stem GGGCCCUCGCUUCGGUGAGGGCUUUACC

The nucleic acid complex may further comprise a nucleic acid linker linking the 3 'end of the first nucleic acid molecule and the 5' end of the target recognition sequence, wherein the linker has 1 to 20, 1 to 15, 10, 4 to 20, 4 to 15, or 4 to 10 nucleotide sequences.

The target recognition sequence may be at least one selected from the group consisting of RNA, RNA aptamer, antisense RNA, and ribozyme capable of hybridizing with a specific region of a target nucleic acid (eg, mRNA), and the total of 10 to 40, 15, 25, or about 20 nucleotides. In addition, the target recognition sequence may bind to one or more sequences of the target nucleic acid, for example, from 1 to 40, 1 to 30, 1 to 20, 1 to 10, 10 to 40, 10, 30, 10 to 20, or about 20 nucleotides of the target nucleic acid, and may specifically form at least one complementary bond with a ribosome binding site (RBS) present in the target nucleic acid have.

The term "aptamer " means an oligonucleotide that binds to a specific target, and may be, for example, RNA aptamer.

The term "antisense RNA" means RNA or a derivative thereof containing a nucleotide sequence complementary to the sequence of a specific mRNA, and is characterized by binding to a complementary sequence in mRNA and inhibiting translation of mRNA into a protein. The antisense RNA sequence of the present invention refers to an RNA sequence that is complementary to the mRNA of the target gene and capable of binding to the mRNA of the target gene and includes a translation of the mRNA of the target gene, translocation into the cytoplasm, maturation, And may inhibit essential activities for overall biological function.

The term "ribozyme" is a type of RNA. It is an RNA that has the same function as an enzyme that recognizes a base sequence of a specific RNA and cleaves itself. The ribozyme is a region that specifically binds to the complementary base sequence of the mRNA of the target gene and cleaves the mRNA of the target gene.

In the present invention, the term " target recognition sequence "refers to a sequence which functions to inhibit the expression of a target gene by a complementary binding with a target nucleic acid, for example, suppressing gene expression of a prokaryote.

In addition, the target recognition sequence has a sequence complementary to a partial sequence of the target nucleic acid and is effectively delivered into the body to inhibit the expression of the target nucleic acid, so that the activity of the target gene can be inhibited very efficiently and the complementary binding with the target nucleic acid And a portion which does not form a pair can be included by a mismatch (the corresponding base is not complementary) or a bulge (no base corresponding to one of the chains) or the like.

In addition, the target recognition sequence may comprise a variant having one or more substitutions, insertions, deletions, and combinations thereof, which is a functional equivalent having a change that does not degrade its activity. For example, the target recognition sequence of the present invention may have a homology of 80% or more, preferably 90% or more, and more preferably 95% or more, to the RNA of the corresponding SEQ ID NO: . Such homology can readily be determined by comparing the sequence of the nucleotide with the corresponding portion of the target gene using computer algorithms well known in the art, for example Align or BLAST algorithms.

The "target gene" is a gene whose expression is inhibited by the target recognition sequence of the present invention, and can be selected arbitrarily. As the target gene, for example, a gene whose sequence is known but which has a function, or a gene whose expression is thought to be a cause of disease can be preferably selected.

The "target nucleic acid" may be a general bacterial mRNA, and the target recognition sequence may be located at a specific region of the target nucleic acid, e.g., -24 to -5, -19 near the ribosome binding site of the mRNA of the bacteria +1, and -15 to +5 (when the A of the ATG codon is +1, the nucleic acid adjacent to the 3 'end is +2 and the nucleic acid adjacent to the 5' end is -1). For example, a nucleic acid molecule targeting the translation initiation region, which is an accessible region of the ribosome, and may also be a sequence other than the translation initiation region of mRNA (messenger RNA), a functional RNA sequence, etc. Lt; / RTI >

Hybridization "means that the target recognition sequence is at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% , 98% or more, 99% or more, or 100% sequence complementarity. Thus, in one example, the target recognition sequence is at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% , More than 99%, or 100% sequence complementarity.

For example, when the target gene is cspE or ompF, -5, -19, +1, and -15 to +5 in the target region -24 of the target nucleic acid are shown in Table 2 below, respectively.

SEQ ID NO: name Sequence listing (5 '-> 3') location SEQ ID NO: 5 cspE mRNA-1 UAUUUUUCAUGUAAAGGUAA -24 to -5 SEQ ID NO: 6 cspE mRNA-2 UUCAUGUAAAGGUAAUUUUG -19 ~ +1 SEQ ID NO: 7 cspE mRNA-3 GUAAAGGUAAUUUUGAUGUC -15 to +5 SEQ ID NO: 8 ompF mRNA-1 AAAAAAACCAUGAGGGUAAU -24 to -5 SEQ ID NO: 9 ompF mRNA-2 AACCAUGAGGGUAAUAAAUA -19 ~ +1 SEQ ID NO: 10 ompF mRNA-3 UGAGGGUAAUAAAUAAUGAU -15 to +5

The target recognition sequences that can hybridize to the target nucleic acid are shown in Table 3 below.

SEQ ID NO: name Sequence listing (5 '-> 3') Target location SEQ ID NO: 11 cspE-1 UUACCUUUACAUGAAAAAUA -24 to -5 SEQ ID NO: 12 cspE-2 CAAAAUUACCUUUACAUGAA -19 ~ +1 SEQ ID NO: 13 cspE-3 GACAUCAAAAUUACCUUUAC -15 to +5 SEQ ID NO: 14 ompF-1 AUUACCCUCAUGGUUUUUUU -24 to -5 SEQ ID NO: 15 ompF-2 UAUUUAUUACCCUCAUGGUU -19 ~ +1 SEQ ID NO: 16 ompF-3 AUCAUUAUUUAUUACCCUCA -15 to +5

The target recognition sequence may be to inhibit gene expression in prokaryotes, wherein the prokaryote is E. coli, separation tank emptying (Rhizobium), Bifidobacterium (Bifidobacterium), Rhodococcus (Rhodococcus), Candida (Candida), El Winiah (Erwinia), Enterobacter (Enterobacter), par Stephen Pasteurella (Pasteurella), Mendoza high Mia (Mannheimia), liquid Tino Bacillus (Actinobacillus), Agde Leganes tee bakteo (Aggregatibacter), janto Monastir (Xanthomonas), Vibrio (Vibrio), Pseudomonas (Pseudomonas), azo Saturday bakteo (Azotobacter), trying Cine Saturday bakteo (Acinetobacter), Central Stony Ah (Ralstonia), Agrobacterium (Agrobacterium), Rizzo Away (Rhizobium), Rhodobacter (Rhodobacter), Eisai Momo Nas ( Zymomonas), Bacillus (Bacillus), stearyl Philo Rhodococcus (Staphylococcus), Lactococcus (Lactococcus), Streptococcus (Streptococcus), Lactobacillus bacteria (Lactobacillus), Clostridium (Clostridium), Corynebacterium (Corynebacterium), Streptomyces (Streptomyces), Bifidobacterium (Bifidobacterium), cycloalkyl tumefaciens (Cyclobacterium) number or the like, but is not limited thereto.

Another example provides a composition for target recognition sequence transfer comprising nucleic acid molecules of the stem-loop structure.

The target recognition sequence may be at least one selected from the group consisting of RNA, RNA aptamer, antisense RNA, and ribozyme capable of hybridizing with a specific region of a target nucleic acid (eg, mRNA), and the total of 10 to 40, 10, 20, or 20 nucleotides. In addition, the target recognition sequence may be complementary to a consecutive 1 to 40, 10 to 40, 20 to 40, 1 to 20, or 10 to 20 nucleotide sequences of the target nucleic acid, for example, Or at least one complementary bond with an existing ribosome binding site (RBS).

Another example provides a composition for target recognition sequence transfer comprising the nucleic acid complex.

The target recognition sequence transfer composition comprises a first nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 1 and a second nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: For example, the first nucleic acid molecule may be composed of the nucleotide sequence of SEQ ID NO: 2 or 3. The first nucleic acid molecule and / or the second nucleic acid molecule may be in a stem-loop structure.

Another example provides a vector comprising a DNA sequence encoding a first nucleic acid molecule, a restriction enzyme site, and a DNA sequence encoding a second nucleic acid molecule.

The first nucleic acid molecule and the second nucleic acid molecule are as described above, and the DNA sequence encoding the first nucleic acid molecule and the second nucleic acid molecule may include a complementary DNA sequence with the first nucleic acid molecule and the second nucleic acid molecule. The restriction enzyme site refers to a site that is recognized and cleaved by a restriction enzyme, and the sequence is known according to the type of restriction enzyme used. In the vector, the DNA sequence encoding the first nucleic acid molecule is connected to the 5 'end of the restriction enzyme site (through or not through a linker), and the DNA sequence encoding the second nucleic acid molecule is linked to the restriction enzyme (Without or through a linker) at the 3 ' end of the site. The linkage of the DNA sequence may include a direct link not through a linker or a linkage through the linker described above.

When the restriction enzyme recognizing the restriction enzyme site contained in the vector is treated, the restriction enzyme site is cleaved and a DNA sequence encoding a predetermined nucleic acid sequence (for example, the target recognition sequence) is inserted into the cleaved site, A nucleic acid complex comprising a first nucleic acid molecule, a second nucleic acid molecule, and a desired nucleic acid sequence (e.g., a target recognition sequence) located therebetween.

In one example, the vector may comprise the nucleotide sequence of SEQ ID NO: 21.

Another example provides a vector comprising DNA encoding said nucleic acid complex.

The vector containing the DNA encoding the nucleic acid complex may be a DNA sequence encoding the first nucleic acid molecule, a DNA sequence encoding the target recognition sequence, and a DNA sequence encoding the second nucleic acid molecule. In one example, the vector comprising the DNA encoding the nucleic acid complex comprises a DNA sequence encoding a first nucleic acid molecule, a DNA sequence encoding a target recognition sequence linked to the 3 ' end of the DNA sequence encoding the first nucleic acid molecule , And a DNA sequence encoding a second nucleic acid molecule linked to the 3 ' end of the DNA sequence encoding the target recognition sequence. The linkage of the DNA sequence may include a direct link not through a linker or a linkage through the linker described above.

In one example, the vector comprising the DNA encoding the nucleic acid complex comprises a restriction enzyme in a vector comprising the DNA sequence encoding the first nucleic acid molecule, the restriction enzyme site, and the DNA sequence encoding the second nucleic acid molecule, And cloning the target recognition sequence at the site where the restriction enzyme site has been cleaved.

Another example provides a cell transformed with said vector.

The cell may be a prokaryotic cell, such as E. coli, separation tank emptying (Rhizobium), Bifidobacterium (Bifidobacterium), Rhodococcus (Rhodococcus), Candida (Candida), El Winiah (Erwinia), Enterobacter ( Enterobacter), par Stephen Pasteurella (Pasteurella), Mendoza high Mia (Mannheimia), liquid Tino Bacillus (Actinobacillus), Agde Leganes tee bakteo (Aggregatibacter), janto Monastir (Xanthomonas), Vibrio (Vibrio), Pseudomonas (Pseudomonas), azo Saturday bakteo (Azotobacter), trying Cine Saturday bakteo (Acinetobacter), Central Stony Ah (Ralstonia), Agrobacterium (Agrobacterium), Rizzo Away (Rhizobium), Rhodobacter (Rhodobacter), Eisai Momo Nas (Zymomonas), Bacillus (Bacillus) , Staphylococcus , Lactococcus , Streptococcus , Lactobacillus , Clostridium , Corynebacterium, Corynebacterium, ), Streptomyces (Streptomyces), Bifidobacterium (Bifidobacterium), may be a cycloalkyl and so on tumefaciens (Cyclobacterium) but is not limited to such.

Another example provides a method for producing a nucleic acid complex comprising the step of expressing the DNA encoding the nucleic acid complex in the transformed cell.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

The present invention relates to a nucleic acid molecule having a stem-loop structure, a nucleic acid complex comprising the nucleic acid molecule, and a composition for transferring a target recognition sequence comprising the nucleic acid complex, wherein the artificial small ribonucleic acid having a stem- A target recognition sequence that interacts with a target nucleic acid on a target gene of a prokaryotic organism can be stably maintained in a single-stranded form, thereby providing a nucleic acid complex capable of effectively silencing a target gene. Therefore, the present invention can efficiently utilize prokaryotic organism by applying it to a target gene of various industrial prokaryotes, and can be utilized for academic research.

Figure 1 is a schematic diagram showing gene silencing through interaction with a target mRNA using as an artificial small regulatory RNAs (afsRNAs) comprising stem-loop structure nucleic acid molecules of an embodiment of the present invention.
FIG. 2 is a diagram for predicting the most appropriate secondary structure having the lowest energy of the nucleic acid complex according to one embodiment of the present invention, using the Mfold program.
FIG. 3 is a diagram showing a cleavage map of the pHM4T-dSL-SmaI plasmid used in one embodiment of the present invention.
FIG. 4 is a graph showing comparison between the expression levels of cspE mRNA (left) and ompF mRNA (right) according to the nucleic acid complex of an embodiment of the present invention, using a blank vector as a control group. FIG.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example  1. Production of target recognition sequence

A target recognition sequence recognizing the target nucleic acid, cspE mRNA and ompF mRNA, was prepared. Specifically, target recognition complementary to regions +1 through -15 to +5 from -24 to -5, -19 relative to +1 when the start codon ATG in the target nucleic acid is +1 Sequence (RNA) was designed as shown in Table 4 below.

Target nucleic acid Target site name Sequence listing (5 '-> 3') SEQ ID NO: cspE mRNA Area between -24 and -5 cspE-1 UUACCUUUACAUGAAAAAUA SEQ ID NO: 11 -19 to +1 area cspE-2 CAAAAUUACCUUUACAUGAA SEQ ID NO: 12 Area from -15 to +5 cspE-3 GACAUCAAAAUUACCUUUAC SEQ ID NO: 13 ompF mRNA Area between -24 and -5 ompF-1 AUUACCCUCAUGGUUUUUUU SEQ ID NO: 14 -19 to +1 area ompF-2 UAUUUAUUACCCUCAUGGUU SEQ ID NO: 15 Area from -15 to +5 ompF-3 AUCAUUAUUUAUUACCCUCA SEQ ID NO: 16

Since double-stranded DNA is required for DNA cloning, DNAs coding for the six designed target recognition sequences (RNA) and complementary sequences thereof were prepared for synthesis (Sequence Synthesis: Bioneer).

The synthesized sequences were each dissolved in nuclease-free water to have a concentration of 100 pmol / uL, and 1 uL of the solution in which the DNA encoding the target recognition sequence was dissolved and 1 uL of the DNA sequence complementary to the DNA encoding the target recognition sequence were dissolved in 48 uL of oligo Annealing buffer to prepare a total of 50 uL of solution. The solution was annealed at 95 ° C to 10 ° C at 5 ° C for 5 minutes with a temperature of 5 ° C to obtain double-stranded DNA. The DNA was stored at -20 ° C.

A total of 50 uL of a reaction solution containing 10 uL (20 pmol) of the obtained double-stranded DNA, 1 uL (Enzynomics) of T4 polynucleotide kinase, 5 uL of Enzynomics 10x T4 DNA buffer (Enzynomics), and 34 uL of nuclease- Minute, and stored at -20 ° C.

Example  2. Recombination Plasmids  Produce

2-1. Plasmid DNA Preparation of

The pHM-tac plasmid was treated with an EcoRI / HindIII restriction enzyme and the product annealed with the oligonucleotide described in the following Table 5 was cloned to obtain a pHM4T-dSL-SmaI plasmid (Park, H., Bak, G., Kim, SC and Lee, Y. (2013) Exploring sRNA-mediated gene silencing mechanisms using artificial small RNAs derived from a natural RNA scaffold in Escherichia coli Nucleic Acids Res. 41, 3787-3804.

The oligonucleotide sequence is a complementary sequence in which both ends are cohesive ends. The plasmid is cloned into the outer end of the strand produced when the pHM-tac plasmid is digested with EcoRI / HindIII restriction enzyme.

Oligo
Nucleotide Sequence listing (5 '-> 3') SEQ ID NO: pHM4T-dSL-SmaI-oligo1 AATTCGAAGCTGACCAGATCGGTCAGTTTCCCGGGCCCTCGCTTCGGTGAGGGCTTTACCA SEQ ID NO: 22 pHM4T-dSL-SmaI-oligo2 AGCTTGGTAAAGCCCTCACCGAAGCGAGGGCCCGGGAAACTGACCGATCTGGTCAGCTTCG SEQ ID NO: 23

Then, 1 to 2 μL of the solution containing the pHM4T-dSL-SmaI plasmid was mixed with 50 μL of chemically competent DH5α E. coli cells (Enzynomics, Korea, CP010) and placed on ice for 20 minutes. Thermal shock was applied and the mixture was allowed to stand on ice for 2 minutes to transform.

1 mL of LB medium (1.0 g of NaCl, 0.5 g of yeast extract, and 1.0 g of tryptone dissolved in 100 mL of distilled water) was added to the reaction solution containing the E. coli transformed with the pHM4T-dSL-SmaI plasmid, And cultured for about 1 hour in an incubator.

Next, 1.5 g of micro agar (Duchefa, Nederland, M1002) was added to 1.0 g of NaCl, 0.5 g of yeast extract and 1.0 g of tryptone, dissolved in 100 mL of distilled water, added with LB / Amp agar plates were coated with 300 L of the above-shaken cultured solution and cultured overnight at 37 캜 in an incubator.

The colonies were streaked with pHM4T-dSL-SmaI plasmids to obtain clean colonies. One colony was cultured in 3 mL of LB medium with 100 ug / mL ampicillin overnight at 37 ° C in a shaking incubator, and the pHM4T-dSL- Cells transformed with SmaI plasmid were obtained.

A pHM4T-dSL-SmaI plasmid (FIG. 3) consisting of SEQ ID NO: 21 was prepared from the cells transformed with the pHM4T-dSL-SmaI plasmid using a plasmid DNA purification kit (Intron Biotechnology, And 3 ug of the obtained plasmid DNA was digested with a 10-fold excess of SmaI restriction enzyme (Promega, USA, R6121).

A total of 100 uL of a reaction mixture of 50 uL (~ 3 ug) of the digested plasmid and 3 uL of SmaI restriction enzyme (Promega, USA, R6121) was mixed with 10 uL of 10x restriction enzyme buffer (Promega, USA, R6121), 37 uL of Nuclease-free water, Solution was prepared, reacted at 25 ° C for 4 to 6 hours, transferred to 65 ° C and reacted for 20 minutes to inactivate the restriction enzyme.

Next, to dephosphorylate the plasmid cut linearly by restriction enzyme so as not to bind again to the circular form, the reaction solution in which the restriction enzyme was inactivated was added to the reaction solution in 10x antarctic phosphatase reaction buffer (New England BioLabs, UK) , And 1 μL of antarctic phosphatase (New England BioLabs, UK, M0289) was added thereto. The mixture was reacted in a constant temperature water bath at 37 ° C for 25 minutes, and then heated at 65 ° C for 10 minutes to inactivate dephosphorylase.

The reaction solution inactivated dephosphorylated enzyme was then electrophoresed on 1% agarose gel, and a 4268 bp cut and dephosphorylated DNA band was cut out of the gel and dissolved in 30 to 50 uL nuclease-free water.

DNA was then purified using a spin column type gel extraction kit (Intron Biotechnology, Korea, 17288) and the purity and amount of DNA were determined using Nanodrop (ThermoScientific, USA). As a result, the purity was about 2.0 at OD260 / OD280, and the concentration of dephosphorylated linear plasmid DNA was found to be at least 10 ng / uL.

2-2. DNA Binding and Transformation

The double-stranded DNA prepared in Example 1 and the plasmid DNA prepared in Example 2-1 were mixed at a molar concentration of 1: 3 to 1: 6 so as to have a final volume of 4 uL or less. 20 mM DTT, 2 mM ATP and 10% PEG), 1 uL T4 ligase (Enzynomics, Korea, M019) was added to each well of a 5 uL 2x rapid ligation buffer (Promega, USA, C6711; 60 mM Tris-HCl ), Filled with nuclease-free water to 10 uL, and reacted at 4 ° C for 4 hours or longer to bind double stranded DNA to the plasmid.

One to two μl of the reaction solution containing the double-stranded DNA-binding plasmid was mixed with 50 μl of chemically competent DH5α E. coli cells (Enzynomics, Korea, CP010), placed on ice for 20 minutes, And allowed to stand on ice for 2 minutes to transform.

2-3. Production of recombinant plasmids

1 mL of LB medium (1.0 g of NaCl, 0.5 g of yeast extract, and 1.0 g of tryptone dissolved in 100 mL of distilled water) was added to the reaction solution containing the transformed Escherichia coli transformed in Example 2-2 and incubated at 37 ° C in a shaking incubator And cultured for about 1 hour.

Next, 1.5 g of micro agar (Duchefa, Nederland, M1002) was added to 1.0 g of NaCl, 0.5 g of yeast extract and 1.0 g of tryptone, dissolved in 100 mL of distilled water, added with LB / Amp agar plates were coated with 300 L of the above-shaken cultured solution and cultured overnight at 37 캜 in an incubator.

The transformed E. coli colonies were streaked to obtain clean colonies. One colony was then cultured in 3 mL of LB medium with 100 ug / mL ampicillin overnight at 37 ° C in a shaking incubator to obtain transformed cells.

Recombinant plasmid DNA was obtained from the transformed cells using a plasmid DNA purification kit (Intron Biotechnology, Korea, 17096), and it was confirmed again whether the recombinant plasmid DNA was produced through DNA sequencing (Sanger method) The concentration and purity of the recombinant plasmid DNA was measured with NanoDrop 1000 (ThermoScientific, USA) and stored at -20 ° C.

The concentration and purity of the plasmid DNA were measured, and it was confirmed that the concentration was 50 ng / uL or more and the purity was about 2.0 at the OD260 / OD280 value.

Example  3. Verification of gene silencing effect

Two mRNA targets (cspE mRNA and ompF mRNA) were tested in Escherichia coli MG1655 in order to confirm that the afsRNA expressed by the recombinant plasmid of Example 2 can be generally used as a method for the desired gene silencing. Both of these mRNAs are mRNAs expressed as single cistron. All experimental samples containing RNA were handled on ice, unless otherwise indicated, and maintained during RNase-free conditions.

3-1. Preparation of E. coli

30 μL of Escherichia coli obtained by culturing Escherichia coli MG1655 (CGSC) and CGSC # 7740 in a shaking incubator at 200 rpm and 37 ^o C for 16 hours was added to a clean 3 mL LB / Amp culture (1.0 g NaCl, 0.5 yeast extract g, and the tryptone 1.0 g was dissolved in 100 mL of distilled water to put in additional ampicillin at a final concentration of 100ug / mL) (1: 100 dilution), at 37 ℃ shaking incubator until OD ₆₀₀ is about 0.5 And centrifuged at 5,000 g for 2 minutes at 4 DEG C to precipitate E. coli.

Then, ice-cold 0.01 M NaCl (500 uL) was added to the precipitated Escherichia coli, and the bacterial cells were resuspended by pipetting again at 4,000C for 2 minutes at 4,000C, .

Then, ice-cold 0.03 M CaCl ₂ (500 μL) was added, and the suspension was allowed to stand on ice for 20 minutes. Then, E. coli was precipitated by centrifugation at 5,000 g for 2 minutes at 4 ° C. and the supernatant was removed. M CaCl ₂ (100 uL) was added and pipetted to float well. Then, 10 to 100 ng of the recombinant plasmid DNA was added, and the mixture was allowed to stand on ice for 10 minutes, followed by thermal shock for 1 minute at 42 DEG C, and then placed on ice again for 2 minutes.

Add 1 mL of LB medium (1.0 g of NaCl, 0.5 g of yeast extract, and 1.0 g of tryptone in 100 mL of distilled water) into each tube and add 300 μL of LB / Amp agar plates (1.0 g NaCl, yeast extract 1.5 g of micro agar (Duchefa, Nederland, M1002) was added to 0.5 g of tryptone and 1.0 g of tryptone to dissolve in 100 mL of distilled water and the ampicillin was added to a final concentration of 100 ug / mL. Was placed on the bottom of the lid and cultured overnight. Then, the transformed colonies were streaked again and one colony was cultured to make a freezer stock.

In addition, a control E. coli was obtained by the same method except that a pHM4T-dSL-SmaI plasmid in which an empty vector target recognition sequence was not introduced instead of a recombinant plasmid was used.

3-2. Total RNA  Ready

The transformed E. coli colonies obtained in Example 4-1 were cultured in a 3 mL LB / Amp medium in a shaking incubator at 200 rpm and 37 ^o C for 16 hours. Then diluted 1/100 and incubated in clean LB / Amp medium for 3 to 4 hours to an OD ₆₀₀ of about 1.0. IPTG (isopropyl-1-thio- [beta] -D-galactopyranoside) was added to the final 1 mM and the cells were further cultured for 20 minutes to express afsRNA.

Then, twice the volume of RNA protect Bacteria Reagent was added to stabilize the expressed afsRNA in the cells, and the mixture was stirred for 5 seconds and left at room temperature for 5 minutes. Then, the mixture was centrifuged at 5,000 g for 10 minutes, and the supernatant was taken out to obtain E. coli.

200 uL (1 mg / mL) of lysozyme solution was added to dissolve the cell wall of the obtained E. coli, and the mixture was reacted at room temperature for 10 minutes with stirring. Total RNA was purified from E. coli cells with cell wall degradation using an RNeasy mini kit.

Specifically, RNA was bound to a spin column using a spin column-type RNA purification kit (QIAGEN, 74104) according to the manufacturer's protocol, followed by washing, and the RNA bound to the spin column was dissolved in 50 μL nuclease-free water The RNA was purified by dissolution. The purified RNA was stored at -70 < 0 > C. The final concentration was> 500 ng / uL.

The purified RNA of the control E. coli was also obtained by carrying out the same method except that the control E. coli colonies of Example 4-1 were used.

3-3. DNase  process

To remove contaminated chromosomal DNA, the reaction solution of Turbo DNA-free TM DNase Kit was mixed in the PCR tube as shown in Table 6 below. A solution containing the purified RNA obtained in Example 3-2 was added to the prepared PCR tube, followed by reaction at 37 ° C for 30 minutes. Further, 2U of DNase I was added once more, and the reaction was further performed at 37 DEG C for 30 minutes. 10 uL of inactivation slurry containing DNase I inactivating substance (0.2 volume) was added. Slurry continued to sink, so stirring well before adding. The reaction solution was stirred at room temperature for 10 minutes with stirring for 5 seconds, and then mixed well. The mixture was centrifuged at 10,000 g for 1.5 minutes to precipitate, and 50 uL of the supernatant was collected and stored at -70 ° C.

The purified RNA of the control E. coli of Example 3-2 was also treated in the same manner as described above to remove contaminating DNA.

Purified total RNA + Nuclease-free water 10 μg in 50 μL 10x Turbo DNase buffer 5uL Turbo DNase I (2U / uL) 1 uL (2U) Total 66 uL

3-4. cDNA  synthesis

In order to synthesize the cDNA strand for Total RNA of Example 3-2, the reaction solution was prepared and stirred as shown in Table 7 below. The reaction solution was reacted at 50 DEG C for 60 minutes using a PCR machine (C1000, BioRad, USA), and the reverse transcriptase was inactivated by heating at 95 DEG C for 5 minutes. The cDNA was stored at -20 ° C until used for real-time PCR.

DNase-treated total RNA 4 uL (~ 800 ng) Nuclease-free water 14 uL Random hexamer (dN6) 2 uL (50 pmol) TOPscriptTM RT DryMIX 1 tube Total 20 uL

3-5. qPCR Gene expression inhibition assay

The primers of Table 8 below were prepared for the analysis of each target gene by qPCR. The primers should be minimized in self-complementarity so that they do not form a dimer, and the PCR product is generally about 100 bp.

primer Sequence listing (5 '-> 3') SEQ ID NO: cspE_F GTCCAAAGGATTCGGTTTCA SEQ ID NO: 17 cspE_R CAGAGCGATTACGTTTGCAG SEQ ID NO: 18 ompF_F AGGCTTTGGTATCGTTGGTG SEQ ID NO: 19 ompF_R TGCGCAACTAACAGAACGTC SEQ ID NO: 20

Specifically, 1 μL of DNase I (2 U / μL) was added to 1 mL of qPCR premix and reacted at 37 ° C. for 30 minutes to remove contaminating chromosomal DNA, and 1 μL of DNase I was added once more. After incubation, DNase I was inactivated by heating at 75 ° C for 15 minutes and placed on ice. Next, a total of 50 uL quantitative Real-Time PCR reaction solution of 1 uL (10 pmol) of each of the Gene-specific primers, 2 uL of template cDNA, 25 uL of TOPreal ™ qPCR 2x PreMIX, and 21 uL of Nuclease-free water was prepared.

The reaction solution was placed in a qPCR reaction tube, stirred and mixed well and then spun down. The tubes were placed in a real-time PCR machine (Exicycler (TM) 96, Bioneer, Korea) and PCR was performed as shown in Table 9 below to amplify the genes.

Temperature time Other 1 cycle 95 ℃ 10 min 40 cycles 95 ℃ 30 s 57-60 ° C 30 s 72 ℃ 20 s (Depending on the size of the result) 1 cycle 25 ℃ 10 min (or melting step at 65-95 < 0 > C)

After completion of the PCR reaction, agarose gel electrophoresis was used to confirm whether specific gene amplification was successfully performed. ddCT method (Kenneth J. Livak and Thomas D. Schmittgen. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2- [Delta] [Delta] CT Method., 25 (4): 402-408, 2001 .), And the results of comparing the relative amounts of mRNA are shown in FIG.

For the control experiment, four samples were prepared as described below, and the PCR reaction was carried out in the same manner as in the above example.

Control group 1) Target mRNA To compare the amount of < RTI ID = 0.0 & pHM4T - dSL - SmaI  Plasmid samples:

Gene-specific primers 1 uL each (10 pmol) Template cDNA (control of pHM4T-dSL-SmaI) 2 uL TOPrealTM qPCR 2x PreMIX 25 uL Nuclease-free water 21 uL gun 50 uL

The control group 1) was a control group using RNA cDNA extracted from strains harboring only pHM4T-dSL-SmaI empty plasmid in order to examine whether mRNA levels differed when afsRNA was expressed and when no afsRNA was expressed. The results are shown in FIG. 4, and the column labeled as vector in FIG. 4 shows the result of the control group 1).

As can be seen from Fig. 4, the amount of target mRNA was significantly decreased in the strain expressing each afsRNA than the control. The expression level of cspE mRNA was decreased by up to 30%, and that of ompF mRNA was decreased by up to 10%.

Control group 2) 16S for intracellular standardization rRNA  ( rrsa ):

rrsAsense 1 uL (10 pmol) antisense primers 1 uL (10 pmol) Template cDNA 2 uL TOPrealTM qPCR 2x PreMIX 25 uL Nuclease-free water 21 uL gun 50 uL

The control group 2) is a control group using 16S rRNA with almost no variation per sample in order to use the ddCt method.

Control group 3) Reverse transcriptase  Control group without reaction:

Gene-specific primers 1 uL (10 pmol) rrse primers 1 uL (10 pmol) DNase-treated RNA mixture of pHM4T-dSL-SmaI control or target afsRNAs 2 uL TOPrealTM qPCR 2x PreMIX 25 uL Nuclease-free water 21 uL gun 50 uL

The control group 3) is a control group for performing qPCR in the same manner on a sample not using a reverse transcriptase to check whether qPCR results are obtained from DNA contaminated with RNA samples.

As can be seen from FIG. 4, the Ct value was shown in the control group, and it was confirmed that the Ct value was not different by 10 or more as compared with the example, and it was confirmed that the RNA sample was not contaminated with DNA (FIG. 4).

Control group 4) Control group without template:

Gene-specific primers 1 uL (10 pmol) rrsA primer 1 uL (10 pmol) TOPrealTM qPCR 2x PreMIX 25 uL Nuclease-free water 23uL gun 50 uL

The control group 4) is a control group to confirm that no DNA is contaminated in the remaining solution (TOPreal qPCR premix, water, primer, etc.) used for qPCR by performing qPCR without templates.

As can be seen from FIG. 4, the Ct value was found in the control group, and it was confirmed that the Ct value was not different by 10 or more compared with the example, and it was confirmed that the remaining solution used for qPCR was not contaminated with DNA 4).

<110> Korea Advanced Institute of Science and Technology <120> An effective method for specific gene silencing using artificial          small RNA <130> DPP20150177KR <150> KR 10-2014-0196025 <151> 2014-12-31 <160> 23 <170> Kopatentin 2.0 <210> 1 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> P1 stem-1 <220> <221> stem_loop <222> (11) <223> n is loop region in stem_loop, and comprises 4 or more RNA,          Each RNA is independently selected from A, U, C, G, and          modified RNAs thereof <400> 1 gaagcugacc nggucaguuu ccc 23 <210> 2 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> P1 stem-2 <400> 2 gaagcugacc agaucgguca guuuccc 27 <210> 3 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> P1 stem-3 <400> 3 gaagcugacc aggaggucag uuuccc 26 <210> 4 <211> 28 <212> RNA <213> Artificial Sequence <220> <223> Termination stem <400> 4 gggcccucgc uucggugagg gcuuuacc 28 <210> 5 <211> 20 <212> RNA <213> Escherichia coli <400> 5 uauuuuucau guaaagguaa 20 <210> 6 <211> 20 <212> RNA <213> Escherichia coli <400> 6 uucauguaaa gguaauuuug 20 <210> 7 <211> 20 <212> RNA <213> Escherichia coli <400> 7 guaaagguaa uuuugauguc 20 <210> 8 <211> 20 <212> RNA <213> Escherichia coli <400> 8 aaaaaaacca ugaggguaau 20 <210> 9 <211> 20 <212> RNA <213> Escherichia coli <400> 9 aaccaugagg guaauaaaua 20 <210> 10 <211> 20 <212> RNA <213> Escherichia coli <400> 10 ugaggguaau aaauaaugau 20 <210> 11 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> cspE-1 <400> 11 uuaccuuuac augaaaaaua 20 <210> 12 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> cspE-2 <400> 12 caaaauuacc uuuacaugaa 20 <210> 13 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> cspE-3 <400> 13 gacaucaaaa uuaccuuuac 20 <210> 14 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> ompF-1 <400> 14 auuacccuca ugguuuuuuu 20 <210> 15 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> ompF-2 <400> 15 uauuuauuac ccucaugguu 20 <210> 16 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> ompF-3 <400> 16 aucauuauuu auuacccuca 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> cspE_F <400> 17 gtccaaagga ttcggtttca 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> cspE_R <400> 18 cagagcgatt acgtttgcag 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ompF_F <400> 19 aggctttggt atcgttggtg 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ompF_R <400> 20 tgcgcaacta acagaacgtc 20 <210> 21 <211> 4268 <212> DNA <213> Artificial Sequence <220> <223> pHM4T-dSL-SmaI <400> 21 ttgacattgt gagcggataa caatataatg aattcgaagc tgaccagatc ggtcagtttc 60 ccgggccctc gcttcggtga gggctttacc aagcttttgg ctgttttggc ggatgagaga 120 agattttcag cctgatacag attaaatcag aacgcagaag cggtctgata aaacagaatt 180 tgcctggcgg cagtagcgcg gtggtcccac ctgaccccat gccgaactca gaagtgaaac 240 gccgtagcgc cgatggtagt gtggggtctc cccatgcgag agtagggaac tgccaggcat 300 caaataaaac gaaaggctca gtcgaaagac tgggcctttc gttttatctg ttgtttgtcg 360 gtgaacgctc tcctgagtag gacaaatccg ccgggagcgg atttgaacgt tgcgaagcaa 420 cggcccggag ggtggcgggc aggacgcccg ccataaactg ccaggcatca aattaagcag 480 aaggccatcc tgacggatgg cctttttgcg tttctacaaa ctcttttgtt tatttttcta 540 aatacattca aatatgtatc cgctcatgag acaataaccc tgataaatgc ttcaataata 600 ttgaaaaagg aagagtatga gtattcaaca tttccgtgtc gcccttattc ccttttttgc 660 gt; agatcagttg ggtgcacgag tgggttacat cgaactggat ctcaacagcg gtaagatcct 780 tgagagtttt cgccccgaag aacgttttcc aatgatgagc acttttaaag ttctgctatg 840 tggcgcggta ttatcccgtg ttgacgccgg gcaagagcaa ctcggtcgcc gcatacacta 900 ttctcagaat gacttggttg agtactcacc agtcacagaa aagcatctta cggatggcat 960 gacagtaaga gaattatgca gtgctgccat aaccatgagt gataacactg cggccaactt 1020 acttctgaca acgatcggag gaccgaagga gctaaccgct tttttgcaca acatggggga 1080 tcatgtaact cgccttgatc gttgggaacc ggagctgaat gaagccatac caaacgacga 1140 gcgtgacacc acgatgctgt agcaatggca acaacgttgc gcaaactatt aactggcgaa 1200 ctacttactc tagcttcccg gcaacaatta atagactgga tggaggcgga taaagttgca 1260 ggaccacttc tgcgctcggc ccttccggct ggctggttta ttgctgataa atctggagcc 1320 ggtgagcgtg ggtctcgcgg tatcattgca gcactggggc cagatggtaa gccctcccgt 1380 atcgtagtta tctacacgac ggggagtcag gcaactatgg atgaacgaaa tagacagatc 1440 gctgagatag gtgcctcact gattaagcat tggtaactgt cagaccaagt ttactcatat 1500 atactttaga ttgatttaaa acttcatttt taatttaaaa ggatctaggt gaagatcctt 1560 tttgataatc tcatgaccaa aatcccttaa cgtgagtttt cgttccactg agcgtcagac 1620 cccgtagaaa agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc 1680 ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca 1740 actctttttc cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgtccttcta 1800 gtgtagccgt agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct 1860 ctgctaatcc tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg 1920 gactcaagac gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc 1980 acacagccca gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcat 2040 tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg 2100 gtcggaacag gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt 2160 cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg 2220 cggagcctat ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg 2280 ccttttgctc acatgttctt tcctgcgtta tcccctgatt ctgtggataa ccgtattacc 2340 gcctttgagt gagctgatac cgctcgccgc agccgaacga ccgagcgcag cgagtcagtg 2400 agcgaggaag cggaagagcg cctgatgcgg tattttctcc ttacgcatct gtgcggtatt 2460 tcacaccgca tatgaggaca ccatcgaatg gtgcaaaacc tttcgcggta tggcatgata 2520 gcgcccggaa gagagtcaat tcagggtggg tgaatggtga aaccagtaac gttatacgat 2580 gtcgcagagt atgccggtgt ctcttatcag accgtttccc gcgtggtgaa ccaggccagc 2640 cacgtttctg cgaaaacgcg ggaaaaagtg gaagcggcga tggcggagct gaattacatt 2700 cccaaccgcg tggcacaaca actggcgggc aaacagtcgt tgctgattgg cgttgccacc 2760 tccagtctgg ccctgcacgc gccgtcgcaa attgtcgcgg cgattaaatc tcgcgccgat 2820 caactgggtg ccagcgtggt ggtgtcgatg gtagaacgaa gcggcgtcga agcctgtaaa 2880 gcggcggtgc acaatcttct cgcgcaacgc gtcagtgggc tgatcattaa ctatccgctg 2940 gatgaccagg atgccattgc tgtggaagct gcctgcacta atgttccggc gttatttctt 3000 gatgtctctg accagacacc catcaacagt attattttct cccatgaaga cggtacgcga 3060 ctgggcgtgg agcatctggt cgcattgggt caccagcaaa tcgcgctgtt agcgggccca 3120 ttaagttctg tctcggcgcg tctgcgtctg gctggctggc ataaatatct cactcgcaat 3180 caaattcagc cgatagcgga acgggaaggc gactggagtg ccatgtccgg ttttcaacaa 3240 accatgcaaa tgctgaatga gggcatcgtt cccactgcga tgctggttgc caacgatcag 3300 atggcgctgg gcgcaatgcg cgccattacc gagtccgggc tgcgcgttgg tgcggatatc 3360 tcggtagtgg gatacgacga taccgaagac agctcatgtt atatcccgcc gttaaccacc 3420 atcaaacagg attttcgcct gctggggcaa accagcgtgg accgcttgct gcaactctct 3480 cagggccagg cggtgaaggg caatcagctg ttgcccgtct cactggtgaa aagaaaaacc 3540 accctggcgc ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag 3600 ctggcacgac aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtaag 3660 ttagctcact cattaggcac cccaggcttt acactttatg cttccggctc gtataatgtg 3720 tggaattgtg agcggataac aatttcacac aggaaacagc tatgaccatg attacggatt 3780 cactggccgt cgttctcgag ctgcttgagc cagtgagcga ttgctggcct agatgaatga 3840 ctgtccacga cagaacccgg cttatcggtc agtttcacct gatttacgta aaaacccgct 3900 tcggcgggtt tttgcttttg gaggggcaga aagatgaatg actgtccacg acgctatacc 3960 caaaagaaag cggcttatcg gtcagtttca cctggtttac gtaaaaaccc gcttcggcgg 4020 gtttttgctt ttggaggggc agaaagatga atgactgtcc acgacactat acccaaaaga 4080 aagcggctta tcggtcagtt tcacctgttt tacgtaaaaa cccgcttcgg cgggttttta 4140 cttttggagg ggcagaaaga tgaatgactg tccacgacac tatacccaaa agaaagcggc 4200 ttatcggtca gttttacctg atgtacgtaa taaaccgttc cgggatccat aaatatgagc 4260 ggataaca 4268 <210> 22 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> pHM4T-dSL-SmaI-oligo1 <400> 22 aattcgaagc tgaccagatc ggtcagtttc ccgggccctc gcttcggtga gggctttacc 60 a 61 <210> 23 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> pHM4T-dSL-SmaI-oligo2 <400> 23 agcttggtaa agccctcacc gaagcgaggg cccgggaaac tgaccgatct ggtcagcttc 60 g 61

Claims (29)

A nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 2 or 3; The nucleic acid molecule according to claim 1, wherein the nucleic acid molecule is a stem-loop structure. delete A first nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 2 or 3,
A second nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 4, and
And a target recognition sequence comprising 10 to 40 nucleotides connected between the first nucleic acid molecule and the second nucleic acid molecule and complementary to 10 to 40 consecutive nucleotide sequences of the mRNA as the target nucleic acid. 5. The method of claim 4, wherein the nucleic acid complex comprises
A first nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 2 or 3,
A target recognition sequence consisting of a total of 10 to 40 nucleotides linked to the 3 ' end of the first nucleic acid molecule, complementarily binding to consecutive 10 to 40 nucleotide sequences of the mRNA as the target nucleic acid, and
And a second nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 4 linked to the 3 ' end of said target recognition sequence. 5. The nucleic acid complex of claim 4, further comprising a nucleic acid linker consisting of 1 to 20 nucleotides connecting the 3 'end of the first nucleic acid molecule and the 5' end of the target recognition sequence. The nucleic acid complex according to any one of claims 4 to 6, wherein the target recognition sequence is at least one selected from the group consisting of RNA, RNA aptamer, antisense RNA, and ribozyme. 8. The nucleic acid complex of claim 7, wherein the target recognition sequence is complementary to a contiguous 10 to 20 nucleotide sequence of the target nucleic acid. 8. The nucleic acid complex of claim 7, wherein the target recognition sequence is complementary to at least one nucleotide of a ribosome binding site (RBS) present in the target nucleic acid. [Claim 11] The method according to claim 9, wherein the ribosome binding site is in the region of -24 to -5, -19 to +1, or -15 to +5 on the basis of + 1 of ATG as a start codon present in the target nucleic acid &Lt; / RTI &gt; delete 9. The nucleic acid complex according to claim 8, wherein the target nucleic acid is a nucleotide sequence selected from the group consisting of SEQ ID NOS: 5 to 10. 5. The nucleic acid complex according to claim 4, wherein the target recognition sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS: 11 to 16. 5. The nucleic acid complex of claim 4, wherein the target recognition sequence inhibits gene expression of prokaryotes. 15. The method of claim 14 wherein the prokaryote is E. coli, separation tank emptying (Rhizobium), Bifidobacterium (Bifidobacterium), Rhodococcus (Rhodococcus), Candida (Candida), El Winiah (Erwinia), Enterobacter (Enterobacter), par Ste Pasteurella (Pasteurella), Men high Mia (Mannheimia), liquid Martino Bacillus (Actinobacillus), Agde Rega tea bakteo (Aggregatibacter), janto Pseudomonas (Xanthomonas), Vibrio (Vibrio), Pseudomonas (Pseudomonas), azo Sat bakteo (Azotobacter) , cliff Cine Saturday bakteo (Acinetobacter), Central Stony Ah (Ralstonia), Agrobacterium (Agrobacterium), Rizzo Away (Rhizobium), Rhodobacter (Rhodobacter), Eisai Momo Nas (Zymomonas), Bacillus (Bacillus), Stephen Philo Caucus For example, Staphylococcus , Lactococcus , Streptococcus , Lactobacillus , Clostridium , Corynebacterium , Streptomyces, ces ), Bifidobacterium , and Cyclobacterium . A composition for target recognition sequence transfer comprising the nucleic acid complex of any one of claims 4 to 6. 17. The composition of claim 16, wherein the target recognition sequence is at least one nucleic acid selected from the group consisting of RNA, RNA aptamer, antisense RNA, and ribozyme. 17. The composition of claim 16, wherein the target recognition sequence is complementary to a contiguous 10 to 20 nucleotide sequence of a nucleic acid of interest. 17. The composition of claim 16, wherein the target recognition sequence comprises at least one complementary bond with a ribosome binding site (RBS) present in the target nucleic acid. The method according to claim 19, wherein the ribosome binding site is in the region of -24 to -5, -19 to +1, or -15 to +5 on the basis of + 1 of ATG as a start codon present in the target nucleic acid &Lt; / RTI &gt; delete A first nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1; and a second nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 4. 23. The composition of claim 22, wherein the first nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO: A vector comprising DNA encoding a nucleic acid complex of any one of claims 4 to 6. 24. A cell transformed with the vector of claim 24. 26. The cell of claim 25, wherein said cell is a prokaryotic cell. The method of claim 26, wherein the prokaryotes are E. coli, separation tank emptying (Rhizobium), Bifidobacterium (Bifidobacterium), Rhodococcus (Rhodococcus), Candida (Candida), El Winiah (Erwinia), Enterobacter (Enterobacter), par Ste Pasteurella (Pasteurella), Men high Mia (Mannheimia), liquid Martino Bacillus (Actinobacillus), Agde Rega tea bakteo (Aggregatibacter), janto Pseudomonas (Xanthomonas), Vibrio (Vibrio), Pseudomonas (Pseudomonas), azo Sat bakteo (Azotobacter) , cliff Cine Saturday bakteo (Acinetobacter), Central Stony Ah (Ralstonia), Agrobacterium (Agrobacterium), Rizzo Away (Rhizobium), Rhodobacter (Rhodobacter), Eisai Momo Nas (Zymomonas), Bacillus (Bacillus), Stephen Philo Caucus (Staphylococcus), Lactococcus (Lactococcus), Streptococcus (Streptococcus), Lactobacillus bacteria (Lactobacillus), Clostridium (Clostridium), Corynebacterium (Corynebacterium), Streptomyces (Streptom yces , Bifidobacterium , and Cyclobacterium . A DNA sequence encoding a first nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 1, a restriction enzyme site, and a DNA sequence encoding a second nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 29. The vector of claim 28, consisting of the nucleotide sequence of SEQ ID NO: 21.

Images